>Feature sequence01 1970 285 gene locus_tag LOCUS_00010 1970 285 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_00010 3076 2177 gene locus_tag LOCUS_00020 gene dapA 3076 2177 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_00020 4119 3382 gene locus_tag LOCUS_00030 gene thyX 4119 3382 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_00030 4467 5015 gene locus_tag LOCUS_00040 4467 5015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030429.1 protein_id gnl|my_center|LOCUS_00040 5571 5113 gene locus_tag LOCUS_00050 5571 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 protein_id gnl|my_center|LOCUS_00050 6341 5577 gene locus_tag LOCUS_00060 gene dapB 6341 5577 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 protein_id gnl|my_center|LOCUS_00060 7765 6386 gene locus_tag LOCUS_00070 7765 6386 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_00070 9999 7762 gene locus_tag LOCUS_00080 9999 7762 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_00080 10705 10415 gene locus_tag LOCUS_00090 gene rpsO 10705 10415 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_00090 12384 10870 gene locus_tag LOCUS_00100 gene eccD 12384 10870 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270242.1 protein_id gnl|my_center|LOCUS_00100 12595 16575 gene locus_tag LOCUS_00110 12595 16575 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_00110 16655 17152 gene locus_tag LOCUS_00120 16655 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17175 19451 gene locus_tag LOCUS_00130 17175 19451 CDS product PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030421.1 protein_id gnl|my_center|LOCUS_00130 19573 20142 gene locus_tag LOCUS_00140 19573 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20552 20253 gene locus_tag LOCUS_00150 20552 20253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 21006 20644 gene locus_tag LOCUS_00160 21006 20644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22257 21088 gene locus_tag LOCUS_00170 gene mycP 22257 21088 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030423.1 protein_id gnl|my_center|LOCUS_00170 24083 22377 gene locus_tag LOCUS_00180 24083 22377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030424.1 protein_id gnl|my_center|LOCUS_00180 24531 24091 gene locus_tag LOCUS_00190 24531 24091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26105 24807 gene locus_tag LOCUS_00200 gene mycP 26105 24807 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_00200 27646 26120 gene locus_tag LOCUS_00210 gene eccB 27646 26120 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030413.1 protein_id gnl|my_center|LOCUS_00210 27828 29204 gene locus_tag LOCUS_00220 gene eccE 27828 29204 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487445.1 protein_id gnl|my_center|LOCUS_00220 29201 29899 gene locus_tag LOCUS_00230 29201 29899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030411.1 protein_id gnl|my_center|LOCUS_00230 30099 30332 gene locus_tag LOCUS_00240 30099 30332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30776 34153 gene locus_tag LOCUS_00250 30776 34153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 34643 36469 gene locus_tag LOCUS_00260 34643 36469 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030408.1 protein_id gnl|my_center|LOCUS_00260 36659 37735 gene locus_tag LOCUS_00270 36659 37735 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_00270 37732 38784 gene locus_tag LOCUS_00280 37732 38784 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973312.1 protein_id gnl|my_center|LOCUS_00280 38781 39887 gene locus_tag LOCUS_00290 38781 39887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030406.1 protein_id gnl|my_center|LOCUS_00290 40087 39812 gene locus_tag LOCUS_00300 40087 39812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40135 41148 gene locus_tag LOCUS_00310 40135 41148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030405.1 protein_id gnl|my_center|LOCUS_00310 42179 41226 gene locus_tag LOCUS_00320 42179 41226 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_00320 45876 42223 gene locus_tag LOCUS_00330 45876 42223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 47050 46115 gene locus_tag LOCUS_00340 gene truB 47050 46115 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_00340 47592 47047 gene locus_tag LOCUS_00350 gene rbfA 47592 47047 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_00350 48023 47670 gene locus_tag LOCUS_00360 48023 47670 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_00360 51305 48171 gene locus_tag LOCUS_00370 51305 48171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 53326 52274 gene locus_tag LOCUS_00380 gene nusA 53326 52274 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_00380 53826 53329 gene locus_tag LOCUS_00390 gene rimP 53826 53329 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_00390 53980 54609 gene locus_tag LOCUS_00400 53980 54609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 54606 55031 gene locus_tag LOCUS_00410 54606 55031 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_00410 55064 55960 gene locus_tag LOCUS_00420 55064 55960 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030398.1 protein_id gnl|my_center|LOCUS_00420 57811 56114 gene locus_tag LOCUS_00430 57811 56114 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973327.1 protein_id gnl|my_center|LOCUS_00430 58481 57906 gene locus_tag LOCUS_00440 58481 57906 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973328.1 protein_id gnl|my_center|LOCUS_00440 59342 58497 gene locus_tag LOCUS_00450 59342 58497 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_00450 60598 59567 gene locus_tag LOCUS_00460 gene ispG 60598 59567 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_00460 62246 60945 gene locus_tag LOCUS_00470 62246 60945 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_00470 63505 62243 gene locus_tag LOCUS_00480 gene dxr 63505 62243 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_00480 64436 63594 gene locus_tag LOCUS_00490 64436 63594 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029831.1 protein_id gnl|my_center|LOCUS_00490 64840 66036 gene locus_tag LOCUS_00500 64840 66036 CDS product glycoside hydrolase family 64 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223266.1 protein_id gnl|my_center|LOCUS_00500 68125 66164 gene locus_tag LOCUS_00510 68125 66164 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_00510 69914 68454 gene locus_tag LOCUS_00520 69914 68454 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_00520 71763 70186 gene locus_tag LOCUS_00530 71763 70186 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030383.1 protein_id gnl|my_center|LOCUS_00530 74165 71982 gene locus_tag LOCUS_00540 74165 71982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 74176 74442 gene locus_tag LOCUS_00550 74176 74442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 74674 76008 gene locus_tag LOCUS_00560 gene gabT 74674 76008 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_00560 76635 76384 gene locus_tag LOCUS_00570 76635 76384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 76576 77016 gene locus_tag LOCUS_00580 76576 77016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00580 78832 77042 gene locus_tag LOCUS_00590 78832 77042 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851194.1 protein_id gnl|my_center|LOCUS_00590 79664 79080 gene locus_tag LOCUS_00600 79664 79080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 81309 79894 gene locus_tag LOCUS_00610 81309 79894 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_00610 82129 81335 gene locus_tag LOCUS_00620 82129 81335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_00620 83064 82129 gene locus_tag LOCUS_00630 83064 82129 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_00630 84227 83061 gene locus_tag LOCUS_00640 84227 83061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_00640 85609 84362 gene locus_tag LOCUS_00650 85609 84362 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_00650 87168 85648 gene locus_tag LOCUS_00660 87168 85648 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_00660 87392 87982 gene locus_tag LOCUS_00670 87392 87982 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_00670 88804 88091 gene locus_tag LOCUS_00680 88804 88091 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973362.1 protein_id gnl|my_center|LOCUS_00680 88879 89991 gene locus_tag LOCUS_00690 88879 89991 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_00690 89988 90737 gene locus_tag LOCUS_00700 89988 90737 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973364.1 protein_id gnl|my_center|LOCUS_00700 92565 91117 gene locus_tag LOCUS_00710 92565 91117 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_00710 92741 93253 gene locus_tag LOCUS_00720 92741 93253 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_00720 93238 94617 gene locus_tag LOCUS_00730 93238 94617 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_00730 94933 95661 gene locus_tag LOCUS_00740 94933 95661 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973371.1 protein_id gnl|my_center|LOCUS_00740 95643 96800 gene locus_tag LOCUS_00750 95643 96800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 96853 98040 gene locus_tag LOCUS_00760 96853 98040 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284839.1 protein_id gnl|my_center|LOCUS_00760 99151 98072 gene locus_tag LOCUS_00770 99151 98072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_00770 100809 99151 gene locus_tag LOCUS_00780 100809 99151 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_00780 102023 100929 gene locus_tag LOCUS_00790 102023 100929 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_00790 103396 102284 gene locus_tag LOCUS_00800 gene rlmN 103396 102284 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_00800 104345 103572 gene locus_tag LOCUS_00810 104345 103572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 105199 104642 gene locus_tag LOCUS_00820 gene frr 105199 104642 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_00820 106108 105329 gene locus_tag LOCUS_00830 gene pyrH 106108 105329 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_00830 107167 106307 gene locus_tag LOCUS_00840 gene tsf 107167 106307 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_00840 108197 107253 gene locus_tag LOCUS_00850 gene rpsB 108197 107253 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_00850 109909 109349 gene locus_tag LOCUS_00860 109909 109349 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_00860 110831 109983 gene locus_tag LOCUS_00870 gene whiG 110831 109983 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_00870 112279 111080 gene locus_tag LOCUS_00880 gene dprA 112279 111080 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_00880 113904 112276 gene locus_tag LOCUS_00890 113904 112276 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_00890 114266 113904 gene locus_tag LOCUS_00900 114266 113904 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_00900 114890 114582 gene locus_tag LOCUS_00910 114890 114582 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 protein_id gnl|my_center|LOCUS_00910 115437 114946 gene locus_tag LOCUS_00920 115437 114946 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_00920 116197 115427 gene locus_tag LOCUS_00930 gene lepB 116197 115427 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030327.1 protein_id gnl|my_center|LOCUS_00930 117088 116258 gene locus_tag LOCUS_00940 117088 116258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 118193 117189 gene locus_tag LOCUS_00950 118193 117189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00950 118884 118186 gene locus_tag LOCUS_00960 118884 118186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 119370 119020 gene locus_tag LOCUS_00970 gene rplS 119370 119020 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_00970 120341 119502 gene locus_tag LOCUS_00980 gene trmD 120341 119502 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_00980 120964 120338 gene locus_tag LOCUS_00990 gene rimM 120964 120338 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_00990 121317 121078 gene locus_tag LOCUS_01000 121317 121078 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_01000 121763 121320 gene locus_tag LOCUS_01010 gene rpsP 121763 121320 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444852.1 protein_id gnl|my_center|LOCUS_01010 122696 122022 gene locus_tag LOCUS_01020 122696 122022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973403.1 protein_id gnl|my_center|LOCUS_01020 123367 124311 gene locus_tag LOCUS_01030 123367 124311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030324.1 protein_id gnl|my_center|LOCUS_01030 124545 125483 gene locus_tag LOCUS_01040 gene yhfZ 124545 125483 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254797.1 protein_id gnl|my_center|LOCUS_01040 125611 125997 gene locus_tag LOCUS_01050 125611 125997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 126011 126367 gene locus_tag LOCUS_01060 126011 126367 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816883.1 protein_id gnl|my_center|LOCUS_01060 126458 127882 gene locus_tag LOCUS_01070 126458 127882 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366832.1 protein_id gnl|my_center|LOCUS_01070 127942 128913 gene locus_tag LOCUS_01080 127942 128913 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815769.1 protein_id gnl|my_center|LOCUS_01080 128915 130018 gene locus_tag LOCUS_01090 128915 130018 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847164.1 protein_id gnl|my_center|LOCUS_01090 130021 131181 gene locus_tag LOCUS_01100 130021 131181 CDS product YhfX family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674095.1 protein_id gnl|my_center|LOCUS_01100 131195 132442 gene locus_tag LOCUS_01110 131195 132442 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090602.1 protein_id gnl|my_center|LOCUS_01110 134071 132524 gene locus_tag LOCUS_01120 gene ffh 134071 132524 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_01120 136704 134254 gene locus_tag LOCUS_01130 136704 134254 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_01130 137284 136946 gene locus_tag LOCUS_01140 137284 136946 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051565.1 protein_id gnl|my_center|LOCUS_01140 138513 137281 gene locus_tag LOCUS_01150 138513 137281 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 protein_id gnl|my_center|LOCUS_01150 140392 138917 gene locus_tag LOCUS_01160 140392 138917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_01160 140831 141490 gene locus_tag LOCUS_01170 140831 141490 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030317.1 protein_id gnl|my_center|LOCUS_01170 142933 141719 gene locus_tag LOCUS_01180 gene ftsY 142933 141719 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_01180 144443 143019 gene locus_tag LOCUS_01190 144443 143019 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 protein_id gnl|my_center|LOCUS_01190 148414 144566 gene locus_tag LOCUS_01200 148414 144566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 148812 148594 gene locus_tag LOCUS_01210 148812 148594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 149560 149279 gene locus_tag LOCUS_01220 149560 149279 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973419.1 protein_id gnl|my_center|LOCUS_01220 149880 150662 gene locus_tag LOCUS_01230 149880 150662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01230 151665 150790 gene locus_tag LOCUS_01240 gene mutM 151665 150790 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_01240 152719 151856 gene locus_tag LOCUS_01250 gene rnc 152719 151856 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_01250 152912 152739 gene locus_tag LOCUS_01260 gene rpmF 152912 152739 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_01260 153523 152915 gene locus_tag LOCUS_01270 153523 152915 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_01270 154919 153723 gene locus_tag LOCUS_01280 154919 153723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 155564 155055 gene locus_tag LOCUS_01290 gene coaD 155564 155055 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_01290 156142 155561 gene locus_tag LOCUS_01300 gene rsmD 156142 155561 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_01300 158530 156335 gene locus_tag LOCUS_01310 gene recG 158530 156335 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_01310 158972 158637 gene locus_tag LOCUS_01320 158972 158637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 160931 159102 gene locus_tag LOCUS_01330 160931 159102 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_01330 161082 161267 gene locus_tag LOCUS_01340 gene rpmB 161082 161267 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_01340 162262 161456 gene locus_tag LOCUS_01350 gene thiD 162262 161456 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_01350 162183 162365 gene locus_tag LOCUS_01360 162183 162365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 163318 162362 gene locus_tag LOCUS_01370 163318 162362 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_01370 163582 163815 gene locus_tag LOCUS_01380 163582 163815 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_01380 163836 164321 gene locus_tag LOCUS_01390 163836 164321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 165535 164378 gene locus_tag LOCUS_01400 165535 164378 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_01400 166571 165570 gene locus_tag LOCUS_01410 166571 165570 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_01410 167320 166568 gene locus_tag LOCUS_01420 167320 166568 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_01420 167577 168257 gene locus_tag LOCUS_01430 gene cofC 167577 168257 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_01430 168251 168475 gene locus_tag LOCUS_01440 168251 168475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030307.1 protein_id gnl|my_center|LOCUS_01440 169212 168556 gene locus_tag LOCUS_01450 169212 168556 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973439.1 protein_id gnl|my_center|LOCUS_01450 169582 169355 gene locus_tag LOCUS_01460 169582 169355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973440.1 protein_id gnl|my_center|LOCUS_01460 170295 169687 gene locus_tag LOCUS_01470 gene leuD 170295 169687 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_01470 171726 170302 gene locus_tag LOCUS_01480 gene leuC 171726 170302 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_01480 171908 172624 gene locus_tag LOCUS_01490 gene ndgR 171908 172624 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_01490 173239 172757 gene locus_tag LOCUS_01500 173239 172757 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030304.1 protein_id gnl|my_center|LOCUS_01500 174030 174083 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 174169 174096 gene locus_tag LOCUS_t00010 174169 174096 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 174260 174188 gene locus_tag LOCUS_t00020 174260 174188 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 174359 174286 gene locus_tag LOCUS_t00030 174359 174286 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 174493 174420 gene locus_tag LOCUS_t00040 174493 174420 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 174584 174512 gene locus_tag LOCUS_t00050 174584 174512 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 175397 174675 gene locus_tag LOCUS_01510 175397 174675 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030303.1 protein_id gnl|my_center|LOCUS_01510 175578 175904 gene locus_tag LOCUS_01520 175578 175904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 175901 176140 gene locus_tag LOCUS_01530 175901 176140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 177694 176219 gene locus_tag LOCUS_01540 gene gltX 177694 176219 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_01540 178487 177687 gene locus_tag LOCUS_01550 178487 177687 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_01550 178786 178610 gene locus_tag LOCUS_01560 178786 178610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327338.1 protein_id gnl|my_center|LOCUS_01560 179297 183289 gene locus_tag LOCUS_01570 179297 183289 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030302.1 protein_id gnl|my_center|LOCUS_01570 181619 181690 gene locus_tag LOCUS_t00060 181619 181690 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 183290 183712 gene locus_tag LOCUS_01580 183290 183712 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_01580 183822 184229 gene locus_tag LOCUS_01590 183822 184229 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_01590 184210 184791 gene locus_tag LOCUS_01600 184210 184791 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_01600 185314 188625 gene locus_tag LOCUS_01610 185314 188625 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030300.1 protein_id gnl|my_center|LOCUS_01610 188627 189049 gene locus_tag LOCUS_01620 188627 189049 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_01620 189501 189046 gene locus_tag LOCUS_01630 189501 189046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 189526 189840 gene locus_tag LOCUS_01640 189526 189840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 189821 190402 gene locus_tag LOCUS_01650 189821 190402 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_01650 190816 190604 gene locus_tag LOCUS_01660 190816 190604 CDS product acyl-CoA carboxylase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030299.1 protein_id gnl|my_center|LOCUS_01660 192480 190897 gene locus_tag LOCUS_01670 192480 190897 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_01670 192847 194073 gene locus_tag LOCUS_01680 192847 194073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 194266 194877 gene locus_tag LOCUS_01690 194266 194877 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_01690 196269 194920 gene locus_tag LOCUS_01700 196269 194920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_01700 198369 196492 gene locus_tag LOCUS_01710 198369 196492 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_01710 199936 198527 gene locus_tag LOCUS_01720 199936 198527 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230096.1 protein_id gnl|my_center|LOCUS_01720 201157 200042 gene locus_tag LOCUS_01730 201157 200042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230097.1 protein_id gnl|my_center|LOCUS_01730 202299 201154 gene locus_tag LOCUS_01740 202299 201154 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230098.1 protein_id gnl|my_center|LOCUS_01740 203283 202303 gene locus_tag LOCUS_01750 203283 202303 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_01750 204530 203280 gene locus_tag LOCUS_01760 204530 203280 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306915.1 protein_id gnl|my_center|LOCUS_01760 206213 204543 gene locus_tag LOCUS_01770 206213 204543 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_01770 207644 206571 gene locus_tag LOCUS_01780 207644 206571 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_01780 207967 209805 gene locus_tag LOCUS_01790 207967 209805 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_01790 211534 209927 gene locus_tag LOCUS_01800 gene cimA 211534 209927 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_01800 212512 211913 gene locus_tag LOCUS_01810 212512 211913 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973468.1 protein_id gnl|my_center|LOCUS_01810 213851 212748 gene locus_tag LOCUS_01820 213851 212748 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 protein_id gnl|my_center|LOCUS_01820 215120 214080 gene locus_tag LOCUS_01830 215120 214080 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_01830 215416 215288 gene locus_tag LOCUS_01840 215416 215288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030289.1 protein_id gnl|my_center|LOCUS_01840 215707 216045 gene locus_tag LOCUS_01850 215707 216045 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596149.1 protein_id gnl|my_center|LOCUS_01850 216145 216435 gene locus_tag LOCUS_01860 216145 216435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 217002 216457 gene locus_tag LOCUS_01870 gene aac(2')-Id 217002 216457 CDS product aminoglycoside N-acetyltransferase AAC(2')-Id inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726942.1 protein_id gnl|my_center|LOCUS_01870 217105 217680 gene locus_tag LOCUS_01880 217105 217680 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532373.1 protein_id gnl|my_center|LOCUS_01880 217677 218540 gene locus_tag LOCUS_01890 217677 218540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 218639 219973 gene locus_tag LOCUS_01900 218639 219973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 220040 220873 gene locus_tag LOCUS_01910 220040 220873 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031583.1 protein_id gnl|my_center|LOCUS_01910 222680 221049 gene locus_tag LOCUS_01920 gene pruA 222680 221049 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730329.1 protein_id gnl|my_center|LOCUS_01920 223662 222736 gene locus_tag LOCUS_01930 223662 222736 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973477.1 protein_id gnl|my_center|LOCUS_01930 223837 225039 gene locus_tag LOCUS_01940 223837 225039 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_01940 225513 225316 gene locus_tag LOCUS_01950 225513 225316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 225422 227056 gene locus_tag LOCUS_01960 225422 227056 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_01960 227150 228856 gene locus_tag LOCUS_01970 227150 228856 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 protein_id gnl|my_center|LOCUS_01970 230573 228969 gene locus_tag LOCUS_01980 gene serA 230573 228969 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_01980 232001 231000 gene locus_tag LOCUS_01990 gene ilvC 232001 231000 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 protein_id gnl|my_center|LOCUS_01990 232656 232129 gene locus_tag LOCUS_02000 gene ilvN 232656 232129 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_02000 234578 232692 gene locus_tag LOCUS_02010 234578 232692 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_02010 238037 234789 gene locus_tag LOCUS_02020 238037 234789 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030287.1 protein_id gnl|my_center|LOCUS_02020 239150 238212 gene locus_tag LOCUS_02030 239150 238212 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_02030 239362 240516 gene locus_tag LOCUS_02040 239362 240516 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_02040 240534 240695 gene locus_tag LOCUS_02050 240534 240695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 243770 240738 gene locus_tag LOCUS_02060 243770 240738 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_02060 244083 243910 gene locus_tag LOCUS_02070 244083 243910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 244989 244267 gene locus_tag LOCUS_02080 244989 244267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 245563 245000 gene locus_tag LOCUS_02090 245563 245000 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973495.1 protein_id gnl|my_center|LOCUS_02090 247866 245608 gene locus_tag LOCUS_02100 247866 245608 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_02100 250121 247995 gene locus_tag LOCUS_02110 250121 247995 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146849784.1 protein_id gnl|my_center|LOCUS_02110 250424 251041 gene locus_tag LOCUS_02120 250424 251041 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_02120 251583 251071 gene locus_tag LOCUS_02130 251583 251071 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400636.1 protein_id gnl|my_center|LOCUS_02130 252115 251651 gene locus_tag LOCUS_02140 252115 251651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 253359 252112 gene locus_tag LOCUS_02150 253359 252112 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_02150 255146 253629 gene locus_tag LOCUS_02160 gene gatB 255146 253629 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_02160 255414 255172 gene locus_tag LOCUS_02170 255414 255172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444751.1 protein_id gnl|my_center|LOCUS_02170 256916 255411 gene locus_tag LOCUS_02180 gene gatA 256916 255411 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_02180 257218 256922 gene locus_tag LOCUS_02190 gene gatC 257218 256922 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_02190 259493 257367 gene locus_tag LOCUS_02200 gene rmdB 259493 257367 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_02200 261992 259728 gene locus_tag LOCUS_02210 gene ligA 261992 259728 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_02210 263155 262061 gene locus_tag LOCUS_02220 263155 262061 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_02220 263841 263152 gene locus_tag LOCUS_02230 263841 263152 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870060.1 protein_id gnl|my_center|LOCUS_02230 264443 263904 gene locus_tag LOCUS_02240 264443 263904 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870058.1 protein_id gnl|my_center|LOCUS_02240 264559 264888 gene locus_tag LOCUS_02250 264559 264888 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973508.1 protein_id gnl|my_center|LOCUS_02250 264966 265784 gene locus_tag LOCUS_02260 264966 265784 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973509.1 protein_id gnl|my_center|LOCUS_02260 266846 265923 gene locus_tag LOCUS_02270 266846 265923 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226614.1 protein_id gnl|my_center|LOCUS_02270 269575 267032 gene locus_tag LOCUS_02280 269575 267032 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259698.1 protein_id gnl|my_center|LOCUS_02280 270895 269765 gene locus_tag LOCUS_02290 gene mnmA 270895 269765 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_02290 270980 271747 gene locus_tag LOCUS_02300 270980 271747 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973511.1 protein_id gnl|my_center|LOCUS_02300 273379 272216 gene locus_tag LOCUS_02310 273379 272216 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_02310 273571 274098 gene locus_tag LOCUS_02320 273571 274098 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_02320 274240 275001 gene locus_tag LOCUS_02330 274240 275001 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_02330 275917 275051 gene locus_tag LOCUS_02340 275917 275051 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_02340 276630 275956 gene locus_tag LOCUS_02350 276630 275956 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_02350 277751 276720 gene locus_tag LOCUS_02360 277751 276720 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230613.1 protein_id gnl|my_center|LOCUS_02360 278809 277772 gene locus_tag LOCUS_02370 278809 277772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230614.1 protein_id gnl|my_center|LOCUS_02370 279799 278816 gene locus_tag LOCUS_02380 279799 278816 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230615.1 protein_id gnl|my_center|LOCUS_02380 280805 279801 gene locus_tag LOCUS_02390 280805 279801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230616.1 protein_id gnl|my_center|LOCUS_02390 282533 280908 gene locus_tag LOCUS_02400 282533 280908 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230617.1 protein_id gnl|my_center|LOCUS_02400 284145 282868 gene locus_tag LOCUS_02410 284145 282868 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079021131.1 protein_id gnl|my_center|LOCUS_02410 285284 284142 gene locus_tag LOCUS_02420 285284 284142 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_02420 286270 285281 gene locus_tag LOCUS_02430 286270 285281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_02430 288159 286402 gene locus_tag LOCUS_02440 288159 286402 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_02440 289251 288253 gene locus_tag LOCUS_02450 289251 288253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_02450 290490 289696 gene locus_tag LOCUS_02460 290490 289696 CDS product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030271.1 protein_id gnl|my_center|LOCUS_02460 291372 290623 gene locus_tag LOCUS_02470 291372 290623 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973524.1 protein_id gnl|my_center|LOCUS_02470 292191 291517 gene locus_tag LOCUS_02480 292191 291517 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030270.1 protein_id gnl|my_center|LOCUS_02480 292653 293816 gene locus_tag LOCUS_02490 gene gcvT 292653 293816 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_02490 293929 294306 gene locus_tag LOCUS_02500 gene gcvH 293929 294306 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_02500 294323 295591 gene locus_tag LOCUS_02510 294323 295591 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_02510 295760 297142 gene locus_tag LOCUS_02520 295760 297142 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_02520 297197 297517 gene locus_tag LOCUS_02530 297197 297517 CDS product DUF3140 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972181.1 protein_id gnl|my_center|LOCUS_02530 297883 297530 gene locus_tag LOCUS_02540 297883 297530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 299649 297880 gene locus_tag LOCUS_02550 gene ctaD 299649 297880 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_02550 301150 299897 gene locus_tag LOCUS_02560 301150 299897 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_02560 302527 301187 gene locus_tag LOCUS_02570 302527 301187 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027221.1 protein_id gnl|my_center|LOCUS_02570 303129 302524 gene locus_tag LOCUS_02580 303129 302524 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 protein_id gnl|my_center|LOCUS_02580 303475 303107 gene locus_tag LOCUS_02590 303475 303107 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 protein_id gnl|my_center|LOCUS_02590 303879 303472 gene locus_tag LOCUS_02600 303879 303472 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971678.1 protein_id gnl|my_center|LOCUS_02600 305558 303882 gene locus_tag LOCUS_02610 305558 303882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 306219 305818 gene locus_tag LOCUS_02620 306219 305818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 307276 306413 gene locus_tag LOCUS_02630 307276 306413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 307565 307350 gene locus_tag LOCUS_02640 307565 307350 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973534.1 protein_id gnl|my_center|LOCUS_02640 308192 307683 gene locus_tag LOCUS_02650 308192 307683 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079178808.1 protein_id gnl|my_center|LOCUS_02650 309225 308455 gene locus_tag LOCUS_02660 309225 308455 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_02660 310579 309335 gene locus_tag LOCUS_02670 310579 309335 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486965.1 protein_id gnl|my_center|LOCUS_02670 312007 310817 gene locus_tag LOCUS_02680 312007 310817 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030260.1 protein_id gnl|my_center|LOCUS_02680 312219 314519 gene locus_tag LOCUS_02690 gene glgX 312219 314519 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_02690 315219 314581 gene locus_tag LOCUS_02700 315219 314581 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 protein_id gnl|my_center|LOCUS_02700 316504 315182 gene locus_tag LOCUS_02710 316504 315182 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870027.1 protein_id gnl|my_center|LOCUS_02710 317345 316602 gene locus_tag LOCUS_02720 317345 316602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973545.1 protein_id gnl|my_center|LOCUS_02720 318309 317347 gene locus_tag LOCUS_02730 318309 317347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_02730 318445 320310 gene locus_tag LOCUS_02740 318445 320310 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_02740 320307 322256 gene locus_tag LOCUS_02750 320307 322256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_02750 323228 322314 gene locus_tag LOCUS_02760 323228 322314 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031174.1 protein_id gnl|my_center|LOCUS_02760 323328 324323 gene locus_tag LOCUS_02770 323328 324323 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 protein_id gnl|my_center|LOCUS_02770 325599 324268 gene locus_tag LOCUS_02780 325599 324268 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_02780 326160 328175 gene locus_tag LOCUS_02790 326160 328175 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973551.1 protein_id gnl|my_center|LOCUS_02790 329222 328578 gene locus_tag LOCUS_02800 329222 328578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486010.1 protein_id gnl|my_center|LOCUS_02800 329433 330914 gene locus_tag LOCUS_02810 329433 330914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 332203 330965 gene locus_tag LOCUS_02820 332203 330965 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031686.1 protein_id gnl|my_center|LOCUS_02820 335002 332402 gene locus_tag LOCUS_02830 335002 332402 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_02830 336807 335521 gene locus_tag LOCUS_02840 336807 335521 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_02840 338036 336804 gene locus_tag LOCUS_02850 338036 336804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 339679 338231 gene locus_tag LOCUS_02860 339679 338231 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524102.1 protein_id gnl|my_center|LOCUS_02860 341631 340156 gene locus_tag LOCUS_02870 341631 340156 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187705.1 protein_id gnl|my_center|LOCUS_02870 342794 341829 gene locus_tag LOCUS_02880 342794 341829 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170228.1 protein_id gnl|my_center|LOCUS_02880 342914 343831 gene locus_tag LOCUS_02890 342914 343831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 344235 346220 gene locus_tag LOCUS_02900 344235 346220 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030248.1 protein_id gnl|my_center|LOCUS_02900 346220 347944 gene locus_tag LOCUS_02910 gene treS 346220 347944 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_02910 348169 349656 gene locus_tag LOCUS_02920 348169 349656 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 protein_id gnl|my_center|LOCUS_02920 349755 352292 gene locus_tag LOCUS_02930 gene glgB 349755 352292 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486244.1 protein_id gnl|my_center|LOCUS_02930 352956 352201 gene locus_tag LOCUS_02940 352956 352201 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031905.1 protein_id gnl|my_center|LOCUS_02940 355472 353298 gene locus_tag LOCUS_02950 355472 353298 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973559.1 protein_id gnl|my_center|LOCUS_02950 355440 355601 gene locus_tag LOCUS_02960 355440 355601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 356100 355768 gene locus_tag LOCUS_02970 356100 355768 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973560.1 protein_id gnl|my_center|LOCUS_02970 356522 356097 gene locus_tag LOCUS_02980 356522 356097 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_02980 357479 356679 gene locus_tag LOCUS_02990 357479 356679 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_02990 357588 357935 gene locus_tag LOCUS_03000 357588 357935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 358089 359576 gene locus_tag LOCUS_03010 358089 359576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 360798 359641 gene locus_tag LOCUS_03020 360798 359641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 363050 360795 gene locus_tag LOCUS_03030 363050 360795 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225572.1 protein_id gnl|my_center|LOCUS_03030 364039 363047 gene locus_tag LOCUS_03040 364039 363047 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267645.1 protein_id gnl|my_center|LOCUS_03040 364538 364041 gene locus_tag LOCUS_03050 364538 364041 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_03050 366230 364812 gene locus_tag LOCUS_03060 366230 364812 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_03060 366366 368060 gene locus_tag LOCUS_03070 366366 368060 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 protein_id gnl|my_center|LOCUS_03070 368057 368761 gene locus_tag LOCUS_03080 368057 368761 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_03080 368861 369757 gene locus_tag LOCUS_03090 368861 369757 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973953.1 protein_id gnl|my_center|LOCUS_03090 369837 371195 gene locus_tag LOCUS_03100 369837 371195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_03100 371242 372192 gene locus_tag LOCUS_03110 371242 372192 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_03110 372192 373016 gene locus_tag LOCUS_03120 372192 373016 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973570.1 protein_id gnl|my_center|LOCUS_03120 373176 374408 gene locus_tag LOCUS_03130 373176 374408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 375761 374736 gene locus_tag LOCUS_03140 375761 374736 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973572.1 protein_id gnl|my_center|LOCUS_03140 376000 378060 gene locus_tag LOCUS_03150 gene pta 376000 378060 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 protein_id gnl|my_center|LOCUS_03150 378116 379327 gene locus_tag LOCUS_03160 378116 379327 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_03160 379402 380838 gene locus_tag LOCUS_03170 gene pyk 379402 380838 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 protein_id gnl|my_center|LOCUS_03170 382241 380937 gene locus_tag LOCUS_03180 382241 380937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283916.1 protein_id gnl|my_center|LOCUS_03180 382845 382231 gene locus_tag LOCUS_03190 382845 382231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 383593 382964 gene locus_tag LOCUS_03200 383593 382964 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_03200 385156 384203 gene locus_tag LOCUS_03210 385156 384203 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_03210 385530 386171 gene locus_tag LOCUS_03220 385530 386171 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030233.1 protein_id gnl|my_center|LOCUS_03220 386260 386739 gene locus_tag LOCUS_03230 386260 386739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 388507 386789 gene locus_tag LOCUS_03240 388507 386789 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_03240 388923 388591 gene locus_tag LOCUS_03250 388923 388591 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_03250 389500 388991 gene locus_tag LOCUS_03260 389500 388991 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_03260 389677 390708 gene locus_tag LOCUS_03270 389677 390708 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_03270 392688 390724 gene locus_tag LOCUS_03280 392688 390724 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_03280 394455 392692 gene locus_tag LOCUS_03290 394455 392692 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_03290 394988 394695 gene locus_tag LOCUS_03300 394988 394695 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_03300 395329 394985 gene locus_tag LOCUS_03310 395329 394985 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030226.1 protein_id gnl|my_center|LOCUS_03310 395546 396154 gene locus_tag LOCUS_03320 395546 396154 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_03320 396181 396804 gene locus_tag LOCUS_03330 396181 396804 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_03330 396801 397580 gene locus_tag LOCUS_03340 396801 397580 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_03340 397686 398162 gene locus_tag LOCUS_03350 397686 398162 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_03350 399704 398112 gene locus_tag LOCUS_03360 399704 398112 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_03360 400363 399701 gene locus_tag LOCUS_03370 400363 399701 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973594.1 protein_id gnl|my_center|LOCUS_03370 400478 401323 gene locus_tag LOCUS_03380 400478 401323 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030224.1 protein_id gnl|my_center|LOCUS_03380 402428 401469 gene locus_tag LOCUS_03390 gene meaB 402428 401469 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_03390 403714 402512 gene locus_tag LOCUS_03400 403714 402512 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_03400 403850 404293 gene locus_tag LOCUS_03410 gene mce 403850 404293 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_03410 404454 408194 gene locus_tag LOCUS_03420 gene scy 404454 408194 CDS product polarized growth protein Scy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030220.1 protein_id gnl|my_center|LOCUS_03420 408309 409247 gene locus_tag LOCUS_03430 408309 409247 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_03430 409477 409244 gene locus_tag LOCUS_03440 409477 409244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 409421 410407 gene locus_tag LOCUS_03450 409421 410407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_03450 410411 411190 gene locus_tag LOCUS_03460 410411 411190 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_03460 