COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..2335776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..849 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA locus_tag LOCUS_00010 CDS 849..1226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1392..2825) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 3121..4254 product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460399.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 4291..4755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5260..5379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 5405..6013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 note possible pseudo, frameshifted CDS 6262..6528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 6488..6958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 7172..7651 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 8392..8673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 8687..9631 product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665889.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene spoIIIAA CDS 9619..10134 product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238702.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene spoIIIAB CDS 10147..10353 product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene spoIIIAC CDS 10363..10761 product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene spoIIIAD CDS 10787..11977 product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946110.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene spoIIIAE CDS 12007..12630 product stage III sporulation protein AF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161052.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene spoIIIAF CDS 12636..13301 product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene spoIIIAG CDS 13321..13848 product SpoIIIAH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914716.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 14086..14565 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472869.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene accB CDS 14580..15929 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene accC CDS 15945..16337 product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 16586..16981 product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene nusB CDS 17221..18084 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene folD CDS 18093..19451 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene xseA CDS 19444..19674 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428423.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene xseB CDS 19677..20570 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene ispA CDS 20786..22675 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene dxs CDS 22679..23509 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111875.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 23741..24190 product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032581.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene argR CDS 24221..25948 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947750.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene recN CDS 26110..27405 product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054681.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene spoIVB CDS 27813..28604 product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene spo0A CDS 28757..29146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(29297..29716) product DUF4183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814352.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(29731..30093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(30176..30319) product YycC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 30411..31133 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172583.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(31167..31400) product DUF2627 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190187.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 31741..33426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 33647..34546 product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764677.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene yqiS CDS 34564..35664 product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene bcd CDS 35813..36907 product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene buk CDS 36927..38348 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene lpdA CDS 38369..39376 product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene bfmBAA CDS 39391..40374 product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene bfmBAB CDS 40466..41755 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257658.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 41874..43298 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(43505..44056) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951608.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 44528..44959 product bacilliredoxin BrxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene brxB CDS complement(45006..46106) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807837.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 46334..47119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 47281..48054 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 48074..48727 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 48720..49442 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590223.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 49611..50579 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 50620..51126 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146547.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 51229..52689 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(52696..54210) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(54203..54682) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 55024..56142 product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 56362..56904 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 56981..58165 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208858.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 58171..58671 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 58748..59677 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene rnz CDS complement(59820..60644) product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene proI CDS 60797..61753 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125147.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 61764..62555 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(62575..63372) product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755833.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(63749..63961) product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081584587.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 64133..64381 product YqkE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(64425..65885) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS 66183..66806 product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 66820..67647 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890721.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 67741..68262 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(68286..68837) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878789.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(69007..69915) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747210.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(69966..70100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS 70176..70718 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067038.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(70936..71109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 71665..72603 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412735.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 72617..73234 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949054.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 73344..73955 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(74200..74781) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 74883..75530 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene spoIIM CDS 75622..76074 product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene fur CDS 76309..76464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 76472..77362 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene xerD CDS 77637..78821 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046067.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene deoB CDS 78834..79640 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 79706..81010 product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243069.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(81395..81742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(81796..82842) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468539.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(82832..83713) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657068.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(83679..84098) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(84267..85307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(85312..86337) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059303470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(86327..87208) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(87174..87593) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548044.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 87862..89040 product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene dacF CDS 89136..89486 product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene spoIIAA CDS 89486..89926 product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243400.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene spoIIAB CDS 89940..90698 product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene sigF CDS 90887..91498 product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438361.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene spoVAA CDS 91485..91907 product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene spoVAB CDS 91921..92373 product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene spoVAC CDS 92387..93400 product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene spoVAD CDS 93404..93754 product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345915.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene spoVAE CDS 93778..94341 product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 94316..95794 product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene spoVAF CDS 95969..97297 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene lysA CDS 97496..98131 product DUF3885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181592.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(98173..99051) product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 99268..99759 product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282576.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 99829..100266 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 100412..100783 product GNAT family N-acetyltransferase RibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene ribT CDS 100818..101381 product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(101485..102012) product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS 102386..103138 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene scpA CDS 103157..103744 product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene scpB CDS 103812..104414 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 104563..105207 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228294.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 105231..105824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 105946..106350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139849141.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 106363..106854 product YpuI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 106925..107839 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(107888..109048) product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520822.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 109256..110317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 110560..110715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 110715..110915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 111087..111839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 111812..113620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 113592..116087 product restriction endonuclease-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 116386..118848 product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047963.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene helD CDS 118872..119468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 119480..120022 product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 120045..123608 product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene brxC CDS 123625..127104 product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene pglX CDS 127220..129766 product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene pglZ CDS 129855..133028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 133095..134042 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 134204..135025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 135108..135434 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 135534..136751 product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene nreB CDS 136788..137012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 137593..139248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 139258..139524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 140254..141036 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504233.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 141303..142538 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 142875..143207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 143204..143671 product DUF2004 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586113.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 144340..144651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 note possible pseudo, internal stop codon, frameshifted CDS complement(144975..145445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(145511..146128) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(146377..146970) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782279.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 147188..148423 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 148618..149700 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(149745..150104) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245808.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 150282..150929 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 150916..151107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 151031..152023 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 152044..152280 product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721282.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 152277..152756 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 152779..153063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 153230..154528 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 154707..155702 product beta-channel forming cytolysin CytK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene cytK2 CDS complement(155752..157200) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 157455..157790 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704076.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 157866..158507 product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(158548..159780) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(159969..160238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(160385..160606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 160689..161840 product non-hemolytic enterotoxin NHE subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene nheA CDS 161860..163053 product non-hemolytic enterotoxin NHE subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162968.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene nheB CDS 163115..164122 product non-hemolytic enterotoxin NHE subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171994.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene nheC CDS 164246..165283 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498961.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 165393..165947 product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234141.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene dinB CDS complement(165989..167539) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055404.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 167712..168617 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082669.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 169151..170236 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 170333..171427 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 171453..172307 product aminoglycoside 6-adenylyltransferase AadK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229862.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene ant(6) CDS 172443..173588 product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene dacB CDS 173581..174177 product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene spmA CDS 174174..174710 product spore maturation protein SpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene spmB CDS complement(174747..176033) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614866.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 176338..177063 product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene rluB CDS 177112..177639 product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene resA CDS 177683..179296 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene resB CDS 179315..180499 product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250084.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene resC CDS 180694..181410 product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426861.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene resD CDS 181410..183185 product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964677.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene resE CDS complement(183202..183591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 184058..185302 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886638.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene tyrS CDS 185562..185858 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 186058..189462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 189434..189931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 189942..190193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 190246..191547 product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136621.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene essB CDS 191600..196117 product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436748.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene essC CDS 196186..196914 product DUF3952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 196939..198399 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031236.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 198429..198689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 198691..199014 product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656382.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 199099..199920 product DUF3952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134207673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 200207..200908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 200953..201732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 201889..202074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 note possible pseudo, frameshifted CDS 202160..202549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 202678..203397 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 203498..203821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 204705..205664 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 205630..206691 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 206693..207910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 207904..208413 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316292.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene cobU CDS 208419..209873 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989707.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 209863..210642 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene cobS CDS 210594..211220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 211172..211585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 211598..212314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 212367..212939 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 213035..213673 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 214009..215256 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 215210..216517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 216544..219249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 219261..220544 product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene cap8O CDS 220541..221344 product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene tagG CDS 221360..222151 product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene tagH CDS 222318..223229 product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 223294..226095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 227659..228903 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 228857..230158 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 230158..230472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 230475..232787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 232810..233643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 233676..234956 product type 8 capsular polysaccharide synthesis protein Cap8O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene cap8O CDS 234956..235765 product teichoic acids export ABC transporter permease subunit TagG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene tagG CDS 235780..237477 product teichoic acids export ABC transporter ATP-binding subunit TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene tagH CDS 237491..238411 product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 238591..239478 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene galU CDS 240113..241180 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 241374..241763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 242675..243253 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 243353..244231 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(244254..244886) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033678946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 245282..246172 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892978.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 246184..248070 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248859.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 248163..248648 product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 248716..249273 product DUF6434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247875.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 249274..249690 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461900.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(249771..250250) product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(250247..250504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(250551..250862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 250920..251645 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570194.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 251638..253278 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036886.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 253367..254263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965555.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(254260..254643) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(254714..254962) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 255265..256311 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167004.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 256311..257831 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763003.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 257828..258430 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 258414..259010 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 259100..259873 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 260076..260681 product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235402.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(260725..260889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(261493..262377) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 assembly_gap 263105..263159 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 263372..263512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(263550..264050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 264161..264658 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 264660..265121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 265138..265548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 265603..266601 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245231.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 note possible pseudo, frameshifted CDS 266586..266804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 note possible pseudo, frameshifted CDS 266939..268693 product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109507.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 268821..269048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 269298..270053 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 270117..270596 product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 270612..271439 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941460.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(271514..272311) product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557606.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 272511..273425 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 273431..273895 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398668.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(273943..274971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(275111..275779) product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231283.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 275928..278117 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 278379..279650 product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225172.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene gudB CDS 279758..280285 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 280337..280801 product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(281029..281613) product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106090.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 281867..282799 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 282944..283612 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002040907.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 283746..284675 product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene ppaC CDS 285121..286410 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017657568.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene hisS CDS 286499..287485 product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 288024..288977 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 289098..289541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(289602..290570) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene ansA CDS 290687..291340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 291411..291602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 291711..292385 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene cmk CDS 292611..293756 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229574.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene rpsA CDS complement(293805..293939) product YpzI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513900.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 294059..294652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399232.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 294656..295597 product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 295578..295772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 296017..297327 product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene engA CDS 297351..298370 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 gene gpsA CDS complement(298411..298914) product preprotein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(299105..299602) product preprotein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478038.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 299881..300525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(300879..301418) product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966324.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(301586..302665) product DUF3900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 302893..303159 product stage VI sporulation protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 303413..303601 product DUF2768 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289008.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 303649..304368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 304572..306050 product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416519.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene spoIVA CDS 306330..306602 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 306693..307259 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene folE CDS 307505..308230 product heptaprenyl diphosphate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163716.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 308261..308971 product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene menG CDS 309044..309979 product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene hepT CDS complement(310017..310550) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 310741..311187 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene ndk CDS 311326..312594 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene hisZ CDS 312548..313183 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244493.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene hisG CDS 313193..314527 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene hisD CDS 314490..315083 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene hisB CDS 315080..315709 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene hisH CDS 315682..316401 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene hisA CDS 316395..317150 product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene hisF CDS 317147..317452 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene hisI CDS 317465..317779 product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene hisE CDS 317874..318647 product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene cheR CDS 318898..320070 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene aroC CDS 320070..321152 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526827.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene aroB CDS 321157..322245 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264005.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene hisC CDS 322344..323648 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664630.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene aroA CDS 323641..324900 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168671.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 324967..325521 product ReoY family proteolytic degradation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 325695..326150 product YpiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871320.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 326293..326796 product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290423.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene qcrA CDS 326802..327476 product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene qcrB CDS 327537..328304 product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene qcrC CDS 328416..329180 product sporulation protein YpjB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene ypjB CDS 329275..329955 product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109966.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 330087..330431 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002108639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 330424..331224 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661724.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene dapB CDS 331234..331620 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene mgsA CDS 331634..332341 product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015666.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene bshB1 CDS 332338..333474 product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene bshA CDS 333467..334663 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 334636..335631 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192045.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 335725..337134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 337469..338314 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000851103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene panB CDS 338305..339189 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene panC CDS 339174..339557 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene panD CDS complement(339606..340169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 340401..343187 product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044941.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene dinG CDS 343423..343593 product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358352.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 343664..344116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 344147..345346 product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761551.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene aspB CDS 345486..346778 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene asnS CDS 346909..347613 product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene dnaD CDS 347692..348342 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene nth CDS 348339..348860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(348871..351396) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(351461..352072) product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155594.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene recU CDS 352188..353144 product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495642.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 353305..353544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 353722..354201 product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 354211..354423 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(354519..354716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(355218..355466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(355482..355652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 355604..356056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 356187..356585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 356644..357201 product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 357280..357582 product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene gpsB CDS 358159..359301 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 359369..361306 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(361824..362207) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435507.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 362339..363850 product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215086.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene ypwA CDS 364259..364828 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 364843..366150 product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene pbuX CDS 366377..369793 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 369842..370105 product YpbS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 370119..370955 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637560.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 371302..372171 product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757056.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(372469..372858) product reverse transcriptase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(372876..373745) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(373852..374538) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 374678..375337 product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 375355..375531 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 375548..376831 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396524.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(376961..377209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(377337..377534) product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene cspD CDS 377878..378225 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817366.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 378222..379772 product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098240.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 380080..381105 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 381083..382009 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 382024..382992 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 383008..383913 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 383931..385718 product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039674.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(385812..387002) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 387335..387838 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 387962..388552 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(388598..389785) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 390219..390626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 390764..391462 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(391522..392892) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(392889..393575) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238957.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(393613..394344) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158258.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(394441..395685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710413.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 395843..397105 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene hflX CDS 397296..398444 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 398632..399426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 399431..400231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 400441..401556 product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599321.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 401721..402716 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 402716..403276 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(403313..403648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(403641..404264) product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191874.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 404419..404778 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419063.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 404762..405607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 405801..406400 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 406498..407280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(407314..407853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458541.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 407953..408777 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622595.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 408863..410071 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 410183..411802 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820031.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(411845..412813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683833.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 412966..415128 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene topB CDS 416369..417667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 417651..419708 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766176.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 419692..421587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 422949..423950 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 424026..424487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 424857..425783 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014525052.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene rbsK CDS 425801..426196 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene rbsD CDS 426224..427570 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286296.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 427893..431063 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867748.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 431269..431691 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(431719..432282) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701718.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 432392..433099 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 433212..434303 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002087.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(434400..435167) product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene lieB CDS complement(435170..436090) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(436105..436419) product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(436412..436741) product PadR family transcriptional regulator LftR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene lftR CDS 437155..437661 product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 437811..438596 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 438816..439304 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986636.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 439313..439669 product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 439686..440531 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(440580..440957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 441177..441356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(441396..441623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 441843..442112 product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 442350..442952 product DUF4878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 443177..443800 product DUF4878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169495.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(443841..445010) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 445559..446311 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 446620..447555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(447668..447817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(447996..448913) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 449117..450328 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742949.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(450350..451267) product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 451242..451445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 451408..451944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(452136..452834) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726880.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(452934..454106) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349486.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(454110..454652) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 454823..455725 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 455905..456147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 456258..456500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 456513..457130 product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 457160..457861 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 457954..458361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 458385..459524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 459564..460184 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174997.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(460221..461210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(461207..461671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(461675..462118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(462115..462663) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 463141..463938 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056115.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene thiM CDS 463942..464592 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene thiE CDS 464865..465029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 465049..466125 product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273580.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 466256..467356 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene tyrA CDS 467524..468942 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(468961..469578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 469777..470589 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223902.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(470912..471136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(471120..472394) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 472686..472976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473838.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 473570..475501 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 475750..476811 product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene rsgA CDS complement(476998..478245) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087661.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 478790..479140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(479163..480203) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 480393..481376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 481578..482555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 482796..483914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(483960..486389) product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(486471..486761) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 486910..487860 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613426.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 488135..488665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(488712..489848) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(490005..490742) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene pssA CDS 491157..492821 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 492929..493531 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881208.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 493631..493825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 494190..494567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 494663..495082 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741976.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 495104..496072 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 496044..496232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 496325..496690 product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 496704..497090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966282.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 497100..497351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 497403..497612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 497548..498372 product lipid II flippase Amj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234394.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene amj CDS 498468..499238 product oxalate:formate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014091.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(499279..499602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253207.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 499691..500365 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160042.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 500437..502125 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 502225..502734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460219.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 502754..503917 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588613.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(504181..504402) product DUF3925 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 504555..505031 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219417.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene bsaA CDS 505107..505670 product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138383.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(505764..505913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(505959..506285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(506399..507031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136052.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 507259..507906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(507944..508183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(508176..508394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 508568..509461 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939625.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 509518..510624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(510661..510894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(511054..511764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 512015..513385 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 513623..515260 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 515387..515533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 515949..516263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 516256..517068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 517061..517402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 517395..518690 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027306.