411332 412615 gene locus_tag LOCUS_03470 411332 412615 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030218.1 protein_id gnl|my_center|LOCUS_03470 412612 413457 gene locus_tag LOCUS_03480 412612 413457 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973604.1 protein_id gnl|my_center|LOCUS_03480 413854 413525 gene locus_tag LOCUS_03490 413854 413525 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973605.1 protein_id gnl|my_center|LOCUS_03490 414065 415090 gene locus_tag LOCUS_03500 414065 415090 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_03500 415561 415169 gene locus_tag LOCUS_03510 415561 415169 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_03510 415775 416446 gene locus_tag LOCUS_03520 gene nucS 415775 416446 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_03520 417092 416490 gene locus_tag LOCUS_03530 417092 416490 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031857.1 protein_id gnl|my_center|LOCUS_03530 417154 417576 gene locus_tag LOCUS_03540 417154 417576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 420149 417594 gene locus_tag LOCUS_03550 420149 417594 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030216.1 protein_id gnl|my_center|LOCUS_03550 420721 420398 gene locus_tag LOCUS_03560 420721 420398 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 protein_id gnl|my_center|LOCUS_03560 421752 420904 gene locus_tag LOCUS_03570 421752 420904 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_03570 422558 421920 gene locus_tag LOCUS_03580 422558 421920 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_03580 422671 423453 gene locus_tag LOCUS_03590 422671 423453 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973614.1 protein_id gnl|my_center|LOCUS_03590 423466 424233 gene locus_tag LOCUS_03600 423466 424233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_03600 424278 424850 gene locus_tag LOCUS_03610 424278 424850 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_03610 425451 424870 gene locus_tag LOCUS_03620 425451 424870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_03620 425540 426802 gene locus_tag LOCUS_03630 425540 426802 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_03630 426799 427449 gene locus_tag LOCUS_03640 426799 427449 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_03640 427847 427512 gene locus_tag LOCUS_03650 427847 427512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 427729 429504 gene locus_tag LOCUS_03660 427729 429504 CDS product glycoside hydrolase family 18 chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030211.1 protein_id gnl|my_center|LOCUS_03660 430070 429624 gene locus_tag LOCUS_03670 430070 429624 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_03670 430578 430204 gene locus_tag LOCUS_03680 430578 430204 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_03680 432157 430703 gene locus_tag LOCUS_03690 gene atpD 432157 430703 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_03690 433095 432157 gene locus_tag LOCUS_03700 433095 432157 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_03700 434714 433116 gene locus_tag LOCUS_03710 gene atpA 434714 433116 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_03710 435688 434873 gene locus_tag LOCUS_03720 435688 434873 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_03720 436239 435685 gene locus_tag LOCUS_03730 436239 435685 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_03730 436507 436283 gene locus_tag LOCUS_03740 gene atpE 436507 436283 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_03740 437406 436585 gene locus_tag LOCUS_03750 gene atpB 437406 436585 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_03750 438051 437638 gene locus_tag LOCUS_03760 438051 437638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973631.1 protein_id gnl|my_center|LOCUS_03760 439771 438317 gene locus_tag LOCUS_03770 439771 438317 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_03770 440599 439958 gene locus_tag LOCUS_03780 440599 439958 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_03780 441243 440596 gene locus_tag LOCUS_03790 441243 440596 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_03790 442235 441330 gene locus_tag LOCUS_03800 gene prmC 442235 441330 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_03800 443390 442299 gene locus_tag LOCUS_03810 gene prfA 443390 442299 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_03810 443731 443504 gene locus_tag LOCUS_03820 gene rpmE 443731 443504 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_03820 445013 443910 gene locus_tag LOCUS_03830 445013 443910 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 protein_id gnl|my_center|LOCUS_03830 446909 445221 gene locus_tag LOCUS_03840 446909 445221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 449204 447105 gene locus_tag LOCUS_03850 449204 447105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 450517 449597 gene locus_tag LOCUS_03860 gene thrB 450517 449597 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_03860 451923 450817 gene locus_tag LOCUS_03870 gene thrC 451923 450817 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_03870 453241 451931 gene locus_tag LOCUS_03880 453241 451931 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_03880 454741 453350 gene locus_tag LOCUS_03890 gene lysA 454741 453350 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_03890 455797 454793 gene locus_tag LOCUS_03900 455797 454793 CDS product DALR anticodon-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030201.1 protein_id gnl|my_center|LOCUS_03900 456393 455968 gene locus_tag LOCUS_03910 456393 455968 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030200.1 protein_id gnl|my_center|LOCUS_03910 456588 456661 gene locus_tag LOCUS_t00070 456588 456661 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 457930 457673 gene locus_tag LOCUS_03920 457930 457673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 457814 460198 gene locus_tag LOCUS_03930 457814 460198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03930 460195 460605 gene locus_tag LOCUS_03940 460195 460605 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223333.1 protein_id gnl|my_center|LOCUS_03940 460706 461911 gene locus_tag LOCUS_03950 460706 461911 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172709.1 protein_id gnl|my_center|LOCUS_03950 461913 464003 gene locus_tag LOCUS_03960 461913 464003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 464000 464848 gene locus_tag LOCUS_03970 464000 464848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_03970 464861 465598 gene locus_tag LOCUS_03980 464861 465598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_03980 466908 465691 gene locus_tag LOCUS_03990 466908 465691 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_03990 469971 467350 gene locus_tag LOCUS_04000 469971 467350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 470217 470741 gene locus_tag LOCUS_04010 470217 470741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 471968 470925 gene locus_tag LOCUS_04020 471968 470925 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872665.1 protein_id gnl|my_center|LOCUS_04020 472009 472893 gene locus_tag LOCUS_04030 gene ligD 472009 472893 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973663.1 protein_id gnl|my_center|LOCUS_04030 472966 473352 gene locus_tag LOCUS_04040 472966 473352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 473506 474084 gene locus_tag LOCUS_04050 473506 474084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 474196 475626 gene locus_tag LOCUS_04060 474196 475626 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283896.1 protein_id gnl|my_center|LOCUS_04060 475623 477080 gene locus_tag LOCUS_04070 475623 477080 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973670.1 protein_id gnl|my_center|LOCUS_04070 477086 478195 gene locus_tag LOCUS_04080 477086 478195 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728740.1 protein_id gnl|my_center|LOCUS_04080 478192 478761 gene locus_tag LOCUS_04090 478192 478761 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030162.1 protein_id gnl|my_center|LOCUS_04090 478975 479982 gene locus_tag LOCUS_04100 478975 479982 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030161.1 protein_id gnl|my_center|LOCUS_04100 480528 480025 gene locus_tag LOCUS_04110 480528 480025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 480454 481059 gene locus_tag LOCUS_04120 480454 481059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 481260 483872 gene locus_tag LOCUS_04130 481260 483872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 484042 485346 gene locus_tag LOCUS_04140 484042 485346 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031385.1 protein_id gnl|my_center|LOCUS_04140 486607 485363 gene locus_tag LOCUS_04150 486607 485363 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973676.1 protein_id gnl|my_center|LOCUS_04150 487292 486651 gene locus_tag LOCUS_04160 487292 486651 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973677.1 protein_id gnl|my_center|LOCUS_04160 487731 487273 gene locus_tag LOCUS_04170 487731 487273 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973678.1 protein_id gnl|my_center|LOCUS_04170 488210 487728 gene locus_tag LOCUS_04180 488210 487728 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327267.1 protein_id gnl|my_center|LOCUS_04180 491083 488207 gene locus_tag LOCUS_04190 491083 488207 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486303.1 protein_id gnl|my_center|LOCUS_04190 491554 492339 gene locus_tag LOCUS_04200 491554 492339 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 protein_id gnl|my_center|LOCUS_04200 492936 492433 gene locus_tag LOCUS_04210 492936 492433 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_04210 495646 493232 gene locus_tag LOCUS_04220 gene lon 495646 493232 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_04220 495818 496465 gene locus_tag LOCUS_04230 495818 496465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 protein_id gnl|my_center|LOCUS_04230 496610 497365 gene locus_tag LOCUS_04240 496610 497365 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_04240 497475 498212 gene locus_tag LOCUS_04250 497475 498212 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_04250 498497 499519 gene locus_tag LOCUS_04260 498497 499519 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973687.1 protein_id gnl|my_center|LOCUS_04260 499832 503701 gene locus_tag LOCUS_04270 499832 503701 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_04270 506808 503785 gene locus_tag LOCUS_04280 gene fxsT 506808 503785 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030145.1 protein_id gnl|my_center|LOCUS_04280 508157 506865 gene locus_tag LOCUS_04290 508157 506865 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189809250.1 protein_id gnl|my_center|LOCUS_04290 508401 508210 gene locus_tag LOCUS_04300 508401 508210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 511875 508777 gene locus_tag LOCUS_04310 511875 508777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 512932 511880 gene locus_tag LOCUS_04320 512932 511880 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030141.1 protein_id gnl|my_center|LOCUS_04320 515087 513045 gene locus_tag LOCUS_04330 515087 513045 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030140.1 protein_id gnl|my_center|LOCUS_04330 515802 515242 gene locus_tag LOCUS_04340 515802 515242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 515881 516060 gene locus_tag LOCUS_04350 515881 516060 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_04350 516209 517165 gene locus_tag LOCUS_04360 516209 517165 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_04360 517167 518132 gene locus_tag LOCUS_04370 517167 518132 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973705.1 protein_id gnl|my_center|LOCUS_04370 518268 518825 gene locus_tag LOCUS_04380 518268 518825 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_04380 518949 519533 gene locus_tag LOCUS_04390 518949 519533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 519530 521086 gene locus_tag LOCUS_04400 519530 521086 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140493.1 protein_id gnl|my_center|LOCUS_04400 521130 522176 gene locus_tag LOCUS_04410 521130 522176 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_04410 522185 522538 gene locus_tag LOCUS_04420 522185 522538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 522570 522779 gene locus_tag LOCUS_04430 522570 522779 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_04430 522779 523330 gene locus_tag LOCUS_04440 522779 523330 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030137.1 protein_id gnl|my_center|LOCUS_04440 525089 523836 gene locus_tag LOCUS_04450 525089 523836 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_04450 525616 526578 gene locus_tag LOCUS_04460 525616 526578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 protein_id gnl|my_center|LOCUS_04460 526607 527554 gene locus_tag LOCUS_04470 526607 527554 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973711.1 protein_id gnl|my_center|LOCUS_04470 527551 528357 gene locus_tag LOCUS_04480 527551 528357 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_04480 529252 528440 gene locus_tag LOCUS_04490 529252 528440 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030136.1 protein_id gnl|my_center|LOCUS_04490 529333 529962 gene locus_tag LOCUS_04500 529333 529962 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_04500 530285 529866 gene locus_tag LOCUS_04510 gene sodX 530285 529866 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868025.1 protein_id gnl|my_center|LOCUS_04510 530437 530832 gene locus_tag LOCUS_04520 gene sodN 530437 530832 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_04520 531283 530840 gene locus_tag LOCUS_04530 531283 530840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 532012 531320 gene locus_tag LOCUS_04540 532012 531320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 532925 532014 gene locus_tag LOCUS_04550 532925 532014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 533753 533004 gene locus_tag LOCUS_04560 533753 533004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 533974 535329 gene locus_tag LOCUS_04570 533974 535329 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199314899.1 protein_id gnl|my_center|LOCUS_04570 535331 535861 gene locus_tag LOCUS_04580 535331 535861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 536408 535971 gene locus_tag LOCUS_04590 536408 535971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 537019 536405 gene locus_tag LOCUS_04600 537019 536405 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_04600 537714 537016 gene locus_tag LOCUS_04610 537714 537016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 539078 538245 gene locus_tag LOCUS_04620 539078 538245 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_04620 540016 539075 gene locus_tag LOCUS_04630 540016 539075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_04630 540148 541467 gene locus_tag LOCUS_04640 540148 541467 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950377.1 protein_id gnl|my_center|LOCUS_04640 541464 542162 gene locus_tag LOCUS_04650 541464 542162 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 protein_id gnl|my_center|LOCUS_04650 543260 542304 gene locus_tag LOCUS_04660 543260 542304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 543685 543257 gene locus_tag LOCUS_04670 543685 543257 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210369.1 protein_id gnl|my_center|LOCUS_04670 544675 543713 gene locus_tag LOCUS_04680 544675 543713 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030296.1 protein_id gnl|my_center|LOCUS_04680 544754 545425 gene locus_tag LOCUS_04690 544754 545425 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973464.1 protein_id gnl|my_center|LOCUS_04690 547731 545392 gene locus_tag LOCUS_04700 547731 545392 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742195.1 protein_id gnl|my_center|LOCUS_04700 548138 547869 gene locus_tag LOCUS_04710 548138 547869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230005.1 protein_id gnl|my_center|LOCUS_04710 548485 548135 gene locus_tag LOCUS_04720 548485 548135 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230004.1 protein_id gnl|my_center|LOCUS_04720 549685 548621 gene locus_tag LOCUS_04730 549685 548621 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031660.1 protein_id gnl|my_center|LOCUS_04730 549889 550545 gene locus_tag LOCUS_04740 gene snpA 549889 550545 CDS product snapalysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971712.1 protein_id gnl|my_center|LOCUS_04740 550603 550627 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 551299 550859 gene locus_tag LOCUS_04750 551299 550859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 551977 551399 gene locus_tag LOCUS_04760 551977 551399 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_04760 553176 552136 gene locus_tag LOCUS_04770 553176 552136 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973720.1 protein_id gnl|my_center|LOCUS_04770 554720 553314 gene locus_tag LOCUS_04780 554720 553314 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973721.1 protein_id gnl|my_center|LOCUS_04780 554893 555567 gene locus_tag LOCUS_04790 554893 555567 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030135.1 protein_id gnl|my_center|LOCUS_04790 555642 556640 gene locus_tag LOCUS_04800 555642 556640 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_04800 558382 556619 gene locus_tag LOCUS_04810 558382 556619 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_04810 558764 559177 gene locus_tag LOCUS_04820 558764 559177 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_04820 559195 560148 gene locus_tag LOCUS_04830 559195 560148 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270193.1 protein_id gnl|my_center|LOCUS_04830 560550 560245 gene locus_tag LOCUS_04840 560550 560245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 560776 561744 gene locus_tag LOCUS_04850 560776 561744 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_04850 562062 562319 gene locus_tag LOCUS_04860 562062 562319 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_04860 564097 562550 gene locus_tag LOCUS_04870 564097 562550 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_04870 565449 564361 gene locus_tag LOCUS_04880 565449 564361 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092074.1 protein_id gnl|my_center|LOCUS_04880 565630 566412 gene locus_tag LOCUS_04890 gene nagB 565630 566412 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_04890 568069 566543 gene locus_tag LOCUS_04900 568069 566543 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_04900 568978 568076 gene locus_tag LOCUS_04910 568978 568076 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225176.1 protein_id gnl|my_center|LOCUS_04910 569994 568975 gene locus_tag LOCUS_04920 569994 568975 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978331.1 protein_id gnl|my_center|LOCUS_04920 571497 570196 gene locus_tag LOCUS_04930 571497 570196 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226207.1 protein_id gnl|my_center|LOCUS_04930 571778 572542 gene locus_tag LOCUS_04940 571778 572542 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_04940 572779 574974 gene locus_tag LOCUS_04950 572779 574974 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084321.1 protein_id gnl|my_center|LOCUS_04950 574971 575177 gene locus_tag LOCUS_04960 574971 575177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 575290 575817 gene locus_tag LOCUS_04970 575290 575817 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030124.1 protein_id gnl|my_center|LOCUS_04970 576175 578559 gene locus_tag LOCUS_04980 576175 578559 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_04980 578559 579578 gene locus_tag LOCUS_04990 578559 579578 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_04990 579638 580183 gene locus_tag LOCUS_05000 579638 580183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 580207 580398 gene locus_tag LOCUS_05010 580207 580398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 580487 580927 gene locus_tag LOCUS_05020 580487 580927 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027121.1 protein_id gnl|my_center|LOCUS_05020 581085 582047 gene locus_tag LOCUS_05030 581085 582047 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030121.1 protein_id gnl|my_center|LOCUS_05030 582817 582083 gene locus_tag LOCUS_05040 582817 582083 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091388998.1 protein_id gnl|my_center|LOCUS_05040 583754 583059 gene locus_tag LOCUS_05050 gene def 583754 583059 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973751.1 protein_id gnl|my_center|LOCUS_05050 584979 583933 gene locus_tag LOCUS_05060 584979 583933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 protein_id gnl|my_center|LOCUS_05060 586349 585042 gene locus_tag LOCUS_05070 586349 585042 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_05070 587899 586346 gene locus_tag LOCUS_05080 587899 586346 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_05080 588450 588130 gene locus_tag LOCUS_05090 gene rsrA 588450 588130 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_05090 589292 588447 gene locus_tag LOCUS_05100 gene sigR 589292 588447 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_05100 590070 589384 gene locus_tag LOCUS_05110 590070 589384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_05110 591038 590223 gene locus_tag LOCUS_05120 591038 590223 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_05120 591749 591234 gene locus_tag LOCUS_05130 591749 591234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 592098 592835 gene locus_tag LOCUS_05140 592098 592835 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_05140 592955 594331 gene locus_tag LOCUS_05150 gene aroA 592955 594331 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_05150 594336 595346 gene locus_tag LOCUS_05160 gene rsgA 594336 595346 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_05160 595401 595796 gene locus_tag LOCUS_05170 595401 595796 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973762.1 protein_id gnl|my_center|LOCUS_05170 596679 595759 gene locus_tag LOCUS_05180 596679 595759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 596848 596663 gene locus_tag LOCUS_05190 596848 596663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 596813 597613 gene locus_tag LOCUS_05200 gene hisN 596813 597613 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_05200 597940 598341 gene locus_tag LOCUS_05210 597940 598341 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_05210 599892 598423 gene locus_tag LOCUS_05220 599892 598423 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_05220 600020 600436 gene locus_tag LOCUS_05230 600020 600436 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_05230 600599 600525 gene locus_tag LOCUS_t00080 600599 600525 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 602697 600712 gene locus_tag LOCUS_05240 602697 600712 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 protein_id gnl|my_center|LOCUS_05240 603008 602934 gene locus_tag LOCUS_t00090 603008 602934 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 605849 603051 gene locus_tag LOCUS_05250 605849 603051 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_05250 605785 606012 gene locus_tag LOCUS_05260 605785 606012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 606120 606725 gene locus_tag LOCUS_05270 606120 606725 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05270 607898 606807 gene locus_tag LOCUS_05280 607898 606807 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_05280 608212 608039 gene locus_tag LOCUS_05290 608212 608039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 608893 608402 gene locus_tag LOCUS_05300 608893 608402 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_05300 610024 608984 gene locus_tag LOCUS_05310 610024 608984 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_05310 610287 611798 gene locus_tag LOCUS_05320 610287 611798 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_05320 611795 612346 gene locus_tag LOCUS_05330 611795 612346 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_05330 613191 612427 gene locus_tag LOCUS_05340 613191 612427 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030111.1 protein_id gnl|my_center|LOCUS_05340 613887 613207 gene locus_tag LOCUS_05350 613887 613207 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973780.1 protein_id gnl|my_center|LOCUS_05350 615556 613901 gene locus_tag LOCUS_05360 615556 613901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05360 616221 615670 gene locus_tag LOCUS_05370 616221 615670 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_05370 616481 617764 gene locus_tag LOCUS_05380 616481 617764 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_05380 617806 619179 gene locus_tag LOCUS_05390 617806 619179 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence02 963 133 gene locus_tag LOCUS_05400 963 133 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743809.1 protein_id gnl|my_center|LOCUS_05400 1544 960 gene locus_tag LOCUS_05410 1544 960 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080680.1 protein_id gnl|my_center|LOCUS_05410 1639 2475 gene locus_tag LOCUS_05420 1639 2475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743809.1 protein_id gnl|my_center|LOCUS_05420 2581 3312 gene locus_tag LOCUS_05430 2581 3312 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191067.1 protein_id gnl|my_center|LOCUS_05430 3434 4189 gene locus_tag LOCUS_05440 3434 4189 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_05440 4311 4709 gene locus_tag LOCUS_05450 4311 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4971 5441 gene locus_tag LOCUS_05460 4971 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5438 6010 gene locus_tag LOCUS_05470 5438 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6526 6017 gene locus_tag LOCUS_05480 6526 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 6640 6840 gene locus_tag LOCUS_05490 6640 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6856 7680 gene locus_tag LOCUS_05500 6856 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7577 7771 gene locus_tag LOCUS_05510 7577 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 7875 8921 gene locus_tag LOCUS_05520 7875 8921 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977755.1 protein_id gnl|my_center|LOCUS_05520 9605 8862 gene locus_tag LOCUS_05530 9605 8862 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_05530 11123 9759 gene locus_tag LOCUS_05540 11123 9759 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_05540 11221 12636 gene locus_tag LOCUS_05550 11221 12636 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_05550 12802 14046 gene locus_tag LOCUS_05560 12802 14046 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027559.1 protein_id gnl|my_center|LOCUS_05560 14043 14708 gene locus_tag LOCUS_05570 14043 14708 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_05570 15102 14731 gene locus_tag LOCUS_05580 15102 14731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 16564 15176 gene locus_tag LOCUS_05590 16564 15176 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 protein_id gnl|my_center|LOCUS_05590 16641 17855 gene locus_tag LOCUS_05600 16641 17855 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027535.1 protein_id gnl|my_center|LOCUS_05600 18019 18876 gene locus_tag LOCUS_05610 18019 18876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031647.1 protein_id gnl|my_center|LOCUS_05610 19029 19355 gene locus_tag LOCUS_05620 19029 19355 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977796.1 protein_id gnl|my_center|LOCUS_05620 19401 20174 gene locus_tag LOCUS_05630 19401 20174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027531.1 protein_id gnl|my_center|LOCUS_05630 20171 22741 gene locus_tag LOCUS_05640 20171 22741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_05640 23374 22844 gene locus_tag LOCUS_05650 23374 22844 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668703.1 protein_id gnl|my_center|LOCUS_05650 23904 23587 gene locus_tag LOCUS_05660 23904 23587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 24249 25358 gene locus_tag LOCUS_05670 24249 25358 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_05670 25865 25386 gene locus_tag LOCUS_05680 25865 25386 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977802.1 protein_id gnl|my_center|LOCUS_05680 26453 25989 gene locus_tag LOCUS_05690 26453 25989 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030713.1 protein_id gnl|my_center|LOCUS_05690 27283 26450 gene locus_tag LOCUS_05700 27283 26450 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_05700 27464 29860 gene locus_tag LOCUS_05710 27464 29860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027528.1 protein_id gnl|my_center|LOCUS_05710 32443 29894 gene locus_tag LOCUS_05720 32443 29894 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 protein_id gnl|my_center|LOCUS_05720 33124 32516 gene locus_tag LOCUS_05730 33124 32516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027527.1 protein_id gnl|my_center|LOCUS_05730 34124 33585 gene locus_tag LOCUS_05740 34124 33585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977808.1 protein_id gnl|my_center|LOCUS_05740 34378 35661 gene locus_tag LOCUS_05750 34378 35661 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027524.1 protein_id gnl|my_center|LOCUS_05750 36858 35686 gene locus_tag LOCUS_05760 36858 35686 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484591.1 protein_id gnl|my_center|LOCUS_05760 36848 37711 gene locus_tag LOCUS_05770 36848 37711 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 protein_id gnl|my_center|LOCUS_05770 37941 38525 gene locus_tag LOCUS_05780 37941 38525 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977812.1 protein_id gnl|my_center|LOCUS_05780 39637 38591 gene locus_tag LOCUS_05790 39637 38591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 39855 41546 gene locus_tag LOCUS_05800 gene lnt 39855 41546 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_05800 41617 41994 gene locus_tag LOCUS_05810 41617 41994 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05810 43142 42129 gene locus_tag LOCUS_05820 43142 42129 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_05820 43663 43139 gene locus_tag LOCUS_05830 43663 43139 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031817.1 protein_id gnl|my_center|LOCUS_05830 44797 43676 gene locus_tag LOCUS_05840 44797 43676 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089170.1 protein_id gnl|my_center|LOCUS_05840 44847 45815 gene locus_tag LOCUS_05850 44847 45815 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031819.1 protein_id gnl|my_center|LOCUS_05850 47742 45853 gene locus_tag LOCUS_05860 47742 45853 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027339.1 protein_id gnl|my_center|LOCUS_05860 49244 48312 gene locus_tag LOCUS_05870 gene tgmB 49244 48312 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027302.1 protein_id gnl|my_center|LOCUS_05870 49452 49261 gene locus_tag LOCUS_05880 gene tgmA 49452 49261 CDS product putative ATP-grasp-modified RiPP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978169.1 protein_id gnl|my_center|LOCUS_05880 50346 49849 gene locus_tag LOCUS_05890 50346 49849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 52355 50607 gene locus_tag LOCUS_05900 52355 50607 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_05900 52787 54190 gene locus_tag LOCUS_05910 52787 54190 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_05910 54187 55707 gene locus_tag LOCUS_05920 54187 55707 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_05920 55704 56756 gene locus_tag LOCUS_05930 55704 56756 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074641.1 protein_id gnl|my_center|LOCUS_05930 56753 57724 gene locus_tag LOCUS_05940 56753 57724 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066698.1 protein_id gnl|my_center|LOCUS_05940 57724 59226 gene locus_tag LOCUS_05950 57724 59226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 60717 59413 gene locus_tag LOCUS_05960 60717 59413 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031374.1 protein_id gnl|my_center|LOCUS_05960 62234 60792 gene locus_tag LOCUS_05970 62234 60792 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031373.1 protein_id gnl|my_center|LOCUS_05970 63769 62231 gene locus_tag LOCUS_05980 63769 62231 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031372.1 protein_id gnl|my_center|LOCUS_05980 64044 65042 gene locus_tag LOCUS_05990 64044 65042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972141.1 protein_id gnl|my_center|LOCUS_05990 65141 66664 gene locus_tag LOCUS_06000 65141 66664 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031371.1 protein_id gnl|my_center|LOCUS_06000 67481 66741 gene locus_tag LOCUS_06010 67481 66741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 68164 67640 gene locus_tag LOCUS_06020 68164 67640 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229426.1 protein_id gnl|my_center|LOCUS_06020 68331 68480 gene locus_tag LOCUS_06030 68331 68480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 70376 68589 gene locus_tag LOCUS_06040 70376 68589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031030.1 protein_id gnl|my_center|LOCUS_06040 73061 70632 gene locus_tag LOCUS_06050 73061 70632 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225437.1 protein_id gnl|my_center|LOCUS_06050 73330 75417 gene locus_tag LOCUS_06060 73330 75417 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_06060 75918 78932 gene locus_tag LOCUS_06070 75918 78932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06070 79883 78963 gene locus_tag LOCUS_06080 79883 78963 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223219.1 protein_id gnl|my_center|LOCUS_06080 80860 80000 gene locus_tag LOCUS_06090 80860 80000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 81332 81817 gene locus_tag LOCUS_06100 81332 81817 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973240.1 protein_id gnl|my_center|LOCUS_06100 81824 83068 gene locus_tag LOCUS_06110 81824 83068 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975337.1 protein_id gnl|my_center|LOCUS_06110 83753 83178 gene locus_tag LOCUS_06120 83753 83178 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_06120 83903 84358 gene locus_tag LOCUS_06130 83903 84358 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027265.1 protein_id gnl|my_center|LOCUS_06130 84363 85331 gene locus_tag LOCUS_06140 84363 85331 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978223.1 protein_id gnl|my_center|LOCUS_06140 85921 85466 gene locus_tag LOCUS_06150 85921 85466 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_06150 87538 86006 gene locus_tag LOCUS_06160 87538 86006 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_06160 88262 87669 gene locus_tag LOCUS_06170 88262 87669 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972077.1 protein_id gnl|my_center|LOCUS_06170 90332 88293 gene locus_tag LOCUS_06180 90332 88293 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_06180 90879 90469 gene locus_tag LOCUS_06190 90879 90469 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164277346.1 protein_id gnl|my_center|LOCUS_06190 91499 90876 gene locus_tag LOCUS_06200 gene dhaL 91499 90876 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_06200 92539 91553 gene locus_tag LOCUS_06210 gene dhaK 92539 91553 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_06210 94277 92799 gene locus_tag LOCUS_06220 94277 92799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 94679 95194 gene locus_tag LOCUS_06230 94679 95194 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225456.1 protein_id gnl|my_center|LOCUS_06230 95401 95937 gene locus_tag LOCUS_06240 95401 95937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027067.1 protein_id gnl|my_center|LOCUS_06240 96241 97257 gene locus_tag LOCUS_06250 96241 97257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 98467 97304 gene locus_tag LOCUS_06260 98467 97304 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027597.1 protein_id gnl|my_center|LOCUS_06260 100634 98460 gene locus_tag LOCUS_06270 100634 98460 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027598.1 protein_id gnl|my_center|LOCUS_06270 101623 100631 gene locus_tag LOCUS_06280 101623 100631 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027599.1 protein_id gnl|my_center|LOCUS_06280 102210 101620 gene locus_tag LOCUS_06290 102210 101620 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027600.1 protein_id gnl|my_center|LOCUS_06290 102387 102968 gene locus_tag LOCUS_06300 gene xdhR 102387 102968 CDS product purine salvage operon transcriptional regulator XdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977696.1 protein_id gnl|my_center|LOCUS_06300 105833 103035 gene locus_tag LOCUS_06310 105833 103035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 106664 105927 gene locus_tag LOCUS_06320 106664 105927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027674.1 protein_id gnl|my_center|LOCUS_06320 107701 106667 gene locus_tag LOCUS_06330 107701 106667 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027675.1 protein_id gnl|my_center|LOCUS_06330 107718 108911 gene locus_tag LOCUS_06340 107718 108911 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027676.1 protein_id gnl|my_center|LOCUS_06340 108917 109576 gene locus_tag LOCUS_06350 108917 109576 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977570.1 protein_id gnl|my_center|LOCUS_06350 110428 109610 gene locus_tag LOCUS_06360 110428 109610 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971527.1 protein_id gnl|my_center|LOCUS_06360 110892 111491 gene locus_tag LOCUS_06370 110892 111491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 111494 112240 gene locus_tag LOCUS_06380 111494 112240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 116349 112273 gene locus_tag LOCUS_06390 116349 112273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 117752 116670 gene locus_tag LOCUS_06400 117752 116670 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229444.1 protein_id gnl|my_center|LOCUS_06400 117864 118823 gene locus_tag LOCUS_06410 117864 118823 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229445.1 protein_id gnl|my_center|LOCUS_06410 119261 119623 gene locus_tag LOCUS_06420 119261 119623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 119620 120243 gene locus_tag LOCUS_06430 119620 120243 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029197.1 protein_id gnl|my_center|LOCUS_06430 120358 120849 gene locus_tag LOCUS_06440 120358 120849 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975205.1 protein_id gnl|my_center|LOCUS_06440 120833 121300 gene locus_tag LOCUS_06450 120833 121300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 122508 121384 gene locus_tag LOCUS_06460 122508 121384 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228351.1 protein_id gnl|my_center|LOCUS_06460 123077 122547 gene locus_tag LOCUS_06470 123077 122547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 123104 123862 gene locus_tag LOCUS_06480 123104 123862 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388219.1 protein_id gnl|my_center|LOCUS_06480 123962 124480 gene locus_tag LOCUS_06490 gene msrA 123962 124480 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510037.1 protein_id gnl|my_center|LOCUS_06490 125051 124590 gene locus_tag LOCUS_06500 125051 124590 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225249.1 protein_id gnl|my_center|LOCUS_06500 126124 125117 gene locus_tag LOCUS_06510 gene ligD 126124 125117 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227028.1 protein_id gnl|my_center|LOCUS_06510 126522 126208 gene locus_tag LOCUS_06520 126522 126208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 127517 126819 gene locus_tag LOCUS_06530 127517 126819 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 protein_id gnl|my_center|LOCUS_06530 128761 127514 gene locus_tag LOCUS_06540 128761 127514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 128895 129812 gene locus_tag LOCUS_06550 128895 129812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230969.1 protein_id gnl|my_center|LOCUS_06550 129809 130636 gene locus_tag LOCUS_06560 129809 130636 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_06560 132511 130724 gene locus_tag LOCUS_06570 132511 130724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_06570 133548 132649 gene locus_tag LOCUS_06580 133548 132649 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_06580 135737 133545 gene locus_tag LOCUS_06590 135737 133545 CDS product DUF6351 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_06590 135903 138578 gene locus_tag LOCUS_06600 135903 138578 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 protein_id gnl|my_center|LOCUS_06600 138853 139263 gene locus_tag LOCUS_06610 138853 139263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 139260 139925 gene locus_tag LOCUS_06620 139260 139925 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031342.1 protein_id gnl|my_center|LOCUS_06620 140375 140058 gene locus_tag LOCUS_06630 140375 140058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 140673 140984 gene locus_tag LOCUS_06640 140673 140984 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973102.1 protein_id gnl|my_center|LOCUS_06640 142605 141076 gene locus_tag LOCUS_06650 142605 141076 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_06650 143194 142991 gene locus_tag LOCUS_06660 143194 142991 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_06660 143521 144774 gene locus_tag LOCUS_06670 143521 144774 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_06670 144771 145439 gene locus_tag LOCUS_06680 144771 145439 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_06680 145554 146489 gene locus_tag LOCUS_06690 145554 146489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_06690 146486 147253 gene locus_tag LOCUS_06700 146486 147253 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_06700 148093 147275 gene locus_tag LOCUS_06710 148093 147275 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_06710 148836 148153 gene locus_tag LOCUS_06720 148836 148153 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027455.1 protein_id gnl|my_center|LOCUS_06720 149587 148919 gene locus_tag LOCUS_06730 149587 148919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 149959 149690 gene locus_tag LOCUS_06740 149959 149690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 150055 150756 gene locus_tag LOCUS_06750 150055 150756 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230170.1 protein_id gnl|my_center|LOCUS_06750 150761 151030 gene locus_tag LOCUS_06760 150761 151030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 151096 152340 gene locus_tag LOCUS_06770 151096 152340 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_06770 152483 154414 gene locus_tag LOCUS_06780 152483 154414 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 protein_id gnl|my_center|LOCUS_06780 154596 155636 gene locus_tag LOCUS_06790 154596 155636 CDS product phosphatidylinositol-specific phospholipase C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230297.1 protein_id gnl|my_center|LOCUS_06790 157272 155710 gene locus_tag LOCUS_06800 157272 155710 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_06800 157409 158410 gene locus_tag LOCUS_06810 157409 158410 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 protein_id gnl|my_center|LOCUS_06810 158392 160725 gene locus_tag LOCUS_06820 158392 160725 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031533.1 protein_id gnl|my_center|LOCUS_06820 161049 162638 gene locus_tag LOCUS_06830 161049 162638 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_06830 162788 164242 gene locus_tag LOCUS_06840 162788 164242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028648.1 protein_id gnl|my_center|LOCUS_06840 164966 164265 gene locus_tag LOCUS_06850 164966 164265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 166886 165063 gene locus_tag LOCUS_06860 166886 165063 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971902.1 protein_id gnl|my_center|LOCUS_06860 167012 168118 gene locus_tag LOCUS_06870 167012 168118 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976857.1 protein_id gnl|my_center|LOCUS_06870 168435 170675 gene locus_tag LOCUS_06880 168435 170675 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_06880 172100 170814 gene locus_tag LOCUS_06890 gene paaF 172100 170814 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031681.1 protein_id gnl|my_center|LOCUS_06890 172388 172630 gene locus_tag LOCUS_06900 172388 172630 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971899.1 protein_id gnl|my_center|LOCUS_06900 172707 173207 gene locus_tag