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene dnaB CDS 519229..519366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 519506..519661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 519754..520227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(520290..520475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(520472..520855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(521269..521439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 521562..522050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 522103..522603 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 522685..523533 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 523565..524530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911582.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 524620..525288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 525394..526122 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083541.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(526215..526760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182716.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(526929..527459) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627261.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(527754..528161) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(528475..529131) product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 529435..529602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(529642..529860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 note possible pseudo, internal stop codon CDS 530237..530548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 530564..531361 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700003.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene dapA CDS complement(531425..531601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(531736..532020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(532699..533151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 533592..534011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(534253..534432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 534767..534952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(535791..535922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 note possible pseudo, internal stop codon CDS complement(536315..538909) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231379.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene ppsA CDS 539209..539508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(539603..539884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(540340..540738) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788358.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 541056..541589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(541735..541923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 542344..542832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 543710..544174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS 544339..544863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(545751..546893) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(546918..547439) product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232721.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(547538..547849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(547839..549848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(549953..551122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(551300..551908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(552104..552478) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(552475..552819) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 552979..553188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 553216..553515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 553581..554096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 554521..554979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(554980..555336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 555412..556218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 556211..556546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 556543..557853 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene dnaB CDS 557857..558069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 558062..558385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 558585..558776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(558865..559314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(560097..560339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 560653..561138 product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166128.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 561135..561677 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012145.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 562087..562767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 562821..562985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 563087..563305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 563610..563906 product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627242.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 563893..564267 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 564374..564811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714099.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 564808..566529 product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 566545..566796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 566793..566927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 566958..568169 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 568132..568716 product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687903.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 568718..570046 product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002415255.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 570061..570300 product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369282.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 570302..570637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126092.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 570627..570959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166632.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 570952..571332 product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 571338..571970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 571982..572368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113343.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 572374..572592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 572609..575656 product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 575668..576555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 576557..577663 product siphovirus ReqiPepy6 Gp37-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 577663..579018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 579039..579347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 579386..579664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 579675..579899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 579899..580681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(581754..582203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 582292..582927 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 582924..584813 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 584989..586809 product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 587034..588272 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 588408..588743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 588863..589708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609533.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 589936..590151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 590164..590628 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102671.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 590913..591122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 591301..591897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 591979..592953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(593047..593319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(593309..593707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 593831..594283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(594329..595582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 595870..596214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 596532..597581 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388278.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 597578..598591 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260776.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 598689..599648 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787743.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 599884..600300 product hut operon transcriptional regulator HutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene hutP CDS 600421..601929 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene hutH CDS 601944..603593 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene hutU CDS 603654..604907 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene hutI CDS 604891..605847 product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene hutG CDS 605897..606454 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(606536..606856) product DUF3784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965808.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 607125..607427 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 607537..608931 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 609087..610088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 610258..610383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 610569..610694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 610760..613687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 613674..614666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 614669..615769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 615744..617312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 617328..618395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 618411..619790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 620010..621347 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 621386..621919 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(622082..623020) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915080.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 623266..624852 product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 625033..627651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 627680..628450 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene phnC CDS 628447..629217 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000761.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene phnE CDS 629214..629999 product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene phnE CDS 630205..630900 product disulfide bond formation protein BdbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene bdbD CDS 630900..631319 product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 631444..632571 product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692564.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 632577..632981 product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 633184..633924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 635078..635590 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620469.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 635672..636106 product bacilliredoxin BrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230794.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene brxA CDS 636156..636671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 636675..637460 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637459.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 637641..638435 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398587.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 638432..638905 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene dfrA CDS 639025..639738 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(640166..640384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(640401..641081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(641181..641861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(641959..642237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(642322..643008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(643203..643880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(643958..644113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(644223..644849) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 645120..645299 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492443.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 645380..646126 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene tatC CDS 646239..647627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 647750..648592 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 648680..650248 product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 650258..651370 product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986512.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 651367..652485 product spore germination protein GerHC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411389.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene gerHC CDS complement(652526..653431) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 653593..654180 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833353.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(654213..654674) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 654943..656856 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene asnB CDS 657150..658268 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844385.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 658362..659144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 659256..659894 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156575269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(659921..660742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 660839..661330 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 661506..661892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 661931..662236 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014540.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 662251..662979 product DUF5081 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 662979..663305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 663337..665070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 665095..665562 product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403325.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(666549..667682) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193190.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(667924..669309) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 669451..669894 product DUF4275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272658.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 669958..671091 product two-component system sensor histidine kinase CasK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170871709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene casK CDS 671091..671726 product two-component system response regulator CasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene casR CDS 671713..671889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 671899..672531 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181656.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 672673..673209 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 673211..674434 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 674605..675870 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 675887..676450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 676484..677461 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260976.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 677448..678686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 678993..679760 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948600.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(679832..680467) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 680677..681111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 681438..683687 product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene helD CDS 683998..684510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(684567..685040) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 685218..685490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 685676..686170 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 686638..686898 product TIGR04197 family type VII secretion effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529659.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 686981..687343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 687340..688731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 688733..689401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156576523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 689559..690233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156576523.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 690282..690551 product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 690728..692635 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 692625..694466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178731.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 694690..695271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487796.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(695318..695701) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(695859..696326) product chromosome-anchoring protein RacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene racA CDS 696528..697871 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene gabT CDS complement(697916..698311) product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247558.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS 698640..699623 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(699776..700363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 700606..702354 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene ade CDS 702590..704185 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722853.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 704279..704446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 704616..704756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(704836..705333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 705564..705743 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 705750..706169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 706866..707780 product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688524.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 707801..708304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 708411..708938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(709052..709255) product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919824.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(709248..711323) product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene cstA CDS 711512..711694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(711837..712385) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 712626..713897 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 713887..714573 product acetate CoA-transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene atoD CDS 714552..715220 product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525293.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 715228..716499 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 716489..717340 product putative beta-lysine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ablB CDS 717424..718836 product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene ablA CDS 718833..719117 product YokU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 719210..719425 product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231160.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 719568..720233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(720359..720514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 720704..720883 product YozD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658451.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 720981..721187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 721191..721997 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 721984..722754 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486596.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(722979..723194) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(723208..723834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(723982..725421) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627647.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(725701..726327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 726686..729202 product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 729369..729860 product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 729871..730086 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(730142..730357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 730477..730659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 730748..731188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(731291..731740) product DUF3920 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422819.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 731924..733225 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546313.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 733340..734332 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(734376..735260) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380395.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 735575..736561 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 736577..737320 product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409953.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(737384..737698) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 737871..738590 product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 738932..741286 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(741320..741793) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 741920..742447 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 742583..743305 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655263.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 743427..744059 product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 744086..744523 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(744572..744892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 745067..745438 product DUF3916 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549065.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 note possible pseudo, internal stop codon CDS complement(745630..745947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(745935..746882) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(746946..747581) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829921.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(747806..748297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 748403..748561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 748754..749782 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 749893..750348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 750361..751893 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 751945..753549 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 753534..754229 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 754288..754683 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 754728..755492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 755544..755753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 755880..756056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 756204..756413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 756550..757332 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 757316..759886 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134266036.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(759923..760213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 760481..761548 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 761545..761691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 761922..762620 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 762607..763998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 764053..764625 product phosphatase PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene phoE CDS 764691..765014 product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242570.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 765026..765451 product FosM family fosfomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene fosM CDS 765475..766098 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400779.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 766279..766593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 767014..767886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(767914..768897) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 769152..772178 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033514.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 772536..774407 product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene abc-f CDS 774652..775338 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391399.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 775356..775826 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 775932..776798 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 777080..777925 product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(778051..779256) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269258.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 779491..779946 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(779957..781177) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 781286..783049 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470210.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 783120..783773 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 783789..784460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 784494..785543 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259330.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 785515..785877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 786086..787207 product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene tnpB CDS 787286..787666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 787670..788161 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483964.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(788335..788673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 789092..789985 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284946.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(790040..790360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 790552..790734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 790745..791194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(791459..792697) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene fabF CDS 792967..793428 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 793590..795713 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494262.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene recQ CDS 796062..796607 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(796682..797110) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600363.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 797391..798428 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 798441..798776 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(798809..799192) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 799376..800521 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 800537..801583 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 801588..803198 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 803211..804722 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 804723..805595 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 805597..806748 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 807042..807371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 807526..807732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 807778..807948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 808031..808423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 808686..809306 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 809494..810291 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 810392..811015 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(811050..812333) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276298.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene kynU CDS 812690..813232 product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 813223..814257 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 814229..814702 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008130072.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 814699..816153 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 816177..816956 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 816979..817854 product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257234.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 817872..818906 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257235.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene dmpG CDS 818903..819691 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 819714..819902 product 2-hydroxymuconate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870292.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 819935..821356 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537978.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 821510..822382 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(822420..823418) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(823434..824054) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(824511..825509) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232642.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(825524..826144) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(826200..826349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 826297..826443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(826514..827653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 827986..828969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 829053..829397 product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407043.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 829411..830076 product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene bshB2 CDS 830176..830577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(830618..831286) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 831534..831980 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 832066..832485 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 832488..832850 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 833020..834015 product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926333.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 834063..834494 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 834508..835005 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 835005..835472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 835589..836836 product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250222.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene ilvA CDS 837211..838839 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021571.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene metG CDS 838989..840071 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene serC CDS 840090..841256 product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490251.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 841275..842525 product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 842650..843276 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(843378..844076) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 844167..844937 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149238867.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 845099..846541 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene aspA CDS 846700..846948 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181712.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 847110..847844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 848545..849351 product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499399.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 849679..850917 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 851035..852180 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 852184..855273 product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 855397..855801 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358764.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 856196..856405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 856490..857458 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248640.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 857609..858295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(858346..859560) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 859792..860934 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 860949..862289 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 862286..862498 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245519.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 862514..863422 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775449.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene mvaB CDS 863433..864215 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 864218..865759 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 865784..867718 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806472.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 867742..868521 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(869009..869911) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 870181..870753 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398494.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(870788..871192) product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428351.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene arsC CDS complement(871219..872259) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene arsB CDS complement(872399..872704) product arsenical resistance operon transcriptional regulator ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene arsR CDS complement(872961..874328) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene bioA CDS complement(874322..875020) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016822.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene bioD CDS 875508..875837 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 876139..877893 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(877965..878900) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 879008..879532 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085768.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 879752..880219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(880264..880833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(880938..881498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(881550..882836) product DUF4179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(882829..883362) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460341.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(883427..883876) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928801.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(884109..884582) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142237840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(884614..884871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(884905..885309) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431726.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(885323..886015) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 886144..886713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(886761..889850) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416534.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene ileS CDS complement(890223..890525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 890645..891379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS complement(891495..892292) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073799.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(892869..893051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(893048..894067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(894374..894688) product quaternary ammonium compound efflux SMR transporter SugE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724784.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene sugE2 CDS complement(894685..895032) product quaternary ammonium compound efflux SMR transporter SugE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene sugE1 CDS complement(895290..895802) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246311.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene adaB CDS complement(895804..896424) product bifunctional transcriptional activator/DNA repair enzyme AdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234924.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene adaA CDS 896620..897531 product DNA-3-methyladenine glycosidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene alkA CDS complement(898000..898401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(898420..900381) product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382718.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(900790..901329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 note possible pseudo, internal stop codon CDS complement(901492..901701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 note possible pseudo, internal stop codon CDS complement(902100..902249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(902631..903770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 904149..905276 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642307.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(905458..905634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(906252..906491) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(906785..907393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(907390..907539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(908177..908749) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064460030.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(908912..910777) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(911220..911612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(912015..912722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(912799..913329) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(913425..914051) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS complement(914052..914504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 914683..915084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(915198..915377) product DUF3970 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(915508..917148) product family 14 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948842.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(917385..918380) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(918715..919059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491395.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(919340..919570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(920066..921247) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(921389..921682) product YxcD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(921670..922095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 922694..923470 product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(923600..925054) product ABC-F type ribosomal protection protein Msr(C) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287458.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene msr(C) CDS complement(925406..925783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(925825..926262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(926253..926819) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(926831..927385) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(927593..928447) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(928703..929749) product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709181.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(929884..931638) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071259.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(931718..932542) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(932619..933596) product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435528.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(933900..934658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(934786..936585) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(936582..937268) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(937618..938382) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(938724..939407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(939627..940208) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene plsY CDS complement(940289..941026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(941143..942927) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225342.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(942930..943607) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 944187..944645 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(944698..945123) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(945310..947220) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000663098.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene thrS CDS 948039..949265 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182456.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(949493..950146) product RNA polymerase subunit sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337509.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(950293..950874) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene clpP CDS complement(950966..951535) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(951552..951911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(951930..952682) product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(952772..953809) product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 954029..954886 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(954932..957025) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(957390..958160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(958247..958771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109898.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(958781..958912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(958931..959122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(959231..959773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350940.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(959992..960321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 960569..961021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 962144..962347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(962389..963021) product replication-relaxation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(962942..964141) product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(964243..964422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(964435..964785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(964800..965006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(964972..965820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 966029..966271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 966306..966635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(966729..967181) product type VII secretion system immunity protein YobK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231326.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene yobK CDS complement(967187..970141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(970419..970667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 970692..971333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(971719..973356) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(973792..974700) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312655.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene prpB CDS complement(974713..976152) product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598123.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene prpD CDS complement(976234..977355) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene mmgD CDS complement(977604..979160) product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(979182..981125) product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075677560.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(981127..982983) product putative thiazole-containing bacteriocin maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(983107..983391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(983689..985131) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene dbpA CDS 985346..985855 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(985902..986438) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045612793.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(986453..987493) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 987833..988285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(988515..989465) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene cysK CDS complement(989613..989849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(990079..990315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 990525..990725 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(991126..991431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 992311..993873 product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene lsrK CDS 993899..994261 product dimethylsulfonioproprionate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909989.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 994268..995056 product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene lsrF CDS 995248..995913 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 996026..996682 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073543581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 997336..998286 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene mraY CDS complement(998332..999168) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(999188..1000492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1000520..1001026) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180591.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1001060..1001899) product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661971.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene kynA CDS complement(1001889..1002536) product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene kynB CDS complement(1002540..1003820) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene kynU CDS complement(1003907..1004362) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 1004486..1004926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555000.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1004960..1005670) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1005921..1006421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(1006521..1006805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1006987..1007544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1007742..1008032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1008079..1009698) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1009913..1012336) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147466.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene parC CDS complement(1012340..1014304) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene parE CDS complement(1014498..1014911) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151390.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1015064..1016383) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1016472..1018247) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797500.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(1018251..1018925) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1019028..1019477) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867062.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 gene nrdG CDS complement(1019474..1021348) product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939611.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1021584..1022183 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene plsY CDS 1022255..1023019 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene map CDS 1023098..1023388 product HesB/YadR/YfhF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1023571..1023900 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724743.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 1023897..1025054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1025119..1026078) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246230.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1026372..1026800) product YbgC/FadM family acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(1026899..1027033) product acid-soluble spore protein SspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527987.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene sspN CDS complement(1027103..1027234) product FbpB family small basic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254703.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(1027375..1027863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1027973..1028581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(1028837..1031560) product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene acnA CDS complement(1031931..1035758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1036029..1036691 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713757.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS 1036792..1038111 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994836.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1038129..1039130) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527716.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1039121..1039309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1039337..1039687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1039846..1040394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1040514..1041668) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1041777..1042718) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495039.