LOCUS_06910 172707 173207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031540.1 protein_id gnl|my_center|LOCUS_06910 173360 175720 gene locus_tag LOCUS_06920 173360 175720 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_06920 175898 177013 gene locus_tag LOCUS_06930 175898 177013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971889.1 protein_id gnl|my_center|LOCUS_06930 179137 177137 gene locus_tag LOCUS_06940 179137 177137 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_06940 180659 179454 gene locus_tag LOCUS_06950 180659 179454 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_06950 180834 182345 gene locus_tag LOCUS_06960 180834 182345 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975980.1 protein_id gnl|my_center|LOCUS_06960 182342 183403 gene locus_tag LOCUS_06970 182342 183403 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 protein_id gnl|my_center|LOCUS_06970 183400 184509 gene locus_tag LOCUS_06980 183400 184509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970002.1 protein_id gnl|my_center|LOCUS_06980 184506 185726 gene locus_tag LOCUS_06990 184506 185726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 185723 186658 gene locus_tag LOCUS_07000 185723 186658 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_07000 186720 189857 gene locus_tag LOCUS_07010 186720 189857 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_07010 189923 189932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 191094 189970 gene locus_tag LOCUS_07020 191094 189970 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971893.1 protein_id gnl|my_center|LOCUS_07020 191325 192818 gene locus_tag LOCUS_07030 191325 192818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031543.1 protein_id gnl|my_center|LOCUS_07030 194297 192876 gene locus_tag LOCUS_07040 194297 192876 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031544.1 protein_id gnl|my_center|LOCUS_07040 195110 194502 gene locus_tag LOCUS_07050 195110 194502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 195469 195107 gene locus_tag LOCUS_07060 195469 195107 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224159.1 protein_id gnl|my_center|LOCUS_07060 196991 195564 gene locus_tag LOCUS_07070 196991 195564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 198023 197181 gene locus_tag LOCUS_07080 198023 197181 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028572.1 protein_id gnl|my_center|LOCUS_07080 198362 199261 gene locus_tag LOCUS_07090 198362 199261 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971569.1 protein_id gnl|my_center|LOCUS_07090 199304 199321 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 199383 200777 gene locus_tag LOCUS_07100 199383 200777 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230107.1 protein_id gnl|my_center|LOCUS_07100 200980 201780 gene locus_tag LOCUS_07110 200980 201780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066671.1 protein_id gnl|my_center|LOCUS_07110 201827 202330 gene locus_tag LOCUS_07120 201827 202330 CDS product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 protein_id gnl|my_center|LOCUS_07120 202413 203381 gene locus_tag LOCUS_07130 202413 203381 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065074.1 protein_id gnl|my_center|LOCUS_07130 204398 203466 gene locus_tag LOCUS_07140 204398 203466 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748902.1 protein_id gnl|my_center|LOCUS_07140 204689 205975 gene locus_tag LOCUS_07150 204689 205975 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368950.1 protein_id gnl|my_center|LOCUS_07150 206091 206747 gene locus_tag LOCUS_07160 206091 206747 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400491.1 protein_id gnl|my_center|LOCUS_07160 206752 207702 gene locus_tag LOCUS_07170 206752 207702 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527149.1 protein_id gnl|my_center|LOCUS_07170 207780 209039 gene locus_tag LOCUS_07180 207780 209039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 209032 210672 gene locus_tag LOCUS_07190 gene groL 209032 210672 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_07190 212071 210782 gene locus_tag LOCUS_07200 212071 210782 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082957.1 protein_id gnl|my_center|LOCUS_07200 211983 212201 gene locus_tag LOCUS_07210 211983 212201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 212675 212205 gene locus_tag LOCUS_07220 212675 212205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 214367 212820 gene locus_tag LOCUS_07230 214367 212820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 215173 214685 gene locus_tag LOCUS_07240 215173 214685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 216059 215442 gene locus_tag LOCUS_07250 216059 215442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 216185 216940 gene locus_tag LOCUS_07260 216185 216940 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222836.1 protein_id gnl|my_center|LOCUS_07260 217070 217432 gene locus_tag LOCUS_07270 217070 217432 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027002.1 protein_id gnl|my_center|LOCUS_07270 217516 218499 gene locus_tag LOCUS_07280 217516 218499 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031566.1 protein_id gnl|my_center|LOCUS_07280 218576 219127 gene locus_tag LOCUS_07290 218576 219127 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223801.1 protein_id gnl|my_center|LOCUS_07290 220382 219117 gene locus_tag LOCUS_07300 220382 219117 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_07300 222823 220379 gene locus_tag LOCUS_07310 222823 220379 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226456.1 protein_id gnl|my_center|LOCUS_07310 224825 222981 gene locus_tag LOCUS_07320 224825 222981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 225822 224902 gene locus_tag LOCUS_07330 225822 224902 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524829.1 protein_id gnl|my_center|LOCUS_07330 226793 225819 gene locus_tag LOCUS_07340 226793 225819 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524828.1 protein_id gnl|my_center|LOCUS_07340 228183 226870 gene locus_tag LOCUS_07350 228183 226870 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_07350 229349 228192 gene locus_tag LOCUS_07360 229349 228192 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 protein_id gnl|my_center|LOCUS_07360 229300 229482 gene locus_tag LOCUS_07370 229300 229482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 229549 231687 gene locus_tag LOCUS_07380 229549 231687 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226869.1 protein_id gnl|my_center|LOCUS_07380 232292 231729 gene locus_tag LOCUS_07390 232292 231729 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027107.1 protein_id gnl|my_center|LOCUS_07390 233121 232285 gene locus_tag LOCUS_07400 233121 232285 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_07400 233313 234275 gene locus_tag LOCUS_07410 233313 234275 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971541.1 protein_id gnl|my_center|LOCUS_07410 234332 234874 gene locus_tag LOCUS_07420 234332 234874 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026968.1 protein_id gnl|my_center|LOCUS_07420 235096 234893 gene locus_tag LOCUS_07430 235096 234893 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977235.1 protein_id gnl|my_center|LOCUS_07430 235305 235114 gene locus_tag LOCUS_07440 235305 235114 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314974.1 protein_id gnl|my_center|LOCUS_07440 235507 235289 gene locus_tag LOCUS_07450 235507 235289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 235529 236509 gene locus_tag LOCUS_07460 235529 236509 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_07460 236653 238029 gene locus_tag LOCUS_07470 236653 238029 CDS product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 protein_id gnl|my_center|LOCUS_07470 238061 238543 gene locus_tag LOCUS_07480 238061 238543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485933.1 protein_id gnl|my_center|LOCUS_07480 238759 239388 gene locus_tag LOCUS_07490 238759 239388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 240165 239401 gene locus_tag LOCUS_07500 240165 239401 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_07500 240491 240694 gene locus_tag LOCUS_07510 240491 240694 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_07510 241130 240777 gene locus_tag LOCUS_07520 241130 240777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 241333 241941 gene locus_tag LOCUS_07530 241333 241941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 242652 242975 gene locus_tag LOCUS_07540 242652 242975 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027047.1 protein_id gnl|my_center|LOCUS_07540 243057 243770 gene locus_tag LOCUS_07550 243057 243770 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324453.1 protein_id gnl|my_center|LOCUS_07550 243881 244057 gene locus_tag LOCUS_07560 243881 244057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 244145 244471 gene locus_tag LOCUS_07570 244145 244471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 244536 244925 gene locus_tag LOCUS_07580 244536 244925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 245507 245079 gene locus_tag LOCUS_07590 245507 245079 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224983.1 protein_id gnl|my_center|LOCUS_07590 245757 247427 gene locus_tag LOCUS_07600 245757 247427 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975161.1 protein_id gnl|my_center|LOCUS_07600 247712 248671 gene locus_tag LOCUS_07610 247712 248671 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_07610 248931 249215 gene locus_tag LOCUS_07620 248931 249215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 250237 249299 gene locus_tag LOCUS_07630 250237 249299 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031711.1 protein_id gnl|my_center|LOCUS_07630 252116 250578 gene locus_tag LOCUS_07640 252116 250578 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_07640 254204 252147 gene locus_tag LOCUS_07650 254204 252147 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027370.1 protein_id gnl|my_center|LOCUS_07650 255195 254368 gene locus_tag LOCUS_07660 255195 254368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 257188 255329 gene locus_tag LOCUS_07670 257188 255329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 257538 258128 gene locus_tag LOCUS_07680 257538 258128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 258318 258722 gene locus_tag LOCUS_07690 258318 258722 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_07690 259733 258828 gene locus_tag LOCUS_07700 259733 258828 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_07700 259975 260847 gene locus_tag LOCUS_07710 259975 260847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 261342 260998 gene locus_tag LOCUS_07720 261342 260998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 262696 261518 gene locus_tag LOCUS_07730 262696 261518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 262875 263822 gene locus_tag LOCUS_07740 262875 263822 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083148.1 protein_id gnl|my_center|LOCUS_07740 263878 264483 gene locus_tag LOCUS_07750 263878 264483 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_07750 264614 264868 gene locus_tag LOCUS_07760 264614 264868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07760 264889 265101 gene locus_tag LOCUS_07770 264889 265101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 266047 265148 gene locus_tag LOCUS_07780 266047 265148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 266596 266147 gene locus_tag LOCUS_07790 266596 266147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 267250 266609 gene locus_tag LOCUS_07800 267250 266609 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031607.1 protein_id gnl|my_center|LOCUS_07800 267800 267333 gene locus_tag LOCUS_07810 267800 267333 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_07810 269323 268034 gene locus_tag LOCUS_07820 269323 268034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 269488 269997 gene locus_tag LOCUS_07830 269488 269997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 270406 270020 gene locus_tag LOCUS_07840 270406 270020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 270705 270403 gene locus_tag LOCUS_07850 270705 270403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 270821 271546 gene locus_tag LOCUS_07860 270821 271546 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972882.1 protein_id gnl|my_center|LOCUS_07860 271543 272328 gene locus_tag LOCUS_07870 271543 272328 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_07870 272546 273571 gene locus_tag LOCUS_07880 272546 273571 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_07880 273600 275186 gene locus_tag LOCUS_07890 273600 275186 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142741014.1 protein_id gnl|my_center|LOCUS_07890 275393 277633 gene locus_tag LOCUS_07900 275393 277633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 279844 277739 gene locus_tag LOCUS_07910 gene fusA 279844 277739 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031026.1 protein_id gnl|my_center|LOCUS_07910 280323 280604 gene locus_tag LOCUS_07920 280323 280604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 280851 282536 gene locus_tag LOCUS_07930 280851 282536 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228262.1 protein_id gnl|my_center|LOCUS_07930 285637 282620 gene locus_tag LOCUS_07940 285637 282620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 286735 285965 gene locus_tag LOCUS_07950 286735 285965 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_07950 286897 288060 gene locus_tag LOCUS_07960 286897 288060 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_07960 288057 289067 gene locus_tag LOCUS_07970 288057 289067 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 protein_id gnl|my_center|LOCUS_07970 289212 290180 gene locus_tag LOCUS_07980 289212 290180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028332.1 protein_id gnl|my_center|LOCUS_07980 290193 291308 gene locus_tag LOCUS_07990 gene chvE 290193 291308 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976402.1 protein_id gnl|my_center|LOCUS_07990 291305 292846 gene locus_tag LOCUS_08000 gene gguA 291305 292846 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976401.1 protein_id gnl|my_center|LOCUS_08000 292852 294111 gene locus_tag LOCUS_08010 gene gguB 292852 294111 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976400.1 protein_id gnl|my_center|LOCUS_08010 294427 294137 gene locus_tag LOCUS_08020 294427 294137 CDS product DUF6510 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729807.1 protein_id gnl|my_center|LOCUS_08020 295133 294429 gene locus_tag LOCUS_08030 295133 294429 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223384.1 protein_id gnl|my_center|LOCUS_08030 295458 295117 gene locus_tag LOCUS_08040 295458 295117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 296067 295468 gene locus_tag LOCUS_08050 296067 295468 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223383.1 protein_id gnl|my_center|LOCUS_08050 296840 296220 gene locus_tag LOCUS_08060 296840 296220 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_08060 297121 297888 gene locus_tag LOCUS_08070 297121 297888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 297999 298919 gene locus_tag LOCUS_08080 297999 298919 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135794525.1 protein_id gnl|my_center|LOCUS_08080 299284 299117 gene locus_tag LOCUS_08090 299284 299117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 299662 299306 gene locus_tag LOCUS_08100 299662 299306 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978264.1 protein_id gnl|my_center|LOCUS_08100 301012 299825 gene locus_tag LOCUS_08110 301012 299825 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_08110 304702 301403 gene locus_tag LOCUS_08120 304702 301403 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_08120 305789 304821 gene locus_tag LOCUS_08130 305789 304821 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_08130 307110 306157 gene locus_tag LOCUS_08140 307110 306157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 308028 307609 gene locus_tag LOCUS_08150 308028 307609 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029382.1 protein_id gnl|my_center|LOCUS_08150 308133 309008 gene locus_tag LOCUS_08160 308133 309008 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 protein_id gnl|my_center|LOCUS_08160 309194 310210 gene locus_tag LOCUS_08170 309194 310210 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_08170 310434 311201 gene locus_tag LOCUS_08180 310434 311201 CDS product NPP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031599.1 protein_id gnl|my_center|LOCUS_08180 311410 312189 gene locus_tag LOCUS_08190 311410 312189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 312135 312701 gene locus_tag LOCUS_08200 312135 312701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08200 312801 313349 gene locus_tag LOCUS_08210 312801 313349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484326.1 protein_id gnl|my_center|LOCUS_08210 316317 313492 gene locus_tag LOCUS_08220 316317 313492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 317426 316314 gene locus_tag LOCUS_08230 317426 316314 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_08230 318866 317439 gene locus_tag LOCUS_08240 318866 317439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 320251 318863 gene locus_tag LOCUS_08250 320251 318863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 320754 320251 gene locus_tag LOCUS_08260 320754 320251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 322036 321053 gene locus_tag LOCUS_08270 322036 321053 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228302.1 protein_id gnl|my_center|LOCUS_08270 322207 322644 gene locus_tag LOCUS_08280 322207 322644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 322729 322995 gene locus_tag LOCUS_08290 322729 322995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027204.1 protein_id gnl|my_center|LOCUS_08290 323922 323056 gene locus_tag LOCUS_08300 323922 323056 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_08300 324122 325588 gene locus_tag LOCUS_08310 324122 325588 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404013.1 protein_id gnl|my_center|LOCUS_08310 325653 326396 gene locus_tag LOCUS_08320 325653 326396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_08320 326383 328494 gene locus_tag LOCUS_08330 326383 328494 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 protein_id gnl|my_center|LOCUS_08330 328618 329088 gene locus_tag LOCUS_08340 328618 329088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 329285 329872 gene locus_tag LOCUS_08350 329285 329872 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222835.1 protein_id gnl|my_center|LOCUS_08350 330416 329940 gene locus_tag LOCUS_08360 330416 329940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 330787 331641 gene locus_tag LOCUS_08370 330787 331641 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226458.1 protein_id gnl|my_center|LOCUS_08370 331756 332625 gene locus_tag LOCUS_08380 331756 332625 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225947.1 protein_id gnl|my_center|LOCUS_08380 333556 332684 gene locus_tag LOCUS_08390 333556 332684 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_08390 335754 333736 gene locus_tag LOCUS_08400 gene cerN 335754 333736 CDS product ceramidase CerN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114226.1 protein_id gnl|my_center|LOCUS_08400 336002 336868 gene locus_tag LOCUS_08410 336002 336868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 337704 337051 gene locus_tag LOCUS_08420 337704 337051 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971593.1 protein_id gnl|my_center|LOCUS_08420 337785 338750 gene locus_tag LOCUS_08430 337785 338750 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534186.1 protein_id gnl|my_center|LOCUS_08430 338858 339979 gene locus_tag LOCUS_08440 338858 339979 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_08440 340719 340078 gene locus_tag LOCUS_08450 340719 340078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 protein_id gnl|my_center|LOCUS_08450 340977 341489 gene locus_tag LOCUS_08460 340977 341489 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227042.1 protein_id gnl|my_center|LOCUS_08460 341507 343822 gene locus_tag LOCUS_08470 341507 343822 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_08470 344709 343939 gene locus_tag LOCUS_08480 gene fabG 344709 343939 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_08480 345646 344711 gene locus_tag LOCUS_08490 345646 344711 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089316.1 protein_id gnl|my_center|LOCUS_08490 345928 346563 gene locus_tag LOCUS_08500 345928 346563 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533709.1 protein_id gnl|my_center|LOCUS_08500 346640 347308 gene locus_tag LOCUS_08510 346640 347308 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_08510 347360 348148 gene locus_tag LOCUS_08520 347360 348148 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_08520 348588 348178 gene locus_tag LOCUS_08530 348588 348178 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_08530 348798 351029 gene locus_tag LOCUS_08540 gene katG 348798 351029 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_08540 351912 351451 gene locus_tag LOCUS_08550 351912 351451 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229003.1 protein_id gnl|my_center|LOCUS_08550 351995 352723 gene locus_tag LOCUS_08560 351995 352723 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229004.1 protein_id gnl|my_center|LOCUS_08560 352778 353476 gene locus_tag LOCUS_08570 352778 353476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 353927 353529 gene locus_tag LOCUS_08580 353927 353529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 354298 355491 gene locus_tag LOCUS_08590 354298 355491 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_08590 356113 355601 gene locus_tag LOCUS_08600 356113 355601 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111527.1 protein_id gnl|my_center|LOCUS_08600 356279 357079 gene locus_tag LOCUS_08610 356279 357079 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031449.1 protein_id gnl|my_center|LOCUS_08610 358226 357225 gene locus_tag LOCUS_08620 358226 357225 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_08620 358385 358954 gene locus_tag LOCUS_08630 358385 358954 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_08630 359069 359764 gene locus_tag LOCUS_08640 359069 359764 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100427.1 protein_id gnl|my_center|LOCUS_08640 360530 359889 gene locus_tag LOCUS_08650 360530 359889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 361361 360747 gene locus_tag LOCUS_08660 361361 360747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_08660 362536 361349 gene locus_tag LOCUS_08670 362536 361349 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 protein_id gnl|my_center|LOCUS_08670 362761 364311 gene locus_tag LOCUS_08680 362761 364311 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028399.1 protein_id gnl|my_center|LOCUS_08680 364576 364797 gene locus_tag LOCUS_08690 364576 364797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 366037 364811 gene locus_tag LOCUS_08700 366037 364811 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_08700 366205 367098 gene locus_tag LOCUS_08710 366205 367098 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975248.1 protein_id gnl|my_center|LOCUS_08710 367095 368396 gene locus_tag LOCUS_08720 367095 368396 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 protein_id gnl|my_center|LOCUS_08720 368393 368755 gene locus_tag LOCUS_08730 368393 368755 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029168.1 protein_id gnl|my_center|LOCUS_08730 369315 368788 gene locus_tag LOCUS_08740 369315 368788 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223272.1 protein_id gnl|my_center|LOCUS_08740 370382 369360 gene locus_tag LOCUS_08750 370382 369360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 371703 370504 gene locus_tag LOCUS_08760 371703 370504 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079030578.1 protein_id gnl|my_center|LOCUS_08760 371587 371862 gene locus_tag LOCUS_08770 371587 371862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 371890 373533 gene locus_tag LOCUS_08780 371890 373533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 373640 373822 gene locus_tag LOCUS_08790 373640 373822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 373824 374306 gene locus_tag LOCUS_08800 373824 374306 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026330850.1 protein_id gnl|my_center|LOCUS_08800 375306 374419 gene locus_tag LOCUS_08810 375306 374419 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_08810 376309 375536 gene locus_tag LOCUS_08820 376309 375536 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_08820 376876 376310 gene locus_tag LOCUS_08830 376876 376310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 378260 376887 gene locus_tag LOCUS_08840 378260 376887 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_08840 378565 379398 gene locus_tag LOCUS_08850 378565 379398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 379519 379337 gene locus_tag LOCUS_08860 379519 379337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 379604 380335 gene locus_tag LOCUS_08870 379604 380335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 383612 380346 gene locus_tag LOCUS_08880 383612 380346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 385755 383956 gene locus_tag LOCUS_08890 385755 383956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 386249 385950 gene locus_tag LOCUS_08900 386249 385950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08900 386692 386228 gene locus_tag LOCUS_08910 386692 386228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08910 386922 387737 gene locus_tag LOCUS_08920 386922 387737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 388741 387866 gene locus_tag LOCUS_08930 388741 387866 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_08930 388996 392151 gene locus_tag LOCUS_08940 388996 392151 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027028.1 protein_id gnl|my_center|LOCUS_08940 392449 393870 gene locus_tag LOCUS_08950 392449 393870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 394399 394031 gene locus_tag LOCUS_08960 394399 394031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 395169 394795 gene locus_tag LOCUS_08970 395169 394795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 396029 397351 gene locus_tag LOCUS_08980 396029 397351 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285867.1 protein_id gnl|my_center|LOCUS_08980 397806 399674 gene locus_tag LOCUS_08990 397806 399674 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484403.1 protein_id gnl|my_center|LOCUS_08990 400501 400049 gene locus_tag LOCUS_09000 400501 400049 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_09000 400950 401483 gene locus_tag LOCUS_09010 400950 401483 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031802.1 protein_id gnl|my_center|LOCUS_09010 401891 401565 gene locus_tag LOCUS_09020 401891 401565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972272.1 protein_id gnl|my_center|LOCUS_09020 402064 402282 gene locus_tag LOCUS_09030 402064 402282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 402395 403177 gene locus_tag LOCUS_09040 402395 403177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 403373 403921 gene locus_tag LOCUS_09050 403373 403921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_09050 404002 404841 gene locus_tag LOCUS_09060 404002 404841 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_09060 404886 405887 gene locus_tag LOCUS_09070 404886 405887 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_09070 405884 406669 gene locus_tag LOCUS_09080 405884 406669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_09080 406893 407654 gene locus_tag LOCUS_09090 406893 407654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 408894 407671 gene locus_tag LOCUS_09100 408894 407671 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031800.1 protein_id gnl|my_center|LOCUS_09100 409031 409774 gene locus_tag LOCUS_09110 409031 409774 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031801.1 protein_id gnl|my_center|LOCUS_09110 410658 409825 gene locus_tag LOCUS_09120 410658 409825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 410886 411821 gene locus_tag LOCUS_09130 410886 411821 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971489.1 protein_id gnl|my_center|LOCUS_09130 412087 412830 gene locus_tag LOCUS_09140 412087 412830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 413315 412887 gene locus_tag LOCUS_09150 413315 412887 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224742.1 protein_id gnl|my_center|LOCUS_09150 413751 413551 gene locus_tag LOCUS_09160 413751 413551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 413663 414046 gene locus_tag LOCUS_09170 413663 414046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 415264 414086 gene locus_tag LOCUS_09180 gene pcaD 415264 414086 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 protein_id gnl|my_center|LOCUS_09180 415930 415313 gene locus_tag LOCUS_09190 gene pcaG 415930 415313 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031115.1 protein_id gnl|my_center|LOCUS_09190 416712 415927 gene locus_tag LOCUS_09200 gene pcaH 416712 415927 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031116.1 protein_id gnl|my_center|LOCUS_09200 417415 416741 gene locus_tag LOCUS_09210 417415 416741 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031118.1 protein_id gnl|my_center|LOCUS_09210 418179 417415 gene locus_tag LOCUS_09220 418179 417415 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031119.1 protein_id gnl|my_center|LOCUS_09220 418320 420023 gene locus_tag LOCUS_09230 418320 420023 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028828.1 protein_id gnl|my_center|LOCUS_09230 420163 421356 gene locus_tag LOCUS_09240 420163 421356 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028757.1 protein_id gnl|my_center|LOCUS_09240 421366 422343 gene locus_tag LOCUS_09250 421366 422343 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877602.1 protein_id gnl|my_center|LOCUS_09250 422340 423134 gene locus_tag LOCUS_09260 422340 423134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_09260 423131 423907 gene locus_tag LOCUS_09270 423131 423907 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_09270 423940 424725 gene locus_tag LOCUS_09280 423940 424725 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_09280 424878 425279 gene locus_tag LOCUS_09290 424878 425279 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_09290 425388 425912 gene locus_tag LOCUS_09300 425388 425912 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_09300 425899 426888 gene locus_tag LOCUS_09310 425899 426888 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640561.1 protein_id gnl|my_center|LOCUS_09310 426885 429080 gene locus_tag LOCUS_09320 426885 429080 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225572.1 protein_id gnl|my_center|LOCUS_09320 430106 429177 gene locus_tag LOCUS_09330 430106 429177 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731571.1 protein_id gnl|my_center|LOCUS_09330 430593 430865 gene locus_tag LOCUS_09340 430593 430865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 431885 430905 gene locus_tag LOCUS_09350 431885 430905 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227567.1 protein_id gnl|my_center|LOCUS_09350 432059 432994 gene locus_tag LOCUS_09360 432059 432994 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227572.1 protein_id gnl|my_center|LOCUS_09360 436878 433090 gene locus_tag LOCUS_09370 436878 433090 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226211.1 protein_id gnl|my_center|LOCUS_09370 439243 437072 gene locus_tag LOCUS_09380 439243 437072 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_09380 439571 439254 gene locus_tag LOCUS_09390 439571 439254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 439606 440169 gene locus_tag LOCUS_09400 439606 440169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 441399 440236 gene locus_tag LOCUS_09410 441399 440236 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_09410 442563 441553 gene locus_tag LOCUS_09420 442563 441553 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878776.1 protein_id gnl|my_center|LOCUS_09420 443308 442688 gene locus_tag LOCUS_09430 443308 442688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_09430 444470 443529 gene locus_tag LOCUS_09440 444470 443529 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 protein_id gnl|my_center|LOCUS_09440 445183 444878 gene locus_tag LOCUS_09450 gene rpsN 445183 444878 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 protein_id gnl|my_center|LOCUS_09450 445419 445183 gene locus_tag LOCUS_09460 gene rpmB 445419 445183 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028971.1 protein_id gnl|my_center|LOCUS_09460 445485 445649 gene locus_tag LOCUS_09470 gene rpmG 445485 445649 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_09470 445679 445933 gene locus_tag LOCUS_09480 445679 445933 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_09480 445933 447087 gene locus_tag LOCUS_09490 445933 447087 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 protein_id gnl|my_center|LOCUS_09490 447141 447377 gene locus_tag LOCUS_09500 gene rpsR 447141 447377 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028969.1 protein_id gnl|my_center|LOCUS_09500 448369 447989 gene locus_tag LOCUS_09510 448369 447989 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969729.1 protein_id gnl|my_center|LOCUS_09510 448362 449525 gene locus_tag LOCUS_09520 448362 449525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 449817 451151 gene locus_tag LOCUS_09530 449817 451151 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_09530 452361 451264 gene locus_tag LOCUS_09540 452361 451264 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486033.1 protein_id gnl|my_center|LOCUS_09540 453714 452575 gene locus_tag LOCUS_09550 453714 452575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 453925 454671 gene locus_tag LOCUS_09560 453925 454671 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031845.1 protein_id gnl|my_center|LOCUS_09560 455241 454885 gene locus_tag LOCUS_09570 455241 454885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 455353 456189 gene locus_tag LOCUS_09580 455353 456189 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_09580 456591 456328 gene locus_tag LOCUS_09590 456591 456328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 457339 457755 gene locus_tag LOCUS_09600 457339 457755 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028624.1 protein_id gnl|my_center|LOCUS_09600 457827 458171 gene locus_tag LOCUS_09610 457827 458171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 459268 458855 gene locus_tag LOCUS_09620 459268 458855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 459443 461401 gene locus_tag LOCUS_09630 459443 461401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 461563 461841 gene locus_tag LOCUS_09640 461563 461841 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029763.1 protein_id gnl|my_center|LOCUS_09640 462499 461990 gene locus_tag LOCUS_09650 462499 461990 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_09650 462546 463973 gene locus_tag LOCUS_09660 462546 463973 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729584.1 protein_id gnl|my_center|LOCUS_09660 464661 464005 gene locus_tag LOCUS_09670 464661 464005 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232802.1 protein_id gnl|my_center|LOCUS_09670 465063 466364 gene locus_tag LOCUS_09680 465063 466364 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 protein_id gnl|my_center|LOCUS_09680 467258 466464 gene locus_tag LOCUS_09690 467258 466464 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_09690 468065 467271 gene locus_tag LOCUS_09700 468065 467271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_09700 469027 468062 gene locus_tag LOCUS_09710 469027 468062 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_09710 470544 469120 gene locus_tag LOCUS_09720 470544 469120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 471230 470541 gene locus_tag LOCUS_09730 471230 470541 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_09730 471691 472065 gene locus_tag LOCUS_09740 471691 472065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 472210 472674 gene locus_tag LOCUS_09750 472210 472674 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224743.1 protein_id gnl|my_center|LOCUS_09750 473798 473932 gene locus_tag LOCUS_09760 473798 473932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 473985 474539 gene locus_tag LOCUS_09770 473985 474539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 474930 475379 gene locus_tag LOCUS_09780 474930 475379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 477207 475681 gene locus_tag LOCUS_09790 477207 475681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 477647 477342 gene locus_tag LOCUS_09800 477647 477342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 478035 477814 gene locus_tag LOCUS_09810 478035 477814 CDS product DUF6480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971811.1 protein_id gnl|my_center|LOCUS_09810 478839 478327 gene locus_tag LOCUS_09820 478839 478327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 479193 480068 gene locus_tag LOCUS_09830 479193 480068 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_09830 481066 480152 gene locus_tag LOCUS_09840 481066 480152 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749486.1 protein_id gnl|my_center|LOCUS_09840 481842 481411 gene locus_tag LOCUS_09850 481842 481411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 481962 482558 gene locus_tag LOCUS_09860 481962 482558 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_09860 483111 482707 gene locus_tag LOCUS_09870 483111 482707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 483348 483551 gene locus_tag LOCUS_09880 483348 483551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 483724 484761 gene locus_tag LOCUS_09890 483724 484761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 484931 485416 gene locus_tag LOCUS_09900 484931 485416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031877.