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1042932..1043612) product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924376.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1043835..1044020) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286203.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 1044372..1045748 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063168296.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1045773..1046195 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1046192..1046647) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764601.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1046672..1047331) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1047335..1048084) product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554685.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1048196..1048792) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660122.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1048805..1049680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1049682..1050230) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843675.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1050234..1050692) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1050705..1051676) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(1051808..1052830) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1053087..1053587) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412130.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1053615..1055906) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene metE CDS 1056643..1058127 product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene dhaS CDS complement(1058169..1058516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1058612..1059073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1059113..1059322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1059562..1060611) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1061402..1061674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1061850..1062044) product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(1062187..1062591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1062588..1063058) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230895.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 gene ribH CDS complement(1063074..1064267) product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469013.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene ribBA CDS complement(1064289..1064930) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene ribE CDS complement(1064915..1066057) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131960.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene ribD CDS complement(1066534..1067010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1067022..1067717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1067723..1068103) product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(1068119..1068973) product metallo-hydrolase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860919.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 1069299..1070798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1070882..1071424 product transcriptional regulator FatR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967878.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene fatR CDS 1071948..1072610 product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742279.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1072765..1072914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1073548..1074006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1074124..1075197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1075341..1075817 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003261579.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1075905..1077206 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644307.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1077282..1078565 product purine/pyrimidine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847027.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1078572..1079159) product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1079557..1080015 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1080027..1081097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1081265..1082734 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069157.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene katB CDS complement(1082833..1083360) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene lepB CDS complement(1083611..1083871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146294.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1084001..1084123 product small acid-soluble spore protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1084202..1084585 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 1084709..1085395 product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1085475..1085903 product DUF2621 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889384.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1085947..1087020) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene murG CDS complement(1087133..1087597) product cytochrome c biogenesis protein CcdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028639.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1087686..1088393) product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene ccdA CDS 1088588..1088770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1088973..1089332 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814298.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 1089319..1090329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140186737.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1090380..1092158) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136732.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1092160..1093908) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(1094074..1094286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1094373..1094813) product sporulation inhibitor of replication protein SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene sirA CDS complement(1095115..1097115) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene tkt CDS complement(1097412..1097645) product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231595.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1097727..1098377) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1098524..1099144 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene lexA CDS complement(1099212..1099523) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076427.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(1099528..1099983) product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003767289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1100625..1101011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1101015..1102547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(1102795..1104129) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene glnA CDS complement(1104204..1104602) product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656783.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene glnR CDS complement(1104761..1106029) product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1106033..1107298) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048525537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene hflX CDS complement(1107432..1108496) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1108545..1109489) product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438185.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene spoVK CDS 1109621..1110607 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450310.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(1110698..1110922) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene hfq CDS complement(1110973..1111902) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene miaA CDS complement(1111993..1112676) product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1112942..1113985 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1113982..1115181 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1115232..1115468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1115504..1116145) product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1116170..1117252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1117585..1117719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1117694..1118263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(1118277..1118801) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465755.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1118863..1120731) product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928126.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1120856..1121833 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1121892..1123199) product bifunctional S-methyl-5'-thioadenosine deaminase/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136699732.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 1123362..1124123 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023938.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1124200..1124766) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476379.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1124771..1125835) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(1125850..1126791) product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272954.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1126843..1127286) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1127725..1129749) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1130898..1131452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201796.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1132069..1132647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1132821..1133351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1133499..1134002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(1134166..1134468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1134658..1135794 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1135872..1136432) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1136447..1137220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084813.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1137371..1137862) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134951.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1137991..1138683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1138739..1139068) product heme-degrading monooxygenase HmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene hmoA CDS complement(1139200..1139646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1139715..1140323) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141374.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(1140323..1141228) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723412.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1141421..1142554) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1142743..1143054) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948422.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1143148..1145049) product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1145480..1146274) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1146284..1147096) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1147111..1148133) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(1148126..1149133) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(1149152..1150111) product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035548.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(1150368..1151684) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665473.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1152129..1152419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1152533..1153390) product kanosamine-6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene ntdB CDS 1153467..1154465 product NTD biosynthesis operon transcriptional regulator NtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene ntdR CDS complement(1154704..1155669) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1155723..1156055) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1156112..1156930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1157739..1158143) product DUF5412 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1158420..1158968) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1159030..1159383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1159492..1160253) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817566.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1160380..1160739) product DUF6176 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1160801..1161646) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570994.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1161687..1162157) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973276.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1162171..1162602) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681082.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(1162574..1163065) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1163085..1163546) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(1163653..1164006) product DUF3147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1163991..1164413) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651930.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1164625..1164771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(1164768..1165841) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1166457..1166903) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1167263..1167610) product DUF4260 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172038.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(1167616..1168392) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1168551..1168760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1168759..1169232 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene msrA CDS complement(1169270..1169908) product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387072.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1170031..1170294) product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1170502..1171320) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966219.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1171341..1172165) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371021.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1172296..1173486) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139310338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1174048..1174188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1174276..1175199) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725545.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1175349..1175495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1175482..1175649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 note possible pseudo, frameshifted CDS 1176183..1176497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1176467..1177159 product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1177198..1178229) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1178242..1178751) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1178757..1179317) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1179430..1180104 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1180156..1181355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1181494..1182054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1182276..1182800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1182873..1184510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948590.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1184808..1185605) product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1186406..1187743) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(1188322..1189239) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene cysK CDS complement(1189410..1189901) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(1189961..1191688) product two-component system sensor histidine kinase YvrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene yvrG CDS complement(1191685..1192398) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283871.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 1192505..1193188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1193188..1194096 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1194164..1195987) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814582.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1195980..1197743) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1198257..1198604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1198980..1199162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1199398..1199910 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1200084..1200254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1200526..1201176) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1201530..1202354 product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523200.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1202390..1202917) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene pyrE CDS 1203207..1203995 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003269647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1204125..1204664) product PRK06770 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358635.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1204993..1205424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1205752..1206900) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1207222..1207812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1208073..1209911) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225342.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1209908..1210585) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1210612..1211421) product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734488.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1211714..1212223 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1212259..1214586) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1214770..1216347 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199961.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1216406..1217053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267784.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 1217551..1218294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 note possible pseudo, internal stop codon CDS 1218319..1218984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 note possible pseudo, internal stop codon CDS complement(1219453..1219584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1219883..1221091) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947707.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene hmpA CDS complement(1221180..1221935) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 1222275..1222451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1222514..1223428) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 1223735..1224370 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183863.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1224479..1224877) product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464537.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1225115..1225777) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1226470..1227213) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135272.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1227213..1227422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1227436..1227699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1227737..1228222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(1228299..1228616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1228624..1233426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1233437..1234201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(1234201..1237338) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119328.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1237511..1237972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1237994..1238581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1238666..1239046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1239380..1239841) product ArpU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166128.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(1239870..1240175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1240185..1241498) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027355.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene dnaB CDS complement(1241503..1241829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(1241822..1242607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1242667..1242900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1242900..1243187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 1243344..1243721 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 1243950..1244471 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232721.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1244677..1263189 product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1263264..1263611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1264376..1265695) product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014168.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1266945..1267649) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1268134..1269003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1269544..1269681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1269959..1271047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1271343..1271567) product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1271692..1271868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1271902..1272090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1272097..1272243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1272579..1272785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1272987..1273253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 1273325..1273516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1273738..1275084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1275354..1275563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1275807..1276475) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1276897..1278330) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053435486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1278645..1279307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1279833..1280117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1280174..1280440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1280555..1280911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1280993..1281358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1281745..1282998 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1283215..1283661) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129415.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1284198..1284395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1284605..1285750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1286149..1287090) product CDF family zinc transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229873.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene czcD CDS complement(1287108..1287443) product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene czrA CDS complement(1287658..1289793) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743763.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1290413..1291399 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1291506..1292021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1292036..1292935) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1293124..1293441) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 1294012..1295361 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948035.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 1295574..1296026 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1296163..1296339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1296796..1296957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 1297243..1297872 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254113.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1298329..1298850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1298950..1299099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 1299164..1299364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1299446..1301368) product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245099.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene mutL CDS complement(1301390..1304023) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene mutS CDS complement(1304238..1304783) product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288800.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene cotE CDS complement(1305105..1307081) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene miaB CDS complement(1307263..1308438) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1308457..1309497) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene tdh CDS complement(1309777..1310643) product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(1310645..1312381) product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(1312760..1313689) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1313774..1314034) product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene spoVS CDS complement(1314148..1314945) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221095.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(1315070..1316635) product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099773.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene rny CDS complement(1316998..1318032) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene recA CDS complement(1318215..1319450) product competence/damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990712.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene cinA CDS complement(1319484..1320059) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene pgsA CDS complement(1320155..1321069) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137484.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1321091..1321882) product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1322110..1322355) product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114454.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(1322424..1323149) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759617.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(1323180..1324466) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1324467..1325744) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772433.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1325882..1326841) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008856.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(1326843..1327892) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1327885..1329417) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1329610..1330650) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730595.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1330747..1331475) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1331854..1334172) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118781.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(1334278..1334481) product YlzJ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605024.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(1334478..1335230) product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139816.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene tepA CDS complement(1335296..1336957) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823087.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1337043..1337849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1337914..1338780) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564763.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene dapA CDS complement(1338792..1340015) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene dapG CDS complement(1340041..1341078) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene asd CDS complement(1341171..1341767) product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene dpaB CDS complement(1341767..1342660) product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene dpaA CDS complement(1342800..1344038) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1344123..1345070) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1345175..1347292) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene pnp CDS complement(1347545..1347814) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene rpsO CDS complement(1347919..1348884) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene ribF CDS complement(1348961..1349887) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene truB CDS complement(1349976..1350326) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene rbfA CDS complement(1350502..1352652) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036341.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene infB CDS complement(1352672..1352974) product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(1352981..1353247) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071128.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS complement(1353260..1354360) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene nusA CDS complement(1354378..1354848) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359097.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rimP CDS complement(1355172..1359482) product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060005.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1359586..1360845) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene rseP CDS complement(1360848..1362008) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene dxr CDS complement(1362028..1362819) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene cdsA CDS complement(1362837..1363607) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene uppS CDS complement(1363744..1364301) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531503.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene frr CDS complement(1364303..1365025) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene pyrH CDS complement(1365093..1365977) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene tsf CDS complement(1366068..1366766) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111485.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene rpsB CDS complement(1366939..1367445) product swarming motility protein SwrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene swrB CDS complement(1367505..1368272) product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene sigD CDS complement(1368296..1368787) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene cheD CDS complement(1368789..1369409) product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene cheC CDS complement(1369421..1369879) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1369912..1371957) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene cheA CDS complement(1371971..1373017) product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene cheB CDS complement(1373023..1373892) product flagellum location/number ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene flhG CDS complement(1373876..1375027) product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene flhF CDS complement(1375024..1377060) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene flhA CDS complement(1377076..1378158) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene flhB CDS complement(1378160..1378945) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene fliR CDS complement(1378955..1379224) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 gene fliQ CDS complement(1379238..1379906) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene fliP CDS complement(1379899..1380540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1380562..1380921) product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene cheY CDS complement(1380944..1382098) product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene fliY CDS complement(1382091..1383092) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene fliM CDS complement(1383129..1383551) product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene fliL CDS complement(1383544..1383765) product swarming motility protein SwrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231966.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene swrD CDS complement(1383812..1385032) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene flgE CDS complement(1385084..1385641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(1385650..1386738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1386754..1387356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1387374..1387814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1387817..1389136) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene fliI CDS complement(1389129..1389899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1389892..1390911) product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene fliG CDS complement(1390924..1392513) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene fliF CDS complement(1392553..1392855) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238544.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene fliE CDS complement(1392894..1393349) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene flgC CDS complement(1393352..1393741) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene flgB CDS complement(1394046..1394825) product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene codY CDS complement(1394848..1396239) product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550088.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene hslU CDS complement(1396253..1396795) product ATP-dependent protease proteolytic subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene hslV CDS complement(1396865..1397767) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene xerC CDS complement(1397836..1399137) product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene trmFO CDS complement(1399206..1401281) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene topA CDS complement(1401509..1402387) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818060.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene dprA CDS complement(1402471..1403382) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene sucD CDS complement(1403403..1404563) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene sucC CDS complement(1404707..1404976) product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(1404973..1406607) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164545570.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1406626..1407390) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1407479..1408357) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene ylqF CDS complement(1408381..1408923) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene lepB CDS complement(1409063..1409407) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene rplS CDS complement(1409544..1410272) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene trmD CDS complement(1410272..1410787) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene rimM CDS complement(1410941..1411168) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(1411184..1411459) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220815.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene rpsP CDS complement(1411575..1412921) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ffh CDS complement(1412934..1413266) product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1413487..1414476) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007656.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene ftsY CDS complement(1414544..1418104) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478987.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene smc CDS complement(1418167..1418910) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene rncS CDS complement(1419051..1419284) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene acpP CDS complement(1419400..1420140) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene fabG CDS complement(1420143..1421084) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene fabD CDS complement(1421101..1422102) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684110.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene plsX CDS complement(1422102..1422686) product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747348.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene fapR CDS complement(1422769..1424841) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene recG CDS complement(1425061..1425723) product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene sdaAB CDS complement(1425788..1427473) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027130.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1427502..1427861) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 1428242..1428430 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene rpmB CDS complement(1428824..1429465) product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1429534..1430178) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene rpe CDS complement(1430181..1431062) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene rsgA CDS complement(1431085..1433079) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene pknB CDS complement(1433082..1433834) product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1433840..1434940) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene rlmN CDS complement(1434945..1436288) product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene rsmB CDS complement(1436290..1437234) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene fmt CDS complement(1437231..1437716) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279455.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene def CDS complement(1437740..1440151) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene priA CDS complement(1440148..1441347) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene coaBC CDS complement(1441483..1441701) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene rpoZ CDS complement(1441703..1442320) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene gmk CDS complement(1442385..1443260) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564118.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1443471..1444409) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1444428..1444547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(1444725..1446137) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284877.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1446468..1449158) product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1449319..1451025 product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1451062..1452054) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1452088..1453104) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1453629..1454981 product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665445.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1455024..1455662) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene pyrE CDS complement(1455659..1456375) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene pyrF CDS complement(1456360..1457289) product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene pyrD CDS complement(1457286..1458065) product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene pyrK CDS complement(1458062..1461271) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126116.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene carB CDS complement(1461256..1462356) product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1462353..1463639) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108375.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene pyrC CDS complement(1463623..1464537) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018849.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene pyrB CDS complement(1464672..1465976) product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435928.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene uraA CDS complement(1466128..1466670) product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene pyrR CDS complement(1466871..1467785) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005836.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1467832..1468287) product lipoprotein signal peptidase LspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene lspA CDS complement(1468431..1468772) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1469021..1469995) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062858.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1470075..1470761) product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1470833..1471339) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1471441..1474197) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene ileS2 CDS complement(1474561..1475055) product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene divIVA CDS complement(1475147..1475923) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164454.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1475942..1476211) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1476218..1476700) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene sepF CDS complement(1476830..1477501) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1477498..1478340) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene pgeF CDS complement(1478420..1478695) product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1478807..1479586) product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197753.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene sigG CDS complement(1479699..1480418) product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene sigE CDS complement(1480449..1481372) product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261975.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene spoIIGA CDS complement(1481748..1482887) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene ftsZ CDS complement(1482934..1484226) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene ftsA CDS complement(1484605..1485402) product cell division protein DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798224.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene divIB CDS complement(1485967..1487061) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene murG CDS complement(1487255..1488349) product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene spoVE CDS complement(1488464..1489816) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860120.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene murD CDS complement(1489818..1490792) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene mraY CDS complement(1490874..1492340) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766307.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene murE CDS complement(1492379..1494298) product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266234.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1494403..1496532) product penicillin-binding protein 2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene pbpB CDS complement(1496595..1496942) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723754.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene ftsL CDS complement(1496966..1497898) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene rsmH CDS complement(1498188..1499810) product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene bshC CDS complement(1499797..1500729) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene panE CDS 1500887..1501372 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506700.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1501453..1502016) product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246476.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1502270..1502443) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene rpmF CDS complement(1502507..1503022) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1503160..1504395 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187910.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(1504416..1505438) product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1505440..1506222) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1506324..1507544 product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273100.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene ylbJ CDS complement(1507588..1508076) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200598.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene coaD CDS complement(1508079..1508645) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene rsmD CDS 1508995..1509384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1509554..1510696) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1510913..1512070 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1512113..1512388) product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080814.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1512520..1512975) product regulatory iron-sulfur-containing complex subunit RicF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene ricF CDS complement(1513055..1513636) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003289268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(1513897..1514139) product YlbE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200990.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1514178..1514585) product YlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(1514662..1515702) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1515887..1516240 product YugN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1516290..1516685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1516769..1517242) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1517505..1517966) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1517985..1518896) product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene ctaG CDS complement(1518975..1519298) product cytochrome c oxidase subunit IVB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985698.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene ctaF CDS complement(1519303..1519932) product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene ctaE CDS complement(1519932..1521800) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene ctaD CDS complement(1521837..1522874) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745268.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene coxB CDS complement(1522983..1523888) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015058.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene ctaB CDS 1524378..1525313 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene ctaA CDS complement(1525339..1526646) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988751.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1526643..1527431) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1527744..1531190) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene pyc CDS complement(1531324..1532505) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967159.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene ftsW CDS complement(1532691..1532978) product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 1533154..1533621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289792.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1533664..1534992) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1535166..1535618) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024581.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 1535772..1535972 product YlaI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001995040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS 1535917..1536408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1536416..1537021) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902228.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 1537713..1538696 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284908.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene asnA CDS 1538722..1538943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1538991..1539275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1539276..1539587) product YlaH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893662.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1539839..1541686) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914762.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene typA CDS 1541868..1542059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1542081..1542881) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232297.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene suhB CDS complement(1543040..1543228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 1543469..1544092 product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 1544104..1545288 product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1545416..1545607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1545736..1546206) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(1546285..1546554) product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456560.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1546559..1547515) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 1547756..1549117 product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene speA CDS complement(1549524..1550411) product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene mntD CDS complement(1550408..1551706) product manganese ABC transporter permease MntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene mntC CDS complement(1551706..1552461) product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene mntB CDS complement(1552490..1553419) product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene mntA CDS 1553622..1554434 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788486.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1554461..1554754) product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 1554899..1555303 product DUF1885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1555315..1556019 product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(1556037..1556582) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(1557072..1558481) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260104.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene lpdA CDS complement(1558486..1559772) product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863427.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene pdhC CDS complement(1559902..1560879) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene pdhB CDS complement(1560883..1561992) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene pdhA CDS complement(1562531..1563181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1563402..1563545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1563682..1564236 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene def CDS complement(1564277..1564432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS 1564886..1565098 product RNA polymerase subunit omega 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene rnpZA CDS 1565102..1566769 product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene rnjA CDS complement(1567090..1568232) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242551.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(1568245..1569513) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1569670..1570815) product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1570974..1572116) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122299.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene metC CDS complement(1572113..1573225) product cystathionine gamma-synthase/O-acetylhomoserine thiolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232857.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene metI CDS 1573711..1574967 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1575016..1575909) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 1576031..1577026 product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1577104..1577625) product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435830.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1577638..1581039) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene metH CDS complement(1581052..1582887) product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 1583074..1583529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1583576..1583881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1583955..1585127) product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1585096..1585689) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852222.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1585809..1586474) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 1586720..1587187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1587232..1588584) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1588944..1589765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 1589912..1590988 product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938001.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene cotH CDS 1591077..1591667 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1591688..1592806) product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1592929..1593630) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783241.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene dapD CDS complement(1593743..1594192) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1594363..1594878) product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1595002..1595241) product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055151.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 1595634..1595939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1596044..1596352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1596476..1596907 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 1597285..1598316 product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948870.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1598405..1599067 product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877445.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 gene sdaAB CDS 1599102..1599974 product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene sdaAA CDS 1600115..1600381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(1600675..1601235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1601632..1603638) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 1603964..1604200 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1604222..1604734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1604927..1606147) product EAL-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1606188..1607312) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1607576..1608673) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1608996..1610093) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1610398..1611423) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1611585..1612967) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1612960..1613607) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1613604..1614494) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1614671..1615312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1615393..1616157) product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene fadH CDS 1616434..1617306 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1617433..1618290) product intercellular adhesin biosynthesis polysaccharide N-deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene icaB CDS complement(1618295..1618789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1618747..1620006) product poly-beta-1,6 N-acetyl-D-glucosamine synthase IcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene icaA CDS complement(1620174..1622276) product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664304.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1622449..1622640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 1622965..1623447 product YkyB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(1623502..1624152) product YkyA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873555.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1624188..1625009) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1625296..1626195) product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene cheV CDS 1626370..1626555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1626736..1627569 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547977.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 1627930..1628340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1628375..1629184) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035802.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene thiD CDS complement(1629198..1630217) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene thiF CDS complement(1630204..1630974) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931981.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene thiG CDS complement(1630976..1631179) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886482.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene thiS CDS complement(1631163..1632278) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333314.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene thiO CDS complement(1632271..1632861) product thiazole tautomerase TenI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene tenI CDS complement(1632867..1633868) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670427.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1633865..1634608) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080857.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1634605..1635345) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256797.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1635317..1636009) product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666827.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene tenA CDS 1636687..1636887 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 1637544..1638845 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482728.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1638890..1639441) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1639654..1640070 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199006.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1640254..1640862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1641162..1643051 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1643170..1644504 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene glnA CDS 1644633..1645871 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1645955..1646488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 note possible pseudo, internal stop codon CDS complement(1646960..1647652) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288375.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1647649..1647978) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356630.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1648123..1649055 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1649138..1649293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1649364..1650965) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1651000..1651173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1651198..1651623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1651642..1653033) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene fumC CDS 1653273..1653422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1653617..1655698) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS complement(1655862..1657928) product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054123.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(1658063..1659427) product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene arcD CDS 1660018..1661451 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(1661477..1661605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1661705..1663594 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1663638..1663979) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1664280..1665782 product DUF4077 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(1665816..1666409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1666549..1667535) product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477858.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1667606..1668037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1668098..1668655) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816782.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 1668816..1670348 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445737.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1670397..1671266) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825875.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(1671384..1672538) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1672528..1673223) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038813.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(1673501..1674268) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031318.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(1674356..1674829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1674948..1675979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1676052..1676375) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426919.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1676486..1677256) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391974.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1677517..1677891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(1677938..1678738) product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1678763..1679245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS complement(1679292..1679774) product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804255.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1679790..1680275) product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804255.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1680442..1680924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1681280..1681951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1681944..1682228) product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1682437..1683645 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 1683664..1684443 product DUF4111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170999871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(1684507..1686504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(1686625..1689102) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1689671..1690237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1690310..1690729) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081432.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1690893..1691306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(1691344..1691736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1691939..1692205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 1692340..1692876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(1692916..1694190) product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420390.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 gene kinB CDS 1694359..1695513 product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 1695666..1696460 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 1696938..1697618 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1697631..1698332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1698354..1698671) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076422.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS complement(1699053..1700318) product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289547.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(1700370..1700888) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769080.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1700910..1701491) product sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244666.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene srtA CDS complement(1701554..1702138) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 1702412..1703164 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 note possible pseudo, internal stop codon CDS 1703161..1703970 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(1704077..1706011) product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265568.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1706365..1706604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1706672..1707526) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1707708..1708877 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014654825.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1709043..1709828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1709850..1710608) product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939488.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(1710837..1711775) product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1712618..1713730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(1713727..1714878) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014352.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1714875..1715807) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608796.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(1715895..1717349) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555499.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 1717411..1719801 product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195651.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(1719861..1720064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(1720080..1720541) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627520.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1720948..1721574 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170017.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(1721622..1721924) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 1722256..1722669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1722710..1724026) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842645.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene brnQ CDS complement(1724685..1724930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1725014..1725562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(1725757..1725945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 1726361..1727809 product polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 1728010..1729479 product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(1729552..1729752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1729767..1730627) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 1731003..1732799 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(1732847..1733398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(1733486..1733779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(1733889..1734215) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804825.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1734362..1735108 product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 1735122..1735466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1735508..1736221) product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1736302..1736520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1736653..1737090 product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(1737134..1737550) product DUF3980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610470.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1737626..1738345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1738421..1739887) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768129.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(1740181..1741590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(1741602..1742090) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1742192..1742788) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(1742785..1743336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1743513..1744736 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1744749..1745972 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 1745976..1747196 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219567.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 1747729..1748199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(1748400..1748990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 1749137..1749859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(1749906..1750589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 1750811..1751488 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 1751488..1752708 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1752759..1754213) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1754322..1754879) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163262472.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1754958..1756226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1756360..1756986) product CmcI family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001988952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(1757110..1757940) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1757969..1758763) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732025.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1758794..1759834) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1759835..1760884) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1760897..1761946) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078295.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1762012..1763010) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809249.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(1763206..1763529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 1763669..1764994 product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 1765088..1765267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 1765279..1765578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(1765647..1766135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(1766178..1767932) product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948038.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 1768445..1768762 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948327.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 1768759..1769475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS complement(1769751..1770614) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722221.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(1770611..1771018) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623961.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1771064..1771606) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709765.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1771793..1772563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1772582..1773001) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1773245..1773691) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804034.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1773771..1774283) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(1774318..1774935) product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(1774932..1775591) product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene mtnX CDS complement(1775596..1776813) product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014181.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene mtnW CDS complement(1777048..1778232) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765527.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 1778327..1779106 product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 1779488..1780675 product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene mtnK CDS 1780672..1781718 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104604.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene mtnA CDS 1781885..1783063 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 1783079..1783279 product NETI motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166303.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 1783402..1784394 product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 1784504..1785361 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766420.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 1785463..1785663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 1785923..1786399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1786462..1786914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(1786993..1787928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(1788074..1788334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(1788398..1788865) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775411.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 1789052..1789870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(1789888..1791699) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763048.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(1791842..1793650) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 1793892..1796642 product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235309.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(1796777..1797493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(1797731..1799545) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928446.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 1799741..1800244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 1800424..1800678 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 1800675..1801403 product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033865.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 1801375..1802775 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443605.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(1802956..1803684) product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086126.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene srtB CDS complement(1803721..1804491) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403746.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1804481..1805464) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036831.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1805481..1806368) product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163510.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene isdE CDS complement(1806513..1807796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 note possible pseudo, internal stop codon CDS complement(1807829..1808284) product NEAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476164.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(1808299..1808958) product heme uptake protein IsdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene isdC CDS complement(1809385..1810092) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 1810201..1810872 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161456.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(1810903..1811448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(1811502..1811915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 1812070..1812441 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800776.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(1812477..1813091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(1813106..1813918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(1814072..1814929) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(1815297..1815479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(1815535..1815930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(1816209..1818011) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243544.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(1818004..1819743) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834766.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(1819761..1820210) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132361.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(1820502..1820747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(1820998..1821324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(1821443..1821766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 1821940..1822551 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(1822638..1823417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 1823565..1823942 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111564.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS 1823996..1824310 product DUF3221 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079377.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(1824323..1825096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(1825106..1825681) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 1825841..1826428 product lipoprotein BA_5634 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737491.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(1826613..1826993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 repeat_region 1826989..1827212 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacactggacctactggagcgactgg CDS complement(1827752..1828537) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(1828743..1830080) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089363.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 1830282..1830701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(1830831..1831667) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 1832127..1833428 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(1833469..1833687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(1833704..1833922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(1833985..1835328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 1835452..1835907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 1836048..1836257 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 1836254..1836760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(1836812..1838272) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930684.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene lysS CDS complement(1838652..1839179) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(1839396..1840268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(1840454..1841365) product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene pfkB CDS complement(1841362..1842117) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957281.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(1842350..1842676) product DUF3909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365609.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(1842679..1843554) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400423.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 1843691..1844302 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231196.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 1844417..1844803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 1844993..1846012 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(1846049..1846495) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386773.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(1846492..1847163) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(1847259..1848476) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(1848476..1848790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169023.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 1848871..1849329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(1849429..1851414) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(1851940..1853919) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(1854169..1856157) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003782.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(1856301..1858292) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946364.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(1859004..1860260) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777354.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(1860797..1862503) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174221.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene ptsP CDS complement(1862503..1862766) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411080.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene ptsH CDS complement(1863402..1865291) product PTS N-acetyl glucosamine transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023104.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene nagE CDS complement(1865806..1866858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(1866830..1867729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(1867698..1868768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(1868758..1869309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(1869533..1870147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(1870221..1871453) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391935.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(1871644..1873701) product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene ptsG CDS complement(1874142..1875005) product ptsGHI operon transcription antiterminator GlcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073864.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene glcT CDS 1875152..1875937 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(1876023..1876769) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 1877072..1877719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 1877739..1878338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(1878524..1878709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(1878921..1879655) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024206.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene nagB CDS complement(1879655..1880785) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene nagA CDS complement(1880963..1881862) product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000876587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(1881875..1882966) product DUF871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253349.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 1883186..1883614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 1883804..1885138 product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145750.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene celF CDS 1885242..1885553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 1885556..1885750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(1885800..1886516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(1886710..1887168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(1887180..1888553) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(1888622..1889347) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984077.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 1889522..1890340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 1890343..1890987 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(1891157..1891594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(1891645..1892829) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124880.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(1893131..1893838) product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene pdaB CDS complement(1893998..1894159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(1894207..1894431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(1894522..1895691) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393897.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 1896382..1896708 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107963.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 1896735..1897412 product DUF1129 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 1897676..1898182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 note possible pseudo, internal stop codon CDS 1898226..1898975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(1899019..1899735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(1899732..1900457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(1900540..1900821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(1900893..1902098) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989560.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(1902100..1903020) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528801.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(1903200..1903502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(1903578..1904690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 1904971..1905357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(1905556..1906356) product bacitracin resistance undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796255.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 gene uppP CDS 1906473..1907039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 1907584..1907856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 1908196..1908555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(1908687..1909817) product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105815.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 1910028..1910717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(1910950..1911825) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(1911929..1912750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(1912768..1913544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 1913758..1914507 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(1914537..1914947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(1915087..1915701) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(1915698..1915868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(1915989..1916312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(1916357..1917166) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626552.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(1917153..1918187) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445949.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(1918187..1919143) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(1919327..1919515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(1919607..1920068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757112.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(1920212..1920529) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312623.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(1920531..1920875) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(1920959..1921540) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002054718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 1921658..1922401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(1922606..1923133) product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473156.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(1923320..1924546) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(1924804..1926513) product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730391.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 1926710..1927993 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 1927990..1928118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 1928194..1928748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935632.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 1928833..1929087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(1929188..1929349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 1930092..1932194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(1932825..1933265) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223866.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 1933344..1933979 product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS 1933992..1934168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(1934193..1935017) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547977.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(1935098..1936099) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598049.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(1936488..1937093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 1937795..1937995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(1938124..1938684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(1938793..1939281) product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217339.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(1939294..1939806) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082252685.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(1939826..1940200) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 1940457..1941164 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene deoD CDS 1941271..1941513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(1941493..1941939) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395634.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(1941917..1942387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(1942387..1942806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(1943131..1943979) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897345.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 1944252..1945376 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937244.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(1945415..1946227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS complement(1946279..1946437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(1946546..1946944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(1947008..1947781) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(1948124..1949092) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203029.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene nrdF CDS complement(1949164..1950063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(1950286..1951032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(1951177..1952307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(1952294..1952653) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959447.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene nrdI CDS 1953096..1955564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 1955606..1956133 product DUF4871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719694.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(1956230..1957141) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(1957231..1958553) product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene brnQ CDS complement(1958875..1959783) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446856.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(1959849..1960532) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079448.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(1960648..1960968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 1961184..1961681 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(1961713..1961907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356683.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(1961969..1962862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(1963008..1963556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 1963673..1964233 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619532.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 1964408..1966348 product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(1966386..1966628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS 1966731..1967291 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208302.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(1967502..1967900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(1967940..1968629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(1968578..1968760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(1968753..1969331) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509948.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 tRNA complement(1969456..1969526) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(1969522..1969728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 1969877..1970596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(1970668..1971531) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136583.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(1971865..1972749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(1972782..1973123) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499973.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 1973474..1973971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 1974249..1974473 product DUF2187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001165081.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 1974539..1974958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(1975002..1975499) product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene queF CDS complement(1975505..1976167) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036285.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene queE CDS complement(1976214..1976696) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368414.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene queD CDS complement(1976696..1977358) product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711596.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene queC CDS 1977747..1979015 product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002352.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene kinB CDS 1979101..1980357 product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene kinB CDS complement(1980517..1981332) product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174258.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene pdxK CDS complement(1981465..1981851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(1981927..1983624) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(1983667..1985364) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(1985414..1987111) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(1987179..1988876) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 1988989..1989558 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(1989873..1992089) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 1992220..1992837 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(1992894..1993595) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(1993667..1994095) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203348.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 1994231..1995748 product DUF3149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 1995941..1996732 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244739.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene motA CDS 1996725..1997498 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene motB CDS complement(1997722..1997913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 1998135..1998917 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549805.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(1998942..1999580) product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(1999802..1999927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 2000109..2001866 product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 2002022..2002273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2002296..2002448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001997002.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS 2002516..2002854 product DUF3905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726024.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2002910..2004262) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204716.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2004344..2005549) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2005654..2006739) product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 gene phaC CDS complement(2006815..2007564) product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene phbB CDS complement(2007583..2008086) product polyhydroxyalkanoic acid synthase subunit PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002004682.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene phaR CDS 2008282..2008710 product poly-beta-hydroxybutyrate-responsive repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903020.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene phaQ CDS 2008755..2009279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2009330..2009773 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2009891..2010079 product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241212.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2010249..2011004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 2011332..2012135 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2012574..2013896 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822361.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2014169..2014972 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(2015192..2015485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2015668..2016603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2016691..2016972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2017021..2017326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103775.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 2017475..2018236 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893026.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2018263..2019264) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2019637..2019828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 2019993..2020751 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490886.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(2020873..2021631) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644360.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2021632..2022402) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521262.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene cobA CDS complement(2022416..2022637) product DUF3906 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2022650..2024278) product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2024291..2024881) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380502.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene cysC CDS complement(2024878..2026011) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene sat CDS complement(2026066..2027139) product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232101.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene cysP CDS complement(2027152..2027874) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244757.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 2028260..2028688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 2028870..2029547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 2029721..2030110 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2030172..2030591) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019670.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2030837..2031427) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2031474..2033354) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025992.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2033544..2034179) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185385.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(2034209..2034637) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2034798..2035724) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448350.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(2035832..2036212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2036398..2036829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2037080..2039683) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 gene adhE CDS 2040398..2041054 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244510.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2041114..2041554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490297.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2041659..2043851) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856434.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(2043854..2044504) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477966.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2044646..2045704) product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772500.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene potD CDS complement(2045819..2046613) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene potC CDS complement(2046610..2047461) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene potB CDS complement(2047458..2048432) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720333.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene potA CDS complement(2049014..2050387) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(2050545..2051795) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2052003..2052173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2052206..2053678) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene putP CDS 2053906..2054376 product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139071.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 2054486..2054764 product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800721.