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence03 921 64 gene locus_tag LOCUS_09910 921 64 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410037.1 protein_id gnl|my_center|LOCUS_09910 2219 1113 gene locus_tag LOCUS_09920 2219 1113 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_09920 3540 2212 gene locus_tag LOCUS_09930 3540 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3655 4386 gene locus_tag LOCUS_09940 3655 4386 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029202.1 protein_id gnl|my_center|LOCUS_09940 4383 5036 gene locus_tag LOCUS_09950 4383 5036 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870668.1 protein_id gnl|my_center|LOCUS_09950 5641 5186 gene locus_tag LOCUS_09960 5641 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 6228 5671 gene locus_tag LOCUS_09970 6228 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159394617.1 protein_id gnl|my_center|LOCUS_09970 7499 6228 gene locus_tag LOCUS_09980 7499 6228 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911099.1 protein_id gnl|my_center|LOCUS_09980 7727 9163 gene locus_tag LOCUS_09990 7727 9163 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534689.1 protein_id gnl|my_center|LOCUS_09990 9864 9178 gene locus_tag LOCUS_10000 9864 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 10046 11032 gene locus_tag LOCUS_10010 10046 11032 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031422.1 protein_id gnl|my_center|LOCUS_10010 12536 11106 gene locus_tag LOCUS_10020 12536 11106 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091318242.1 protein_id gnl|my_center|LOCUS_10020 12798 13769 gene locus_tag LOCUS_10030 12798 13769 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 protein_id gnl|my_center|LOCUS_10030 15222 13813 gene locus_tag LOCUS_10040 15222 13813 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_10040 16862 15315 gene locus_tag LOCUS_10050 16862 15315 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 protein_id gnl|my_center|LOCUS_10050 18316 16859 gene locus_tag LOCUS_10060 18316 16859 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_10060 19294 18881 gene locus_tag LOCUS_10070 19294 18881 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969729.1 protein_id gnl|my_center|LOCUS_10070 19424 20311 gene locus_tag LOCUS_10080 19424 20311 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 protein_id gnl|my_center|LOCUS_10080 20342 20776 gene locus_tag LOCUS_10090 20342 20776 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897995.1 protein_id gnl|my_center|LOCUS_10090 21588 20863 gene locus_tag LOCUS_10100 21588 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 22256 21786 gene locus_tag LOCUS_10110 22256 21786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 22449 23384 gene locus_tag LOCUS_10120 22449 23384 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031781.1 protein_id gnl|my_center|LOCUS_10120 23381 24181 gene locus_tag LOCUS_10130 23381 24181 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_10130 24178 24624 gene locus_tag LOCUS_10140 24178 24624 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_10140 26798 24657 gene locus_tag LOCUS_10150 26798 24657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 28814 26907 gene locus_tag LOCUS_10160 28814 26907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 30345 28927 gene locus_tag LOCUS_10170 30345 28927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 31354 30413 gene locus_tag LOCUS_10180 31354 30413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228743.1 protein_id gnl|my_center|LOCUS_10180 32733 31534 gene locus_tag LOCUS_10190 32733 31534 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 protein_id gnl|my_center|LOCUS_10190 33350 33048 gene locus_tag LOCUS_10200 33350 33048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 34177 33560 gene locus_tag LOCUS_10210 34177 33560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030751.1 protein_id gnl|my_center|LOCUS_10210 34344 34769 gene locus_tag LOCUS_10220 34344 34769 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026899.1 protein_id gnl|my_center|LOCUS_10220 35135 34788 gene locus_tag LOCUS_10230 35135 34788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877697.1 protein_id gnl|my_center|LOCUS_10230 35246 35782 gene locus_tag LOCUS_10240 35246 35782 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170904.1 protein_id gnl|my_center|LOCUS_10240 35967 36284 gene locus_tag LOCUS_10250 35967 36284 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382829.1 protein_id gnl|my_center|LOCUS_10250 36455 39751 gene locus_tag LOCUS_10260 36455 39751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 39796 40824 gene locus_tag LOCUS_10270 39796 40824 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 protein_id gnl|my_center|LOCUS_10270 42126 41014 gene locus_tag LOCUS_10280 42126 41014 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971615.1 protein_id gnl|my_center|LOCUS_10280 43126 42266 gene locus_tag LOCUS_10290 43126 42266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_10290 44148 43123 gene locus_tag LOCUS_10300 44148 43123 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_10300 44880 44266 gene locus_tag LOCUS_10310 44880 44266 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_10310 45056 45823 gene locus_tag LOCUS_10320 gene map 45056 45823 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_10320 45996 46877 gene locus_tag LOCUS_10330 45996 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 46954 47691 gene locus_tag LOCUS_10340 46954 47691 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 protein_id gnl|my_center|LOCUS_10340 48192 47725 gene locus_tag LOCUS_10350 48192 47725 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_10350 48702 48217 gene locus_tag LOCUS_10360 48702 48217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029233.1 protein_id gnl|my_center|LOCUS_10360 48791 50815 gene locus_tag LOCUS_10370 48791 50815 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031470.1 protein_id gnl|my_center|LOCUS_10370 51269 50871 gene locus_tag LOCUS_10380 51269 50871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 51694 51341 gene locus_tag LOCUS_10390 51694 51341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 53420 51750 gene locus_tag LOCUS_10400 53420 51750 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_10400 55916 53853 gene locus_tag LOCUS_10410 55916 53853 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_10410 56236 57549 gene locus_tag LOCUS_10420 56236 57549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 58623 57652 gene locus_tag LOCUS_10430 58623 57652 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786700.1 protein_id gnl|my_center|LOCUS_10430 58957 58700 gene locus_tag LOCUS_10440 58957 58700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 59148 58954 gene locus_tag LOCUS_10450 59148 58954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 59257 60102 gene locus_tag LOCUS_10460 59257 60102 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974794.1 protein_id gnl|my_center|LOCUS_10460 60081 60272 gene locus_tag LOCUS_10470 60081 60272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 60705 60259 gene locus_tag LOCUS_10480 60705 60259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 60704 61192 gene locus_tag LOCUS_10490 60704 61192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 61610 61164 gene locus_tag LOCUS_10500 61610 61164 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027669.1 protein_id gnl|my_center|LOCUS_10500 62789 61671 gene locus_tag LOCUS_10510 62789 61671 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_10510 63445 62786 gene locus_tag LOCUS_10520 63445 62786 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_10520 63623 65236 gene locus_tag LOCUS_10530 gene metG 63623 65236 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975149.1 protein_id gnl|my_center|LOCUS_10530 66243 65422 gene locus_tag LOCUS_10540 66243 65422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 67123 66254 gene locus_tag LOCUS_10550 67123 66254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 67625 67116 gene locus_tag LOCUS_10560 67625 67116 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225162.1 protein_id gnl|my_center|LOCUS_10560 69543 67780 gene locus_tag LOCUS_10570 gene aspS 69543 67780 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_10570 69731 71875 gene locus_tag LOCUS_10580 69731 71875 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_10580 73032 71902 gene locus_tag LOCUS_10590 73032 71902 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975144.1 protein_id gnl|my_center|LOCUS_10590 73735 73043 gene locus_tag LOCUS_10600 73735 73043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 74607 74032 gene locus_tag LOCUS_10610 74607 74032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 74670 76496 gene locus_tag LOCUS_10620 74670 76496 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_10620 76681 77985 gene locus_tag LOCUS_10630 76681 77985 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_10630 78074 78283 gene locus_tag LOCUS_10640 78074 78283 CDS product DUF6458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975139.1 protein_id gnl|my_center|LOCUS_10640 80149 78314 gene locus_tag LOCUS_10650 80149 78314 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_10650 81219 80146 gene locus_tag LOCUS_10660 81219 80146 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029658.1 protein_id gnl|my_center|LOCUS_10660 81301 82548 gene locus_tag LOCUS_10670 81301 82548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_10670 82545 83039 gene locus_tag LOCUS_10680 82545 83039 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975131.1 protein_id gnl|my_center|LOCUS_10680 83913 83101 gene locus_tag LOCUS_10690 83913 83101 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_10690 84091 84915 gene locus_tag LOCUS_10700 84091 84915 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_10700 86414 84963 gene locus_tag LOCUS_10710 86414 84963 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_10710 87100 86411 gene locus_tag LOCUS_10720 87100 86411 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_10720 87450 87244 gene locus_tag LOCUS_10730 87450 87244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 87350 88258 gene locus_tag LOCUS_10740 87350 88258 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_10740 88445 89266 gene locus_tag LOCUS_10750 88445 89266 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775665.1 protein_id gnl|my_center|LOCUS_10750 90784 89438 gene locus_tag LOCUS_10760 90784 89438 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_10760 91818 90838 gene locus_tag LOCUS_10770 91818 90838 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_10770 93020 91821 gene locus_tag LOCUS_10780 gene pdhA 93020 91821 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_10780 93333 94004 gene locus_tag LOCUS_10790 93333 94004 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_10790 94125 94556 gene locus_tag LOCUS_10800 94125 94556 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029249.1 protein_id gnl|my_center|LOCUS_10800 94664 95713 gene locus_tag LOCUS_10810 94664 95713 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_10810 97373 95763 gene locus_tag LOCUS_10820 97373 95763 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326665.1 protein_id gnl|my_center|LOCUS_10820 97757 99385 gene locus_tag LOCUS_10830 97757 99385 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029251.1 protein_id gnl|my_center|LOCUS_10830 99396 99827 gene locus_tag LOCUS_10840 99396 99827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 100056 99808 gene locus_tag LOCUS_10850 100056 99808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 99995 100648 gene locus_tag LOCUS_10860 99995 100648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 100806 101501 gene locus_tag LOCUS_10870 100806 101501 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_10870 101618 102334 gene locus_tag LOCUS_10880 101618 102334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_10880 102331 105273 gene locus_tag LOCUS_10890 102331 105273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 105373 105927 gene locus_tag LOCUS_10900 105373 105927 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_10900 107143 106157 gene locus_tag LOCUS_10910 107143 106157 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_10910 108316 107261 gene locus_tag LOCUS_10920 108316 107261 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_10920 109830 108337 gene locus_tag LOCUS_10930 109830 108337 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029253.1 protein_id gnl|my_center|LOCUS_10930 110756 109827 gene locus_tag LOCUS_10940 110756 109827 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943903.1 protein_id gnl|my_center|LOCUS_10940 112516 111101 gene locus_tag LOCUS_10950 112516 111101 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029255.1 protein_id gnl|my_center|LOCUS_10950 113547 112516 gene locus_tag LOCUS_10960 113547 112516 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029256.1 protein_id gnl|my_center|LOCUS_10960 114725 113544 gene locus_tag LOCUS_10970 gene pdhA 114725 113544 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_10970 114900 115412 gene locus_tag LOCUS_10980 114900 115412 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_10980 116071 115475 gene locus_tag LOCUS_10990 116071 115475 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975101.1 protein_id gnl|my_center|LOCUS_10990 117615 116068 gene locus_tag LOCUS_11000 117615 116068 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_11000 117857 119566 gene locus_tag LOCUS_11010 gene paaN 117857 119566 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029260.1 protein_id gnl|my_center|LOCUS_11010 120363 119611 gene locus_tag LOCUS_11020 120363 119611 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029261.1 protein_id gnl|my_center|LOCUS_11020 121705 120398 gene locus_tag LOCUS_11030 121705 120398 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 protein_id gnl|my_center|LOCUS_11030 122460 121702 gene locus_tag LOCUS_11040 122460 121702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 122575 123618 gene locus_tag LOCUS_11050 gene paaA 122575 123618 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_11050 123615 123905 gene locus_tag LOCUS_11060 gene paaB 123615 123905 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_11060 123902 124672 gene locus_tag LOCUS_11070 gene paaC 123902 124672 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_11070 124666 125205 gene locus_tag LOCUS_11080 gene paaJ 124666 125205 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_11080 125206 126279 gene locus_tag LOCUS_11090 gene paaK 125206 126279 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083203.1 protein_id gnl|my_center|LOCUS_11090 126727 126383 gene locus_tag LOCUS_11100 126727 126383 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_11100 127779 126796 gene locus_tag LOCUS_11110 127779 126796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975094.1 protein_id gnl|my_center|LOCUS_11110 129324 127882 gene locus_tag LOCUS_11120 129324 127882 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029264.1 protein_id gnl|my_center|LOCUS_11120 129811 129455 gene locus_tag LOCUS_11130 129811 129455 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031457.1 protein_id gnl|my_center|LOCUS_11130 129978 130589 gene locus_tag LOCUS_11140 129978 130589 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026806.1 protein_id gnl|my_center|LOCUS_11140 130985 130899 gene locus_tag LOCUS_t00100 130985 130899 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 131301 132173 gene locus_tag LOCUS_11150 gene fhaA 131301 132173 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_11150 132184 132699 gene locus_tag LOCUS_11160 gene fhaB 132184 132699 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_11160 132838 134355 gene locus_tag LOCUS_11170 132838 134355 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_11170 134381 135790 gene locus_tag LOCUS_11180 134381 135790 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_11180 135787 137247 gene locus_tag LOCUS_11190 135787 137247 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_11190 137603 139618 gene locus_tag LOCUS_11200 gene pknB 137603 139618 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_11200 140525 139740 gene locus_tag LOCUS_11210 140525 139740 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975085.1 protein_id gnl|my_center|LOCUS_11210 142116 140668 gene locus_tag LOCUS_11220 142116 140668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 142754 142113 gene locus_tag LOCUS_11230 142754 142113 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_11230 142924 142751 gene locus_tag LOCUS_11240 142924 142751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174256084.1 protein_id gnl|my_center|LOCUS_11240 143856 143089 gene locus_tag LOCUS_11250 143856 143089 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_11250 143998 144255 gene locus_tag LOCUS_11260 gene crgA 143998 144255 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_11260 145457 144564 gene locus_tag LOCUS_11270 145457 144564 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_11270 146113 145586 gene locus_tag LOCUS_11280 146113 145586 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_11280 146301 146453 gene locus_tag LOCUS_11290 146301 146453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 146426 147223 gene locus_tag LOCUS_11300 146426 147223 CDS product DUF5324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029273.1 protein_id gnl|my_center|LOCUS_11300 147931 147488 gene locus_tag LOCUS_11310 147931 147488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 148924 148097 gene locus_tag LOCUS_11320 148924 148097 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_11320 149093 149716 gene locus_tag LOCUS_11330 149093 149716 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 protein_id gnl|my_center|LOCUS_11330 149909 149836 gene locus_tag LOCUS_t00110 149909 149836 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 150089 150637 gene locus_tag LOCUS_11340 150089 150637 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029275.1 protein_id gnl|my_center|LOCUS_11340 150726 152282 gene locus_tag LOCUS_11350 150726 152282 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029276.1 protein_id gnl|my_center|LOCUS_11350 153783 152347 gene locus_tag LOCUS_11360 153783 152347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029277.1 protein_id gnl|my_center|LOCUS_11360 154088 153954 gene locus_tag LOCUS_11370 154088 153954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11370 154688 154769 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 156646 155279 gene locus_tag LOCUS_11380 156646 155279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 156901 156662 gene locus_tag LOCUS_11390 156901 156662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 157486 157076 gene locus_tag LOCUS_11400 157486 157076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 157713 158174 gene locus_tag LOCUS_11410 157713 158174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 158258 158857 gene locus_tag LOCUS_11420 158258 158857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 158854 159639 gene locus_tag LOCUS_11430 158854 159639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 159636 160646 gene locus_tag LOCUS_11440 159636 160646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 160643 160936 gene locus_tag LOCUS_11450 160643 160936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 160933 162447 gene locus_tag LOCUS_11460 160933 162447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 162525 164000 gene locus_tag LOCUS_11470 162525 164000 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225386.1 protein_id gnl|my_center|LOCUS_11470 163997 164296 gene locus_tag LOCUS_11480 163997 164296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 164293 164586 gene locus_tag LOCUS_11490 164293 164586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 164668 165054 gene locus_tag LOCUS_11500 164668 165054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 165054 165878 gene locus_tag LOCUS_11510 165054 165878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 165946 166926 gene locus_tag LOCUS_11520 165946 166926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 166923 167627 gene locus_tag LOCUS_11530 166923 167627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 167627 167953 gene locus_tag LOCUS_11540 167627 167953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 167950 168144 gene locus_tag LOCUS_11550 167950 168144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 168208 168702 gene locus_tag LOCUS_11560 168208 168702 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 protein_id gnl|my_center|LOCUS_11560 168720 169082 gene locus_tag LOCUS_11570 168720 169082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 169082 169273 gene locus_tag LOCUS_11580 169082 169273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 169270 169953 gene locus_tag LOCUS_11590 169270 169953 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325987.1 protein_id gnl|my_center|LOCUS_11590 169965 170510 gene locus_tag LOCUS_11600 169965 170510 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 protein_id gnl|my_center|LOCUS_11600 170586 171122 gene locus_tag LOCUS_11610 170586 171122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 171119 171697 gene locus_tag LOCUS_11620 171119 171697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 171694 172833 gene locus_tag LOCUS_11630 171694 172833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 172830 173993 gene locus_tag LOCUS_11640 172830 173993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 173990 174361 gene locus_tag LOCUS_11650 173990 174361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 174455 175285 gene locus_tag LOCUS_11660 174455 175285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 175805 175287 gene locus_tag LOCUS_11670 175805 175287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 175879 176589 gene locus_tag LOCUS_11680 175879 176589 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036339.1 protein_id gnl|my_center|LOCUS_11680 177487 177164 gene locus_tag LOCUS_11690 177487 177164 CDS product DUF6233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185906780.1 protein_id gnl|my_center|LOCUS_11690 177725 178255 gene locus_tag LOCUS_11700 177725 178255 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_11700 178255 178734 gene locus_tag LOCUS_11710 178255 178734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 179214 178780 gene locus_tag LOCUS_11720 179214 178780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 179503 179204 gene locus_tag LOCUS_11730 179503 179204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 179660 179971 gene locus_tag LOCUS_11740 179660 179971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 179971 180108 gene locus_tag LOCUS_11750 179971 180108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 180181 180546 gene locus_tag LOCUS_11760 180181 180546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 180580 181950 gene locus_tag LOCUS_11770 180580 181950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 181954 182481 gene locus_tag LOCUS_11780 181954 182481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 182478 182975 gene locus_tag LOCUS_11790 182478 182975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 182972 183559 gene locus_tag LOCUS_11800 182972 183559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 183816 184853 gene locus_tag LOCUS_11810 183816 184853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 185007 185378 gene locus_tag LOCUS_11820 185007 185378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 185542 185910 gene locus_tag LOCUS_11830 185542 185910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 186066 186485 gene locus_tag LOCUS_11840 186066 186485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 186890 186759 gene locus_tag LOCUS_11850 186890 186759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 187400 187738 gene locus_tag LOCUS_11860 187400 187738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 188170 187799 gene locus_tag LOCUS_11870 188170 187799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 188160 188684 gene locus_tag LOCUS_11880 188160 188684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 188681 189961 gene locus_tag LOCUS_11890 188681 189961 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_11890 189961 190113 gene locus_tag LOCUS_11900 189961 190113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 190113 191627 gene locus_tag LOCUS_11910 190113 191627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 191642 192754 gene locus_tag LOCUS_11920 191642 192754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 192990 192751 gene locus_tag LOCUS_11930 192990 192751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 193148 193948 gene locus_tag LOCUS_11940 193148 193948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 193964 194914 gene locus_tag LOCUS_11950 193964 194914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 194995 195378 gene locus_tag LOCUS_11960 194995 195378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 195375 195797 gene locus_tag LOCUS_11970 195375 195797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 195797 196306 gene locus_tag LOCUS_11980 195797 196306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 196320 196985 gene locus_tag LOCUS_11990 196320 196985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 196985 197302 gene locus_tag LOCUS_12000 196985 197302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 197315 197662 gene locus_tag LOCUS_12010 197315 197662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 197659 198093 gene locus_tag LOCUS_12020 197659 198093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 198104 198583 gene locus_tag LOCUS_12030 198104 198583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 198583 199098 gene locus_tag LOCUS_12040 198583 199098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 199311 201842 gene locus_tag LOCUS_12050 199311 201842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 201842 204607 gene locus_tag LOCUS_12060 201842 204607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 204609 205829 gene locus_tag LOCUS_12070 204609 205829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 205840 206244 gene locus_tag LOCUS_12080 205840 206244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 206310 206573 gene locus_tag LOCUS_12090 206310 206573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 206573 207439 gene locus_tag LOCUS_12100 206573 207439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 207454 207684 gene locus_tag LOCUS_12110 207454 207684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 207681 207950 gene locus_tag LOCUS_12120 207681 207950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 208377 208003 gene locus_tag LOCUS_12130 208377 208003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 208616 208374 gene locus_tag LOCUS_12140 208616 208374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 208497 209051 gene locus_tag LOCUS_12150 208497 209051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 210258 209032 gene locus_tag LOCUS_12160 210258 209032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 210450 210797 gene locus_tag LOCUS_12170 210450 210797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 210794 211039 gene locus_tag LOCUS_12180 210794 211039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 211036 211191 gene locus_tag LOCUS_12190 211036 211191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 211531 211295 gene locus_tag LOCUS_12200 211531 211295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 212187 212113 gene locus_tag LOCUS_t00120 212187 212113 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 213060 212293 gene locus_tag LOCUS_12210 213060 212293 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326689.1 protein_id gnl|my_center|LOCUS_12210 215693 213066 gene locus_tag LOCUS_12220 gene gyrA 215693 213066 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_12220 217814 215736 gene locus_tag LOCUS_12230 gene gyrB 217814 215736 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_12230 218956 218399 gene locus_tag LOCUS_12240 218956 218399 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_12240 220110 218953 gene locus_tag LOCUS_12250 gene recF 220110 218953 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_12250 221115 220162 gene locus_tag LOCUS_12260 gene gnd 221115 220162 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_12260 222406 221276 gene locus_tag LOCUS_12270 gene dnaN 222406 221276 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_12270 225079 223304 gene locus_tag LOCUS_12280 gene dnaA 225079 223304 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 protein_id gnl|my_center|LOCUS_12280 225482 225619 gene locus_tag LOCUS_12290 gene rpmH 225482 225619 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_12290 225815 226009 gene locus_tag LOCUS_12300 225815 226009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 226006 226371 gene locus_tag LOCUS_12310 gene yidD 226006 226371 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975049.1 protein_id gnl|my_center|LOCUS_12310 226375 227646 gene locus_tag LOCUS_12320 gene yidC 226375 227646 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029289.1 protein_id gnl|my_center|LOCUS_12320 227697 228209 gene locus_tag LOCUS_12330 227697 228209 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_12330 228320 229036 gene locus_tag LOCUS_12340 gene rsmG 228320 229036 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_12340 229361 230389 gene locus_tag LOCUS_12350 229361 230389 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_12350 230386 231528 gene locus_tag LOCUS_12360 230386 231528 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_12360 231832 232449 gene locus_tag LOCUS_12370 231832 232449 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_12370 232900 232571 gene locus_tag LOCUS_12380 gene trxA 232900 232571 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_12380 233918 232944 gene locus_tag LOCUS_12390 gene trxB 233918 232944 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_12390 235071 234043 gene locus_tag LOCUS_12400 235071 234043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 235814 235068 gene locus_tag LOCUS_12410 gene sigM 235814 235068 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_12410 237638 235845 gene locus_tag LOCUS_12420 237638 235845 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 protein_id gnl|my_center|LOCUS_12420 240097 237758 gene locus_tag LOCUS_12430 gene murJ 240097 237758 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029297.1 protein_id gnl|my_center|LOCUS_12430 242644 240143 gene locus_tag LOCUS_12440 242644 240143 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_12440 242836 244302 gene locus_tag LOCUS_12450 242836 244302 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_12450 245708 244422 gene locus_tag LOCUS_12460 245708 244422 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_12460 246887 245805 gene locus_tag LOCUS_12470 246887 245805 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_12470 247701 246949 gene locus_tag LOCUS_12480 247701 246949 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_12480 248063 250789 gene locus_tag LOCUS_12490 248063 250789 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 protein_id gnl|my_center|LOCUS_12490 250971 252467 gene locus_tag LOCUS_12500 250971 252467 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_12500 253622 252591 gene locus_tag LOCUS_12510 253622 252591 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_12510 254903 253785 gene locus_tag LOCUS_12520 gene femX 254903 253785 CDS product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 protein_id gnl|my_center|LOCUS_12520 255356 255039 gene locus_tag LOCUS_12530 255356 255039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_12530 255628 255918 gene locus_tag LOCUS_12540 gene rpsF 255628 255918 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_12540 255995 256600 gene locus_tag LOCUS_12550 255995 256600 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029303.1 protein_id gnl|my_center|LOCUS_12550 256643 256879 gene locus_tag LOCUS_12560 gene rpsR 256643 256879 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_12560 256898 257344 gene locus_tag LOCUS_12570 gene rplI 256898 257344 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_12570 258928 257510 gene locus_tag LOCUS_12580 258928 257510 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_12580 259352 261760 gene locus_tag LOCUS_12590 259352 261760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 263215 261965 gene locus_tag LOCUS_12600 263215 261965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 263160 263450 gene locus_tag LOCUS_12610 263160 263450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 263410 263604 gene locus_tag LOCUS_12620 263410 263604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 263804 264106 gene locus_tag LOCUS_12630 263804 264106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 264221 264622 gene locus_tag LOCUS_12640 264221 264622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 265072 264668 gene locus_tag LOCUS_12650 265072 264668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046584027.1 protein_id gnl|my_center|LOCUS_12650 265180 265575 gene locus_tag LOCUS_12660 265180 265575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 265847 266203 gene locus_tag LOCUS_12670 265847 266203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 267141 266386 gene locus_tag LOCUS_12680 267141 266386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 267244 267771 gene locus_tag LOCUS_12690 267244 267771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 268815 267808 gene locus_tag LOCUS_12700 268815 267808 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027205.1 protein_id gnl|my_center|LOCUS_12700 269414 268845 gene locus_tag LOCUS_12710 269414 268845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 270856 269600 gene locus_tag LOCUS_12720 270856 269600 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776478.1 protein_id gnl|my_center|LOCUS_12720 270762 271046 gene locus_tag LOCUS_12730 270762 271046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 271102 272487 gene locus_tag LOCUS_12740 271102 272487 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 protein_id gnl|my_center|LOCUS_12740 273238 272738 gene locus_tag LOCUS_12750 273238 272738 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_12750 273758 273249 gene locus_tag LOCUS_12760 273758 273249 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 protein_id gnl|my_center|LOCUS_12760 273898 275094 gene locus_tag LOCUS_12770 273898 275094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_12770 275747 275109 gene locus_tag LOCUS_12780 275747 275109 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027389.1 protein_id gnl|my_center|LOCUS_12780 275725 276405 gene locus_tag LOCUS_12790 275725 276405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 276958 276479 gene locus_tag LOCUS_12800 276958 276479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 277904 277011 gene locus_tag LOCUS_12810 277904 277011 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_12810 279283 278126 gene locus_tag LOCUS_12820 279283 278126 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029309.1 protein_id gnl|my_center|LOCUS_12820 279670 279290 gene locus_tag LOCUS_12830 279670 279290 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_12830 279685 280002 gene locus_tag LOCUS_12840 279685 280002 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029310.1 protein_id gnl|my_center|LOCUS_12840 280222 280440 gene locus_tag LOCUS_12850 280222 280440 CDS product DUF5326 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029311.1 protein_id gnl|my_center|LOCUS_12850 280681 281412 gene locus_tag LOCUS_12860 280681 281412 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029312.1 protein_id gnl|my_center|LOCUS_12860 281565 281999 gene locus_tag LOCUS_12870 281565 281999 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975006.1 protein_id gnl|my_center|LOCUS_12870 283362 282058 gene locus_tag LOCUS_12880 283362 282058 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 protein_id gnl|my_center|LOCUS_12880 283570 285369 gene locus_tag LOCUS_12890 gene thiC 283570 285369 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029315.1 protein_id gnl|my_center|LOCUS_12890 285733 287079 gene locus_tag LOCUS_12900 285733 287079 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226023.1 protein_id gnl|my_center|LOCUS_12900 287104 288360 gene locus_tag LOCUS_12910 287104 288360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 288439 288957 gene locus_tag LOCUS_12920 288439 288957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 288964 289317 gene locus_tag LOCUS_12930 288964 289317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 289314 291026 gene locus_tag LOCUS_12940 289314 291026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 291056 291625 gene locus_tag LOCUS_12950 291056 291625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 291879 292880 gene locus_tag LOCUS_12960 291879 292880 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225015.1 protein_id gnl|my_center|LOCUS_12960 292873 293544 gene locus_tag LOCUS_12970 292873 293544 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225016.1 protein_id gnl|my_center|LOCUS_12970 294412 293594 gene locus_tag LOCUS_12980 294412 293594 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029327.1 protein_id gnl|my_center|LOCUS_12980 296014 294560 gene locus_tag LOCUS_12990 296014 294560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 297299 296211 gene locus_tag LOCUS_13000 297299 296211 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 protein_id gnl|my_center|LOCUS_13000 297809 298888 gene locus_tag LOCUS_13010 gene hisC 297809 298888 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_13010 299100 300629 gene locus_tag LOCUS_13020 299100 300629 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974998.1 protein_id gnl|my_center|LOCUS_13020 300646 301647 gene locus_tag LOCUS_13030 gene cydB 300646 301647 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_13030 301730 305296 gene locus_tag LOCUS_13040 gene cydD 301730 305296 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_13040 305307 307103 gene locus_tag LOCUS_13050 305307 307103 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 protein_id gnl|my_center|LOCUS_13050 307969 307100 gene locus_tag LOCUS_13060 307969 307100 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_13060 308966 308061 gene locus_tag LOCUS_13070 308966 308061 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326709.1 protein_id gnl|my_center|LOCUS_13070 309545 309021 gene locus_tag LOCUS_13080 309545 309021 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_13080 310722 309760 gene locus_tag LOCUS_13090 310722 309760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 311727 310753 gene locus_tag LOCUS_13100 311727 310753 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 protein_id gnl|my_center|LOCUS_13100 313667 311724 gene locus_tag LOCUS_13110 313667 311724 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551438.1 protein_id gnl|my_center|LOCUS_13110 314509 313667 gene locus_tag LOCUS_13120 314509 313667 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485334.1 protein_id gnl|my_center|LOCUS_13120 314770 315852 gene locus_tag LOCUS_13130 314770 315852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_13130 315842 316723 gene locus_tag LOCUS_13140 315842 316723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_13140 316720 317631 gene locus_tag LOCUS_13150 316720 317631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_13150 317661 318380 gene locus_tag LOCUS_13160 317661 318380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_13160 318647 319357 gene locus_tag LOCUS_13170 318647 319357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 320534 319680 gene locus_tag LOCUS_13180 320534 319680 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 protein_id gnl|my_center|LOCUS_13180 321820 320531 gene locus_tag LOCUS_13190 gene serS 321820 320531 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_13190 323315 322380 gene locus_tag LOCUS_13200 gene pheA 323315 322380 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_13200 324688 323384 gene locus_tag LOCUS_13210 gene efeB 324688 323384 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029343.1 protein_id gnl|my_center|LOCUS_13210 326705 324693 gene locus_tag LOCUS_13220 326705 324693 CDS product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029406.1 protein_id gnl|my_center|LOCUS_13220 327079 326720 gene locus_tag LOCUS_13230 327079 326720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 327036 327242 gene locus_tag LOCUS_13240 327036 327242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 327885 327223 gene locus_tag LOCUS_13250 327885 327223 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_13250 328813 327956 gene locus_tag LOCUS_13260 328813 327956 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_13260 329787 328921 gene locus_tag LOCUS_13270 329787 328921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029346.1 protein_id gnl|my_center|LOCUS_13270 329980 330465 gene locus_tag LOCUS_13280 329980 330465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 332138 330615 gene locus_tag LOCUS_13290 332138 330615 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_13290 333678 332284 gene locus_tag LOCUS_13300 333678 332284 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029348.1 protein_id gnl|my_center|LOCUS_13300 334317 335000 gene locus_tag LOCUS_13310 334317 335000 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974971.1 protein_id gnl|my_center|LOCUS_13310 335210 335710 gene locus_tag LOCUS_13320 335210 335710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 336963 335983 gene locus_tag LOCUS_13330 336963 335983 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_13330 337719 337204 gene locus_tag LOCUS_13340 337719 337204 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974968.1 protein_id gnl|my_center|LOCUS_13340 338691 337882 gene locus_tag LOCUS_13350 338691 337882 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_13350 338961 340460 gene locus_tag LOCUS_13360 338961 340460 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029350.1 protein_id gnl|my_center|LOCUS_13360 340701 341819 gene locus_tag LOCUS_13370 gene ansZ 340701 341819 CDS product asparaginase AnsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246337.1 protein_id gnl|my_center|LOCUS_13370 343184 341859 gene locus_tag LOCUS_13380 343184 341859 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226537.1 protein_id gnl|my_center|LOCUS_13380 343519 343181 gene locus_tag LOCUS_13390 343519 343181 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265538.1 protein_id gnl|my_center|LOCUS_13390 344183 343545 gene locus_tag LOCUS_13400 344183 343545 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_13400 346286 344508 gene locus_tag LOCUS_13410 346286 344508 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051183874.1 protein_id gnl|my_center|LOCUS_13410 346782 348266 gene locus_tag LOCUS_13420 346782 348266 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031445.1 protein_id gnl|my_center|LOCUS_13420 349796 348306 gene locus_tag LOCUS_13430 349796 348306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 350683 350874 gene locus_tag LOCUS_13440 350683 350874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 351860 350976 gene locus_tag LOCUS_13450 351860 350976 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_13450 352885 352972 gene locus_tag LOCUS_t00130 352885 352972 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 353618 355951 gene locus_tag LOCUS_13460 353618 355951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 356823 356164 gene locus_tag LOCUS_13470 356823 356164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 357109 357564 gene locus_tag LOCUS_13480 357109 357564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 357746 358681 gene locus_tag LOCUS_13490 357746 358681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 359701 358757 gene locus_tag LOCUS_13500 359701 358757 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029372.1 protein_id gnl|my_center|LOCUS_13500 360031 360336 gene locus_tag LOCUS_13510 360031 360336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974960.1 protein_id gnl|my_center|LOCUS_13510 360705 360400 gene locus_tag LOCUS_13520 360705 360400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 360808 361416 gene locus_tag LOCUS_13530 360808 361416 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_13530 361611 363269 gene locus_tag LOCUS_13540 361611 363269 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029376.1 protein_id gnl|my_center|LOCUS_13540 367502 363342 gene locus_tag LOCUS_13550 367502 363342 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029379.1 protein_id gnl|my_center|LOCUS_13550 368275 367790 gene locus_tag LOCUS_13560 368275 367790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 368492 368583 gene locus_tag LOCUS_t00140 368492 368583 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 368757 368830 gene locus_tag LOCUS_t00150 368757 368830 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 370477 370235 gene locus_tag LOCUS_13570 370477 370235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 370879 370670 gene locus_tag LOCUS_13580 370879 370670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 372874 371708 gene locus_tag LOCUS_13590 372874 371708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 373326 374522 gene locus_tag LOCUS_13600 373326 374522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 374747 375949 gene locus_tag LOCUS_13610 374747 375949 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_13610 376067 376630 gene locus_tag LOCUS_13620 376067 376630 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031787.1 protein_id gnl|my_center|LOCUS_13620 376733 377386 gene locus_tag LOCUS_13630 376733 377386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 377605 377426 gene locus_tag LOCUS_13640 377605 377426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 377672 378265 gene locus_tag LOCUS_13650 377672 378265 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175439.1 protein_id gnl|my_center|LOCUS_13650 378304 379209 gene locus_tag LOCUS_13660 378304 379209 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628631.1 protein_id gnl|my_center|LOCUS_13660 379279 380190 gene locus_tag LOCUS_13670 379279 380190 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029384.1 protein_id gnl|my_center|LOCUS_13670 380339 380644 gene locus_tag LOCUS_13680 380339 380644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 380787 381491 gene locus_tag LOCUS_13690 380787 381491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_13690 381614 383158 gene locus_tag LOCUS_13700 381614 383158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_13700 383204 384019 gene locus_tag LOCUS_13710 383204 384019 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029392.1 protein_id gnl|my_center|LOCUS_13710 384590 384120 gene locus_tag LOCUS_13720 384590 384120 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974936.1 protein_id gnl|my_center|LOCUS_13720 385428 384601 gene locus_tag LOCUS_13730 385428 384601 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029395.1 protein_id gnl|my_center|LOCUS_13730 388037 385632 gene locus_tag LOCUS_13740 388037 385632 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029396.1 protein_id gnl|my_center|LOCUS_13740 388707 388162 gene locus_tag LOCUS_13750 388707 388162 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029397.1 protein_id gnl|my_center|LOCUS_13750 388961 389167 gene locus_tag LOCUS_13760 388961 389167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 389396 389184 gene locus_tag LOCUS_13770 389396 389184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 390383 389505 gene locus_tag LOCUS_13780 390383 389505 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974928.1 protein_id gnl|my_center|LOCUS_13780 391615 390605 gene locus_tag LOCUS_13790 391615 390605 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029398.1 protein_id gnl|my_center|LOCUS_13790 392132 391839 gene locus_tag LOCUS_13800 392132 391839 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974926.1 protein_id gnl|my_center|LOCUS_13800 392421 392257 gene locus_tag LOCUS_13810 392421 392257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 392838 395027 gene locus_tag LOCUS_13820 392838 395027 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027193.1 protein_id gnl|my_center|LOCUS_13820 395195 396079 gene locus_tag LOCUS_13830 395195 396079 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831427.1 protein_id gnl|my_center|LOCUS_13830 396253 396168 gene locus_tag LOCUS_t00160 396253 396168 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 396794 396285 gene locus_tag LOCUS_13840 gene tadA 396794 396285 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_13840 397348 396794 gene locus_tag LOCUS_13850 397348 396794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974923.1 protein_id gnl|my_center|LOCUS_13850 398143 397601 gene locus_tag LOCUS_13860 398143 397601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 398105 398740 gene locus_tag LOCUS_13870 gene upp 398105 398740 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_13870 399443 398808 gene locus_tag LOCUS_13880 399443 398808 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974920.1 protein_id gnl|my_center|LOCUS_13880 399873 399571 gene locus_tag LOCUS_13890 399873 399571 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_13890 401774 400197 gene locus_tag LOCUS_13900 401774 400197 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_13900 402572 401970 gene locus_tag LOCUS_13910 402572 401970 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_13910 402738 405038 gene locus_tag LOCUS_13920 402738 405038 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 protein_id gnl|my_center|LOCUS_13920 405111 407411 gene locus_tag LOCUS_13930 405111 407411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 408862 407471 gene locus_tag LOCUS_13940 408862 407471 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230612.1 protein_id gnl|my_center|LOCUS_13940 409322 408906 gene locus_tag LOCUS_13950 409322 408906 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_13950 409627 410373 gene locus_tag LOCUS_13960 409627 410373 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224871.1 protein_id gnl|my_center|LOCUS_13960 410578 410366 gene locus_tag LOCUS_13970 410578 410366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 410487 411395 gene locus_tag LOCUS_13980 410487 411395 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027024.1 protein_id gnl|my_center|LOCUS_13980 411434 412186 gene locus_tag LOCUS_13990 411434 412186 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226429.1 protein_id gnl|my_center|LOCUS_13990 412979 412239 gene locus_tag LOCUS_14000 412979 412239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 413030 414136 gene locus_tag LOCUS_14010 413030 414136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 414118 415137 gene locus_tag LOCUS_14020 414118 415137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 415149 415661 gene locus_tag LOCUS_14030 415149 415661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 415702 417450 gene locus_tag LOCUS_14040 415702 417450 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975341.1 protein_id gnl|my_center|LOCUS_14040 417560 419389 gene locus_tag LOCUS_14050 417560 419389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 420729 419563 gene locus_tag LOCUS_14060 420729 419563 CDS product NAD-dependent formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169958.1 protein_id gnl|my_center|LOCUS_14060 421829 420843 gene locus_tag LOCUS_14070 421829 420843 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729997.1 protein_id gnl|my_center|LOCUS_14070 422732 421950 gene locus_tag LOCUS_14080 422732 421950 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978033.1 protein_id gnl|my_center|LOCUS_14080 422933 424189 gene locus_tag LOCUS_14090 422933 424189 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029547.1 protein_id gnl|my_center|LOCUS_14090 424186 424974 gene locus_tag LOCUS_14100 424186 424974 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029548.1 protein_id gnl|my_center|LOCUS_14100 424955 425374 gene locus_tag LOCUS_14110 424955 425374 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_14110 425512 427212 gene locus_tag LOCUS_14120 425512 427212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 428733 427267 gene locus_tag LOCUS_14130 428733 427267 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144042.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence04 634 963 gene locus_tag LOCUS_14140 634 963 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030169.1 protein_id gnl|my_center|LOCUS_14140 960 2231 gene locus_tag LOCUS_14150 960 2231 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227255.1 protein_id gnl|my_center|LOCUS_14150 2228 3442 gene locus_tag LOCUS_14160 2228 3442 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 protein_id gnl|my_center|LOCUS_14160 4193 4942 gene locus_tag LOCUS_14170 4193 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 5974 5057 gene locus_tag LOCUS_14180 5974 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6288 5971 gene locus_tag LOCUS_14190 6288 5971 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_14190 7171 6326 gene locus_tag LOCUS_14200 7171 6326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_14200 8481 7204 gene locus_tag LOCUS_14210 8481 7204 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031716.1 protein_id gnl|my_center|LOCUS_14210 9719 8742 gene locus_tag LOCUS_14220 9719 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 9938 10462 gene locus_tag LOCUS_14230 9938 10462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 10606 11235 gene locus_tag LOCUS_14240 10606 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 11232 12179 gene locus_tag LOCUS_14250 11232 12179 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_14250 12745 12167 gene locus_tag LOCUS_14260 12745 12167 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_14260 12936 13868 gene locus_tag LOCUS_14270 12936 13868 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971447.1 protein_id gnl|my_center|LOCUS_14270 13988 16417 gene locus_tag LOCUS_14280 13988 16417 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 protein_id gnl|my_center|LOCUS_14280 16567 16971 gene locus_tag LOCUS_14290 16567 16971 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864086.1 protein_id gnl|my_center|LOCUS_14290 17024 17335 gene locus_tag LOCUS_14300 17024 17335 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_14300 17633 18118 gene locus_tag LOCUS_14310 17633 18118 CDS product DUF6099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030573.1 protein_id gnl|my_center|LOCUS_14310 18234 19184 gene locus_tag LOCUS_14320 18234 19184 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973051.1 protein_id gnl|my_center|LOCUS_14320 19222 20166 gene locus_tag LOCUS_14330 gene mmuM 19222 20166 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_14330 20197 21702 gene locus_tag LOCUS_14340 20197 21702 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485480.1 protein_id gnl|my_center|LOCUS_14340 21699 24341 gene locus_tag LOCUS_14350 21699 24341 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_14350 24570 25802 gene locus_tag LOCUS_14360 24570 25802 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_14360 25958 27007 gene locus_tag LOCUS_14370 gene argF 25958 27007 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_14370 27412 26996 gene locus_tag LOCUS_14380 27412 26996 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973043.1 protein_id gnl|my_center|LOCUS_14380 27779 28606 gene locus_tag LOCUS_14390 27779 28606 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_14390 28591 30957 gene locus_tag LOCUS_14400 28591 30957 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030579.1 protein_id gnl|my_center|LOCUS_14400 31408 30944 gene locus_tag LOCUS_14410 31408 30944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 32282 31452 gene locus_tag LOCUS_14420 32282 31452 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_14420 33978 32326 gene locus_tag LOCUS_14430 gene ambL 33978 32326 CDS product aminobenozate:CoA ligase AmbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485583.1 protein_id gnl|my_center|LOCUS_14430 34085 35206 gene locus_tag LOCUS_14440 34085 35206 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973037.1 protein_id gnl|my_center|LOCUS_14440 35203 35622 gene locus_tag LOCUS_14450 35203 35622 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_14450 35752 38184 gene locus_tag LOCUS_14460 35752 38184 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 protein_id gnl|my_center|LOCUS_14460 38181 39209 gene locus_tag LOCUS_14470 38181 39209 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_14470 39272 40273 gene locus_tag LOCUS_14480 39272 40273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 40815 40420 gene locus_tag LOCUS_14490 40815 40420 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029646.1 protein_id gnl|my_center|LOCUS_14490 40954 42402 gene locus_tag LOCUS_14500 40954 42402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029960.1 protein_id gnl|my_center|LOCUS_14500 42491 43171 gene locus_tag LOCUS_14510 42491 43171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974037.1 protein_id gnl|my_center|LOCUS_14510 43246 43842 gene locus_tag LOCUS_14520 43246 43842 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972778.1 protein_id gnl|my_center|LOCUS_14520 44964 43879 gene locus_tag LOCUS_14530 44964 43879 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895366.1 protein_id gnl|my_center|LOCUS_14530 45466 45113 gene locus_tag LOCUS_14540 45466 45113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 45414 46691 gene locus_tag LOCUS_14550 45414 46691 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030832.1 protein_id gnl|my_center|LOCUS_14550 47023 47604 gene locus_tag LOCUS_14560 47023 47604 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_14560 47767 47967 gene locus_tag LOCUS_14570 47767 47967 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_14570 48574 48056 gene locus_tag LOCUS_14580 48574 48056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 49410 48718 gene locus_tag LOCUS_14590 49410 48718 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531570.1 protein_id gnl|my_center|LOCUS_14590 49523 50899 gene locus_tag LOCUS_14600 49523 50899 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408499.1 protein_id gnl|my_center|LOCUS_14600 52850 50985 gene locus_tag LOCUS_14610 52850 50985 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_14610 53062 53628 gene locus_tag LOCUS_14620 53062 53628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 53679 54221 gene locus_tag LOCUS_14630 53679 54221 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029169.1 protein_id gnl|my_center|LOCUS_14630 54375 54818 gene locus_tag LOCUS_14640 54375 54818 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 protein_id gnl|my_center|LOCUS_14640 55217 54834 gene locus_tag LOCUS_14650 55217 54834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 55553 55269 gene locus_tag LOCUS_14660 55553 55269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 56374 55550 gene locus_tag LOCUS_14670 56374 55550 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030972.1 protein_id gnl|my_center|LOCUS_14670 56832 56371 gene locus_tag LOCUS_14680 56832 56371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 58030 56870 gene locus_tag LOCUS_14690 58030 56870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 58619 58023 gene locus_tag LOCUS_14700 58619 58023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030970.1 protein_id gnl|my_center|LOCUS_14700 58903 58646 gene locus_tag LOCUS_14710 58903 58646 CDS product gas vesicle protein GvpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978210.1 protein_id gnl|my_center|LOCUS_14710 59674 58961 gene locus_tag LOCUS_14720 59674 58961 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972477.1 protein_id gnl|my_center|LOCUS_14720 60142 59678 gene locus_tag LOCUS_14730 60142 59678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 60579 60208 gene locus_tag LOCUS_14740 60579 60208 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742178.1 protein_id gnl|my_center|LOCUS_14740 61539 60847 gene locus_tag LOCUS_14750 61539 60847 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390772.1 protein_id gnl|my_center|LOCUS_14750 61715 62821 gene locus_tag LOCUS_14760 61715 62821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 62805 63788 gene locus_tag LOCUS_14770 62805 63788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 63815 65119 gene locus_tag LOCUS_14780 63815 65119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 65098 65769 gene locus_tag LOCUS_14790 65098 65769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 65766 67445 gene locus_tag LOCUS_14800 65766 67445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 67442 68098 gene locus_tag LOCUS_14810 67442 68098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 68095 69042 gene locus_tag LOCUS_14820 68095 69042 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928887.1 protein_id gnl|my_center|LOCUS_14820 69196 69375 gene locus_tag LOCUS_14830 69196 69375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 71226 69448 gene locus_tag LOCUS_14840 71226 69448 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171583159.1 protein_id gnl|my_center|LOCUS_14840 71441 72661 gene locus_tag LOCUS_14850 71441 72661 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727666.1 protein_id gnl|my_center|LOCUS_14850 72719 73525 gene locus_tag LOCUS_14860 72719 73525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 75792 73567 gene locus_tag LOCUS_14870 75792 73567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 75997 76788 gene locus_tag LOCUS_14880 75997 76788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 77708 76830 gene locus_tag LOCUS_14890 77708 76830 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225811.1 protein_id gnl|my_center|LOCUS_14890 78945 77719 gene locus_tag LOCUS_14900 78945 77719 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_14900 80033 78942 gene locus_tag LOCUS_14910 80033 78942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 80962 80258 gene locus_tag LOCUS_14920 80962 80258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 82677 81295 gene locus_tag LOCUS_14930 82677 81295 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224852.1 protein_id gnl|my_center|LOCUS_14930 83278 82715 gene locus_tag LOCUS_14940 83278 82715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224853.1 protein_id gnl|my_center|LOCUS_14940 83380 83961 gene locus_tag LOCUS_14950 83380 83961 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224854.1 protein_id gnl|my_center|LOCUS_14950 84576 84301 gene locus_tag LOCUS_14960 84576 84301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 84890 84732 gene locus_tag LOCUS_14970 84890 84732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 86734 85205 gene locus_tag LOCUS_14980 86734 85205 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_14980 87126 86926 gene locus_tag LOCUS_14990 87126 86926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 87970 87233 gene locus_tag LOCUS_15000 87970 87233 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862685.1 protein_id gnl|my_center|LOCUS_15000 88171 89046 gene locus_tag LOCUS_15010 88171 89046 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_15010 89058 89678 gene locus_tag LOCUS_15020 89058 89678 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229206.1 protein_id gnl|my_center|LOCUS_15020 89988 92702 gene locus_tag LOCUS_15030 gene acnA 89988 92702 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_15030 92931 93098 gene locus_tag LOCUS_15040 92931 93098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 93327 93124 gene locus_tag LOCUS_15050 93327 93124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 94172 93324 gene locus_tag LOCUS_15060 94172 93324 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_15060 98095 94253 gene locus_tag LOCUS_15070 98095 94253 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 protein_id gnl|my_center|LOCUS_15070 98758 100206 gene locus_tag LOCUS_15080 gene ngcE 98758 100206 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_15080 100255 101184 gene locus_tag LOCUS_15090 100255 101184 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030592.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15090 101184 102107 gene locus_tag LOCUS_15100 101184 102107 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_15100 102503 103702 gene locus_tag LOCUS_15110 102503 103702 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_15110 103824 104936 gene locus_tag LOCUS_15120 103824 104936 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_15120 105141 105920 gene locus_tag LOCUS_15130 105141 105920 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_15130 105917 107209 gene locus_tag LOCUS_15140 105917 107209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_15140 107415 109385 gene locus_tag LOCUS_15150 gene dxs 107415 109385 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_15150 109581 111044 gene locus_tag LOCUS_15160 109581 111044 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_15160 111092 112666 gene locus_tag LOCUS_15170 111092 112666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 113034 112642 gene locus_tag LOCUS_15180 113034 112642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_15180 113136 114293 gene locus_tag LOCUS_15190 113136 114293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972904.1 protein_id gnl|my_center|LOCUS_15190 116498 114372 gene locus_tag LOCUS_15200 116498 114372 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_15200 114550 114457 gene locus_tag LOCUS_t00170 114550 114457 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 117715 116495 gene locus_tag LOCUS_15210 117715 116495 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_15210 119352 118189 gene locus_tag LOCUS_15220 119352 118189 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_15220 120219 119560 gene locus_tag LOCUS_15230 120219 119560 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972894.1 protein_id gnl|my_center|LOCUS_15230 121458 120475 gene locus_tag LOCUS_15240 121458 120475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 121349 122335 gene locus_tag LOCUS_15250 gene hemE 121349 122335 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_15250 123717 122338 gene locus_tag LOCUS_15260 123717 122338 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030612.1 protein_id gnl|my_center|LOCUS_15260 124897 123788 gene locus_tag LOCUS_15270 124897 123788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 125007 126488 gene locus_tag LOCUS_15280 gene hemG 125007 126488 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_15280 126493 127209 gene locus_tag LOCUS_15290 126493 127209 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_15290 127546 128058 gene locus_tag LOCUS_15300 127546 128058 CDS product DUF664 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_15300 128972 128055 gene locus_tag LOCUS_15310 128972 128055 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_15310 129139 129996 gene locus_tag LOCUS_15320 129139 129996 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_15320 131767 130106 gene locus_tag LOCUS_15330 131767 130106 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485448.1 protein_id gnl|my_center|LOCUS_15330 132902 131955 gene locus_tag LOCUS_15340 132902 131955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 134660 132909 gene locus_tag LOCUS_15350 134660 132909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 135596 134811 gene locus_tag LOCUS_15360 135596 134811 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027588.1 protein_id gnl|my_center|LOCUS_15360 136524 135718 gene locus_tag LOCUS_15370 136524 135718 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_15370 136599 137285 gene locus_tag LOCUS_15380 136599 137285 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971849.1 protein_id gnl|my_center|LOCUS_15380 137308 138213 gene locus_tag LOCUS_15390 137308 138213 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030617.1 protein_id gnl|my_center|LOCUS_15390 138210 138878 gene locus_tag LOCUS_15400 138210 138878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972873.1 protein_id gnl|my_center|LOCUS_15400 138911 139066 gene locus_tag LOCUS_15410 138911 139066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 140009 139170 gene locus_tag LOCUS_15420 140009 139170 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_15420 140165 140674 gene locus_tag LOCUS_15430 140165 140674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975331.1 protein_id gnl|my_center|LOCUS_15430 140838 142298 gene locus_tag LOCUS_15440 140838 142298 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 protein_id gnl|my_center|LOCUS_15440 142448 143692 gene locus_tag LOCUS_15450 142448 143692 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027331.1 protein_id gnl|my_center|LOCUS_15450 145136 143769 gene locus_tag LOCUS_15460 145136 143769 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030620.1 protein_id gnl|my_center|LOCUS_15460 145729 145304 gene locus_tag LOCUS_15470 145729 145304 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_15470 147134 145812 gene locus_tag LOCUS_15480 gene zapE 147134 145812 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_15480 147133 147939 gene locus_tag LOCUS_15490 147133 147939 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_15490 148084 148623 gene locus_tag LOCUS_15500 148084 148623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972862.1 protein_id gnl|my_center|LOCUS_15500 148702 150102 gene locus_tag LOCUS_15510 gene murC 148702 150102 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_15510 150121 150528 gene locus_tag LOCUS_15520 gene msrB 150121 150528 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_15520 150737 152149 gene locus_tag LOCUS_15530 150737 152149 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222156.1 protein_id gnl|my_center|LOCUS_15530 152175 152741 gene locus_tag LOCUS_15540 152175 152741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 153170 152778 gene locus_tag LOCUS_15550 153170 152778 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031553.1 protein_id gnl|my_center|LOCUS_15550 153306 153944 gene locus_tag LOCUS_15560 153306 153944 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731541.1 protein_id gnl|my_center|LOCUS_15560 154080 155060 gene locus_tag LOCUS_15570 154080 155060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 155647 155057 gene locus_tag LOCUS_15580 155647 155057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 protein_id gnl|my_center|LOCUS_15580 156786 155803 gene locus_tag LOCUS_15590 156786 155803 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973989.1 protein_id gnl|my_center|LOCUS_15590 158721 156874 gene locus_tag LOCUS_15600 gene treZ 158721 156874 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 protein_id gnl|my_center|LOCUS_15600 159728 158820 gene locus_tag LOCUS_15610 159728 158820 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_15610 159863 160411 gene locus_tag LOCUS_15620 159863 160411 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_15620 162827 160485 gene locus_tag LOCUS_15630 gene treY 162827 160485 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030639.1 protein_id gnl|my_center|LOCUS_15630 165167 163044 gene locus_tag LOCUS_15640 gene glgX 165167 163044 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_15640 165569 166801 gene locus_tag LOCUS_15650 165569 166801 CDS product SAV2148 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030641.1 protein_id gnl|my_center|LOCUS_15650 166915 167637 gene locus_tag LOCUS_15660 166915 167637 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_15660 168674 167775 gene locus_tag LOCUS_15670 168674 167775 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030643.1 protein_id gnl|my_center|LOCUS_15670 168859 169797 gene locus_tag LOCUS_15680 168859 169797 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030644.1 protein_id gnl|my_center|LOCUS_15680 169794 170633 gene locus_tag LOCUS_15690 169794 170633 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_15690 170672 171970 gene locus_tag LOCUS_15700 170672 171970 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030646.1 protein_id gnl|my_center|LOCUS_15700 173295 171961 gene locus_tag LOCUS_15710 173295 171961 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229204.1 protein_id gnl|my_center|LOCUS_15710 173687 173292 gene locus_tag LOCUS_15720 173687 173292 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229205.1 protein_id gnl|my_center|LOCUS_15720 174145 173741 gene locus_tag LOCUS_15730 174145 173741 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227761.1 protein_id gnl|my_center|LOCUS_15730 174313 175518 gene locus_tag LOCUS_15740 gene mgt 174313 175518 CDS product macrolide-inactivating glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972830.1 protein_id gnl|my_center|LOCUS_15740 177987 175612 gene locus_tag LOCUS_15750 177987 175612 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_15750 178367 179566 gene locus_tag LOCUS_15760 178367 179566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 179746 180300 gene locus_tag LOCUS_15770 179746 180300 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_15770 180293 180664 gene locus_tag LOCUS_15780 180293 180664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 180776 181513 gene locus_tag LOCUS_15790 180776 181513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 181629 181808 gene locus_tag LOCUS_15800 181629 181808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 181912 183096 gene locus_tag LOCUS_15810 181912 183096 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_15810 183160 184518 gene locus_tag LOCUS_15820 183160 184518 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728200.1 protein_id gnl|my_center|LOCUS_15820 184534 185673 gene locus_tag LOCUS_15830 184534 185673 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 protein_id gnl|my_center|LOCUS_15830 186474 185713 gene locus_tag LOCUS_15840 186474 185713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767689.1 protein_id gnl|my_center|LOCUS_15840 187376 186450 gene locus_tag LOCUS_15850 187376 186450 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_15850 188461 187373 gene locus_tag LOCUS_15860 188461 187373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 188460 188771 gene locus_tag LOCUS_15870 188460 188771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 189931 188726 gene locus_tag LOCUS_15880 189931 188726 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889484.1 protein_id gnl|my_center|LOCUS_15880 190199 191197 gene locus_tag LOCUS_15890 190199 191197 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_15890 191876 191178 gene locus_tag LOCUS_15900 191876 191178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 191800 192402 gene locus_tag LOCUS_15910 191800 192402 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831756.1 protein_id gnl|my_center|LOCUS_15910 193277 192510 gene locus_tag LOCUS_15920 193277 192510 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_15920 194220 193282 gene locus_tag LOCUS_15930 194220 193282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 protein_id gnl|my_center|LOCUS_15930 194998 194207 gene locus_tag LOCUS_15940 194998 194207 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_15940 196180 195062 gene locus_tag LOCUS_15950 196180 195062 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_15950 197796 196432 gene locus_tag LOCUS_15960 197796 196432 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_15960 198943 197963 gene locus_tag LOCUS_15970 gene cysD 198943 197963 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_15970 199503 198943 gene locus_tag LOCUS_15980 gene cysC 199503 198943 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_15980 200201 199488 gene locus_tag LOCUS_15990 200201 199488 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_15990 200374 200198 gene locus_tag LOCUS_16000 200374 200198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_16000 202068 200371 gene locus_tag LOCUS_16010 gene sirA 202068 200371 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_16010 202067 202327 gene locus_tag LOCUS_16020 202067 202327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 202928 202347 gene locus_tag LOCUS_16030 202928 202347 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_16030 204339 203035 gene locus_tag LOCUS_16040 204339 203035 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_16040 206333 204690 gene locus_tag LOCUS_16050 206333 204690 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_16050 206447 207493 gene locus_tag LOCUS_16060 206447 207493 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_16060 207503 208258 gene locus_tag LOCUS_16070 207503 208258 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_16070 208590 208198 gene locus_tag LOCUS_16080 208590 208198 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_16080 208702 210354 gene locus_tag LOCUS_16090 208702 210354 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223179.1 protein_id gnl|my_center|LOCUS_16090 211145 210387 gene locus_tag LOCUS_16100 211145 210387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223184.1 protein_id gnl|my_center|LOCUS_16100 212080 211160 gene locus_tag LOCUS_16110 212080 211160 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223185.1 protein_id gnl|my_center|LOCUS_16110 212236 212895 gene locus_tag LOCUS_16120 212236 212895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_16120 214080 213103 gene locus_tag LOCUS_16130 214080 213103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 214260 216542 gene locus_tag LOCUS_16140 214260 216542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 216539 217918 gene locus_tag LOCUS_16150 216539 217918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 219508 217937 gene locus_tag LOCUS_16160 219508 217937 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226994.1 protein_id gnl|my_center|LOCUS_16160 221643 219508 gene locus_tag LOCUS_16170 221643 219508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 223267 221636 gene locus_tag LOCUS_16180 223267 221636 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085677.1 protein_id gnl|my_center|LOCUS_16180 225348 223267 gene locus_tag LOCUS_16190 225348 223267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 225989 225381 gene locus_tag LOCUS_16200 225989 225381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 227148 226255 gene locus_tag LOCUS_16210 227148 226255 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_16210 228032 227721 gene locus_tag LOCUS_16220 228032 227721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 228119 228610 gene locus_tag LOCUS_16230 228119 228610 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971855.1 protein_id gnl|my_center|LOCUS_16230 229114 228638 gene locus_tag LOCUS_16240 229114 228638 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_16240 229578 229201 gene locus_tag LOCUS_16250 229578 229201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 229714 230244 gene locus_tag LOCUS_16260 229714 230244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978004.1 protein_id gnl|my_center|LOCUS_16260 230510 230641 gene locus_tag LOCUS_16270 230510 230641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 230928 232031 gene locus_tag LOCUS_16280 230928 232031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 232365 233852 gene locus_tag LOCUS_16290 232365 233852 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031678.1 protein_id gnl|my_center|LOCUS_16290 233849 234271 gene locus_tag LOCUS_16300 233849 234271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 234268 234627 gene locus_tag LOCUS_16310 234268 234627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 234602 235333 gene locus_tag LOCUS_16320 234602 235333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 235338 236579 gene locus_tag LOCUS_16330 235338 236579 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_16330 236703 237437 gene locus_tag LOCUS_16340 236703 237437 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969479.1 protein_id gnl|my_center|LOCUS_16340 237938 237465 gene locus_tag LOCUS_16350 237938 237465 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978082.1 protein_id gnl|my_center|LOCUS_16350 238015 238503 gene locus_tag LOCUS_16360 238015 238503 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027466.1 protein_id gnl|my_center|LOCUS_16360 239295 238519 gene locus_tag LOCUS_16370 239295 238519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 239791 239444 gene locus_tag LOCUS_16380 239791 239444 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977520.1 protein_id gnl|my_center|LOCUS_16380 240015 241052 gene locus_tag LOCUS_16390 240015 241052 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027713.1 protein_id gnl|my_center|LOCUS_16390 241266 242462 gene locus_tag LOCUS_16400 241266 242462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027122.1 protein_id gnl|my_center|LOCUS_16400 243697 242531 gene locus_tag LOCUS_16410 243697 242531 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030634.1 protein_id gnl|my_center|LOCUS_16410 243668 244009 gene locus_tag LOCUS_16420 243668 244009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 244002 245171 gene locus_tag LOCUS_16430 244002 245171 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324798.1 protein_id gnl|my_center|LOCUS_16430 245168 246037 gene locus_tag LOCUS_16440 245168 246037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 246042 246548 gene locus_tag LOCUS_16450 246042 246548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16450 247039 246623 gene locus_tag LOCUS_16460 247039 246623 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 protein_id gnl|my_center|LOCUS_16460 247467 247102 gene locus_tag LOCUS_16470 247467 247102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 248104 247547 gene locus_tag LOCUS_16480 248104 247547 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976524.1 protein_id gnl|my_center|LOCUS_16480 248676 248206 gene locus_tag LOCUS_16490 248676 248206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 248866 249732 gene locus_tag LOCUS_16500 248866 249732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 249973 251085 gene locus_tag LOCUS_16510 gene rsgA 249973 251085 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_16510 251152 252711 gene locus_tag LOCUS_16520 gene alkA 251152 252711 CDS product bifunctional regulatory protein/DNA repair enzyme AlkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900313.1 protein_id gnl|my_center|LOCUS_16520 253055 252681 gene locus_tag LOCUS_16530 253055 252681 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 protein_id gnl|my_center|LOCUS_16530 253246 253052 gene locus_tag LOCUS_16540 253246 253052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 253181 254137 gene locus_tag LOCUS_16550 253181 254137 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145736531.1 protein_id gnl|my_center|LOCUS_16550 255640 254252 gene locus_tag LOCUS_16560 255640 254252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 255958 256728 gene locus_tag LOCUS_16570 255958 256728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 259176 256777 gene locus_tag LOCUS_16580 259176 256777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227787.1 protein_id gnl|my_center|LOCUS_16580 259809 259327 gene locus_tag LOCUS_16590 259809 259327 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030690.1 protein_id gnl|my_center|LOCUS_16590 261035 260019 gene locus_tag LOCUS_16600 261035 260019 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030691.1 protein_id gnl|my_center|LOCUS_16600 261339 263177 gene locus_tag LOCUS_16610 261339 263177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 263273 265021 gene locus_tag LOCUS_16620 263273 265021 CDS product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030693.1 protein_id gnl|my_center|LOCUS_16620 268146 265039 gene locus_tag LOCUS_16630 268146 265039 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_16630 268358 268786 gene locus_tag LOCUS_16640 268358 268786 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865215.1 protein_id gnl|my_center|LOCUS_16640 269995 268916 gene locus_tag LOCUS_16650 269995 268916 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030695.1 protein_id gnl|my_center|LOCUS_16650 271063 270221 gene locus_tag LOCUS_16660 271063 270221 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030696.1 protein_id gnl|my_center|LOCUS_16660 271292 272164 gene locus_tag LOCUS_16670 271292 272164 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030697.1 protein_id gnl|my_center|LOCUS_16670 272310 273524 gene locus_tag LOCUS_16680 272310 273524 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014331.1 protein_id gnl|my_center|LOCUS_16680 274326 273553 gene locus_tag LOCUS_16690 274326 273553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972756.1 protein_id gnl|my_center|LOCUS_16690 276551 274704 gene locus_tag LOCUS_16700 276551 274704 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_16700 276791 277681 gene locus_tag LOCUS_16710 276791 277681 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_16710 277684 278313 gene locus_tag LOCUS_16720 277684 278313 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030707.1 protein_id gnl|my_center|LOCUS_16720 278316 280700 gene locus_tag LOCUS_16730 278316 280700 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030708.1 protein_id gnl|my_center|LOCUS_16730 281109 280807 gene locus_tag LOCUS_16740 281109 280807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 281108 282406 gene locus_tag LOCUS_16750 281108 282406 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030709.1 protein_id gnl|my_center|LOCUS_16750 282455 283606 gene locus_tag LOCUS_16760 282455 283606 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_16760 285151 283529 gene locus_tag LOCUS_16770 285151 283529 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026469007.1 protein_id gnl|my_center|LOCUS_16770 285260 286480 gene locus_tag LOCUS_16780 285260 286480 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_16780 286471 287118 gene locus_tag LOCUS_16790 286471 287118 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_16790 287306 289120 gene locus_tag LOCUS_16800 287306 289120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 290178 289144 gene locus_tag LOCUS_16810 290178 289144 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_16810 290400 291173 gene locus_tag LOCUS_16820 290400 291173 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_16820 291263 291460 gene locus_tag LOCUS_16830 291263 291460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 292844 291513 gene locus_tag LOCUS_16840 gene lysA 292844 291513 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230687.1 protein_id gnl|my_center|LOCUS_16840 293227 292841 gene locus_tag LOCUS_16850 293227 292841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 293948 293397 gene locus_tag LOCUS_16860 293948 293397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16860 294247 293930 gene locus_tag LOCUS_16870 294247 293930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16870 293966 293970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 294380 296116 gene locus_tag LOCUS_16880 gene ibuL 294380 296116 CDS product isobutyrate:CoA ligase IbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030731.1 protein_id gnl|my_center|LOCUS_16880 296692 296177 gene locus_tag LOCUS_16890 296692 296177 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229593.1 protein_id gnl|my_center|LOCUS_16890 297579 296740 gene locus_tag LOCUS_16900 297579 296740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 297578 299365 gene locus_tag LOCUS_16910 gene gcl 297578 299365 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030737.1 protein_id gnl|my_center|LOCUS_16910 299837 299481 gene locus_tag LOCUS_16920 299837 299481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 301188 300298 gene locus_tag LOCUS_16930 301188 300298 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972722.1 protein_id gnl|my_center|LOCUS_16930 302135 301269 gene locus_tag LOCUS_16940 302135 301269 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_16940 302502 302756 gene locus_tag LOCUS_16950 302502 302756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063646595.1 protein_id gnl|my_center|LOCUS_16950 302753 303130 gene locus_tag LOCUS_16960 302753 303130 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_16960 303301 303810 gene locus_tag LOCUS_16970 gene uraD 303301 303810 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_16970 303815 304237 gene locus_tag LOCUS_16980 gene uraH 303815 304237 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030741.1 protein_id gnl|my_center|LOCUS_16980 304241 305152 gene locus_tag LOCUS_16990 gene pucL 304241 305152 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972716.1 protein_id gnl|my_center|LOCUS_16990 305334 306710 gene locus_tag LOCUS_17000 305334 306710 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 protein_id gnl|my_center|LOCUS_17000 307026 308474 gene locus_tag LOCUS_17010 307026 308474 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972712.1 protein_id gnl|my_center|LOCUS_17010 309404 308541 gene locus_tag LOCUS_17020 gene csnA 309404 308541 CDS product chitosanase CsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027289.1 protein_id gnl|my_center|LOCUS_17020 309580 310689 gene locus_tag LOCUS_17030 309580 310689 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031776.1 protein_id gnl|my_center|LOCUS_17030 311041 310709 gene locus_tag LOCUS_17040 311041 310709 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081659.1 protein_id gnl|my_center|LOCUS_17040 311967 311149 gene locus_tag LOCUS_17050 gene csnA 311967 311149 CDS product chitosanase CsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027289.1 protein_id gnl|my_center|LOCUS_17050 312111 314348 gene locus_tag LOCUS_17060 312111 314348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 315049 314435 gene locus_tag LOCUS_17070 315049 314435 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_17070 315376 315134 gene locus_tag LOCUS_17080 315376 315134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 317149 315527 gene locus_tag LOCUS_17090 gene aceB 317149 315527 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_17090 317978 317352 gene locus_tag LOCUS_17100 317978 317352 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_17100 318247 318558 gene locus_tag LOCUS_17110 318247 318558 CDS product DUF5955 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972682.1 protein_id gnl|my_center|LOCUS_17110 319642 318830 gene locus_tag LOCUS_17120 gene allR 319642 318830 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_17120 320026 321399 gene locus_tag LOCUS_17130 gene allB 320026 321399 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_17130 321403 322569 gene locus_tag LOCUS_17140 gene alc 321403 322569 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 protein_id gnl|my_center|LOCUS_17140 323336 322581 gene locus_tag LOCUS_17150 323336 322581 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030766.1 protein_id gnl|my_center|LOCUS_17150 323594 324817 gene locus_tag LOCUS_17160 323594 324817 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_17160 324814 325497 gene locus_tag LOCUS_17170 324814 325497 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_17170 325593 326804 gene locus_tag LOCUS_17180 325593 326804 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_17180 326850 327272 gene locus_tag LOCUS_17190 326850 327272 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_17190 328334 327318 gene locus_tag LOCUS_17200 328334 327318 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_17200 328498 329286 gene locus_tag LOCUS_17210 328498 329286 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_17210 329437 330450 gene locus_tag LOCUS_17220 329437 330450 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030773.1 protein_id gnl|my_center|LOCUS_17220 330548 331570 gene locus_tag LOCUS_17230 330548 331570 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030773.1 protein_id gnl|my_center|LOCUS_17230 331567 332652 gene locus_tag LOCUS_17240 331567 332652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972668.1 protein_id gnl|my_center|LOCUS_17240 332649 333584 gene locus_tag LOCUS_17250 332649 333584 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 protein_id gnl|my_center|LOCUS_17250 333828 335198 gene locus_tag LOCUS_17260 333828 335198 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_17260 335195 335770 gene locus_tag LOCUS_17270 335195 335770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972665.1 protein_id gnl|my_center|LOCUS_17270 335867 337183 gene locus_tag LOCUS_17280 335867 337183 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030840.1 protein_id gnl|my_center|LOCUS_17280 337180 337932 gene locus_tag LOCUS_17290 337180 337932 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_17290 338076 338855 gene locus_tag LOCUS_17300 338076 338855 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_17300 338983 339408 gene locus_tag LOCUS_17310 338983 339408 CDS product DUF6278 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972582.1 protein_id gnl|my_center|LOCUS_17310 340810 340067 gene locus_tag LOCUS_17320 340810 340067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972573.1 protein_id gnl|my_center|LOCUS_17320 340938 342773 gene locus_tag LOCUS_17330 gene ggt 340938 342773 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 protein_id gnl|my_center|LOCUS_17330 343622 342855 gene locus_tag LOCUS_17340 gene map 343622 342855 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_17340 343557 343916 gene locus_tag LOCUS_17350 343557 343916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 343984 344364 gene locus_tag LOCUS_17360 343984 344364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 344589 346175 gene locus_tag LOCUS_17370 344589 346175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189405100.1 protein_id gnl|my_center|LOCUS_17370 346405 347247 gene locus_tag LOCUS_17380 346405 347247 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_17380 347244 348638 gene locus_tag LOCUS_17390 347244 348638 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_17390 348754 350157 gene locus_tag LOCUS_17400 gene hydA 348754 350157 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_17400 350178 351179 gene locus_tag LOCUS_17410 350178 351179 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_17410 352287 351235 gene locus_tag LOCUS_17420 352287 351235 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 protein_id gnl|my_center|LOCUS_17420 353085 352396 gene locus_tag LOCUS_17430 353085 352396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 353432 353082 gene locus_tag LOCUS_17440 353432 353082 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222963.1 protein_id gnl|my_center|LOCUS_17440 353519 353980 gene locus_tag LOCUS_17450 353519 353980 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073069.1 protein_id gnl|my_center|LOCUS_17450 354364 356175 gene locus_tag LOCUS_17460 354364 356175 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_17460 356370 357248 gene locus_tag LOCUS_17470 356370 357248 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 protein_id gnl|my_center|LOCUS_17470 357360 358778 gene locus_tag LOCUS_17480 357360 358778 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 protein_id gnl|my_center|LOCUS_17480 359108 359875 gene locus_tag LOCUS_17490 359108 359875 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_17490 360011 361492 gene locus_tag LOCUS_17500 360011 361492 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_17500 361506 362060 gene locus_tag LOCUS_17510 361506 362060 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_17510 362819 362094 gene locus_tag LOCUS_17520 362819 362094 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_17520 364180 362867 gene locus_tag LOCUS_17530 364180 362867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 364897 364349 gene locus_tag LOCUS_17540 364897 364349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 365036 366190 gene locus_tag LOCUS_17550 365036 366190 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_17550 366654 367841 gene locus_tag LOCUS_17560 366654 367841 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_17560 367844 368329 gene locus_tag LOCUS_17570 367844 368329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 368326 369129 gene locus_tag LOCUS_17580 368326 369129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 370201 369047 gene locus_tag LOCUS_17590 370201 369047 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_17590 370462 371262 gene locus_tag LOCUS_17600 370462 371262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228790.1 protein_id gnl|my_center|LOCUS_17600 371259 372161 gene locus_tag LOCUS_17610 371259 372161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978153.1 protein_id gnl|my_center|LOCUS_17610 372158 373048 gene locus_tag LOCUS_17620 372158 373048 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027308.1 protein_id gnl|my_center|LOCUS_17620 373041 374141 gene locus_tag LOCUS_17630 373041 374141 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027307.1 protein_id gnl|my_center|LOCUS_17630 374138 375415 gene locus_tag LOCUS_17640 374138 375415 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978156.1 protein_id gnl|my_center|LOCUS_17640 376349 375495 gene locus_tag LOCUS_17650 gene pssA 376349 375495 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_17650 376983 376336 gene locus_tag LOCUS_17660 376983 376336 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_17660 378357 377152 gene locus_tag LOCUS_17670 378357 377152 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_17670 378873 378361 gene locus_tag LOCUS_17680 378873 378361 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_17680 379863 378877 gene locus_tag LOCUS_17690 379863 378877 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_17690 381923 379860 gene locus_tag LOCUS_17700 381923 379860 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_17700 383262 381925 gene locus_tag LOCUS_17710 gene ccrA 383262 381925 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_17710 383399 383590 gene locus_tag LOCUS_17720 383399 383590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 384542 383721 gene locus_tag LOCUS_17730 384542 383721 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_17730 386423 384636 gene locus_tag LOCUS_17740 386423 384636 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030948.1 protein_id gnl|my_center|LOCUS_17740 386831 387508 gene locus_tag LOCUS_17750 386831 387508 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030949.1 protein_id gnl|my_center|LOCUS_17750 388019 387492 gene locus_tag LOCUS_17760 388019 387492 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_17760 388429 388025 gene locus_tag LOCUS_17770 388429 388025 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030951.1 protein_id gnl|my_center|LOCUS_17770 389155 388649 gene locus_tag LOCUS_17780 389155 388649 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092502.1 protein_id gnl|my_center|LOCUS_17780 390738 389389 gene locus_tag LOCUS_17790 390738 389389 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228608.1 protein_id gnl|my_center|LOCUS_17790 392752 391205 gene locus_tag LOCUS_17800 392752 391205 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091320726.1 protein_id gnl|my_center|LOCUS_17800 393020 393550 gene locus_tag LOCUS_17810 393020 393550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 393665 394042 gene locus_tag LOCUS_17820 393665 394042 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_17820 394771 394076 gene locus_tag LOCUS_17830 394771 394076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 396093 394822 gene locus_tag LOCUS_17840 396093 394822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 396801 397943 gene locus_tag LOCUS_17850 396801 397943 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_17850 397940 399427 gene locus_tag LOCUS_17860 397940 399427 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030516.1 protein_id gnl|my_center|LOCUS_17860 399510 399797 gene locus_tag LOCUS_17870 399510 399797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 399805 401151 gene locus_tag LOCUS_17880 399805 401151 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105315.