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2054761..2056200 product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104834.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene panF CDS 2056586..2057404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111898.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(2057549..2057716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2057929..2059830) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(2059903..2060814) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808254.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2060811..2060978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 2061476..2062051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2062279..2062926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2063173..2063496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 2063385..2063840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 2063837..2064709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2064783..2065043) product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254393.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2065213..2065728 product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765863.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 2065733..2066155 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 2066196..2066525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2066546..2067391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2067474..2068994) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089363.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2069391..2070197) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498278.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2070279..2071187) product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2071325..2072032 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523228.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 2072248..2072448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2072566..2073252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(2073393..2074643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2074784..2077360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2077694..2078062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2078082..2078561) product DUF2716 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886642.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2078524..2079486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2079464..2080765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2080828..2081550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(2081725..2082432) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222169.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene rluF CDS complement(2082556..2083230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168086.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2083223..2083906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049695.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2083995..2084459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(2084694..2085311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2085452..2085949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2086168..2086503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(2086554..2086718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2086711..2087184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS complement(2087215..2087565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2087552..2087731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(2087871..2088338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2088361..2089335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(2089526..2089771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2089900..2092173 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245380.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2092301..2092444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2092510..2092962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2093152..2093469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2093473..2093670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2093682..2094332) product spore coat CotO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477963.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(2094325..2094519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2094580..2095548) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene rfbB CDS complement(2095545..2096111) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869415.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene rfbC CDS complement(2096234..2097148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(2097209..2097766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2097777..2098901) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene pseC CDS complement(2098921..2099829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(2099845..2101734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 note possible pseudo, internal stop codon CDS complement(2102060..2102833) product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene fabI CDS complement(2103109..2104476) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062407.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene mgtE CDS 2104611..2105792 product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654702.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS 2105872..2106609 product bis(5'-nucleosyl)-tetraphosphatase PrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene prpE CDS complement(2106662..2107549) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2107567..2108361) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(2108391..2109014) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081482.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 2109172..2109756 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 2109901..2110788 product ClpXP adapter SpxH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360645.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 2111176..2111376 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816704.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 2111373..2111813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(2111998..2112147) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831295.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene rpmG CDS complement(2112177..2113364) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757677.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 2113697..2114005 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092636.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 2114016..2114591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 2114621..2115193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2115227..2115790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2115835..2116413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(2116676..2118481) product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 gene pepF CDS complement(2118523..2118747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2118909..2119154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2119846..2121387) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2121518..2122201) product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350713.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene mecA CDS 2122318..2122608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2122490..2122888) product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene spx CDS 2123356..2123559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559980.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2123684..2125072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2125105..2125953) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242585.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 gene rfbD CDS complement(2126075..2126941) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene rfbA CDS complement(2127098..2128354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2128431..2129417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(2129493..2130668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(2130682..2132040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(2132037..2132693) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(2132843..2133412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(2133604..2134491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449496.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(2134646..2135602) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(2135752..2136447) product DUF2711 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088346064.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(2136586..2136726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2136764..2137702) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166346.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(2137692..2138738) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(2138758..2139777) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(2139777..2140706) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2140804..2142420) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824276.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 2142738..2143112 product DUF3899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 2143437..2144426 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene trpS CDS complement(2144470..2145222) product YjbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2145481..2146281) product DUF2268 domain-containing putative Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(2146460..2147698) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 gene fabF CDS complement(2147762..2148694) product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100539.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene fabH CDS complement(2148766..2149536) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017650999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2149593..2150327) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 2150588..2150773 product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211116.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2150858..2152018) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2152031..2152936) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(2152952..2153569) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949054.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(2153634..2154749) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene hppD CDS complement(2154914..2155567) product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221982.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(2155640..2158237) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene clpB CDS complement(2158339..2158578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 2158717..2159295 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963375.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 2159523..2160329 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041235.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2160399..2160548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(2160626..2161051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(2161200..2162045) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364453.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 2162167..2162298 product DUF3941 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120851.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(2162349..2163209) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281259.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 2163344..2163835 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 2164015..2164332 product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2164370..2164858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(2164947..2165453) product DUF4829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966442.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(2165567..2166883) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042441161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 2167044..2168780 product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 2168982..2170217 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055843.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2170230..2170574 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(2170696..2172432) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990058.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(2172639..2173331) product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754845.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 2173456..2173878 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282269.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 2173892..2174368 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(2174351..2174539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2174657..2174824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 2174796..2175377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 2175438..2176208 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2176249..2176884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(2177056..2177331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2177396..2179246) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene asnB CDS 2179395..2179940 product DUF2777 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616046.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2180023..2180370) product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233494.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 2180510..2181718 product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene rocD CDS complement(2181765..2182664) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2182799..2183020 product spore germination protein GerPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001111187.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene gerPA CDS 2183050..2183241 product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene gerPB CDS 2183285..2183896 product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070760.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 gene gerPC CDS 2183899..2184078 product spore germination protein GerPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene gerPD CDS 2184097..2184537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2184543..2184758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 2184771..2184986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(2185056..2188778) product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene addA CDS complement(2188775..2192284) product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058551.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene addB CDS 2192390..2192653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(2192705..2193241) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene lepB CDS complement(2193273..2194289) product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 2194450..2195403 product endonuclease YokF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399048.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene yokF CDS complement(2195485..2195634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 2195826..2196725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2196944..2197540) product competence protein ComK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444443.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2197784..2199061) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene aceA CDS complement(2199092..2200669) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071740670.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene aceB CDS complement(2200882..2202147) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233297.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(2202279..2203808) product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(2204068..2205063) product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897285.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(2205067..2205798) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784668.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 2205943..2206071 product protein YhfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886464.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene yhfH CDS complement(2206037..2206204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(2206640..2208079) product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228080.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene hemY CDS complement(2208107..2209033) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene hemH CDS complement(2209054..2210100) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252614.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene hemE CDS complement(2210440..2212617) product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(2212610..2213353) product ecs operon protein EcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634132.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene ecsC CDS complement(2213395..2214609) product ABC transporter permease EcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene ecsB CDS complement(2214609..2215346) product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292612.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 gene ecsA CDS 2216061..2216495 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016841.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2216552..2216908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 2217085..2217642 product HTH-type transcriptional regulator Hpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834924.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(2217644..2217988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 2218641..2219513 product peptidylprolyl isomerase PrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene prsA CDS complement(2219625..2220344) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(2220449..2220652) product sporulation YhaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449227.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(2220720..2221694) product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 gene yhaM CDS complement(2221714..2224614) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242210.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(2224611..2225852) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381159.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2226000..2226185 product YhzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539551.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 2226198..2226374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(2226423..2227211) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003269647.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(2227980..2229476) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924633.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(2229606..2230478) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2230390..2230674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2230622..2230777) product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046095.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2230835..2231185) product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164614.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(2231239..2232363) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139368465.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(2232367..2232546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2232644..2233717 product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene spaC CDS 2233725..2235086 product YheC/YheD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658062.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(2235132..2235374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 2235625..2235828 product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene sasP CDS complement(2235926..2236771) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234966.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(2236932..2238353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(2238378..2239265) product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 gene murQ CDS complement(2239502..2240785) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 2241063..2241542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(2241590..2243608) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116616.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(2243605..2245356) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493192.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 2245915..2247351 product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213643.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene gapN CDS complement(2247455..2248363) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 2248939..2250369 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 2250673..2252358 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene argS CDS 2252465..2253031 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727419.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(2253074..2253919) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244125.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(2254026..2254874) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2255037..2255732) product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651510.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(2255754..2256440) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(2256565..2257590) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544177.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(2257583..2258938) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 gene cydA CDS complement(2259030..2259170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 2259392..2259535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(2259770..2260303) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780361.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 2260470..2261240 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(2261283..2262260) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2262414..2262737) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003168681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 2262840..2263073 product spore coat associated protein CotJA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362188.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 2263070..2263333 product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 gene cotJB CDS 2263346..2263915 product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265278.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 gene cotJC CDS 2263966..2264910 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879443.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 2265114..2265323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(2265248..2266060) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455203.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 2266307..2267494 product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(2267708..2268493) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(2268618..2270039) product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202693.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene spoVR CDS 2270275..2270994 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181479.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS complement(2271066..2271773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 2271904..2272452 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506639.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 2272615..2272869 product YhdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 2272981..2273946 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2273989..2275020) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(2275157..2276851) product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene glpD CDS complement(2277075..2278565) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759995.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene glpK CDS complement(2278642..2279352) product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272193.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene glpF CDS complement(2279630..2280184) product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394285.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene glpP CDS complement(2280263..2282005) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244986.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene pgcA CDS 2282205..2282636 product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 2282638..2283102 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738459.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 2283167..2284438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 2284454..2285143 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142165.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 2285122..2286555 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824532.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 2286632..2286841 product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115485.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 2287049..2287180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 2287308..2287631 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578885.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2287715..2288473) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717597.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(2288544..2289413) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 2289599..2290906 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482713.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS complement(2291229..2293631) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(2293717..2293920) product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 gene copZ CDS complement(2293936..2294271) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(2294510..2295361) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(2295425..2296516) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411484.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(2296625..2297725) product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270702.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 gene kdpDN CDS complement(2297793..2298374) product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412605.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene kdpC CDS complement(2298396..2300495) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248019.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene kdpB CDS complement(2300515..2302188) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638357.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene kdpA CDS 2303081..2304460 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443134.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 2304642..2305535 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000530036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(2305522..2305644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 assembly_gap 2306580..2306619 estimated_length known gap_type within scaffold linkage_evidence paired-ends assembly_gap 2306878..2307047 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 2307710..2307901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 2308518..2312294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(2312344..2313312) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401673.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 2313429..2313587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(2313624..2315348) product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211478014.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene cydC CDS complement(2315345..2317078) product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene cydD CDS complement(2317078..2318091) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950085.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene cydB CDS complement(2318081..2319478) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene cydA CDS complement(2320274..2321515) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(2321759..2322937) product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503517.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 gene yhbH CDS 2323242..2324216 product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477972.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(2324264..2326159) product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353280.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(2326482..2326955) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene trmL CDS complement(2327051..2327947) product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260551.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2328010..2329149) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene queG CDS complement(2329197..2329409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2329630..2330652) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(2331151..2331789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073111.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(2331825..2332490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(2332762..2333703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 tRNA complement(2333970..2334053) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(2334180..2334265) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(2334284..2334357) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(2334367..2334441) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(2334445..2334519) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(2334549..2334623) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA complement(2334638..2334711) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA complement(2334719..2334802) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(2334811..2334883) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA complement(2334900..2334975) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(2334984..2335059) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(2335064..2335140) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA complement(2335171..2335246) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA complement(2335255..2335329) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA complement(2335348..2335439) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA complement(2335448..2335522) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 rRNA complement(2335533..2335643) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence02 source 1..542867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5930..6082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(6555..7121) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene efp CDS complement(7132..8193) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene pepQ CDS complement(8197..8640) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735140.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 gene aroQ CDS complement(8850..9359) product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024773.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 9535..10458 product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807121.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 10564..10941 product SA1362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014463.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(10972..11406) product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene mntR CDS complement(11689..12525) product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 12705..13085 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108653.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(13145..13636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(13703..15160) product aminomethyl-transferring glycine dehydrogenase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795703.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene gcvPB CDS complement(15157..16497) product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903221.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene gcvPA CDS complement(16515..17615) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 gene gcvT CDS 17852..19525 product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 19512..20324 product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(20417..20611) product YqzE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106081.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(20647..21159) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836631.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 gene aroK CDS complement(21163..21540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(21537..21842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(21961..22281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(22265..22711) product comG operon protein ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene comGD CDS complement(22692..22997) product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178696.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene comGC CDS complement(23015..24046) product comG operon protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472051.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene comGB CDS complement(24043..25089) product competence protein ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399124.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene comGA CDS 25249..25953 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434123.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 26030..26266 product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440720.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(26305..27396) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525152.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(27401..28024) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 28181..28354 product DUF2759 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524853.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(28405..30036) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824544.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(30147..31205) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886566.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(31310..31516) product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253699.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(31589..33052) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(33176..34711) product rhomboid protease YqgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230128.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 gene yqgP CDS complement(34879..35826) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(35949..36512) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642751.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(36610..36759) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153056.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene rpmG CDS complement(36882..37652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(37814..38473) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251240.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene phoU CDS complement(38486..39322) product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226683.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene pstB CDS complement(39354..40235) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450297.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene pstA CDS complement(40235..41188) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204619.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 gene pstC CDS complement(41262..42212) product phosphate ABC transporter substrate-binding protein PhoX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871265.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene phoX CDS complement(42414..44705) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(44856..46133) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871382.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(46226..46837) product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene sodA tRNA complement(47085..47158) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(47269..48897) product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989585.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 49107..49877 product DUF1189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021907.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 49975..50328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825414.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 50501..51619 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene ispG CDS complement(51668..53245) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173891.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(53340..53855) product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(53868..54386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(54391..54708) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092636.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(54927..55286) product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833129.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(55449..55865) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054516.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(55884..56711) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(56713..57513) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(57684..58178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(58263..59141) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435958.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 59250..59507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(59540..59869) product DUF1904 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(59898..60788) product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(60887..62209) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194030.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 62374..63057 product YqfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246095.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 63151..64101 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene ispH CDS complement(64119..64352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(64988..66109) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036219.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(66106..66813) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006542.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(66901..67254) product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828141.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene cccA CDS complement(67367..67897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(67987..69111) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764058.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene rpoD CDS complement(69151..70947) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene dnaG CDS complement(70950..71399) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 71372..71578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS complement(71694..72497) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(72527..73162) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583757.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(73463..75535) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene glyS CDS complement(75535..76416) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene glyQ CDS complement(76684..77436) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487015.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene recO CDS complement(77467..77610) product YqzL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883924.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(77762..78664) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene era CDS complement(78713..79057) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715480.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS complement(79085..79549) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene ybeY CDS complement(79561..81606) product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091509.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(81798..82760) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(82764..83948) product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792498.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene yqfD CDS complement(84052..84336) product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732269.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene yqfC CDS complement(84520..84966) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054571.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(84981..85154) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048061.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene rpsU CDS complement(85406..86074) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene deoC CDS 86282..87418 product stage II sporulation protein SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079288.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene spoIIP CDS complement(87441..87986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(88094..88570) product S-ribosylhomocysteine lyase LuxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene luxS CDS complement(88691..90049) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108679.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene mtaB CDS complement(90055..90804) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190154.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(90814..91749) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene prmA CDS complement(91873..93003) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene dnaJ CDS complement(93157..94983) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene dnaK CDS complement(95017..95586) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392711.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene grpE CDS complement(95660..96694) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene hrcA CDS complement(96841..97974) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene hemW CDS complement(97993..98616) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(98760..100586) product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030950.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene lepA CDS complement(100776..101093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(101206..102306) product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene gpr CDS 102482..102739 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene rpsT CDS complement(102820..104016) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190330.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(104134..105501) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665388.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(105517..106527) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene holA CDS 106835..106969 product YqzM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229983.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(106992..109049) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879844.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(109599..110021) product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393866.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(110174..110779) product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene comEA CDS 110876..111706 product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020554.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene comER CDS complement(111865..112620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(112698..113897) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212371.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 114059..115330 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503125.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 115436..116170 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 116371..117759 product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS complement(117804..118808) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647231.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(119239..119619) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944311.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(119727..120458) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(120458..120811) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998173.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 gene rsfS CDS complement(120808..121383) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078244.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene yqeK CDS complement(121376..121942) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226048.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene nadD CDS complement(121957..122250) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene yhbY CDS complement(122244..123086) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812091.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 gene aroE CDS complement(123105..124211) product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140795.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene yqeH CDS complement(124215..124730) product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 125030..125221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(125285..126079) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 126439..127152 product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene sigK CDS complement(127184..127969) product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041248.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(128082..129218) product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(129223..130140) product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(130291..130983) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217037.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene mtnN CDS complement(131143..131694) product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 gene bstA CDS 131802..132011 product YrzA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010984.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(132062..132673) product YrrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897109.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(132745..134493) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(134777..135253) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179966.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene greA CDS complement(135452..136087) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225916.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene udk CDS complement(136105..137385) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217969.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(137408..138334) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742806.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(138341..139075) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389090.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(139173..140282) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572132.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene mltG CDS complement(140433..140711) product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(140728..141144) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene ruvX CDS complement(141147..141413) product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(141534..144185) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811842.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene alaS CDS complement(144614..145681) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793108.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(145803..146801) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 gene bioB CDS complement(146977..147546) product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964669.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 147796..148512 product chitin disaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593465.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene chbG CDS complement(148564..149121) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711853.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene lepB CDS complement(149232..150104) product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558802.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(150190..151050) product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558806.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(151062..151910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(151980..154172) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245424.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(154375..154560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(154576..154767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(154917..157241) product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528070.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(157284..157940) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066409.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 158188..158865 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948142.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(158908..160212) product heme-based aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245216.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene hemAT CDS complement(160398..161516) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038006.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 gene mnmA CDS complement(161528..162670) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439881.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(162706..163122) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 163397..164662 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812943.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 164756..165211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(165686..166633) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(166880..168241) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964998.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(168860..169267) product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606863.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(169863..171236) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene nhaC CDS 172598..174334 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene thiC CDS complement(174390..175058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(175165..175344) product acid-soluble spore protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382683.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(175519..175692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 175771..176436 product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(176492..177262) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903177.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(177373..179145) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840888.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene aspS CDS complement(179160..180428) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027084.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene hisS CDS complement(180863..181039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242605.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 181176..182036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(182071..182511) product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266954.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(182524..184719) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262810.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 gene relA CDS complement(185112..185624) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(185655..187973) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene recJ CDS complement(188227..190470) product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119059.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene secDF CDS complement(190675..190962) product post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886981.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 191068..192618 product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene spoVB CDS complement(192665..193300) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454832.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 193538..193918 product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS complement(193967..194227) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991116.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene yajC CDS complement(194276..195415) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125365.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 gene tgt CDS complement(195472..196500) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354028.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene queA CDS complement(196665..196862) product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138162.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(196862..197863) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene ruvB CDS complement(197869..198477) product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 gene ruvA CDS complement(198627..199097) product BofC C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871185.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(199414..199920) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236612.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(200119..200862) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437535.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 gene nadE CDS complement(201001..202590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(202740..203840) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025295.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 gene nadA CDS complement(203837..204682) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092232.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 gene nadC CDS complement(204663..206177) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138565.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 gene nadB CDS 206308..207453 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973795.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 207446..207991 product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812272.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(208004..208882) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene pheA CDS complement(208946..210856) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(210897..212816) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(212791..213567) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114529.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(213662..214744) product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865482.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(214734..215441) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276723.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS complement(215426..215626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(215767..217056) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497128.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene obgE CDS complement(217070..217609) product sporulation initiation phosphotransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037006.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(217689..217856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(217922..218212) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944957.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene rpmA CDS complement(218217..218561) product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(218569..218880) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene rplU CDS complement(219040..220461) product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(220480..221100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245105.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(221209..221961) product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599075.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene spoIVFB CDS complement(222059..222832) product stage IV sporulation protein SpoIVFA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene spoIVFA CDS complement(222951..223745) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503309.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene minD CDS complement(223748..224431) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391517.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene minC CDS complement(224496..225014) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975750.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene mreD CDS complement(225011..225859) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene mreC CDS complement(225882..226916) product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466737.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene mreB CDS complement(227387..228580) product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812470.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(229070..229645) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene radC CDS complement(229701..230270) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(230418..231371) product stage II sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361009.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(231501..232169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(232166..232738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(232738..233727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(233754..234347) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886586.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(234597..235058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(235076..236284) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(236271..237326) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(237340..238989) product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(239032..240318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 240577..241128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS 241198..241689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 241703..242872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS complement(242911..244200) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene folC CDS complement(244312..245484) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873272.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(245806..248451) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072244.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene valS CDS 248950..249144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(249185..250216) product spore coat protein YsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene ysxE CDS complement(250291..251325) product stage VI sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179738.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene spoVID CDS 251559..252125 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093334.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(252153..252578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 252705..252869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(252911..254200) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene hemL CDS complement(254203..255183) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087065.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 gene hemB CDS complement(255140..255985) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992353.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene hemD CDS complement(255978..256916) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene hemC CDS complement(256931..257755) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(257770..259110) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547841.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene hemA CDS complement(259450..260034) product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene ysxC CDS complement(260031..262355) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene lon CDS complement(262535..264199) product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119176.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene lonB CDS complement(264457..265722) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472282.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene clpX CDS complement(266009..267295) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene tig CDS complement(267474..268481) product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 gene ddcA CDS complement(268656..268826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 268898..269119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 note possible pseudo, internal stop codon, frameshifted CDS 269065..269253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 note possible pseudo, internal stop codon, frameshifted CDS 269275..269442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27260 note possible pseudo, internal stop codon, frameshifted CDS complement(269774..270652) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832652.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene galU CDS 270960..271574 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475206.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 272133..272315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 272402..272899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(273058..273894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 274112..274726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(275155..276042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069702494.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(276430..279171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 279347..280342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(280635..281093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(281626..283407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(283413..284207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS complement(284543..285553) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene xerD tRNA complement(285683..285761) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(285768..285841) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(285936..286448) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645497.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(286470..287069) product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815943.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(287083..287820) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261765.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(287969..289006) product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126760.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene gerM CDS complement(289165..289959) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene racE CDS complement(290120..290914) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene racE CDS complement(291032..291256) product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene gerE CDS complement(291473..291739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS 291906..292895 product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(292952..293833) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246070.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(293962..295920) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176119.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(295907..296674) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859654.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(296862..298832) product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227211.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 gene pbpC CDS 298975..299670 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 299674..300648 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765340.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS 300678..301463 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393250.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS 301423..303312 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145068.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(303360..303809) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822741.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(303903..304664) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291827.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 gene sdhB CDS complement(304657..306417) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676737.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 gene sdhA CDS complement(306431..307057) product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678351.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene sdhC CDS 307339..307788 product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042226.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(307834..309072) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(309190..309816) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755401.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(309892..311670) product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544275.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene uvrC CDS complement(311895..312293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(312311..313429) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532716.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(313416..313919) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017723.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(314333..314647) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018943.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene trxA CDS complement(314758..315150) product glyoxalase GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 gene glxA CDS complement(315254..316231) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 gene etfA CDS complement(316312..317085) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029028.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 gene etfB CDS complement(317137..317910) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(317925..318530) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(318680..320365) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 320776..321147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 321131..322744 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523070.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(322778..323719) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108844.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene argF CDS complement(323789..324940) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200534.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene argD CDS complement(324937..325698) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286797.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene argB CDS complement(325712..326941) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene argJ CDS complement(326964..328001) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861219.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene argC CDS 328186..328665 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(328846..331203) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(331224..332936) product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867537.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene polX CDS complement(333023..333550) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565409.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(333566..333820) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082701.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 gene zapA CDS 333992..334915 product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene rnhC CDS 334986..335135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(335204..337621) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 gene pheT CDS complement(337638..338681) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene pheS CDS complement(338666..338815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(339183..339935) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS 340118..340324 product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009513.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene sspI CDS complement(340486..341571) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163568.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(341744..342103) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 gene rplT CDS complement(342144..342341) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125945.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 gene rpmI CDS complement(342363..342863) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886591.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 gene infC CDS complement(343307..344095) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664715.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(344414..345430) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene adhP CDS 345636..346367 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042772.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS complement(346405..348336) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 gene thrS CDS complement(348659..349531) product putative sporulation protein YtxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569629.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 gene ytxC CDS complement(349645..350628) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(350621..351535) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180622.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(351553..352341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(352335..353036) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_215552704.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(353038..353415) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687512.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(353590..354522) product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400112.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 gene dnaI CDS complement(354525..355952) product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415049.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(356102..356560) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203687.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 gene nrdR CDS complement(356709..357092) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 gene speD CDS complement(357450..358484) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198972.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(358576..359190) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 gene coaE CDS complement(359237..359875) product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 gene ytaF CDS complement(359937..360761) product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene mutM CDS complement(360774..363401) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene polA CDS complement(363749..365497) product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032129.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene phoR CDS complement(365490..366206) product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065220.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene phoP CDS complement(366371..366841) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914178.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(366944..367885) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene mdh CDS complement(367899..369188) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene icd CDS complement(369299..370417) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 gene citZ CDS complement(370655..371116) product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 371209..372318 product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081388.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene ytvI CDS complement(372348..372728) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871622.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene fxsA CDS complement(372802..374556) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene pyk CDS complement(374614..375573) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821163.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 gene pfkA CDS complement(375980..376966) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818794.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene accA CDS complement(376963..377820) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene accD CDS complement(377838..378482) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204448.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(378497..379729) product NAD-dependent malic enzyme 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199012.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(379818..383147) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene dnaE CDS 383370..383705 product YtrH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383157.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS 383706..384206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265736.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(384246..385184) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545149.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 385333..385641 product YtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144776.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(385684..386997) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201587.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS complement(387119..387802) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 387952..389049 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene pepQ CDS 389253..391811 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010869.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene mprF CDS complement(391856..392578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(392711..393844) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219405.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene ald CDS 394054..394497 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066673.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(394565..395941) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041265.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene argH CDS complement(395938..397140) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358518.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene argG CDS 397314..397622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(397673..398506) product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256850.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(398621..399466) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(399714..400565) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823432.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(400711..401247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(401537..402727) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034575.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene ackA CDS complement(403006..404004) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084366.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS complement(404247..404843) product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024529.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene tpx CDS 404908..405621 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646306.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(405663..406067) product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350005.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 gene ytfJ CDS complement(406067..406708) product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 406890..407708 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785168.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(407735..408685) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269958.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(408687..409547) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002023328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(409604..411178) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503960.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(411239..412828) product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(412978..413178) product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene sasP CDS complement(413283..414491) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922339.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene thiI CDS complement(414497..415630) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638965.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(415771..417471) product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377302.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene ezrA CDS 417672..418157 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494335.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 418430..419032 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135311.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene rpsD CDS 419201..420388 product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747527.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(420403..420972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(421508..422764) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727370.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 gene tyrS CDS 423186..425831 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289443.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(425883..427601) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862049.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene acsA CDS 427798..428430 product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581400.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene acuA CDS 428454..429098 product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634568.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 429095..430273 product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092793.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene acuC CDS complement(430297..431295) product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 transl_table 11 codon_start 1 locus_tag LOCUS_28760 gene ccpA CDS complement(431634..432542) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990012.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 gene thrB CDS complement(432539..433594) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene thrC CDS complement(433599..434882) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924346.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(435101..437290) product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748665.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 gene cpdB CDS complement(437440..437766) product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene ytxJ CDS complement(437768..438211) product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197720.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 438450..439565 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 439751..440107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808640.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 440129..440776 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS 440890..441621 product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716089.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene liaF CDS 441618..442661 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744337.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 442663..443295 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598707.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(443336..444634) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219470.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene murC CDS complement(444838..445947) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(446014..448620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(448791..449513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(449580..450188) product biofilm matrix protein CalY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053731.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene calY CDS complement(450262..450837) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767792.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(450856..451716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(451894..452481) product CalY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172852.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(452750..453355) product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006759.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(453361..454164) product DUF1444 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967991.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(454255..454572) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838193.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(454578..455591) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(455593..456114) product DUF84 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(456181..457254) product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031503.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 457447..457785 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118543.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(457836..458678) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436857.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(458767..459402) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene trmB CDS 459546..459824 product YtzH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122234.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(459917..460702) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986674.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(460997..463132) product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921725.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 gene pulA CDS complement(463139..464110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229241.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(464110..465267) product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(465392..466825) product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene pepV CDS 467141..467362 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805512.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS complement(467463..468176) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS complement(468181..469809) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284049.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS complement(470016..471272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 471488..472702 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558883.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(472739..472921) product sporulation protein Cse60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(472929..473162) product DUF2553 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533800.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 473663..474586 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(474595..476985) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(477092..477385) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141204.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(477456..478670) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477904.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(478735..479310) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254439.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(479436..480656) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224971.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(480658..481539) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058142.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(481694..482005) product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018860.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 482353..483699 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964998.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(483802..484659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(484809..485183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(485283..487700) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene leuS CDS complement(488051..489169) product spore germination protein GerSC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252201.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene gerSC CDS complement(489166..490269) product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166522.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(490262..491815) product spore germination protein GerSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528995.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene gerSA CDS complement(491933..493138) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137547.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(493313..494092) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537932.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene trpA CDS complement(494082..495290) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105014.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene trpB CDS complement(495287..495895) product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865141.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(495892..496626) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 gene trpC CDS complement(496627..498234) product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(498231..499652) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003269846.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 gene trpE CDS complement(500254..500403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(500418..500681) product YtzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840865.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS 500874..501836 product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868031.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 501833..502405 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(502428..503489) product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102461.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 503612..504127 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS complement(504144..504587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 note possible pseudo, internal stop codon CDS complement(504615..504767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(504879..506078) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene metK CDS 506707..508293 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 gene pckA CDS 508463..508900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 509040..510050 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733143.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 510063..510818 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009050.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 510805..511617 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368771.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(511683..512168) product nucleoside triphosphatase YtkD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229087.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene ytkD CDS complement(512253..512564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435818.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 512795..512950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 513028..513252 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809333.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene yidD CDS complement(513253..513816) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838169.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 514064..515407 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286188.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene cydA CDS 515397..516425 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017662.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene cydB CDS complement(516464..517537) product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411355.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(517534..518628) product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049058.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(518653..520488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(520614..521708) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403270.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene menC CDS complement(521713..523185) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(523284..524102) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963873.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene menB CDS complement(524117..524926) product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103366.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 gene menH CDS complement(524923..526683) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059249.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 gene menD CDS complement(526683..528080) product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616720.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 528340..529254 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 529316..530041 product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957397.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(530127..530327) product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 gene cspD CDS 530696..531442 product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260111.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(531457..533886) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494109.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 gene glgP CDS complement(533937..535373) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 gene glgA CDS complement(535370..536389) product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504155.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene glgD CDS complement(536410..537546) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene glgC CDS complement(537494..539428) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100880.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene glgB CDS complement(539833..540150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 540257..540439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 tRNA complement(540485..540556) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(540564..540654) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA complement(540663..540737) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(540746..540822) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(540827..540900) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(540908..540983) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(540992..541067) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(541087..541162) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(541171..541246) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(541251..541327) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(541368..541460) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA complement(541477..541553) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(541579..541655) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(541683..541758) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(541770..541846) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(541904..541980) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(541990..542078) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(542088..542162) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA complement(542181..542264) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(542280..542355) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(542365..542440) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(542445..542520) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 rRNA complement(542528..542638) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence03 source 1..221287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 385..741 product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025063.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(762..1208) product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene perR CDS complement(1408..2937) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(3319..3786) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 gene bcp CDS complement(3790..4221) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964343.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS 4404..5708 product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181462.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene hemL CDS 6117..10580 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932983.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 10744..11829 product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765785.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(11839..13596) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161599.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(13728..14258) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506622.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(14424..14747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(14744..15004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(15153..15332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 15456..15680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275445.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(15700..16800) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene mutY CDS 16927..17910 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379111.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(18069..18335) product YfhJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998170.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 18453..18605 product small, acid-soluble spore protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517891.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 18630..18788 product YpzG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122093.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(18856..19170) product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057035.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(19262..20074) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268502.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 gene recX CDS 20188..21078 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684382.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 21091..22221 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698326.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 22456..23016 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914736.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 23138..23260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(23544..24692) product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594708.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(24888..25622) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238461.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 gene pflA CDS complement(25710..27935) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene pflB CDS complement(28234..28977) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048245.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 29174..30103 product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149861.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 gene glsA CDS 30282..30620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002373.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(30664..31275) product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070938.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS complement(31603..32151) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002080246.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS complement(32192..32629) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283500.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(32780..34141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 34380..35489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(35672..37048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(37321..38325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(38481..39056) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483979.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(39210..39461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(39665..39823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(40015..40416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 40674..41426 product YrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967863.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(41636..42283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(42539..44461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 44793..45077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(45230..45427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(45717..47258) product DUF4041 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860984.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(47348..47635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(47750..49135) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene rlmD CDS complement(49153..50016) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269422.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(50085..50921) product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681209.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene pdaA CDS 51056..51613 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467655.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(51791..52264) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977090.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 52451..53035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 53096..53722 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170049.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 53804..54955 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(55192..56715) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 gene fumA CDS complement(56826..57014) product SE1561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513558.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 57167..58288 product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156016.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene yfkAB CDS complement(58384..59181) product YfkD famly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233657.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(59262..59879) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244154.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(59940..60989) product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene cax CDS 61214..61627 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550210.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 61776..61922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(62002..62733) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885954.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(62809..63744) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845702.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 63829..64029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 64045..65958 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083755.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(66175..67014) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226536.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(67130..67621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(67655..68125) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250910.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(68193..69863) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759022.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 70022..70246 product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 70543..71106 product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 gene thiT CDS 71325..72290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 72528..74384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(74508..74696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(74775..75743) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205729.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(75756..76778) product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986244.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(76890..77762) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248042.