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence05 3300 2983 gene locus_tag LOCUS_17890 3300 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3743 3396 gene locus_tag LOCUS_17900 3743 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4090 3740 gene locus_tag LOCUS_17910 4090 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4273 4097 gene locus_tag LOCUS_17920 4273 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 4871 4350 gene locus_tag LOCUS_17930 4871 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5367 4924 gene locus_tag LOCUS_17940 5367 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5636 5346 gene locus_tag LOCUS_17950 5636 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5990 5646 gene locus_tag LOCUS_17960 5990 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 6544 5993 gene locus_tag LOCUS_17970 6544 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6884 6534 gene locus_tag LOCUS_17980 6884 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7093 6881 gene locus_tag LOCUS_17990 7093 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 7372 7103 gene locus_tag LOCUS_18000 7372 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 8703 7372 gene locus_tag LOCUS_18010 8703 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 9582 8710 gene locus_tag LOCUS_18020 9582 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 11515 9587 gene locus_tag LOCUS_18030 11515 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 11739 11515 gene locus_tag LOCUS_18040 11739 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 11785 12006 gene locus_tag LOCUS_18050 11785 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 13751 12003 gene locus_tag LOCUS_18060 13751 12003 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_18060 14208 13723 gene locus_tag LOCUS_18070 14208 13723 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900701.1 protein_id gnl|my_center|LOCUS_18070 15253 14915 gene locus_tag LOCUS_18080 15253 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 15699 15316 gene locus_tag LOCUS_18090 15699 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 16165 15800 gene locus_tag LOCUS_18100 16165 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 16779 16162 gene locus_tag LOCUS_18110 16779 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 17297 16758 gene locus_tag LOCUS_18120 17297 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 17624 17382 gene locus_tag LOCUS_18130 17624 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 18260 17817 gene locus_tag LOCUS_18140 18260 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 18736 18287 gene locus_tag LOCUS_18150 18736 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 19240 18740 gene locus_tag LOCUS_18160 19240 18740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 19838 19242 gene locus_tag LOCUS_18170 19838 19242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 20633 19848 gene locus_tag LOCUS_18180 20633 19848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 22895 20784 gene locus_tag LOCUS_18190 22895 20784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 24214 22892 gene locus_tag LOCUS_18200 24214 22892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 24531 24235 gene locus_tag LOCUS_18210 24531 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 24779 24552 gene locus_tag LOCUS_18220 24779 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 24959 24789 gene locus_tag LOCUS_18230 24959 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 25254 25048 gene locus_tag LOCUS_18240 25254 25048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 25496 25353 gene locus_tag LOCUS_18250 25496 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 25696 25493 gene locus_tag LOCUS_18260 25696 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 25863 25690 gene locus_tag LOCUS_18270 25863 25690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 26135 25860 gene locus_tag LOCUS_18280 26135 25860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 26334 27071 gene locus_tag LOCUS_18290 26334 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 27167 27631 gene locus_tag LOCUS_18300 27167 27631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 27706 28488 gene locus_tag LOCUS_18310 27706 28488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 28568 28885 gene locus_tag LOCUS_18320 28568 28885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 29536 28892 gene locus_tag LOCUS_18330 29536 28892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 29772 29575 gene locus_tag LOCUS_18340 29772 29575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 30444 30091 gene locus_tag LOCUS_18350 30444 30091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 30834 30568 gene locus_tag LOCUS_18360 30834 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 31766 30831 gene locus_tag LOCUS_18370 31766 30831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 32535 31849 gene locus_tag LOCUS_18380 32535 31849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 32921 32592 gene locus_tag LOCUS_18390 32921 32592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 33727 32957 gene locus_tag LOCUS_18400 33727 32957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 35097 33724 gene locus_tag LOCUS_18410 gene dnaB 35097 33724 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_18410 36008 35094 gene locus_tag LOCUS_18420 36008 35094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 37288 36212 gene locus_tag LOCUS_18430 37288 36212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 37196 37570 gene locus_tag LOCUS_18440 37196 37570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 38067 37663 gene locus_tag LOCUS_18450 38067 37663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 38498 38067 gene locus_tag LOCUS_18460 38498 38067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 38653 38495 gene locus_tag LOCUS_18470 38653 38495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 39099 38650 gene locus_tag LOCUS_18480 39099 38650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 39434 39096 gene locus_tag LOCUS_18490 39434 39096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 40381 39515 gene locus_tag LOCUS_18500 40381 39515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 41376 40378 gene locus_tag LOCUS_18510 41376 40378 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_18510 42588 41464 gene locus_tag LOCUS_18520 gene dnaN 42588 41464 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803666.1 protein_id gnl|my_center|LOCUS_18520 42776 42588 gene locus_tag LOCUS_18530 42776 42588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 43275 42883 gene locus_tag LOCUS_18540 43275 42883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 43642 43370 gene locus_tag LOCUS_18550 43642 43370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 43952 43737 gene locus_tag LOCUS_18560 43952 43737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 44215 43949 gene locus_tag LOCUS_18570 44215 43949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 44805 44212 gene locus_tag LOCUS_18580 44805 44212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 44981 44802 gene locus_tag LOCUS_18590 44981 44802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 45232 44978 gene locus_tag LOCUS_18600 45232 44978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 45531 45232 gene locus_tag LOCUS_18610 45531 45232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 45856 45620 gene locus_tag LOCUS_18620 45856 45620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 46156 45887 gene locus_tag LOCUS_18630 46156 45887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 46372 46764 gene locus_tag LOCUS_18640 46372 46764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 46938 47210 gene locus_tag LOCUS_18650 46938 47210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 47200 48537 gene locus_tag LOCUS_18660 47200 48537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 48912 48730 gene locus_tag LOCUS_18670 48912 48730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 48827 50260 gene locus_tag LOCUS_18680 48827 50260 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_18680 50531 50812 gene locus_tag LOCUS_18690 50531 50812 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_18690 52201 50882 gene locus_tag LOCUS_18700 gene murA 52201 50882 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_18700 52486 53067 gene locus_tag LOCUS_18710 52486 53067 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_18710 53174 53506 gene locus_tag LOCUS_18720 53174 53506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 53782 55428 gene locus_tag LOCUS_18730 53782 55428 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_18730 55684 56580 gene locus_tag LOCUS_18740 55684 56580 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 protein_id gnl|my_center|LOCUS_18740 56577 58040 gene locus_tag LOCUS_18750 56577 58040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18750 58037 60346 gene locus_tag LOCUS_18760 58037 60346 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028673.1 protein_id gnl|my_center|LOCUS_18760 60746 60674 gene locus_tag LOCUS_t00180 60746 60674 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 60938 62395 gene locus_tag LOCUS_18770 60938 62395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_18770 62614 64398 gene locus_tag LOCUS_18780 62614 64398 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_18780 64767 65408 gene locus_tag LOCUS_18790 64767 65408 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_18790 65478 66275 gene locus_tag LOCUS_18800 65478 66275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028670.1 protein_id gnl|my_center|LOCUS_18800 67539 66205 gene locus_tag LOCUS_18810 gene mrx(A) 67539 66205 CDS product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 protein_id gnl|my_center|LOCUS_18810 67721 67536 gene locus_tag LOCUS_18820 67721 67536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 68469 67846 gene locus_tag LOCUS_18830 68469 67846 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_18830 69547 68561 gene locus_tag LOCUS_18840 69547 68561 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028669.1 protein_id gnl|my_center|LOCUS_18840 70389 69547 gene locus_tag LOCUS_18850 70389 69547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975878.1 protein_id gnl|my_center|LOCUS_18850 71768 70386 gene locus_tag LOCUS_18860 71768 70386 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975879.1 protein_id gnl|my_center|LOCUS_18860 72408 71761 gene locus_tag LOCUS_18870 72408 71761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_18870 72941 72438 gene locus_tag LOCUS_18880 72941 72438 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_18880 73089 74228 gene locus_tag LOCUS_18890 gene hppD 73089 74228 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_18890 75208 74357 gene locus_tag LOCUS_18900 75208 74357 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_18900 76011 75226 gene locus_tag LOCUS_18910 76011 75226 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887671.1 protein_id gnl|my_center|LOCUS_18910 76825 76025 gene locus_tag LOCUS_18920 76825 76025 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_18920 78572 76929 gene locus_tag LOCUS_18930 78572 76929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 80311 78689 gene locus_tag LOCUS_18940 80311 78689 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270060.1 protein_id gnl|my_center|LOCUS_18940 80380 81798 gene locus_tag LOCUS_18950 80380 81798 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_18950 82278 81802 gene locus_tag LOCUS_18960 82278 81802 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_18960 82507 84081 gene locus_tag LOCUS_18970 82507 84081 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484871.1 protein_id gnl|my_center|LOCUS_18970 84214 84921 gene locus_tag LOCUS_18980 84214 84921 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279138.1 protein_id gnl|my_center|LOCUS_18980 85185 84907 gene locus_tag LOCUS_18990 85185 84907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 85587 87998 gene locus_tag LOCUS_19000 85587 87998 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_19000 88122 88565 gene locus_tag LOCUS_19010 88122 88565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 89182 88595 gene locus_tag LOCUS_19020 89182 88595 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_19020 90675 89320 gene locus_tag LOCUS_19030 90675 89320 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_19030 90841 91146 gene locus_tag LOCUS_19040 gene clpS 90841 91146 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_19040 91146 91733 gene locus_tag LOCUS_19050 91146 91733 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_19050 92018 93484 gene locus_tag LOCUS_19060 92018 93484 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028661.1 protein_id gnl|my_center|LOCUS_19060 93625 94038 gene locus_tag LOCUS_19070 93625 94038 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_19070 94217 95200 gene locus_tag LOCUS_19080 94217 95200 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_19080 95276 96328 gene locus_tag LOCUS_19090 95276 96328 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_19090 96325 97149 gene locus_tag LOCUS_19100 96325 97149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_19100 97425 97742 gene locus_tag LOCUS_19110 97425 97742 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_19110 97742 98692 gene locus_tag LOCUS_19120 97742 98692 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_19120 98812 99942 gene locus_tag LOCUS_19130 98812 99942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 100482 99976 gene locus_tag LOCUS_19140 100482 99976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 100694 101446 gene locus_tag LOCUS_19150 100694 101446 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_19150 102750 101539 gene locus_tag LOCUS_19160 102750 101539 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_19160 102731 102922 gene locus_tag LOCUS_19170 102731 102922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 104402 103122 gene locus_tag LOCUS_19180 104402 103122 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028656.1 protein_id gnl|my_center|LOCUS_19180 104606 104839 gene locus_tag LOCUS_19190 104606 104839 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_19190 104944 105681 gene locus_tag LOCUS_19200 gene rph 104944 105681 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_19200 105782 106165 gene locus_tag LOCUS_19210 105782 106165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975907.1 protein_id gnl|my_center|LOCUS_19210 106199 106801 gene locus_tag LOCUS_19220 gene rdgB 106199 106801 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_19220 106989 106904 gene locus_tag LOCUS_t00190 106989 106904 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 108552 107044 gene locus_tag LOCUS_19230 108552 107044 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977606.1 protein_id gnl|my_center|LOCUS_19230 109146 108679 gene locus_tag LOCUS_19240 gene bcp 109146 108679 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_19240 109305 109625 gene locus_tag LOCUS_19250 109305 109625 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028653.1 protein_id gnl|my_center|LOCUS_19250 109738 110094 gene locus_tag LOCUS_19260 109738 110094 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_19260 110246 110566 gene locus_tag LOCUS_19270 110246 110566 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975912.1 protein_id gnl|my_center|LOCUS_19270 113298 110851 gene locus_tag LOCUS_19280 113298 110851 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 protein_id gnl|my_center|LOCUS_19280 113521 114321 gene locus_tag LOCUS_19290 113521 114321 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_19290 114314 115198 gene locus_tag LOCUS_19300 114314 115198 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_19300 115224 116240 gene locus_tag LOCUS_19310 115224 116240 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_19310 116272 116967 gene locus_tag LOCUS_19320 116272 116967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19320 118347 117013 gene locus_tag LOCUS_19330 118347 117013 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_19330 118535 120076 gene locus_tag LOCUS_19340 118535 120076 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_19340 120287 120859 gene locus_tag LOCUS_19350 120287 120859 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486994.1 protein_id gnl|my_center|LOCUS_19350 120998 121816 gene locus_tag LOCUS_19360 120998 121816 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_19360 121948 122682 gene locus_tag LOCUS_19370 121948 122682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 122988 123968 gene locus_tag LOCUS_19380 122988 123968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270042.1 protein_id gnl|my_center|LOCUS_19380 124018 124503 gene locus_tag LOCUS_19390 124018 124503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 124709 124509 gene locus_tag LOCUS_19400 124709 124509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 125554 124706 gene locus_tag LOCUS_19410 125554 124706 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_19410 125756 126436 gene locus_tag LOCUS_19420 125756 126436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 126563 127678 gene locus_tag LOCUS_19430 126563 127678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 128767 127769 gene locus_tag LOCUS_19440 128767 127769 CDS product SEC-C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028623.1 protein_id gnl|my_center|LOCUS_19440 130212 128842 gene locus_tag LOCUS_19450 130212 128842 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028622.1 protein_id gnl|my_center|LOCUS_19450 130124 130324 gene locus_tag LOCUS_19460 130124 130324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 130398 130928 gene locus_tag LOCUS_19470 130398 130928 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326320.1 protein_id gnl|my_center|LOCUS_19470 131040 131360 gene locus_tag LOCUS_19480 131040 131360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 131594 131376 gene locus_tag LOCUS_19490 131594 131376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 131497 132261 gene locus_tag LOCUS_19500 131497 132261 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_19500 132458 133315 gene locus_tag LOCUS_19510 132458 133315 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_19510 133373 133969 gene locus_tag LOCUS_19520 133373 133969 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_19520 134519 134031 gene locus_tag LOCUS_19530 134519 134031 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028617.1 protein_id gnl|my_center|LOCUS_19530 135616 134516 gene locus_tag LOCUS_19540 135616 134516 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_19540 135673 136962 gene locus_tag LOCUS_19550 135673 136962 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975954.1 protein_id gnl|my_center|LOCUS_19550 137096 138121 gene locus_tag LOCUS_19560 137096 138121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 138383 139471 gene locus_tag LOCUS_19570 138383 139471 CDS product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533035.1 protein_id gnl|my_center|LOCUS_19570 139589 140368 gene locus_tag LOCUS_19580 139589 140368 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_19580 140480 141646 gene locus_tag LOCUS_19590 140480 141646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 141666 142358 gene locus_tag LOCUS_19600 141666 142358 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028613.1 protein_id gnl|my_center|LOCUS_19600 142574 143560 gene locus_tag LOCUS_19610 142574 143560 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_19610 145608 143656 gene locus_tag LOCUS_19620 145608 143656 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_19620 147572 145605 gene locus_tag LOCUS_19630 147572 145605 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_19630 148074 148000 gene locus_tag LOCUS_t00200 148074 148000 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 148256 149590 gene locus_tag LOCUS_19640 148256 149590 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028607.1 protein_id gnl|my_center|LOCUS_19640 149605 151647 gene locus_tag LOCUS_19650 149605 151647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 151802 152395 gene locus_tag LOCUS_19660 151802 152395 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_19660 153320 152562 gene locus_tag LOCUS_19670 153320 152562 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866451.1 protein_id gnl|my_center|LOCUS_19670 154400 153576 gene locus_tag LOCUS_19680 gene ehuA 154400 153576 CDS product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975969.1 protein_id gnl|my_center|LOCUS_19680 155040 154390 gene locus_tag LOCUS_19690 gene ehuD 155040 154390 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975970.1 protein_id gnl|my_center|LOCUS_19690 155783 155037 gene locus_tag LOCUS_19700 gene ehuC 155783 155037 CDS product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975971.1 protein_id gnl|my_center|LOCUS_19700 156577 155780 gene locus_tag LOCUS_19710 gene ehuB 156577 155780 CDS product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975972.1 protein_id gnl|my_center|LOCUS_19710 156877 157377 gene locus_tag LOCUS_19720 156877 157377 CDS product DUF3830 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975973.1 protein_id gnl|my_center|LOCUS_19720 158829 157432 gene locus_tag LOCUS_19730 158829 157432 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 protein_id gnl|my_center|LOCUS_19730 159784 158834 gene locus_tag LOCUS_19740 159784 158834 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975976.1 protein_id gnl|my_center|LOCUS_19740 159915 160901 gene locus_tag LOCUS_19750 159915 160901 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975977.1 protein_id gnl|my_center|LOCUS_19750 160898 161623 gene locus_tag LOCUS_19760 160898 161623 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975978.1 protein_id gnl|my_center|LOCUS_19760 161719 162780 gene locus_tag LOCUS_19770 161719 162780 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_19770 164752 162812 gene locus_tag LOCUS_19780 164752 162812 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975983.1 protein_id gnl|my_center|LOCUS_19780 165130 166413 gene locus_tag LOCUS_19790 165130 166413 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028602.1 protein_id gnl|my_center|LOCUS_19790 166540 166466 gene locus_tag LOCUS_t00210 166540 166466 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 167256 166624 gene locus_tag LOCUS_19800 167256 166624 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028603.1 protein_id gnl|my_center|LOCUS_19800 167781 167434 gene locus_tag LOCUS_19810 167781 167434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975980.1 protein_id gnl|my_center|LOCUS_19810 169230 167875 gene locus_tag LOCUS_19820 169230 167875 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_19820 170960 169227 gene locus_tag LOCUS_19830 170960 169227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_19830 172210 170951 gene locus_tag LOCUS_19840 172210 170951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_19840 173129 172110 gene locus_tag LOCUS_19850 173129 172110 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 protein_id gnl|my_center|LOCUS_19850 173364 173960 gene locus_tag LOCUS_19860 173364 173960 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_19860 175419 174034 gene locus_tag LOCUS_19870 175419 174034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028595.1 protein_id gnl|my_center|LOCUS_19870 175681 176151 gene locus_tag LOCUS_19880 175681 176151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 176203 177093 gene locus_tag LOCUS_19890 176203 177093 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_19890 177661 177116 gene locus_tag LOCUS_19900 177661 177116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270050.1 protein_id gnl|my_center|LOCUS_19900 177795 178529 gene locus_tag LOCUS_19910 177795 178529 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_19910 178526 179911 gene locus_tag LOCUS_19920 178526 179911 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_19920 181533 180109 gene locus_tag LOCUS_19930 181533 180109 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976002.1 protein_id gnl|my_center|LOCUS_19930 182450 181566 gene locus_tag LOCUS_19940 182450 181566 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028591.1 protein_id gnl|my_center|LOCUS_19940 183487 182447 gene locus_tag LOCUS_19950 183487 182447 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_19950 184860 183493 gene locus_tag LOCUS_19960 184860 183493 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_19960 185070 184997 gene locus_tag LOCUS_t00220 185070 184997 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 185757 185176 gene locus_tag LOCUS_19970 gene orn 185757 185176 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_19970 187000 185780 gene locus_tag LOCUS_19980 187000 185780 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_19980 187626 187405 gene locus_tag LOCUS_19990 187626 187405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 187687 187896 gene locus_tag LOCUS_20000 187687 187896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 188049 188570 gene locus_tag LOCUS_20010 188049 188570 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976010.1 protein_id gnl|my_center|LOCUS_20010 190439 188610 gene locus_tag LOCUS_20020 gene glmS 190439 188610 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_20020 190838 190521 gene locus_tag LOCUS_20030 190838 190521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_20030 191782 190892 gene locus_tag LOCUS_20040 191782 190892 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976013.1 protein_id gnl|my_center|LOCUS_20040 192190 191819 gene locus_tag LOCUS_20050 192190 191819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 192243 193676 gene locus_tag LOCUS_20060 192243 193676 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028586.1 protein_id gnl|my_center|LOCUS_20060 194087 194839 gene locus_tag LOCUS_20070 194087 194839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 195801 194770 gene locus_tag LOCUS_20080 gene desE 195801 194770 CDS product siderophore-binding protein DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976020.1 protein_id gnl|my_center|LOCUS_20080 195956 196318 gene locus_tag LOCUS_20090 195956 196318 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975921.1 protein_id gnl|my_center|LOCUS_20090 197032 196349 gene locus_tag LOCUS_20100 197032 196349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 197149 197844 gene locus_tag LOCUS_20110 197149 197844 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_20110 198995 197841 gene locus_tag LOCUS_20120 198995 197841 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_20120 199933 198998 gene locus_tag LOCUS_20130 199933 198998 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_20130 201993 199930 gene locus_tag LOCUS_20140 201993 199930 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_20140 203632 202001 gene locus_tag LOCUS_20150 203632 202001 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_20150 203721 204332 gene locus_tag LOCUS_20160 203721 204332 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_20160 204492 204408 gene locus_tag LOCUS_t00230 204492 204408 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 204956 205744 gene locus_tag LOCUS_20170 204956 205744 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_20170 206721 205810 gene locus_tag LOCUS_20180 206721 205810 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_20180 207921 206764 gene locus_tag LOCUS_20190 207921 206764 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028577.1 protein_id gnl|my_center|LOCUS_20190 209515 208082 gene locus_tag LOCUS_20200 209515 208082 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742168.1 protein_id gnl|my_center|LOCUS_20200 209647 211164 gene locus_tag LOCUS_20210 209647 211164 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224493.1 protein_id gnl|my_center|LOCUS_20210 211278 212282 gene locus_tag LOCUS_20220 gene speB 211278 212282 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_20220 212279 213976 gene locus_tag LOCUS_20230 212279 213976 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028574.1 protein_id gnl|my_center|LOCUS_20230 214165 218121 gene locus_tag LOCUS_20240 214165 218121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_20240 219243 218146 gene locus_tag LOCUS_20250 219243 218146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 220234 219236 gene locus_tag LOCUS_20260 220234 219236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 220430 220693 gene locus_tag LOCUS_20270 220430 220693 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 protein_id gnl|my_center|LOCUS_20270 220690 221160 gene locus_tag LOCUS_20280 220690 221160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 221434 221252 gene locus_tag LOCUS_20290 221434 221252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 221729 221547 gene locus_tag LOCUS_20300 221729 221547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 221925 223322 gene locus_tag LOCUS_20310 221925 223322 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_20310 223319 224632 gene locus_tag LOCUS_20320 223319 224632 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_20320 226298 224979 gene locus_tag LOCUS_20330 226298 224979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_20330 227272 226295 gene locus_tag LOCUS_20340 227272 226295 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_20340 228170 227343 gene locus_tag LOCUS_20350 228170 227343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 228877 228167 gene locus_tag LOCUS_20360 228877 228167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 230811 228874 gene locus_tag LOCUS_20370 230811 228874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_20370 232199 230874 gene locus_tag LOCUS_20380 232199 230874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 233317 232196 gene locus_tag LOCUS_20390 233317 232196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 233684 233382 gene locus_tag LOCUS_20400 233684 233382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 235146 236573 gene locus_tag LOCUS_20410 235146 236573 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_20410 236868 237545 gene locus_tag LOCUS_20420 236868 237545 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_20420 238536 237736 gene locus_tag LOCUS_20430 238536 237736 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_20430 239519 238533 gene locus_tag LOCUS_20440 239519 238533 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085299.1 protein_id gnl|my_center|LOCUS_20440 240727 239666 gene locus_tag LOCUS_20450 240727 239666 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976047.1 protein_id gnl|my_center|LOCUS_20450 240852 242003 gene locus_tag LOCUS_20460 240852 242003 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456192.1 protein_id gnl|my_center|LOCUS_20460 242000 243229 gene locus_tag LOCUS_20470 242000 243229 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028561.1 protein_id gnl|my_center|LOCUS_20470 243226 244113 gene locus_tag LOCUS_20480 243226 244113 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028560.1 protein_id gnl|my_center|LOCUS_20480 244437 246659 gene locus_tag LOCUS_20490 244437 246659 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_20490 245858 245923 gene locus_tag LOCUS_t00240 245858 245923 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 246870 248171 gene locus_tag LOCUS_20500 246870 248171 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 protein_id gnl|my_center|LOCUS_20500 248446 248123 gene locus_tag LOCUS_20510 248446 248123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 249002 248748 gene locus_tag LOCUS_20520 249002 248748 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_20520 249853 249146 gene locus_tag LOCUS_20530 249853 249146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 250033 252327 gene locus_tag LOCUS_20540 250033 252327 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_20540 252621 252424 gene locus_tag LOCUS_20550 252621 252424 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326277.1 protein_id gnl|my_center|LOCUS_20550 253787 252876 gene locus_tag LOCUS_20560 253787 252876 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_20560 253914 255032 gene locus_tag LOCUS_20570 gene iolC 253914 255032 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_20570 255029 255910 gene locus_tag LOCUS_20580 255029 255910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 protein_id gnl|my_center|LOCUS_20580 255992 256972 gene locus_tag LOCUS_20590 gene iolB 255992 256972 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_20590 256969 258855 gene locus_tag LOCUS_20600 gene iolD 256969 258855 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_20600 258905 260404 gene locus_tag LOCUS_20610 gene mmsA 258905 260404 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_20610 260710 260447 gene locus_tag LOCUS_20620 260710 260447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 260697 261161 gene locus_tag LOCUS_20630 260697 261161 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_20630 261279 262130 gene locus_tag LOCUS_20640 261279 262130 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222875.1 protein_id gnl|my_center|LOCUS_20640 262575 262150 gene locus_tag LOCUS_20650 262575 262150 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229329.1 protein_id gnl|my_center|LOCUS_20650 262741 265383 gene locus_tag LOCUS_20660 262741 265383 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484949.1 protein_id gnl|my_center|LOCUS_20660 265380 266252 gene locus_tag LOCUS_20670 265380 266252 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_20670 267223 266279 gene locus_tag LOCUS_20680 267223 266279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 267575 269143 gene locus_tag LOCUS_20690 267575 269143 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028539.1 protein_id gnl|my_center|LOCUS_20690 269336 269809 gene locus_tag LOCUS_20700 269336 269809 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226533.1 protein_id gnl|my_center|LOCUS_20700 270554 269790 gene locus_tag LOCUS_20710 270554 269790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20710 271169 270696 gene locus_tag LOCUS_20720 271169 270696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 271322 272611 gene locus_tag LOCUS_20730 271322 272611 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_20730 272666 273910 gene locus_tag LOCUS_20740 272666 273910 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971841.1 protein_id gnl|my_center|LOCUS_20740 274125 275813 gene locus_tag LOCUS_20750 274125 275813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974530.1 protein_id gnl|my_center|LOCUS_20750 275937 276482 gene locus_tag LOCUS_20760 275937 276482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225074.1 protein_id gnl|my_center|LOCUS_20760 277693 276377 gene locus_tag LOCUS_20770 277693 276377 CDS product DUF1864 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074060.1 protein_id gnl|my_center|LOCUS_20770 278055 278834 gene locus_tag LOCUS_20780 278055 278834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 278949 279785 gene locus_tag LOCUS_20790 278949 279785 CDS product APH(3'') family aminoglycoside O-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110890.1 protein_id gnl|my_center|LOCUS_20790 279936 281231 gene locus_tag LOCUS_20800 279936 281231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_20800 281606 281274 gene locus_tag LOCUS_20810 281606 281274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 281704 281629 gene locus_tag LOCUS_t00250 281704 281629 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 282031 283623 gene locus_tag LOCUS_20820 282031 283623 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028513.1 protein_id gnl|my_center|LOCUS_20820 283620 285503 gene locus_tag LOCUS_20830 283620 285503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20830 285681 286232 gene locus_tag LOCUS_20840 285681 286232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 286447 287871 gene locus_tag LOCUS_20850 286447 287871 CDS product TQXA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028511.1 protein_id gnl|my_center|LOCUS_20850 288153 289817 gene locus_tag LOCUS_20860 gene ettA 288153 289817 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_20860 289819 290244 gene locus_tag LOCUS_20870 289819 290244 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_20870 290241 290933 gene locus_tag LOCUS_20880 290241 290933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866307.1 protein_id gnl|my_center|LOCUS_20880 292055 290979 gene locus_tag LOCUS_20890 292055 290979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_20890 295066 292052 gene locus_tag LOCUS_20900 295066 292052 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484980.1 protein_id gnl|my_center|LOCUS_20900 298454 295068 gene locus_tag LOCUS_20910 298454 295068 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484982.1 protein_id gnl|my_center|LOCUS_20910 299043 298645 gene locus_tag LOCUS_20920 299043 298645 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_20920 299260 300285 gene locus_tag LOCUS_20930 299260 300285 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028500.1 protein_id gnl|my_center|LOCUS_20930 301521 300346 gene locus_tag LOCUS_20940 301521 300346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 302943 301588 gene locus_tag LOCUS_20950 302943 301588 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_20950 304561 303101 gene locus_tag LOCUS_20960 304561 303101 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 protein_id gnl|my_center|LOCUS_20960 307306 304565 gene locus_tag LOCUS_20970 307306 304565 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028497.1 protein_id gnl|my_center|LOCUS_20970 308735 307407 gene locus_tag LOCUS_20980 308735 307407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_20980 309898 308828 gene locus_tag LOCUS_20990 309898 308828 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028495.1 protein_id gnl|my_center|LOCUS_20990 311310 309910 gene locus_tag LOCUS_21000 311310 309910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976138.1 protein_id gnl|my_center|LOCUS_21000 312632 311619 gene locus_tag LOCUS_21010 312632 311619 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_21010 313897 312623 gene locus_tag LOCUS_21020 313897 312623 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028492.1 protein_id gnl|my_center|LOCUS_21020 314811 313906 gene locus_tag LOCUS_21030 314811 313906 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028491.1 protein_id gnl|my_center|LOCUS_21030 315755 314814 gene locus_tag LOCUS_21040 315755 314814 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 protein_id gnl|my_center|LOCUS_21040 317108 315774 gene locus_tag LOCUS_21050 317108 315774 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028490.1 protein_id gnl|my_center|LOCUS_21050 318405 317188 gene locus_tag LOCUS_21060 318405 317188 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_21060 319784 318708 gene locus_tag LOCUS_21070 319784 318708 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283001.1 protein_id gnl|my_center|LOCUS_21070 320074 320610 gene locus_tag LOCUS_21080 320074 320610 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_21080 