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 78040..79125 product nitric oxide synthase oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047612.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(79166..80509) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454045.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(80599..81414) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925921.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(81475..83007) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743034.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 83125..83742 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886490.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(83808..84449) product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456219.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 84579..84968 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778831.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(85147..86382) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517080.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(86668..87048) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925584.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(87117..88451) product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861590.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(88506..89786) product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(89797..90477) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773720.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(90647..90796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(90966..91808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(91822..93171) product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene ykoH CDS complement(93175..93861) product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene ykoG CDS complement(93934..95364) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028163.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(95361..96542) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 96775..97113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(97176..97760) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433181.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene leuD CDS complement(97738..99132) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000518111.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene leuC CDS complement(99135..100196) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415384.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 gene leuB CDS complement(100207..101730) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene leuA CDS complement(101733..102743) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151741.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene ilvC CDS complement(102766..103281) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822948.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene ilvN CDS complement(103278..104984) product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene ilvB CDS complement(104923..105117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS complement(105294..106961) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728794.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene ilvD CDS complement(106977..107873) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene ilvE CDS 108364..108813 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172426.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(109109..109546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS complement(109688..110593) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121523.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene metA CDS complement(110595..111878) product bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504766.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 112296..112625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(112692..114128) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 gene proS CDS 114672..115316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 115471..116115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 116260..116904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(116932..117456) product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964911.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(117510..119495) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS complement(119715..120998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 121272..121970 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949146.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 121948..124104 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986267.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS complement(124113..124343) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025240.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS complement(124368..125354) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986321.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS complement(125583..126191) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005646.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(126271..126864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(127016..127687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(127689..128225) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965073.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(128397..129443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(129440..130141) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(130189..130653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(130858..131451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(131535..132338) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562830.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(132355..133230) product glutamate biosynthesis transcriptional regulator GltR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246132.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene gltR CDS 133361..134308 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039561.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 134407..134748 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS complement(134814..135341) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896302.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(135466..136071) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 136231..137430 product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475872.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS complement(137474..138028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 note possible pseudo, frameshifted CDS complement(138022..138930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 note possible pseudo, frameshifted CDS 139054..139674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964068.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(139720..140196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(140287..141246) product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022848.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 141649..142260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(142383..143675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(144953..145723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158217.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 145865..146305 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003770811.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 146376..147074 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119492.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 147509..148072 product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924420.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 gene ahpC CDS 148115..149644 product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599501.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 gene ahpF CDS 149782..150057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(150128..150463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(150477..153914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(154026..154676) product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene srtB CDS complement(155112..157031) product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195117.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene abc-f CDS complement(157511..158206) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233742.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS 158643..158870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 note possible pseudo, frameshifted CDS 158884..159306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31420 note possible pseudo, frameshifted CDS complement(159379..160065) product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207380.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(160209..160334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(160331..161398) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103224.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 161602..162465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(162575..163534) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(163531..164301) product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene pxpA CDS complement(164312..165019) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene pxpB CDS complement(165039..166238) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(166927..168201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(168821..170203) product reverse transcriptase/maturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459234.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 170355..170513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(170730..171644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(172015..173115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(173133..173642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS complement(174561..175538) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566703.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 175930..177273 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 177497..177778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 177871..178482 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943659.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 178484..179014 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709765.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(179164..180537) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene rlmD CDS complement(180627..181526) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(181736..183166) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 gene gatB CDS complement(183182..184642) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051433.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 gene gatA CDS complement(184657..184947) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086999.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene gatC CDS 185176..185964 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984753.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 186105..186524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(186707..186865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(187299..187895) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989773.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(187922..188317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(188445..188828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(189117..189254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 189442..189681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(190702..191358) product DUF4310 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421479.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS complement(191360..192145) product DUF4311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421478.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(192161..192502) product DUF4312 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288312.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(192516..192875) product glycine-rich SFCGS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288314.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(192877..193233) product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(193279..195096) product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706696.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS complement(195469..195903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(195990..197537) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene pruA CDS complement(197542..197733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(197779..198963) product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(198981..200987) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 gene ligA CDS complement(200998..203199) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene pcrA CDS complement(203204..203881) product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS 204134..204412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(204517..205854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 206186..206509 product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461632.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(206522..206929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(206945..207178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 207305..207838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(207865..209133) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101936.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 gene purD CDS complement(209148..210686) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene purH CDS complement(210683..211264) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene purN CDS complement(211261..212286) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262439.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene purM CDS complement(212381..213796) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879025.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene purF CDS complement(213781..216000) product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055555.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene purL CDS complement(215984..216667) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene purQ CDS complement(216664..216918) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278823.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene purS CDS complement(216906..217628) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170544.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 gene purC CDS complement(217719..219011) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625682.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 gene purB CDS complement(219008..220159) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 gene purK CDS complement(220156..220644) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839367.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene purE sequence04 source 1..218575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(83..238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 313..1308 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842311.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(1343..2695) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 2897..3103 product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105789.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(3136..3525) product S1 domain-containing post-transcriptional regulator GSP13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003765.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene yugI CDS complement(3954..5120) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808507.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(5117..5611) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003749.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 5795..6631 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015208.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(6668..6856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 6988..7374 product kinase-associated lipoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(7418..8044) product 3'-5' exonuclease KapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344356.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene kapD CDS 8378..9703 product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545209.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(9730..10110) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140612.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 10188..10883 product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810326.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(10920..12413) product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487984.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene pepA CDS complement(12545..13066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS complement(13162..13836) product stationary phase survival protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969090.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene spsC CDS complement(13919..14242) product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(14356..15567) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986965.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 16006..16989 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026689.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 17113..18357 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391935.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 18573..18785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(18832..19263) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(20146..20298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(20298..22796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(22789..23049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(23128..23910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(23932..24141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(24122..24373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(24387..24614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(24697..25215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS complement(25215..27086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(27804..28451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(28612..28749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(28761..29912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(30087..30374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(30477..30845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 31158..31385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 31412..31843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(32107..32718) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023352.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 33155..33292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 34495..34749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(34824..35111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(35444..36601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(36598..36774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 37084..37308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(37290..38057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(38375..39298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 note possible pseudo, internal stop codon CDS complement(39476..39829) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573822.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(39846..40694) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077385.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene dapF CDS 40939..41640 product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(41679..41918) product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595027.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 42097..43164 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682068.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(43194..43508) product DUF1462 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248594.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 43671..43898 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431159.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(43983..44993) product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 gene malR CDS complement(45121..46113) product spore coat protein CotS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614215.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene cotS CDS 46283..46783 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665093.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(46882..47355) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(47380..48150) product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(48256..48726) product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274012.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 48850..49821 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439090.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene glpX CDS 49852..50118 product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392606.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(50146..50448) product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435943.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(50578..51489) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166373.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene lipA CDS 51679..52668 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944673.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(52665..53456) product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968113.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 gene yunB CDS complement(53503..53805) product DUF1805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248463.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(53857..55101) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073806426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(55475..55798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 55791..56480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 56781..57737 product sporulation hydrolase CotR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243674.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 gene cotR CDS complement(57852..59249) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 gene sufB CDS complement(59333..59764) product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene sufU CDS complement(59754..60974) product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020767.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 gene sufS CDS complement(60974..62278) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152167.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 gene sufD CDS complement(62299..63078) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 gene sufC CDS complement(63408..64742) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666870.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(64865..65302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 note possible pseudo, internal stop codon CDS complement(65390..65653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(65810..66637) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722409.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 gene metQ CDS complement(66655..67320) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359401.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(67313..68338) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601775.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(68655..69011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(69118..69648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(69689..69835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(69955..70275) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228585.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(70295..70645) product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640869.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(70869..71249) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene gcvH CDS complement(71297..71650) product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 72107..73873 product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933560.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene lytS CDS 73854..74591 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 74826..76031 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747885.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(76262..78046) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(78092..79267) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206324.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(79280..81667) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 81851..81988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(82031..82825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS complement(82818..83390) product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031387.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS complement(83383..83706) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102620.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(83855..84772) product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 85107..85367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228567.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 85383..85697 product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(85737..86381) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667670.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene fsa CDS 86776..88017 product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261272.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 88100..88498 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230049.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(88524..88784) product YusU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290594.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(88879..90231) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS complement(90289..90705) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285639.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS complement(90796..91278) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266027.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 gene rraA CDS complement(91492..92202) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539282.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(92210..93220) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227484.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(93213..93962) product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862024.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(93959..95062) product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510099.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(95049..96146) product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(96173..97261) product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440054.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(97271..97552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(97630..98934) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013051.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 99303..100370 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025518.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(100414..101808) product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843974.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene nhaC CDS 102332..102457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(102496..103953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(103923..104486) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(104564..106006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(105984..106469) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(106595..107314) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532950.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 107550..107669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(107675..108349) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202582.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(108349..109440) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990019.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(109571..110950) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839519.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(110947..111624) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781961.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 repeat_region 112684..113471 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actggtgctactggcgctac CDS 113695..113898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS complement(114056..114823) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722505.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(114775..115143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(115235..116080) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(116534..117466) product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013141957.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 gene bla CDS 117675..119453 product BlaR1 family beta-lactam sensor/signal transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860827.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 119474..119854 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(120139..120360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(120724..120894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33450 note possible pseudo, internal stop codon CDS complement(121141..121770) product Ltp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674335.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(122338..123090) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590071.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(123087..124151) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631245.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(124151..125164) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041820.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(125184..126194) product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753444.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(126585..127262) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815816.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(127992..128627) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687274.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(128906..129055) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(129062..129241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(129279..129917) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689900.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 130149..130583 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512998.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(131196..132119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(132125..133252) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085739.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(133257..135965) product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195918.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS complement(136016..137335) product TniQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188384634.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(137449..137874) product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016117863.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(137906..138187) product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941864.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(138237..139997) product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 gene arsA CDS complement(140016..140375) product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948467.1 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene arsD CDS complement(140445..140849) product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428363.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene arsC CDS complement(140877..141932) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 gene arsB CDS complement(141962..142309) product metal-responsive transcriptional regulator AseR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243257.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene aseR CDS complement(142786..143280) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(143427..144485) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(144557..145933) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921933.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(146038..146358) product arsenical resistance operon transcriptional regulator ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026021.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene arsR CDS complement(146801..147427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(147431..148072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(148041..149240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 tmRNA complement(149785..150140) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(150320..150787) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 gene smpB CDS complement(150905..153421) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391086.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 gene rnr CDS complement(153453..154187) product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene estA CDS complement(154363..154596) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557262.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 gene secG CDS complement(154678..155415) product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002387.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 gene nfsA CDS complement(155613..156905) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103949.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 gene eno CDS complement(157048..158583) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231152.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene gpmI CDS complement(158576..159337) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231038.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene tpiA CDS complement(159464..160648) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(161171..162178) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161236.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 gene gap CDS complement(162240..163262) product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258187.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 gene cggR CDS complement(163422..163664) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869729.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(163684..164973) product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647965.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene rpoN CDS 165221..167932 product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820934.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(167971..168471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(168608..168919) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989050.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(168945..170231) product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168860.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 gene celB CDS complement(170268..170576) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023567.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(171155..171592) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041890.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(171771..171980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(172161..172406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 tRNA complement(172589..172665) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(172769..173377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025210.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS 173665..174246 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 gene clpP CDS complement(174357..175310) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene whiA CDS complement(175387..176346) product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene mgfK CDS complement(176352..177227) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138464.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 gene rapZ CDS complement(177261..177719) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190080.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS complement(177891..178841) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288072.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene trxB CDS complement(178957..179946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(180187..180825) product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700956.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene ppaX CDS complement(180890..181702) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 gene lgt CDS complement(181742..182677) product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene hprK CDS complement(182868..183233) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267308.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(183478..186351) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 gene uvrA CDS complement(186359..188338) product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441046.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 gene uvrB CDS complement(188464..189168) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144469.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(189168..190010) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170865.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(190173..190865) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144469.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(190875..191924) product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185912.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS 192085..192933 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660680.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS 192948..193115 product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085171.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 193220..194380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(194483..195661) product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033687181.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(195931..197346) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(197486..198763) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726077.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(198880..199770) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene ftsX CDS complement(199760..200446) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene ftsE CDS complement(200656..200979) product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242725.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 gene cccB CDS complement(201422..203113) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009435.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(203369..204352) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene prfB CDS complement(204566..207070) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene secA CDS complement(207268..207807) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene raiA CDS complement(208052..208249) product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene cspC CDS complement(208445..208795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS complement(208795..209196) product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene fliS CDS complement(209201..210736) product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(210755..211093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(211253..212323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(212421..213107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(213349..214455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS complement(214550..216043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS complement(216061..217977) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 misc_feature complement(218066..>218575) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166847803.1:flagellin Hag locus_tag LOCUS_34370 sequence05 source 1..185331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1200..1604) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 gene atpC CDS complement(1626..3041) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032600.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene atpD CDS complement(3083..3940) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 gene atpG CDS complement(4031..5539) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027518.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene atpA CDS complement(5555..6100) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene atpH CDS complement(6097..6618) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142616.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene atpF CDS complement(6765..6986) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052064.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene atpE CDS complement(7040..7750) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399871.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 gene atpB CDS complement(7770..7952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(7985..8209) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171223.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(8526..10706) product serine protease Vpr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227419.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 gene vpr CDS complement(10794..11933) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene wecB CDS complement(11973..12602) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 gene upp CDS complement(12761..14002) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110494.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 gene glyA CDS complement(14191..14766) product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(14919..15356) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869538.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene rpiB CDS complement(15380..16660) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410233.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(16706..17128) product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832373.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(17225..17791) product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142475.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(17850..18893) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(18987..19439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(19504..20166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(20313..21176) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267042.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene prmC CDS complement(21173..22243) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887064.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 gene prfA CDS complement(22338..22913) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280862.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(23218..23418) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene rpmE CDS complement(23569..24840) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053899.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene rho CDS complement(25307..26272) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442341.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 gene glpX CDS complement(26334..27620) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413260.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 gene murA CDS complement(27983..28840) product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131850.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(29053..29421) product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene spo0F CDS 29720..30238 product DUF2529 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912402.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(30282..31889) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene pyrG CDS complement(32162..32704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(32701..32904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 33009..34565 product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591593.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene opuD CDS complement(34637..36160) product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181014.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(36153..37199) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614096.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS complement(37352..40591) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(40588..41226) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238599.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(41261..42394) product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene acdA CDS complement(42412..43533) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(43560..44411) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(44501..45691) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047982.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(45881..47971) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086758.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS 48191..49393 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465731.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene cls CDS 49406..50362 product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605880.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene uvsE CDS complement(50392..50547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(50544..51149) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619239.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(51146..52270) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890391.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(52271..53008) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228297.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(53008..53907) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411157.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(54050..55759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(56029..57717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS complement(57710..59368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(59643..61313) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086456.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 gene argS CDS complement(61306..61749) product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414867.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(61877..63574) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966667.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(63743..65443) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966667.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS complement(65558..66439) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209826.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 gene speB CDS complement(66453..67280) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene speE CDS 67488..69527 product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(69663..70172) product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(70188..70868) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 71133..71318 product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147171.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(71490..72791) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262741.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(72906..73130) product DUF1450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526071.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 73374..74063 product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868358.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 74153..75007 product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071929.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 75038..75205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(75311..76282) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067215.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 gene pta CDS 76535..77278 product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287595.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 77446..77874 product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538153.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene cwlJ CDS 77893..78303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(78341..78709) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688312.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(78778..79077) product YwdI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243806.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 79270..80088 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS complement(80140..80805) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181937.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(81003..82316) product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948912.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(82304..83494) product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373755.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 83708..83914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(84014..85006) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206490.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(84999..85916) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(85916..86722) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256988.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(86874..87965) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986423.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(88129..89538) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048015.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 gene selA CDS complement(89639..89833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 90221..91360 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499486.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(91853..94036) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(94145..95587) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918536.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(95769..96758) product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 gene iolU CDS complement(96839..97771) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972130.