323747 320718 gene locus_tag LOCUS_21090 323747 320718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 324007 324261 gene locus_tag LOCUS_21100 324007 324261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028482.1 protein_id gnl|my_center|LOCUS_21100 324262 326457 gene locus_tag LOCUS_21110 gene malQ 324262 326457 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028481.1 protein_id gnl|my_center|LOCUS_21110 326462 326752 gene locus_tag LOCUS_21120 326462 326752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028480.1 protein_id gnl|my_center|LOCUS_21120 329493 326923 gene locus_tag LOCUS_21130 gene pepN 329493 326923 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_21130 329641 330144 gene locus_tag LOCUS_21140 329641 330144 CDS product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_21140 331219 330191 gene locus_tag LOCUS_21150 331219 330191 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_21150 334751 331449 gene locus_tag LOCUS_21160 334751 331449 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028469.1 protein_id gnl|my_center|LOCUS_21160 336047 334953 gene locus_tag LOCUS_21170 336047 334953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270042.1 protein_id gnl|my_center|LOCUS_21170 336046 336423 gene locus_tag LOCUS_21180 336046 336423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 339492 336850 gene locus_tag LOCUS_21190 gene pepN 339492 336850 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_21190 339652 340290 gene locus_tag LOCUS_21200 339652 340290 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_21200 340567 340361 gene locus_tag LOCUS_21210 340567 340361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 341309 340665 gene locus_tag LOCUS_21220 341309 340665 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_21220 342489 341410 gene locus_tag LOCUS_21230 342489 341410 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230795.1 protein_id gnl|my_center|LOCUS_21230 344399 342993 gene locus_tag LOCUS_21240 344399 342993 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168723.1 protein_id gnl|my_center|LOCUS_21240 345437 344427 gene locus_tag LOCUS_21250 345437 344427 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976288.1 protein_id gnl|my_center|LOCUS_21250 346636 345434 gene locus_tag LOCUS_21260 346636 345434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728940.1 protein_id gnl|my_center|LOCUS_21260 347420 346629 gene locus_tag LOCUS_21270 347420 346629 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393168.1 protein_id gnl|my_center|LOCUS_21270 348532 347417 gene locus_tag LOCUS_21280 348532 347417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728939.1 protein_id gnl|my_center|LOCUS_21280 349410 348529 gene locus_tag LOCUS_21290 349410 348529 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894672.1 protein_id gnl|my_center|LOCUS_21290 350465 349407 gene locus_tag LOCUS_21300 350465 349407 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894671.1 protein_id gnl|my_center|LOCUS_21300 351902 350472 gene locus_tag LOCUS_21310 351902 350472 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104316.1 protein_id gnl|my_center|LOCUS_21310 352070 353521 gene locus_tag LOCUS_21320 352070 353521 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 protein_id gnl|my_center|LOCUS_21320 353518 354135 gene locus_tag LOCUS_21330 353518 354135 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036162.1 protein_id gnl|my_center|LOCUS_21330 354300 355274 gene locus_tag LOCUS_21340 354300 355274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 355545 356138 gene locus_tag LOCUS_21350 355545 356138 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_21350 356200 356688 gene locus_tag LOCUS_21360 356200 356688 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_21360 356750 357571 gene locus_tag LOCUS_21370 356750 357571 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_21370 358845 357604 gene locus_tag LOCUS_21380 358845 357604 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_21380 358966 360111 gene locus_tag LOCUS_21390 358966 360111 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_21390 361377 360163 gene locus_tag LOCUS_21400 361377 360163 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21400 361520 361966 gene locus_tag LOCUS_21410 361520 361966 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 protein_id gnl|my_center|LOCUS_21410 363070 361946 gene locus_tag LOCUS_21420 363070 361946 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_21420 363614 363808 gene locus_tag LOCUS_21430 363614 363808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976178.1 protein_id gnl|my_center|LOCUS_21430 363998 363925 gene locus_tag LOCUS_t00260 363998 363925 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 364145 364221 gene locus_tag LOCUS_t00270 364145 364221 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 364400 365827 gene locus_tag LOCUS_21440 gene tig 364400 365827 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_21440 366070 366687 gene locus_tag LOCUS_21450 366070 366687 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030186848.1 protein_id gnl|my_center|LOCUS_21450 366756 367424 gene locus_tag LOCUS_21460 366756 367424 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_21460 367569 368861 gene locus_tag LOCUS_21470 gene clpX 367569 368861 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_21470 369892 368945 gene locus_tag LOCUS_21480 369892 368945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028456.1 protein_id gnl|my_center|LOCUS_21480 370023 372650 gene locus_tag LOCUS_21490 370023 372650 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_21490 372729 374252 gene locus_tag LOCUS_21500 372729 374252 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_21500 374257 374619 gene locus_tag LOCUS_21510 374257 374619 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 protein_id gnl|my_center|LOCUS_21510 374726 375136 gene locus_tag LOCUS_21520 gene ndk 374726 375136 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976187.1 protein_id gnl|my_center|LOCUS_21520 375422 376453 gene locus_tag LOCUS_21530 375422 376453 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_21530 376744 377703 gene locus_tag LOCUS_21540 gene mreC 376744 377703 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_21540 377715 378380 gene locus_tag LOCUS_21550 gene mreD 377715 378380 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976190.1 protein_id gnl|my_center|LOCUS_21550 378377 380734 gene locus_tag LOCUS_21560 gene mrdA 378377 380734 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_21560 380738 381937 gene locus_tag LOCUS_21570 gene rodA 380738 381937 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_21570 381999 383612 gene locus_tag LOCUS_21580 381999 383612 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_21580 383716 385665 gene locus_tag LOCUS_21590 383716 385665 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_21590 386717 385743 gene locus_tag LOCUS_21600 386717 385743 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_21600 387067 388233 gene locus_tag LOCUS_21610 387067 388233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028447.1 protein_id gnl|my_center|LOCUS_21610 388363 389145 gene locus_tag LOCUS_21620 388363 389145 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_21620 389383 393495 gene locus_tag LOCUS_21630 389383 393495 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028446.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21630 393849 394967 gene locus_tag LOCUS_21640 393849 394967 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776119.1 protein_id gnl|my_center|LOCUS_21640 394964 395986 gene locus_tag LOCUS_21650 394964 395986 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776118.1 protein_id gnl|my_center|LOCUS_21650 395976 397556 gene locus_tag LOCUS_21660 395976 397556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 397553 399187 gene locus_tag LOCUS_21670 397553 399187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 399184 400467 gene locus_tag LOCUS_21680 399184 400467 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776106.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence06 205 1542 gene locus_tag LOCUS_21690 205 1542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978040.1 protein_id gnl|my_center|LOCUS_21690 2002 1676 gene locus_tag LOCUS_21700 2002 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2104 2892 gene locus_tag LOCUS_21710 2104 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2892 3665 gene locus_tag LOCUS_21720 gene cseB 2892 3665 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_21720 3668 4948 gene locus_tag LOCUS_21730 3668 4948 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030163.1 protein_id gnl|my_center|LOCUS_21730 5029 6783 gene locus_tag LOCUS_21740 5029 6783 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973938.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21740 7337 6876 gene locus_tag LOCUS_21750 7337 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 8260 7379 gene locus_tag LOCUS_21760 8260 7379 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028549.1 protein_id gnl|my_center|LOCUS_21760 9886 8396 gene locus_tag LOCUS_21770 9886 8396 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966104.1 protein_id gnl|my_center|LOCUS_21770 11387 10395 gene locus_tag LOCUS_21780 11387 10395 CDS product DUF2510 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031111.1 protein_id gnl|my_center|LOCUS_21780 12842 11451 gene locus_tag LOCUS_21790 12842 11451 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028357.1 protein_id gnl|my_center|LOCUS_21790 12156 12066 gene locus_tag LOCUS_t00280 12156 12066 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14283 12835 gene locus_tag LOCUS_21800 14283 12835 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028356.1 protein_id gnl|my_center|LOCUS_21800 15649 14336 gene locus_tag LOCUS_21810 15649 14336 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028355.1 protein_id gnl|my_center|LOCUS_21810 15819 16526 gene locus_tag LOCUS_21820 15819 16526 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976364.1 protein_id gnl|my_center|LOCUS_21820 16821 17549 gene locus_tag LOCUS_21830 16821 17549 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_21830 17763 18362 gene locus_tag LOCUS_21840 17763 18362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466964.1 protein_id gnl|my_center|LOCUS_21840 18475 19281 gene locus_tag LOCUS_21850 18475 19281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 20410 19265 gene locus_tag LOCUS_21860 20410 19265 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029162.1 protein_id gnl|my_center|LOCUS_21860 20847 21581 gene locus_tag LOCUS_21870 20847 21581 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027253.1 protein_id gnl|my_center|LOCUS_21870 21592 23193 gene locus_tag LOCUS_21880 21592 23193 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_21880 23395 24771 gene locus_tag LOCUS_21890 23395 24771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 24844 25275 gene locus_tag LOCUS_21900 24844 25275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 28880 25359 gene locus_tag LOCUS_21910 28880 25359 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_21910 30860 29133 gene locus_tag LOCUS_21920 30860 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 31725 31009 gene locus_tag LOCUS_21930 31725 31009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 33209 31722 gene locus_tag LOCUS_21940 33209 31722 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_21940 33493 33768 gene locus_tag LOCUS_21950 gene chpF 33493 33768 CDS product chaplin ChpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028524.1 protein_id gnl|my_center|LOCUS_21950 34790 33924 gene locus_tag LOCUS_21960 34790 33924 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_21960 35393 34812 gene locus_tag LOCUS_21970 35393 34812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 36451 35555 gene locus_tag LOCUS_21980 36451 35555 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031550.1 protein_id gnl|my_center|LOCUS_21980 37189 36734 gene locus_tag LOCUS_21990 37189 36734 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486148.1 protein_id gnl|my_center|LOCUS_21990 38012 37218 gene locus_tag LOCUS_22000 38012 37218 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226234.1 protein_id gnl|my_center|LOCUS_22000 38211 39197 gene locus_tag LOCUS_22010 38211 39197 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031414.1 protein_id gnl|my_center|LOCUS_22010 40310 39252 gene locus_tag LOCUS_22020 40310 39252 CDS product DUF6397 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027615.1 protein_id gnl|my_center|LOCUS_22020 40863 40444 gene locus_tag LOCUS_22030 40863 40444 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977676.1 protein_id gnl|my_center|LOCUS_22030 41444 43411 gene locus_tag LOCUS_22040 41444 43411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_22040 44297 43503 gene locus_tag LOCUS_22050 44297 43503 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_22050 45892 44483 gene locus_tag LOCUS_22060 45892 44483 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027651.1 protein_id gnl|my_center|LOCUS_22060 46055 46654 gene locus_tag LOCUS_22070 46055 46654 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027620.1 protein_id gnl|my_center|LOCUS_22070 46782 47087 gene locus_tag LOCUS_22080 46782 47087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 47200 48132 gene locus_tag LOCUS_22090 47200 48132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027623.1 protein_id gnl|my_center|LOCUS_22090 48408 48226 gene locus_tag LOCUS_22100 48408 48226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325661.1 protein_id gnl|my_center|LOCUS_22100 49614 48535 gene locus_tag LOCUS_22110 49614 48535 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029216.1 protein_id gnl|my_center|LOCUS_22110 49836 52883 gene locus_tag LOCUS_22120 49836 52883 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_22120 52880 54214 gene locus_tag LOCUS_22130 52880 54214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027625.1 protein_id gnl|my_center|LOCUS_22130 54065 54154 gene locus_tag LOCUS_t00290 54065 54154 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 54757 56226 gene locus_tag LOCUS_22140 54757 56226 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224487.1 protein_id gnl|my_center|LOCUS_22140 56223 57869 gene locus_tag LOCUS_22150 56223 57869 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229315.1 protein_id gnl|my_center|LOCUS_22150 58040 59476 gene locus_tag LOCUS_22160 58040 59476 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776259.1 protein_id gnl|my_center|LOCUS_22160 60752 59523 gene locus_tag LOCUS_22170 60752 59523 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803847.1 protein_id gnl|my_center|LOCUS_22170 64001 60882 gene locus_tag LOCUS_22180 64001 60882 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_22180 65988 63994 gene locus_tag LOCUS_22190 65988 63994 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225053.1 protein_id gnl|my_center|LOCUS_22190 69274 66242 gene locus_tag LOCUS_22200 69274 66242 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_22200 70454 69969 gene locus_tag LOCUS_22210 70454 69969 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223301.1 protein_id gnl|my_center|LOCUS_22210 70651 71577 gene locus_tag LOCUS_22220 70651 71577 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_22220 72499 71600 gene locus_tag LOCUS_22230 72499 71600 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109964.1 protein_id gnl|my_center|LOCUS_22230 73019 74707 gene locus_tag LOCUS_22240 73019 74707 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230332.1 protein_id gnl|my_center|LOCUS_22240 74704 75843 gene locus_tag LOCUS_22250 74704 75843 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_22250 75840 76856 gene locus_tag LOCUS_22260 75840 76856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 76871 77128 gene locus_tag LOCUS_22270 76871 77128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 77125 77865 gene locus_tag LOCUS_22280 gene fabG 77125 77865 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225891.1 protein_id gnl|my_center|LOCUS_22280 77927 78712 gene locus_tag LOCUS_22290 77927 78712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 80019 78787 gene locus_tag LOCUS_22300 80019 78787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 80672 80118 gene locus_tag LOCUS_22310 80672 80118 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026879.1 protein_id gnl|my_center|LOCUS_22310 80912 81874 gene locus_tag LOCUS_22320 80912 81874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_22320 82790 81885 gene locus_tag LOCUS_22330 82790 81885 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031840.1 protein_id gnl|my_center|LOCUS_22330 84058 82796 gene locus_tag LOCUS_22340 84058 82796 CDS product family 2 encapsulin nanocompartment cargo protein terpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031839.1 protein_id gnl|my_center|LOCUS_22340 85597 84185 gene locus_tag LOCUS_22350 85597 84185 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971441.1 protein_id gnl|my_center|LOCUS_22350 86551 85943 gene locus_tag LOCUS_22360 86551 85943 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228168.1 protein_id gnl|my_center|LOCUS_22360 87415 86585 gene locus_tag LOCUS_22370 87415 86585 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228169.1 protein_id gnl|my_center|LOCUS_22370 87593 87913 gene locus_tag LOCUS_22380 87593 87913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 90903 87910 gene locus_tag LOCUS_22390 90903 87910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 91388 90900 gene locus_tag LOCUS_22400 91388 90900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 91504 92829 gene locus_tag LOCUS_22410 91504 92829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 92939 95788 gene locus_tag LOCUS_22420 92939 95788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 96860 96141 gene locus_tag LOCUS_22430 96860 96141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 97247 97657 gene locus_tag LOCUS_22440 97247 97657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 98618 97665 gene locus_tag LOCUS_22450 98618 97665 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388444.1 protein_id gnl|my_center|LOCUS_22450 98703 99482 gene locus_tag LOCUS_22460 98703 99482 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836202.1 protein_id gnl|my_center|LOCUS_22460 99484 99939 gene locus_tag LOCUS_22470 99484 99939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 100860 100009 gene locus_tag LOCUS_22480 100860 100009 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 protein_id gnl|my_center|LOCUS_22480 100961 101551 gene locus_tag LOCUS_22490 100961 101551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 102826 101651 gene locus_tag LOCUS_22500 102826 101651 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469535.1 protein_id gnl|my_center|LOCUS_22500 104259 102823 gene locus_tag LOCUS_22510 104259 102823 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028163.1 protein_id gnl|my_center|LOCUS_22510 105046 104387 gene locus_tag LOCUS_22520 105046 104387 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_22520 106434 105043 gene locus_tag LOCUS_22530 106434 105043 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_22530 106780 106457 gene locus_tag LOCUS_22540 106780 106457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22540 106982 107278 gene locus_tag LOCUS_22550 106982 107278 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484482.1 protein_id gnl|my_center|LOCUS_22550 107319 108284 gene locus_tag LOCUS_22560 107319 108284 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_22560 109375 108299 gene locus_tag LOCUS_22570 109375 108299 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729552.1 protein_id gnl|my_center|LOCUS_22570 109907 111709 gene locus_tag LOCUS_22580 109907 111709 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029615.1 protein_id gnl|my_center|LOCUS_22580 111888 112619 gene locus_tag LOCUS_22590 111888 112619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 112827 113567 gene locus_tag LOCUS_22600 112827 113567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 115076 113619 gene locus_tag LOCUS_22610 115076 113619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22610 115246 115701 gene locus_tag LOCUS_22620 115246 115701 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862546.1 protein_id gnl|my_center|LOCUS_22620 115973 115755 gene locus_tag LOCUS_22630 115973 115755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 115986 116366 gene locus_tag LOCUS_22640 115986 116366 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091620749.1 protein_id gnl|my_center|LOCUS_22640 116450 117115 gene locus_tag LOCUS_22650 116450 117115 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191067.1 protein_id gnl|my_center|LOCUS_22650 117844 117164 gene locus_tag LOCUS_22660 117844 117164 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026858.1 protein_id gnl|my_center|LOCUS_22660 117979 118542 gene locus_tag LOCUS_22670 117979 118542 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026857.1 protein_id gnl|my_center|LOCUS_22670 120744 118621 gene locus_tag LOCUS_22680 120744 118621 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031005.1 protein_id gnl|my_center|LOCUS_22680 121966 120959 gene locus_tag LOCUS_22690 121966 120959 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727260.1 protein_id gnl|my_center|LOCUS_22690 123579 121966 gene locus_tag LOCUS_22700 123579 121966 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_22700 125864 123576 gene locus_tag LOCUS_22710 125864 123576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 126742 125861 gene locus_tag LOCUS_22720 126742 125861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 127770 126739 gene locus_tag LOCUS_22730 127770 126739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229921.1 protein_id gnl|my_center|LOCUS_22730 129311 127767 gene locus_tag LOCUS_22740 129311 127767 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 protein_id gnl|my_center|LOCUS_22740 130227 129349 gene locus_tag LOCUS_22750 130227 129349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731601.1 protein_id gnl|my_center|LOCUS_22750 131153 130227 gene locus_tag LOCUS_22760 131153 130227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031749.1 protein_id gnl|my_center|LOCUS_22760 132289 131150 gene locus_tag LOCUS_22770 132289 131150 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739092.1 protein_id gnl|my_center|LOCUS_22770 132535 133440 gene locus_tag LOCUS_22780 132535 133440 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_22780 133445 134350 gene locus_tag LOCUS_22790 133445 134350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 134475 134915 gene locus_tag LOCUS_22800 134475 134915 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971523.1 protein_id gnl|my_center|LOCUS_22800 135078 135009 gene locus_tag LOCUS_t00300 135078 135009 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 136072 135293 gene locus_tag LOCUS_22810 136072 135293 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228675.1 protein_id gnl|my_center|LOCUS_22810 138321 136096 gene locus_tag LOCUS_22820 138321 136096 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_22820 138973 138554 gene locus_tag LOCUS_22830 138973 138554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 139285 140931 gene locus_tag LOCUS_22840 139285 140931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 141216 142253 gene locus_tag LOCUS_22850 141216 142253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 142357 143589 gene locus_tag LOCUS_22860 142357 143589 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026915.1 protein_id gnl|my_center|LOCUS_22860 143658 144371 gene locus_tag LOCUS_22870 143658 144371 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026914.1 protein_id gnl|my_center|LOCUS_22870 144368 145942 gene locus_tag LOCUS_22880 144368 145942 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225919.1 protein_id gnl|my_center|LOCUS_22880 146432 145974 gene locus_tag LOCUS_22890 146432 145974 CDS product DUF6234 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668745.1 protein_id gnl|my_center|LOCUS_22890 147962 146925 gene locus_tag LOCUS_22900 147962 146925 CDS product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026912.1 protein_id gnl|my_center|LOCUS_22900 148981 147959 gene locus_tag LOCUS_22910 148981 147959 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026911.1 protein_id gnl|my_center|LOCUS_22910 150552 148978 gene locus_tag LOCUS_22920 gene crtI 150552 148978 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026910.1 protein_id gnl|my_center|LOCUS_22920 150788 150549 gene locus_tag LOCUS_22930 150788 150549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 151227 152600 gene locus_tag LOCUS_22940 151227 152600 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_22940 154140 152620 gene locus_tag LOCUS_22950 154140 152620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027315.1 protein_id gnl|my_center|LOCUS_22950 154839 154228 gene locus_tag LOCUS_22960 154839 154228 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727585.1 protein_id gnl|my_center|LOCUS_22960 154939 156192 gene locus_tag LOCUS_22970 154939 156192 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_22970 156275 157492 gene locus_tag LOCUS_22980 156275 157492 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_22980 158319 157519 gene locus_tag LOCUS_22990 158319 157519 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031037.1 protein_id gnl|my_center|LOCUS_22990 158899 158381 gene locus_tag LOCUS_23000 158899 158381 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486744.1 protein_id gnl|my_center|LOCUS_23000 158989 159549 gene locus_tag LOCUS_23010 158989 159549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 159595 160179 gene locus_tag LOCUS_23020 159595 160179 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224151.1 protein_id gnl|my_center|LOCUS_23020 160683 160225 gene locus_tag LOCUS_23030 160683 160225 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 protein_id gnl|my_center|LOCUS_23030 160778 161359 gene locus_tag LOCUS_23040 160778 161359 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978089.1 protein_id gnl|my_center|LOCUS_23040 162208 161444 gene locus_tag LOCUS_23050 162208 161444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 162937 162308 gene locus_tag LOCUS_23060 162937 162308 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 protein_id gnl|my_center|LOCUS_23060 163497 162934 gene locus_tag LOCUS_23070 163497 162934 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729728.1 protein_id gnl|my_center|LOCUS_23070 163762 163598 gene locus_tag LOCUS_23080 163762 163598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 165295 167310 gene locus_tag LOCUS_23090 165295 167310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23090 168232 167396 gene locus_tag LOCUS_23100 168232 167396 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_23100 168558 168364 gene locus_tag LOCUS_23110 168558 168364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977636.1 protein_id gnl|my_center|LOCUS_23110 169547 168690 gene locus_tag LOCUS_23120 169547 168690 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_23120 170367 169705 gene locus_tag LOCUS_23130 170367 169705 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 protein_id gnl|my_center|LOCUS_23130 171370 170360 gene locus_tag LOCUS_23140 171370 170360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_23140 172272 171367 gene locus_tag LOCUS_23150 172272 171367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_23150 173230 172265 gene locus_tag LOCUS_23160 173230 172265 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_23160 174852 173254 gene locus_tag LOCUS_23170 174852 173254 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_23170 176100 174964 gene locus_tag LOCUS_23180 176100 174964 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027646.1 protein_id gnl|my_center|LOCUS_23180 177311 176097 gene locus_tag LOCUS_23190 177311 176097 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027647.1 protein_id gnl|my_center|LOCUS_23190 178288 177311 gene locus_tag LOCUS_23200 178288 177311 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 protein_id gnl|my_center|LOCUS_23200 179157 178447 gene locus_tag LOCUS_23210 179157 178447 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_23210 180538 179240 gene locus_tag LOCUS_23220 180538 179240 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_23220 181730 180657 gene locus_tag LOCUS_23230 181730 180657 CDS product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027255.1 protein_id gnl|my_center|LOCUS_23230 183040 181760 gene locus_tag LOCUS_23240 183040 181760 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978237.1 protein_id gnl|my_center|LOCUS_23240 183665 183045 gene locus_tag LOCUS_23250 183665 183045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027256.1 protein_id gnl|my_center|LOCUS_23250 185791 183662 gene locus_tag LOCUS_23260 185791 183662 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_23260 187529 185916 gene locus_tag LOCUS_23270 187529 185916 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_23270 188726 187626 gene locus_tag LOCUS_23280 188726 187626 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739092.1 protein_id gnl|my_center|LOCUS_23280 188954 189925 gene locus_tag LOCUS_23290 188954 189925 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972087.1 protein_id gnl|my_center|LOCUS_23290 191291 189963 gene locus_tag LOCUS_23300 191291 189963 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466721.1 protein_id gnl|my_center|LOCUS_23300 191440 192345 gene locus_tag LOCUS_23310 191440 192345 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_23310 192466 192909 gene locus_tag LOCUS_23320 gene cynS 192466 192909 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 protein_id gnl|my_center|LOCUS_23320 193896 192919 gene locus_tag LOCUS_23330 193896 192919 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226103.1 protein_id gnl|my_center|LOCUS_23330 194140 196317 gene locus_tag LOCUS_23340 194140 196317 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639906.1 protein_id gnl|my_center|LOCUS_23340 196362 198068 gene locus_tag LOCUS_23350 gene malL 196362 198068 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_23350 199886 198159 gene locus_tag LOCUS_23360 199886 198159 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_23360 202780 199907 gene locus_tag LOCUS_23370 202780 199907 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_23370 203309 204277 gene locus_tag LOCUS_23380 203309 204277 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031720.1 protein_id gnl|my_center|LOCUS_23380 206791 204374 gene locus_tag LOCUS_23390 206791 204374 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223208.1 protein_id gnl|my_center|LOCUS_23390 207035 207349 gene locus_tag LOCUS_23400 207035 207349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976525.1 protein_id gnl|my_center|LOCUS_23400 207501 208007 gene locus_tag LOCUS_23410 207501 208007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 208451 208047 gene locus_tag LOCUS_23420 208451 208047 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029240.1 protein_id gnl|my_center|LOCUS_23420 208582 209523 gene locus_tag LOCUS_23430 208582 209523 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029241.1 protein_id gnl|my_center|LOCUS_23430 211718 209571 gene locus_tag LOCUS_23440 gene ligA 211718 209571 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485959.1 protein_id gnl|my_center|LOCUS_23440 212774 211818 gene locus_tag LOCUS_23450 212774 211818 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088045.1 protein_id gnl|my_center|LOCUS_23450 213827 212853 gene locus_tag LOCUS_23460 gene hemC 213827 212853 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971798.1 protein_id gnl|my_center|LOCUS_23460 214173 215381 gene locus_tag LOCUS_23470 214173 215381 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742228.1 protein_id gnl|my_center|LOCUS_23470 215392 216519 gene locus_tag LOCUS_23480 215392 216519 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_23480 216942 216550 gene locus_tag LOCUS_23490 216942 216550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 217005 220904 gene locus_tag LOCUS_23500 217005 220904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 220904 222040 gene locus_tag LOCUS_23510 220904 222040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 222037 223335 gene locus_tag LOCUS_23520 222037 223335 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027799.1 protein_id gnl|my_center|LOCUS_23520 224331 223375 gene locus_tag LOCUS_23530 224331 223375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 224604 225356 gene locus_tag LOCUS_23540 224604 225356 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 protein_id gnl|my_center|LOCUS_23540 227130 225421 gene locus_tag LOCUS_23550 227130 225421 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921422.1 protein_id gnl|my_center|LOCUS_23550 227393 227130 gene locus_tag LOCUS_23560 227393 227130 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528614.1 protein_id gnl|my_center|LOCUS_23560 227884 227399 gene locus_tag LOCUS_23570 gene trxC 227884 227399 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889424.1 protein_id gnl|my_center|LOCUS_23570 230535 227890 gene locus_tag LOCUS_23580 gene clpB 230535 227890 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_23580 230879 230526 gene locus_tag LOCUS_23590 230879 230526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 231841 230876 gene locus_tag LOCUS_23600 231841 230876 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943043.1 protein_id gnl|my_center|LOCUS_23600 232460 231849 gene locus_tag LOCUS_23610 232460 231849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 234389 232470 gene locus_tag LOCUS_23620 gene dnaK 234389 232470 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144248.1 protein_id gnl|my_center|LOCUS_23620 236967 234613 gene locus_tag LOCUS_23630 236967 234613 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_23630 237800 236964 gene locus_tag LOCUS_23640 237800 236964 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_23640 238485 237991 gene locus_tag LOCUS_23650 238485 237991 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055566559.1 protein_id gnl|my_center|LOCUS_23650 238682 240328 gene locus_tag LOCUS_23660 gene pgm 238682 240328 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_23660 241212 240355 gene locus_tag LOCUS_23670 241212 240355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027957.1 protein_id gnl|my_center|LOCUS_23670 242465 241209 gene locus_tag LOCUS_23680 242465 241209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 242730 243554 gene locus_tag LOCUS_23690 242730 243554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_23690 243584 244714 gene locus_tag LOCUS_23700 243584 244714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 244877 245662 gene locus_tag LOCUS_23710 244877 245662 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971739.1 protein_id gnl|my_center|LOCUS_23710 245795 246604 gene locus_tag LOCUS_23720 245795 246604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 246625 247101 gene locus_tag LOCUS_23730 246625 247101 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970037.1 protein_id gnl|my_center|LOCUS_23730 247176 247823 gene locus_tag LOCUS_23740 247176 247823 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_23740 248716 247898 gene locus_tag LOCUS_23750 248716 247898 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027589.1 protein_id gnl|my_center|LOCUS_23750 248682 249179 gene locus_tag LOCUS_23760 248682 249179 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977708.1 protein_id gnl|my_center|LOCUS_23760 249768 249274 gene locus_tag LOCUS_23770 249768 249274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973057.1 protein_id gnl|my_center|LOCUS_23770 250028 250219 gene locus_tag LOCUS_23780 250028 250219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 251409 250336 gene locus_tag LOCUS_23790 251409 250336 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971557.1 protein_id gnl|my_center|LOCUS_23790 251540 251965 gene locus_tag LOCUS_23800 251540 251965 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328136.1 protein_id gnl|my_center|LOCUS_23800 252573 251989 gene locus_tag LOCUS_23810 252573 251989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_23810 253515 252610 gene locus_tag LOCUS_23820 gene htpX 253515 252610 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_23820 253691 253969 gene locus_tag LOCUS_23830 253691 253969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23830 253991 254266 gene locus_tag LOCUS_23840 253991 254266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23840 254366 255481 gene locus_tag LOCUS_23850 254366 255481 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975538.1 protein_id gnl|my_center|LOCUS_23850 255495 256124 gene locus_tag LOCUS_23860 255495 256124 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223203.1 protein_id gnl|my_center|LOCUS_23860 256744 256130 gene locus_tag LOCUS_23870 256744 256130 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230929.1 protein_id gnl|my_center|LOCUS_23870 256837 256980 gene locus_tag LOCUS_23880 256837 256980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 256980 257834 gene locus_tag LOCUS_23890 256980 257834 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243852.1 protein_id gnl|my_center|LOCUS_23890 258559 257891 gene locus_tag LOCUS_23900 258559 257891 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 protein_id gnl|my_center|LOCUS_23900 258774 259211 gene locus_tag LOCUS_23910 258774 259211 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975822.1 protein_id gnl|my_center|LOCUS_23910 260080 259247 gene locus_tag LOCUS_23920 260080 259247 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031456.1 protein_id gnl|my_center|LOCUS_23920 260298 261731 gene locus_tag LOCUS_23930 260298 261731 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031455.1 protein_id gnl|my_center|LOCUS_23930 261956 263095 gene locus_tag LOCUS_23940 261956 263095 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_23940 264372 263290 gene locus_tag LOCUS_23950 264372 263290 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229444.1 protein_id gnl|my_center|LOCUS_23950 264535 265452 gene locus_tag LOCUS_23960 264535 265452 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229445.1 protein_id gnl|my_center|LOCUS_23960 265515 266726 gene locus_tag LOCUS_23970 265515 266726 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031719.1 protein_id gnl|my_center|LOCUS_23970 266861 267403 gene locus_tag LOCUS_23980 266861 267403 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 protein_id gnl|my_center|LOCUS_23980 267584 267429 gene locus_tag LOCUS_23990 267584 267429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 268178 267705 gene locus_tag LOCUS_24000 268178 267705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 268701 268321 gene locus_tag LOCUS_24010 268701 268321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 268666 269190 gene locus_tag LOCUS_24020 268666 269190 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_24020 270001 269273 gene locus_tag LOCUS_24030 270001 269273 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868936.1 protein_id gnl|my_center|LOCUS_24030 270392 269985 gene locus_tag LOCUS_24040 270392 269985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 271179 270442 gene locus_tag LOCUS_24050 271179 270442 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_24050 271430 272557 gene locus_tag LOCUS_24060 271430 272557 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_24060 272607 273881 gene locus_tag LOCUS_24070 272607 273881 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 protein_id gnl|my_center|LOCUS_24070 273963 274151 gene locus_tag LOCUS_24080 273963 274151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 274154 275179 gene locus_tag LOCUS_24090 274154 275179 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807628.1 protein_id gnl|my_center|LOCUS_24090 275265 275999 gene locus_tag LOCUS_24100 275265 275999 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208961.1 protein_id gnl|my_center|LOCUS_24100 275996 276688 gene locus_tag LOCUS_24110 275996 276688 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 protein_id gnl|my_center|LOCUS_24110 276749 277879 gene locus_tag LOCUS_24120 276749 277879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 277949 279055 gene locus_tag LOCUS_24130 277949 279055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 279052 280797 gene locus_tag LOCUS_24140 279052 280797 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390948.1 protein_id gnl|my_center|LOCUS_24140 280877 282076 gene locus_tag LOCUS_24150 280877 282076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064851.1 protein_id gnl|my_center|LOCUS_24150 282183 283253 gene locus_tag LOCUS_24160 282183 283253 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243875.1 protein_id gnl|my_center|LOCUS_24160 284227 283373 gene locus_tag LOCUS_24170 284227 283373 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030940.1 protein_id gnl|my_center|LOCUS_24170 285824 284313 gene locus_tag LOCUS_24180 285824 284313 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461820.1 protein_id gnl|my_center|LOCUS_24180 287067 285895 gene locus_tag LOCUS_24190 287067 285895 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_24190 287469 287275 gene locus_tag LOCUS_24200 287469 287275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24200 287446 288222 gene locus_tag LOCUS_24210 287446 288222 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623997.1 protein_id gnl|my_center|LOCUS_24210 288258 288779 gene locus_tag LOCUS_24220 288258 288779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 288776 288985 gene locus_tag LOCUS_24230 288776 288985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 289337 288996 gene locus_tag LOCUS_24240 289337 288996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 290748 289546 gene locus_tag LOCUS_24250 290748 289546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 291291 290917 gene locus_tag LOCUS_24260 291291 290917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 291605 292495 gene locus_tag LOCUS_24270 gene argB 291605 292495 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_24270 293135 292602 gene locus_tag LOCUS_24280 293135 292602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 294825 293221 gene locus_tag LOCUS_24290 294825 293221 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230124.1 protein_id gnl|my_center|LOCUS_24290 295063 294851 gene locus_tag LOCUS_24300 295063 294851 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978376.1 protein_id gnl|my_center|LOCUS_24300 295172 296269 gene locus_tag LOCUS_24310 295172 296269 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027154.1 protein_id gnl|my_center|LOCUS_24310 298065 296362 gene locus_tag LOCUS_24320 298065 296362 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666957.1 protein_id gnl|my_center|LOCUS_24320 309052 298049 gene locus_tag LOCUS_24330 309052 298049 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027156.1 protein_id gnl|my_center|LOCUS_24330 310926 309124 gene locus_tag LOCUS_24340 310926 309124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027157.1 protein_id gnl|my_center|LOCUS_24340 312043 310991 gene locus_tag LOCUS_24350 312043 310991 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978370.1 protein_id gnl|my_center|LOCUS_24350 313089 312229 gene locus_tag LOCUS_24360 313089 312229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_24360 314254 313124 gene locus_tag LOCUS_24370 314254 313124 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 protein_id gnl|my_center|LOCUS_24370 315309 314251 gene locus_tag LOCUS_24380 315309 314251 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978367.1 protein_id gnl|my_center|LOCUS_24380 316704 315364 gene locus_tag LOCUS_24390 316704 315364 CDS product lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226866.1 protein_id gnl|my_center|LOCUS_24390 316955 317902 gene locus_tag LOCUS_24400 316955 317902 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027162.1 protein_id gnl|my_center|LOCUS_24400 318400 318035 gene locus_tag LOCUS_24410 318400 318035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 318555 319091 gene locus_tag LOCUS_24420 318555 319091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 319198 320076 gene locus_tag