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(97880..98467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(98594..99328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(99273..99428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(99623..100315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS complement(100517..101371) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659627.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 101544..104645 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033514.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 104829..105671 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170865.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 105671..106378 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144469.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(106482..107222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(107454..109778) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948921.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(109873..110772) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 gene msrB CDS complement(110929..111924) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166018.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 112414..112590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 112591..112791 product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(112835..114031) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255976.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 114261..114731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954998.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS complement(114774..115772) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321171.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(115793..116848) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289801.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS complement(117127..117834) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598666.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(117871..118572) product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700724.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(118726..119562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(119581..120666) product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137402.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS complement(120759..121445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431334.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS complement(121538..122140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS complement(122115..122681) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965073.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS complement(122803..131052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(131457..132506) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(132484..132672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 132704..133627 product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 133701..134711 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 134708..135709 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983751.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS complement(135723..135851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 135962..137779 product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655834.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 gene pepF CDS complement(137845..138675) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877687.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(138672..139655) product DUF6005 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200705.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(139648..139911) product petrobactin biosynthesis protein AsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250564.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene asbD CDS complement(139908..141140) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909573.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(141154..142872) product petrobactin biosynthesis protein AsbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053144.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene asbB CDS complement(142850..144664) product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163354.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 145133..146503 product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010111.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 gene glpT CDS complement(146550..147050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 147266..147682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(147732..148523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(148884..149363) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027000.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene rlmH CDS complement(149447..149608) product CxxH/CxxC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002183021.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(149721..150515) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(150564..151478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(151465..152799) product two-component system activity regulator YycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061560.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene yycH CDS complement(152796..154643) product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755373.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 gene walK CDS complement(154647..155351) product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971865.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene walR tRNA complement(155530..155603) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 tRNA complement(155624..155699) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(155723..155797) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(155812..155887) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(156051..157340) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100238.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(157524..158888) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 gene dnaB CDS complement(158914..159360) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864235.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene rplI CDS complement(159357..161324) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS complement(161724..161960) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918873.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene rpsR CDS complement(162025..162540) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene ssb CDS complement(162583..162870) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 gene rpsF CDS complement(163152..164252) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 gene ychF CDS complement(164400..164597) product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436051.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(164599..165540) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 165695..166294 product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020714.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 gene yyaC CDS complement(166317..167168) product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene spo0J CDS complement(167161..167946) product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 gene soj CDS complement(168113..168961) product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 gene noc CDS complement(169050..169769) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019628.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 gene rsmG CDS complement(169792..171681) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 gene mnmG CDS complement(171694..173070) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393757.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 gene mnmE CDS complement(173326..173943) product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111516.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(173943..174716) product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727748.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 gene spoIIIJ CDS complement(174760..175110) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 gene rnpA CDS complement(175335..175469) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 gene rpmH CDS 176366..177715 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 gene dnaA CDS 177894..179033 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212886.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 gene dnaN CDS 179186..179413 product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821364.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 gene yaaA CDS 179438..180568 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 gene recF CDS 180610..182538 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 gene gyrB CDS 182624..185098 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 gene gyrA sequence06 source 1..71215 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(239..1777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(1965..2252) product DUF2087 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360471.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(2268..3032) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454677.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(3064..4377) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082232609.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(4395..5066) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 5225..6154 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 6129..6845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 6845..7585 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476317.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 7685..8473 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195528.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS complement(8728..9345) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943404.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 9468..10445 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181976.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS complement(10487..10780) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS complement(11031..11657) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522508.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(11750..12601) product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 gene catE CDS complement(12624..13022) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077757.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 13167..13490 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000104.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 13907..14821 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057102.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene murB CDS complement(14879..15049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS complement(15051..16649) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832324.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(16655..17848) product capsular polyglutamate synthetase PgsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243306.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 gene pgsA CDS complement(17861..18310) product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227889.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 gene pgsC CDS complement(18338..19525) product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227883.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 gene pgsB CDS complement(19838..20974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(21060..21725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(21755..22906) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS 23069..24787 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008568.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS complement(24822..25229) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072501.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 25424..25729 product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678042.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 25775..26149 product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925285.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(26146..26886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 26995..27360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS complement(27400..28377) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949134.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS complement(28491..29690) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(30037..30378) product alkylphosphonate utilization operon protein PhnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212737.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene phnA CDS complement(30579..31226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(31403..31597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(31658..32290) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189288.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS complement(32402..35305) product collagenase ColA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036395.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene colA CDS complement(35310..35453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(35943..36272) product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963867.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(36467..37552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(37580..38308) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073543581.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(38485..39171) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(39171..40628) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(40898..43534) product calcium-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721406.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(43755..45470) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944619.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(45664..45957) product RNA polymerase alpha subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718625.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(45981..46481) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831493.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 46666..47028 product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632403.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(47097..48218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(48205..48888) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(48928..49521) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269085.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(49538..50275) product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990443.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 gene ccdA CDS complement(50272..50934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS complement(51103..52440) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228217.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(52686..53642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428935.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS complement(53728..54435) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346313.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(55381..55659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS 55987..56217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS 56354..57082 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 57088..58644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 58641..58772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(58833..60545) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010470.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(60542..61255) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283871.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 61455..62051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 62051..62977 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990678.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS complement(63216..65024) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334158.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 gene glmS CDS complement(65567..66913) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521476.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 gene glmM CDS complement(66942..68171) product CdaA regulatory protein CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234947.1 transl_table 11 codon_start 1 locus_tag LOCUS_36750 gene cdaR CDS complement(68171..68986) product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115700.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 gene cdaA CDS complement(69149..70045) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711572.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 gene rocF tRNA complement(70303..70378) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(70388..70462) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(70488..70560) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(70562..70636) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(70688..70771) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(70787..70862) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA complement(70868..70942) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA complement(70980..71052) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA complement(71065..71139) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 sequence07 source 1..57734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 83..193 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 420..881 product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244563.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 gene ctsR CDS 908..1450 product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128393.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 1453..2538 product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050842.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 2535..4970 product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene clpC CDS 5071..6447 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 gene radA CDS 6495..7568 product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 gene disA CDS 7755..8855 product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 8868..9545 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288284.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 gene ispD CDS 9554..10030 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene ispF CDS 10086..11534 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415140.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene gltX CDS 11921..12595 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene cysE CDS 12576..13976 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152276.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene cysS CDS 13961..14392 product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564262.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 14398..15141 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 gene rlmB CDS 15144..15653 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997886.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 15720..16370 product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS 16648..16830 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399676.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene secE CDS 17033..17566 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415794.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 gene nusG CDS 17744..18169 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene rplK CDS 18277..18966 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987630.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 gene rplA CDS 19203..19703 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene rplJ CDS 19764..20123 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159736.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene rplL CDS 20285..20884 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 21111..24644 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147554.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 gene rpoB CDS 24791..28393 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567939.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 gene rpoC CDS 28722..29144 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 gene rpsL CDS 29183..29653 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene rpsG CDS 29729..31810 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 gene fusA CDS 31931..33118 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029614.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene tuf CDS 33446..33754 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene rpsJ CDS 33787..34410 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160207.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 gene rplC CDS 34440..35063 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene rplD CDS 35063..35353 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205558.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene rplW CDS 35380..36210 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511580.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 gene rplB CDS 36268..36546 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene rpsS CDS 36564..36905 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 gene rplV CDS 36909..37565 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529956.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene rpsC CDS 37567..38001 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928969.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 gene rplP CDS 37991..38191 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene rpmC CDS 38214..38477 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 gene rpsQ CDS 38521..38889 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288669.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 gene rplN CDS 38928..39239 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene rplX CDS 39269..39808 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 gene rplE CDS 39842..40027 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene rpsN CDS 40058..40456 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 gene rpsH CDS 40487..41026 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene rplF CDS 41058..41420 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 gene rplR CDS 41442..41942 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene rpsE CDS 41962..42144 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 gene rpmD CDS 42178..42618 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766080.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 gene rplO CDS 42618..43913 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 gene secY CDS 43974..44627 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048992.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 44624..45370 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene map CDS 45449..45667 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene infA CDS 45842..46207 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235095.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 gene rpsM CDS 46231..46620 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 gene rpsK CDS 46776..47372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 47551..47913 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 gene rplQ CDS 48117..48959 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711757.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 48935..49810 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406513.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 49800..50594 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186532.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 50607..51362 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001995175.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene truA CDS 51522..51959 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 gene rplM CDS 51984..52376 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079986.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 gene rpsI CDS 52505..52951 product DUF2521 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101005.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 53016..53729 product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822436.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 gene cwlD CDS 53832..54890 product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256628.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(54931..55560) product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827295.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 gene gerD CDS 55701..56351 product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088527.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 gene kbaA CDS complement(56366..57130) product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464703.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 gene pdaB CDS 57290..57520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900295.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 sequence08 source 1..51109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..386 product sigma factor G inhibitor Gin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776278.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 517..1941 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 1959..2579 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene tmk CDS 2686..3123 product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 3136..4128 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169561.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 gene holB CDS 4133..4963 product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 4974..5339 product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412056.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 gene yabA CDS 5446..6186 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055366.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 6194..6466 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414342.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 6435..7301 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267808.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene rsmI CDS complement(7328..7609) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843036.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 7919..9916 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134147.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 gene metG CDS 10281..11048 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 11149..12315 product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226754.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS 12499..13059 product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene rnmV CDS 13056..13934 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene rsmA CDS 14092..14979 product sporulation peptidase YabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173738.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene yabG CDS 15098..15355 product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 15461..15646 product acid-soluble spore protein SspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985066.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene sspF CDS 15856..16725 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene ispE CDS 16780..17634 product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702475.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene purR CDS 17779..18021 product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966269.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene spoVG CDS 18209..19588 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene glmU CDS 19609..20562 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS 20613..20750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 20806..21369 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 gene pth CDS 21466..21696 product anti-sigma-F factor Fin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243417.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 gene fin CDS 21774..25307 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 gene mfd CDS 25510..26046 product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648302.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 gene spoVT CDS 26262..27845 product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444142.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 27876..29321 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 gene mazG CDS 29335..29595 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234876.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 29679..29984 product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059101.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene yabP CDS 29981..30580 product spore cortex biosynthesis protein YabQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene yabQ CDS 30596..30967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS 31055..31492 product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 tRNA 31728..31804 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 tRNA 31813..31884 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 CDS 32074..32196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS 32334..34802 product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 gene spoIIE CDS 34889..35626 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243782.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS 35592..36527 product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene prkT CDS 36597..38033 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655473.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 gene tilS CDS 38017..38556 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226700.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 gene hpt CDS 38634..40625 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene ftsH CDS 40720..41484 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 41502..42377 product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656372.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 gene hslO CDS 42529..43452 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261712.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene cysK CDS 43543..44940 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene pabB CDS 44937..45533 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene pabA CDS 45518..46390 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene pabC CDS 46392..47231 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene folP CDS 47224..47586 product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358063.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 gene folB CDS 47583..48080 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059449.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene folK CDS 48032..48256 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387031.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 48258..49259 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912251.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene dusB CDS 49405..50889 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369671.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene lysS sequence09 source 1..47149 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..389) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219727.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 gene csrA CDS complement(392..838) product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 gene fliW CDS complement(852..1427) product DUF6470 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243053.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(1487..2359) product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228004.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 gene flgL CDS complement(2370..3929) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228001.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene flgK CDS complement(3952..4443) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460798.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(4476..4748) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227997.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 gene flgM CDS complement(4763..5167) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(5230..5751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(5918..6865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS complement(7640..8482) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684725.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS complement(8954..9577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 note possible pseudo, internal stop codon, frameshifted CDS complement(9552..9872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 note possible pseudo, frameshifted CDS complement(9884..10282) product IS200/IS605-like element ISEfa4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287522.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 gene tnpA CDS complement(10666..11346) product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 gene degU CDS complement(11394..12527) product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 gene degS CDS 12925..13563 product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 13732..14994 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437416.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(15176..16240) product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 16526..17308 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597156.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 17416..18636 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649370.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS 18779..19462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS complement(19691..20428) product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724008.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 20796..22412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939120.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 22402..25146 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610098.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(25232..25711) product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080707.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(25772..26203) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 gene fabZ CDS complement(26257..26523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(26539..27357) product flagellar hook-basal body complex protein FlhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244381.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene flhP CDS complement(27404..28228) product flagellar hook-basal body complex protein FlhO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244097.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene flhO CDS complement(28507..29508) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(29682..29954) product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544012.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene spoIIID CDS complement(30174..30989) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214946.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(31173..32180) product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672623.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 gene spoIID CDS complement(32415..33725) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411274.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 gene murA CDS complement(33760..34476) product YwmB family TATA-box binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033689837.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(34537..34773) product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057889.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(34858..36363) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186264.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 gene nuoN CDS complement(36370..37866) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998901.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(37866..39728) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568230.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene nuoL CDS complement(39754..40068) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene nuoK CDS complement(40061..40576) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012801.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS complement(40573..40992) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677191.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene nuoI CDS complement(41069..42070) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 gene nuoH CDS complement(42070..43170) product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 gene nuoD CDS complement(43177..44547) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212088642.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(44544..45062) product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 gene nuoB CDS complement(45053..45418) product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 gene nuoA misc_feature complement(45592..>47149) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000680977.1:S-layer homology domain-containing protein locus_tag LOCUS_38520 sequence10 source 1..28198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 905..1300 product DUF2691 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820297.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 1306..2022 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846112.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(2064..2855) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771997.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(2860..4512) product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705542.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS 4924..5889 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 gene glcK CDS 5981..7633 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(7681..8016) product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000629070.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 8195..9103 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948245.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 9120..10265 product linearmycin resistance permease LnrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243650.1 transl_table 11 codon_start 1 locus_tag LOCUS_38620 gene lnrN CDS complement(10293..10679) product DUF1634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700872.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(10676..11512) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727947.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 11745..11939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(11980..12549) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733163.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 12704..13261 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 13429..14508 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 14586..15953 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610677.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 gene murF CDS 16023..16664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 17066..18667 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206592.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 18753..19715 product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961155.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 gene uvsE CDS 20408..20764 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene acpS CDS 20830..21840 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS 22069..23232 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390615.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 gene alr CDS 23366..23647 product antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004570.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 23652..24002 product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 gene ndoA CDS 24094..26262 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477896.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS 26501..26959 product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344247.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 tRNA 27074..27148 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 27156..27246 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 assembly_gap 27265..27311 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 27330..27404 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 27413..27488 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 tRNA 27508..27583 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 tRNA 27604..27678 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 tRNA 27710..27795 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 tRNA 27889..27965 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA 27971..28047 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA 28056..28129 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 sequence11 source 1..23127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 74..149 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 tRNA 154..229 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA 237..312 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA 332..406 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA 416..504 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA 514..590 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 tRNA 652..728 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 tRNA 741..816 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 tRNA 830..922 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 tRNA 965..1041 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA 1064..1156 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 assembly_gap 1178..1207 estimated_length known gap_type within scaffold linkage_evidence paired-ends tRNA 1248..1323 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 tRNA 1355..1438 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 tRNA 1449..1523 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA 1615..1688 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 tRNA 1695..1771 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 tRNA 1780..1854 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA 1859..1930 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 CDS 2210..2494 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 gene groES CDS 2602..4230 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene groL CDS 4485..5357 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948353.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS 5368..6474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS 6523..7782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS 7854..9161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS 9240..9887 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859738.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 gene pcp CDS 10200..11738 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene guaA CDS 11961..12140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(12593..12766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 12873..13118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174908.1 transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS 13276..13743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(13860..14726) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002302695.1 transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 15135..16835 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730661.1 transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 16925..17881 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860738.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS 17895..18821 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451077.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 18835..19812 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030783.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 CDS 19809..20774 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294513.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(20811..21191) product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624926.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 21634..22956 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833093.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 sequence12 source 1..18433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..1013) product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554292.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS 1129..2592 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264083.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 gene guaB CDS 2697..4028 product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053075.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene dacA CDS 4225..5109 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186165.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene pdxS CDS 5186..5761 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene pdxT CDS 6098..7372 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884181.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 gene serS tRNA 7474..7566 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00870 CDS 7706..8101 product DUF3797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364201.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 8319..8747 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167964.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS complement(8786..9454) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053585.1 transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(9451..10092) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148218.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(10222..10755) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798745.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(10862..11698) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212060.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(11717..12727) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260757.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS complement(12724..13779) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388278.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 14051..14521 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 gene tadA CDS 14999..16690 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121588.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 gene dnaX CDS 16714..17034 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225427.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 17046..17642 product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559169.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 gene recR CDS 17664..17882 product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466023.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 17955..18218 product sigma-K factor-processing regulator BofA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225421.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene bofA sequence13 source 1..11341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS complement(970..2403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(2804..4111) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218333.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(4108..6324) product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS 6718..6906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 6944..7138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 7347..7544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 7665..7787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(8005..8490) product DUF3967 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033679177.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 8683..9579 product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774874.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(9576..10475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774875.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 10591..10890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 10853..11248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 sequence14 source 1..5501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 397..1125 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745340.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 1122..1319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(1346..1981) product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437705.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(2419..3441) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 gene tsaD CDS complement(3438..3890) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 gene rimI CDS complement(3890..4594) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 gene tsaB CDS complement(4597..5007) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 gene tsaE sequence15 source 1..2736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(765..1130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS complement(1234..1908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 misc_feature complement(1915..>2736) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243665.1:tRNA nuclease WapA locus_tag LOCUS_39420 sequence16 source 1..1100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence17 source 1..928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 73..148 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00880 tRNA 153..228 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00890 tRNA 237..312 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00900 tRNA 328..411 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00910 tRNA 430..504 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00920 tRNA 514..602 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00930 tRNA 612..688 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00940 tRNA 700..776 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00950 tRNA 784..859 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00960 sequence18 source 1..835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence19 source 1..772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence20 source 1..527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@