LOCUS_24430 319198 320076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 320812 320123 gene locus_tag LOCUS_24440 320812 320123 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_24440 322559 321276 gene locus_tag LOCUS_24450 322559 321276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 324155 322728 gene locus_tag LOCUS_24460 324155 322728 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_24460 324384 324884 gene locus_tag LOCUS_24470 324384 324884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 325069 326244 gene locus_tag LOCUS_24480 325069 326244 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 protein_id gnl|my_center|LOCUS_24480 327299 326301 gene locus_tag LOCUS_24490 327299 326301 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969365.1 protein_id gnl|my_center|LOCUS_24490 328560 327373 gene locus_tag LOCUS_24500 328560 327373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 328764 329666 gene locus_tag LOCUS_24510 328764 329666 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228232.1 protein_id gnl|my_center|LOCUS_24510 331655 329655 gene locus_tag LOCUS_24520 331655 329655 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_24520 332502 331858 gene locus_tag LOCUS_24530 332502 331858 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_24530 334250 332571 gene locus_tag LOCUS_24540 334250 332571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_24540 334529 335329 gene locus_tag LOCUS_24550 334529 335329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 335286 335561 gene locus_tag LOCUS_24560 335286 335561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 336792 335653 gene locus_tag LOCUS_24570 336792 335653 CDS product glutathione-independent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974908.1 protein_id gnl|my_center|LOCUS_24570 337520 337320 gene locus_tag LOCUS_24580 337520 337320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 337580 338092 gene locus_tag LOCUS_24590 337580 338092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 338337 338852 gene locus_tag LOCUS_24600 338337 338852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 339597 339202 gene locus_tag LOCUS_24610 339597 339202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 339686 340579 gene locus_tag LOCUS_24620 339686 340579 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_24620 341791 340865 gene locus_tag LOCUS_24630 341791 340865 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189804125.1 protein_id gnl|my_center|LOCUS_24630 342643 341852 gene locus_tag LOCUS_24640 342643 341852 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975110.1 protein_id gnl|my_center|LOCUS_24640 343728 342889 gene locus_tag LOCUS_24650 343728 342889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 344996 343893 gene locus_tag LOCUS_24660 gene vanJ 344996 343893 CDS product teicoplanin resistance protein VanJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029107.1 protein_id gnl|my_center|LOCUS_24660 345090 345779 gene locus_tag LOCUS_24670 345090 345779 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_24670 345790 346887 gene locus_tag LOCUS_24680 gene vanS-Sc 345790 346887 CDS product VanSc-type vancomycin resistance histidine kinase VanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975349.1 protein_id gnl|my_center|LOCUS_24680 346929 348758 gene locus_tag LOCUS_24690 346929 348758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 349731 348769 gene locus_tag LOCUS_24700 349731 348769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 351083 349728 gene locus_tag LOCUS_24710 351083 349728 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226651.1 protein_id gnl|my_center|LOCUS_24710 352745 351093 gene locus_tag LOCUS_24720 352745 351093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533383.1 protein_id gnl|my_center|LOCUS_24720 353824 352742 gene locus_tag LOCUS_24730 353824 352742 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_24730 355277 353982 gene locus_tag LOCUS_24740 355277 353982 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_24740 355894 355274 gene locus_tag LOCUS_24750 355894 355274 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247843.1 protein_id gnl|my_center|LOCUS_24750 356243 355866 gene locus_tag LOCUS_24760 356243 355866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 356659 356240 gene locus_tag LOCUS_24770 356659 356240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 358032 356656 gene locus_tag LOCUS_24780 358032 356656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 358734 359156 gene locus_tag LOCUS_24790 358734 359156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 360771 359179 gene locus_tag LOCUS_24800 360771 359179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_24800 361492 360944 gene locus_tag LOCUS_24810 361492 360944 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_24810 361600 362550 gene locus_tag LOCUS_24820 361600 362550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 363281 362571 gene locus_tag LOCUS_24830 363281 362571 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971533.1 protein_id gnl|my_center|LOCUS_24830 363788 363342 gene locus_tag LOCUS_24840 363788 363342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 364704 364039 gene locus_tag LOCUS_24850 364704 364039 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873188.1 protein_id gnl|my_center|LOCUS_24850 364804 365784 gene locus_tag LOCUS_24860 364804 365784 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224988.1 protein_id gnl|my_center|LOCUS_24860 366874 365846 gene locus_tag LOCUS_24870 366874 365846 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 protein_id gnl|my_center|LOCUS_24870 367888 367022 gene locus_tag LOCUS_24880 367888 367022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 368691 367885 gene locus_tag LOCUS_24890 368691 367885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 368890 369075 gene locus_tag LOCUS_24900 368890 369075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 369072 369746 gene locus_tag LOCUS_24910 369072 369746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 369875 371092 gene locus_tag LOCUS_24920 369875 371092 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026891.1 protein_id gnl|my_center|LOCUS_24920 371103 372041 gene locus_tag LOCUS_24930 371103 372041 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495068.1 protein_id gnl|my_center|LOCUS_24930 372142 372555 gene locus_tag LOCUS_24940 372142 372555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 373252 372641 gene locus_tag LOCUS_24950 373252 372641 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971478.1 protein_id gnl|my_center|LOCUS_24950 374179 373265 gene locus_tag LOCUS_24960 374179 373265 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729840.1 protein_id gnl|my_center|LOCUS_24960 374922 375458 gene locus_tag LOCUS_24970 374922 375458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 375553 376002 gene locus_tag LOCUS_24980 375553 376002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 376993 376004 gene locus_tag LOCUS_24990 376993 376004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 377084 377263 gene locus_tag LOCUS_25000 377084 377263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 378134 377304 gene locus_tag LOCUS_25010 378134 377304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 378247 379806 gene locus_tag LOCUS_25020 378247 379806 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 protein_id gnl|my_center|LOCUS_25020 380614 379880 gene locus_tag LOCUS_25030 380614 379880 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969543.1 protein_id gnl|my_center|LOCUS_25030 380807 381391 gene locus_tag LOCUS_25040 380807 381391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 382360 381464 gene locus_tag LOCUS_25050 382360 381464 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225947.1 protein_id gnl|my_center|LOCUS_25050 382514 382993 gene locus_tag LOCUS_25060 382514 382993 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227660.1 protein_id gnl|my_center|LOCUS_25060 383755 383165 gene locus_tag LOCUS_25070 383755 383165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 384588 383941 gene locus_tag LOCUS_25080 384588 383941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 384816 385205 gene locus_tag LOCUS_25090 384816 385205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 385595 385993 gene locus_tag LOCUS_25100 385595 385993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25100 385960 386169 gene locus_tag LOCUS_25110 385960 386169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 386337 386708 gene locus_tag LOCUS_25120 386337 386708 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228912.1 protein_id gnl|my_center|LOCUS_25120 387756 386767 gene locus_tag LOCUS_25130 387756 386767 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225460.1 protein_id gnl|my_center|LOCUS_25130 388013 389152 gene locus_tag LOCUS_25140 388013 389152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 389118 389615 gene locus_tag LOCUS_25150 389118 389615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 390668 389925 gene locus_tag LOCUS_25160 390668 389925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 391807 390878 gene locus_tag LOCUS_25170 391807 390878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence07 260 48 gene locus_tag LOCUS_25180 260 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1071 247 gene locus_tag LOCUS_25190 1071 247 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_25190 1191 1601 gene locus_tag LOCUS_25200 1191 1601 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_25200 2386 1724 gene locus_tag LOCUS_25210 gene leuE 2386 1724 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_25210 2404 2817 gene locus_tag LOCUS_25220 2404 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 2814 3206 gene locus_tag LOCUS_25230 2814 3206 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 protein_id gnl|my_center|LOCUS_25230 4856 3234 gene locus_tag LOCUS_25240 4856 3234 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031217.1 protein_id gnl|my_center|LOCUS_25240 5824 4907 gene locus_tag LOCUS_25250 5824 4907 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029918.1 protein_id gnl|my_center|LOCUS_25250 6195 7070 gene locus_tag LOCUS_25260 6195 7070 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029915.1 protein_id gnl|my_center|LOCUS_25260 8710 7406 gene locus_tag LOCUS_25270 8710 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 9468 8710 gene locus_tag LOCUS_25280 9468 8710 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_25280 10448 9825 gene locus_tag LOCUS_25290 10448 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029911.1 protein_id gnl|my_center|LOCUS_25290 12337 10697 gene locus_tag LOCUS_25300 12337 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 12960 12541 gene locus_tag LOCUS_25310 12960 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 12844 13191 gene locus_tag LOCUS_25320 12844 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 13409 13741 gene locus_tag LOCUS_25330 gene sdhC 13409 13741 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974113.1 protein_id gnl|my_center|LOCUS_25330 13745 14236 gene locus_tag LOCUS_25340 13745 14236 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029907.1 protein_id gnl|my_center|LOCUS_25340 14258 16012 gene locus_tag LOCUS_25350 gene sdhA 14258 16012 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_25350 16012 16791 gene locus_tag LOCUS_25360 16012 16791 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_25360 16944 17468 gene locus_tag LOCUS_25370 16944 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 18243 17455 gene locus_tag LOCUS_25380 18243 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 18303 19067 gene locus_tag LOCUS_25390 18303 19067 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029905.1 protein_id gnl|my_center|LOCUS_25390 21534 19027 gene locus_tag LOCUS_25400 21534 19027 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_25400 21685 22416 gene locus_tag LOCUS_25410 21685 22416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_25410 22413 23921 gene locus_tag LOCUS_25420 gene phoR 22413 23921 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_25420 25338 24031 gene locus_tag LOCUS_25430 25338 24031 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 protein_id gnl|my_center|LOCUS_25430 25643 25353 gene locus_tag LOCUS_25440 25643 25353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974124.1 protein_id gnl|my_center|LOCUS_25440 25834 27114 gene locus_tag LOCUS_25450 25834 27114 CDS product DUF5136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486558.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25450 28076 27111 gene locus_tag LOCUS_25460 28076 27111 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_25460 28243 29682 gene locus_tag LOCUS_25470 28243 29682 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974129.1 protein_id gnl|my_center|LOCUS_25470 29763 30518 gene locus_tag LOCUS_25480 29763 30518 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974130.1 protein_id gnl|my_center|LOCUS_25480 31157 30561 gene locus_tag LOCUS_25490 31157 30561 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_25490 31341 31168 gene locus_tag LOCUS_25500 31341 31168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 32418 31408 gene locus_tag LOCUS_25510 gene trpS 32418 31408 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 protein_id gnl|my_center|LOCUS_25510 32487 33119 gene locus_tag LOCUS_25520 32487 33119 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378484.1 protein_id gnl|my_center|LOCUS_25520 33112 34029 gene locus_tag LOCUS_25530 33112 34029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 34192 34950 gene locus_tag LOCUS_25540 34192 34950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 35092 36297 gene locus_tag LOCUS_25550 gene rocD 35092 36297 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_25550 37639 36455 gene locus_tag LOCUS_25560 37639 36455 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_25560 37939 37658 gene locus_tag LOCUS_25570 37939 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 38218 38877 gene locus_tag LOCUS_25580 38218 38877 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270136.1 protein_id gnl|my_center|LOCUS_25580 40032 38884 gene locus_tag LOCUS_25590 40032 38884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978628.1 protein_id gnl|my_center|LOCUS_25590 41642 40068 gene locus_tag LOCUS_25600 41642 40068 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729584.1 protein_id gnl|my_center|LOCUS_25600 41690 42250 gene locus_tag LOCUS_25610 41690 42250 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_25610 42445 43083 gene locus_tag LOCUS_25620 42445 43083 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225044.1 protein_id gnl|my_center|LOCUS_25620 43551 43288 gene locus_tag LOCUS_25630 43551 43288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 43445 44323 gene locus_tag LOCUS_25640 43445 44323 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226393.1 protein_id gnl|my_center|LOCUS_25640 44416 45009 gene locus_tag LOCUS_25650 44416 45009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 45073 46122 gene locus_tag LOCUS_25660 45073 46122 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226390.1 protein_id gnl|my_center|LOCUS_25660 46489 46133 gene locus_tag LOCUS_25670 46489 46133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030669.1 protein_id gnl|my_center|LOCUS_25670 47580 46624 gene locus_tag LOCUS_25680 47580 46624 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_25680 49714 47660 gene locus_tag LOCUS_25690 49714 47660 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_25690 50775 49711 gene locus_tag LOCUS_25700 50775 49711 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_25700 52328 50775 gene locus_tag LOCUS_25710 52328 50775 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974143.1 protein_id gnl|my_center|LOCUS_25710 53959 52451 gene locus_tag LOCUS_25720 53959 52451 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029892.1 protein_id gnl|my_center|LOCUS_25720 54691 54203 gene locus_tag LOCUS_25730 54691 54203 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977781.1 protein_id gnl|my_center|LOCUS_25730 56014 55025 gene locus_tag LOCUS_25740 56014 55025 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_25740 57340 56192 gene locus_tag LOCUS_25750 57340 56192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 58307 57708 gene locus_tag LOCUS_25760 58307 57708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 59185 58319 gene locus_tag LOCUS_25770 59185 58319 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_25770 59477 60082 gene locus_tag LOCUS_25780 59477 60082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 61816 60221 gene locus_tag LOCUS_25790 gene purH 61816 60221 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_25790 62511 61813 gene locus_tag LOCUS_25800 gene purN 62511 61813 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_25800 63343 62810 gene locus_tag LOCUS_25810 63343 62810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 63703 63410 gene locus_tag LOCUS_25820 63703 63410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 65790 63700 gene locus_tag LOCUS_25830 65790 63700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 65916 67238 gene locus_tag LOCUS_25840 65916 67238 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871938.1 protein_id gnl|my_center|LOCUS_25840 68239 67355 gene locus_tag LOCUS_25850 gene sucD 68239 67355 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_25850 69435 68260 gene locus_tag LOCUS_25860 gene sucC 69435 68260 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_25860 70882 69695 gene locus_tag LOCUS_25870 70882 69695 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_25870 73308 70879 gene locus_tag LOCUS_25880 73308 70879 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_25880 74453 73305 gene locus_tag LOCUS_25890 74453 73305 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_25890 74547 75953 gene locus_tag LOCUS_25900 74547 75953 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055512687.1 protein_id gnl|my_center|LOCUS_25900 76075 77790 gene locus_tag LOCUS_25910 76075 77790 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_25910 78232 77819 gene locus_tag LOCUS_25920 78232 77819 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_25920 78460 79371 gene locus_tag LOCUS_25930 78460 79371 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_25930 79679 81286 gene locus_tag LOCUS_25940 79679 81286 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029871.1 protein_id gnl|my_center|LOCUS_25940 83906 81363 gene locus_tag LOCUS_25950 gene pcrA 83906 81363 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_25950 84266 85435 gene locus_tag LOCUS_25960 84266 85435 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029869.1 protein_id gnl|my_center|LOCUS_25960 85565 86677 gene locus_tag LOCUS_25970 85565 86677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029802.1 protein_id gnl|my_center|LOCUS_25970 86908 87960 gene locus_tag LOCUS_25980 86908 87960 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_25980 88033 88437 gene locus_tag LOCUS_25990 88033 88437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 89162 88449 gene locus_tag LOCUS_26000 89162 88449 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_26000 90568 89159 gene locus_tag LOCUS_26010 90568 89159 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_26010 90720 92024 gene locus_tag LOCUS_26020 90720 92024 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029865.1 protein_id gnl|my_center|LOCUS_26020 92011 92274 gene locus_tag LOCUS_26030 92011 92274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 92699 92181 gene locus_tag LOCUS_26040 92699 92181 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897578.1 protein_id gnl|my_center|LOCUS_26040 94180 92915 gene locus_tag LOCUS_26050 94180 92915 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029864.1 protein_id gnl|my_center|LOCUS_26050 95033 94275 gene locus_tag LOCUS_26060 95033 94275 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226783.1 protein_id gnl|my_center|LOCUS_26060 95676 95086 gene locus_tag LOCUS_26070 95676 95086 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_26070 97371 95791 gene locus_tag LOCUS_26080 gene guaA 97371 95791 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_26080 97683 97964 gene locus_tag LOCUS_26090 97683 97964 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486583.1 protein_id gnl|my_center|LOCUS_26090 98666 99760 gene locus_tag LOCUS_26100 98666 99760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 101723 99861 gene locus_tag LOCUS_26110 101723 99861 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029860.1 protein_id gnl|my_center|LOCUS_26110 103367 101742 gene locus_tag LOCUS_26120 103367 101742 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_26120 105233 103515 gene locus_tag LOCUS_26130 105233 103515 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518622.1 protein_id gnl|my_center|LOCUS_26130 107164 105356 gene locus_tag LOCUS_26140 107164 105356 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486587.1 protein_id gnl|my_center|LOCUS_26140 110655 107386 gene locus_tag LOCUS_26150 110655 107386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 112984 110996 gene locus_tag LOCUS_26160 112984 110996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 113261 113052 gene locus_tag LOCUS_26170 113261 113052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 115132 113426 gene locus_tag LOCUS_26180 115132 113426 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_26180 115390 116652 gene locus_tag LOCUS_26190 115390 116652 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_26190 116771 117259 gene locus_tag LOCUS_26200 116771 117259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 118457 117333 gene locus_tag LOCUS_26210 118457 117333 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_26210 120074 118572 gene locus_tag LOCUS_26220 gene guaB 120074 118572 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_26220 120756 120202 gene locus_tag LOCUS_26230 120756 120202 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_26230 121667 121056 gene locus_tag LOCUS_26240 121667 121056 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 protein_id gnl|my_center|LOCUS_26240 122105 122428 gene locus_tag LOCUS_26250 122105 122428 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_26250 123487 122591 gene locus_tag LOCUS_26260 123487 122591 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_26260 123582 124337 gene locus_tag LOCUS_26270 123582 124337 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_26270 124445 125248 gene locus_tag LOCUS_26280 124445 125248 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_26280 125546 125358 gene locus_tag LOCUS_26290 125546 125358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 125451 126473 gene locus_tag LOCUS_26300 125451 126473 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027277.1 protein_id gnl|my_center|LOCUS_26300 126633 127973 gene locus_tag LOCUS_26310 126633 127973 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227189.1 protein_id gnl|my_center|LOCUS_26310 127970 128920 gene locus_tag LOCUS_26320 127970 128920 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978201.1 protein_id gnl|my_center|LOCUS_26320 128917 129846 gene locus_tag LOCUS_26330 128917 129846 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978200.1 protein_id gnl|my_center|LOCUS_26330 129903 130937 gene locus_tag LOCUS_26340 129903 130937 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027278.1 protein_id gnl|my_center|LOCUS_26340 132695 131070 gene locus_tag LOCUS_26350 gene groL 132695 131070 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_26350 133104 132796 gene locus_tag LOCUS_26360 gene groES 133104 132796 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_26360 134507 133338 gene locus_tag LOCUS_26370 134507 133338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 134394 135665 gene locus_tag LOCUS_26380 134394 135665 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_26380 135870 138092 gene locus_tag LOCUS_26390 135870 138092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 138129 138842 gene locus_tag LOCUS_26400 138129 138842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 138839 139351 gene locus_tag LOCUS_26410 138839 139351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 139927 139385 gene locus_tag LOCUS_26420 139927 139385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 140709 140071 gene locus_tag LOCUS_26430 140709 140071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 140865 141668 gene locus_tag LOCUS_26440 140865 141668 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229343.1 protein_id gnl|my_center|LOCUS_26440 142958 141696 gene locus_tag LOCUS_26450 142958 141696 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029845.1 protein_id gnl|my_center|LOCUS_26450 143363 143010 gene locus_tag LOCUS_26460 143363 143010 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974216.1 protein_id gnl|my_center|LOCUS_26460 143720 143469 gene locus_tag LOCUS_26470 143720 143469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029842.1 protein_id gnl|my_center|LOCUS_26470 144814 143717 gene locus_tag LOCUS_26480 gene tsaD 144814 143717 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_26480 145316 144807 gene locus_tag LOCUS_26490 gene rimI 145316 144807 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_26490 145972 145313 gene locus_tag LOCUS_26500 gene tsaB 145972 145313 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_26500 145868 146644 gene locus_tag LOCUS_26510 145868 146644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 146861 146694 gene locus_tag LOCUS_26520 146861 146694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 147041 147919 gene locus_tag LOCUS_26530 147041 147919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 148509 147937 gene locus_tag LOCUS_26540 gene tsaE 148509 147937 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_26540 149737 148481 gene locus_tag LOCUS_26550 149737 148481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_26550 150969 149734 gene locus_tag LOCUS_26560 gene alr 150969 149734 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_26560 151361 151023 gene locus_tag LOCUS_26570 151361 151023 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_26570 152505 151402 gene locus_tag LOCUS_26580 152505 151402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227468.1 protein_id gnl|my_center|LOCUS_26580 154556 152580 gene locus_tag LOCUS_26590 154556 152580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 155965 154724 gene locus_tag LOCUS_26600 155965 154724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 156154 156822 gene locus_tag LOCUS_26610 156154 156822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 158344 156890 gene locus_tag LOCUS_26620 158344 156890 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_26620 158743 158375 gene locus_tag LOCUS_26630 158743 158375 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_26630 160694 158787 gene locus_tag LOCUS_26640 gene glmS 160694 158787 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_26640 160780 162708 gene locus_tag LOCUS_26650 160780 162708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 163936 162761 gene locus_tag LOCUS_26660 163936 162761 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230016.1 protein_id gnl|my_center|LOCUS_26660 164607 163933 gene locus_tag LOCUS_26670 164607 163933 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_26670 164787 165467 gene locus_tag LOCUS_26680 164787 165467 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727993.1 protein_id gnl|my_center|LOCUS_26680 165478 166572 gene locus_tag LOCUS_26690 gene coaA 165478 166572 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_26690 165489 165509 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 166600 167544 gene locus_tag LOCUS_26700 166600 167544 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082376.1 protein_id gnl|my_center|LOCUS_26700 168966 167599 gene locus_tag LOCUS_26710 gene glmM 168966 167599 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_26710 169869 169342 gene locus_tag LOCUS_26720 gene rpsI 169869 169342 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_26720 170355 169912 gene locus_tag LOCUS_26730 gene rplM 170355 169912 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_26730 172219 170597 gene locus_tag LOCUS_26740 172219 170597 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_26740 172315 173199 gene locus_tag LOCUS_26750 172315 173199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029828.1 protein_id gnl|my_center|LOCUS_26750 174066 173167 gene locus_tag LOCUS_26760 gene truA 174066 173167 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_26760 174676 174167 gene locus_tag LOCUS_26770 gene rplQ 174676 174167 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974243.1 protein_id gnl|my_center|LOCUS_26770 175779 174757 gene locus_tag LOCUS_26780 175779 174757 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_26780 176343 175939 gene locus_tag LOCUS_26790 gene rpsK 176343 175939 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_26790 176788 176408 gene locus_tag LOCUS_26800 gene rpsM 176788 176408 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_26800 177365 177144 gene locus_tag LOCUS_26810 gene infA 177365 177144 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_26810 178408 177572 gene locus_tag LOCUS_26820 gene map 178408 177572 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 protein_id gnl|my_center|LOCUS_26820 179233 178571 gene locus_tag LOCUS_26830 179233 178571 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_26830 180552 179233 gene locus_tag LOCUS_26840 gene secY 180552 179233 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_26840 181273 180818 gene locus_tag LOCUS_26850 gene rplO 181273 180818 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_26850 181457 181275 gene locus_tag LOCUS_26860 gene rpmD 181457 181275 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_26860 182059 181457 gene locus_tag LOCUS_26870 gene rpsE 182059 181457 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_26870 182489 182106 gene locus_tag LOCUS_26880 gene rplR 182489 182106 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_26880 183031 182492 gene locus_tag LOCUS_26890 gene rplF 183031 182492 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_26890 183451 183053 gene locus_tag LOCUS_26900 gene rpsH 183451 183053 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_26900 183863 183678 gene locus_tag LOCUS_26910 183863 183678 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_26910 184423 183866 gene locus_tag LOCUS_26920 gene rplE 184423 183866 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_26920 184746 184423 gene locus_tag LOCUS_26930 gene rplX 184746 184423 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 protein_id gnl|my_center|LOCUS_26930 185117 184749 gene locus_tag LOCUS_26940 gene rplN 185117 184749 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_26940 185511 185221 gene locus_tag LOCUS_26950 gene rpsQ 185511 185221 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_26950 185735 185511 gene locus_tag LOCUS_26960 gene rpmC 185735 185511 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_26960 186154 185735 gene locus_tag LOCUS_26970 gene rplP 186154 185735 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_26970 187011 186160 gene locus_tag LOCUS_26980 gene rpsC 187011 186160 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974261.1 protein_id gnl|my_center|LOCUS_26980 187382 187011 gene locus_tag LOCUS_26990 gene rplV 187382 187011 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_26990 187683 187402 gene locus_tag LOCUS_27000 gene rpsS 187683 187402 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_27000 188534 187698 gene locus_tag LOCUS_27010 gene rplB 188534 187698 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_27010 188899 188582 gene locus_tag LOCUS_27020 188899 188582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 189561 188899 gene locus_tag LOCUS_27030 gene rplD 189561 188899 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_27030 190210 189566 gene locus_tag LOCUS_27040 gene rplC 190210 189566 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_27040 190533 190225 gene locus_tag LOCUS_27050 gene rpsJ 190533 190225 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_27050 191039 191230 gene locus_tag LOCUS_27060 191039 191230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 191227 191628 gene locus_tag LOCUS_27070 191227 191628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 191625 191885 gene locus_tag LOCUS_27080 gene yoeB 191625 191885 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_27080 192139 191930 gene locus_tag LOCUS_27090 192139 191930 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029810.1 protein_id gnl|my_center|LOCUS_27090 193011 192136 gene locus_tag LOCUS_27100 193011 192136 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486778.1 protein_id gnl|my_center|LOCUS_27100 193144 193614 gene locus_tag LOCUS_27110 193144 193614 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029808.1 protein_id gnl|my_center|LOCUS_27110 193733 194617 gene locus_tag LOCUS_27120 193733 194617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974288.1 protein_id gnl|my_center|LOCUS_27120 194749 196110 gene locus_tag LOCUS_27130 194749 196110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 196556 198658 gene locus_tag LOCUS_27140 196556 198658 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230673.1 protein_id gnl|my_center|LOCUS_27140 199060 198752 gene locus_tag LOCUS_27150 199060 198752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 201888 199024 gene locus_tag LOCUS_27160 201888 199024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 203525 201888 gene locus_tag LOCUS_27170 203525 201888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 205015 203822 gene locus_tag LOCUS_27180 gene tuf 205015 203822 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_27180 207310 205181 gene locus_tag LOCUS_27190 gene fusA 207310 205181 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_27190 207819 207349 gene locus_tag LOCUS_27200 gene rpsG 207819 207349 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_27200 208194 207823 gene locus_tag LOCUS_27210 gene rpsL 208194 207823 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_27210 209017 208580 gene locus_tag LOCUS_27220 209017 208580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 209808 209026 gene locus_tag LOCUS_27230 209808 209026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 213801 209896 gene locus_tag LOCUS_27240 213801 209896 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_27240 217418 213936 gene locus_tag LOCUS_27250 gene rpoB 217418 213936 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_27250 217854 217926 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 218385 218002 gene locus_tag LOCUS_27260 gene rplL 218385 218002 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_27260 219027 218470 gene locus_tag LOCUS_27270 gene rplJ 219027 218470 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_27270 220294 219344 gene locus_tag LOCUS_27280 220294 219344 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974312.1 protein_id gnl|my_center|LOCUS_27280 221159 220437 gene locus_tag LOCUS_27290 gene rplA 221159 220437 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_27290 221691 221257 gene locus_tag LOCUS_27300 gene rplK 221691 221257 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_27300 222827 221892 gene locus_tag LOCUS_27310 gene nusG 222827 221892 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_27310 223198 222908 gene locus_tag LOCUS_27320 gene secE 223198 222908 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_27320 223379 223306 gene locus_tag LOCUS_t00310 223379 223306 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 223597 224832 gene locus_tag LOCUS_27330 223597 224832 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_27330 224959 226008 gene locus_tag LOCUS_27340 224959 226008 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_27340 226659 226057 gene locus_tag LOCUS_27350 226659 226057 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222250.1 protein_id gnl|my_center|LOCUS_27350 226795 227430 gene locus_tag LOCUS_27360 226795 227430 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222251.1 protein_id gnl|my_center|LOCUS_27360 228508 227453 gene locus_tag LOCUS_27370 228508 227453 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_27370 230083 228632 gene locus_tag LOCUS_27380 230083 228632 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 protein_id gnl|my_center|LOCUS_27380 230802 230218 gene locus_tag LOCUS_27390 230802 230218 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 protein_id gnl|my_center|LOCUS_27390 231356 230928 gene locus_tag LOCUS_27400 231356 230928 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_27400 231814 231362 gene locus_tag LOCUS_27410 231814 231362 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_27410 232109 231945 gene locus_tag LOCUS_27420 gene rpmG 232109 231945 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_27420 232271 232198 gene locus_tag LOCUS_t00320 232271 232198 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 232391 232318 gene locus_tag LOCUS_t00330 232391 232318 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 232732 233976 gene locus_tag LOCUS_27430 232732 233976 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029783.1 protein_id gnl|my_center|LOCUS_27430 234110 234769 gene locus_tag LOCUS_27440 234110 234769 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_27440 234910 234828 gene locus_tag LOCUS_t00340 234910 234828 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 235137 235625 gene locus_tag LOCUS_27450 235137 235625 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_27450 235752 236411 gene locus_tag LOCUS_27460 235752 236411 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196240169.1 protein_id gnl|my_center|LOCUS_27460 236687 236418 gene locus_tag LOCUS_27470 236687 236418 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029763.1 protein_id gnl|my_center|LOCUS_27470 236774 238033 gene locus_tag LOCUS_27480 236774 238033 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029762.1 protein_id gnl|my_center|LOCUS_27480 238428 238036 gene locus_tag LOCUS_27490 238428 238036 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029761.1 protein_id gnl|my_center|LOCUS_27490 239288 238425 gene locus_tag LOCUS_27500 gene htpX 239288 238425 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_27500 241074 239476 gene locus_tag LOCUS_27510 241074 239476 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_27510 242666 241071 gene locus_tag LOCUS_27520 242666 241071 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_27520 244676 242670 gene locus_tag LOCUS_27530 244676 242670 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_27530 245083 244673 gene locus_tag LOCUS_27540 245083 244673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 245631 245083 gene locus_tag LOCUS_27550 245631 245083 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_27550 246206 245628 gene locus_tag LOCUS_27560 246206 245628 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_27560 247175 246207 gene locus_tag LOCUS_27570 247175 246207 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_27570 248128 247172 gene locus_tag LOCUS_27580 248128 247172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 248808 248128 gene locus_tag LOCUS_27590 248808 248128 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_27590 249200 248799 gene locus_tag LOCUS_27600 249200 248799 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_27600 249457 250665 gene locus_tag LOCUS_27610 249457 250665 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029753.1 protein_id gnl|my_center|LOCUS_27610 250829 252181 gene locus_tag LOCUS_27620 250829 252181 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_27620 252558 253190 gene locus_tag LOCUS_27630 252558 253190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_27630 253464 255428 gene locus_tag LOCUS_27640 253464 255428 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_27640 255421 256479 gene locus_tag LOCUS_27650 255421 256479 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_27650 256666 257727 gene locus_tag LOCUS_27660 gene rarD 256666 257727 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_27660 259157 257664 gene locus_tag LOCUS_27670 259157 257664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728620.1 protein_id gnl|my_center|LOCUS_27670 259268 259726 gene locus_tag LOCUS_27680 259268 259726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 260349 259756 gene locus_tag LOCUS_27690 260349 259756 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029748.1 protein_id gnl|my_center|LOCUS_27690 260401 260850 gene locus_tag LOCUS_27700 260401 260850 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974357.1 protein_id gnl|my_center|LOCUS_27700 261469 260888 gene locus_tag LOCUS_27710 261469 260888 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236076230.1 protein_id gnl|my_center|LOCUS_27710 261523 262506 gene locus_tag LOCUS_27720 261523 262506 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029747.1 protein_id gnl|my_center|LOCUS_27720 263490 262534 gene locus_tag LOCUS_27730 263490 262534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_27730 264427 263477 gene locus_tag LOCUS_27740 264427 263477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_27740 265925 264651 gene locus_tag LOCUS_27750 265925 264651 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_27750 267173 266163 gene locus_tag LOCUS_27760 267173 266163 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_27760 267492 268715 gene locus_tag LOCUS_27770 gene fahA 267492 268715 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029743.1 protein_id gnl|my_center|LOCUS_27770 268754 269023 gene locus_tag LOCUS_27780 268754 269023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 270758 269106 gene locus_tag LOCUS_27790 gene nuoN 270758 269106 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_27790 272326 270755 gene locus_tag LOCUS_27800 272326 270755 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_27800 274226 272331 gene locus_tag LOCUS_27810 gene nuoL 274226 272331 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974373.1 protein_id gnl|my_center|LOCUS_27810 274540 274241 gene locus_tag LOCUS_27820 gene nuoK 274540 274241 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_27820 275361 274537 gene locus_tag LOCUS_27830 275361 274537 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_27830 276017 275358 gene locus_tag LOCUS_27840 gene nuoI 276017 275358 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_27840 277398 276010 gene locus_tag LOCUS_27850 gene nuoH 277398 276010 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_27850 279917 277395 gene locus_tag LOCUS_27860 279917 277395 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 protein_id gnl|my_center|LOCUS_27860 281269 279914 gene locus_tag LOCUS_27870 gene nuoF 281269 279914 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_27870 282123 281269 gene locus_tag LOCUS_27880 gene nuoE 282123 281269 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_27880 283442 282120 gene locus_tag LOCUS_27890 283442 282120 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_27890 284194 283439 gene locus_tag LOCUS_27900 284194 283439 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_27900 284745 284191 gene locus_tag LOCUS_27910 284745 284191 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_27910 285124 284765 gene locus_tag LOCUS_27920 285124 284765 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_27920 285892 286713 gene locus_tag LOCUS_27930 285892 286713 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029732.1 protein_id gnl|my_center|LOCUS_27930 286978 287538 gene locus_tag LOCUS_27940 286978 287538 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973532.1 protein_id gnl|my_center|LOCUS_27940 288867 287584 gene locus_tag LOCUS_27950 288867 287584 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_27950 289004 289528 gene locus_tag LOCUS_27960 289004 289528 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029731.1 protein_id gnl|my_center|LOCUS_27960 290210 289509 gene locus_tag LOCUS_27970 290210 289509 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_27970 291000 290338 gene locus_tag LOCUS_27980 291000 290338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029727.1 protein_id gnl|my_center|LOCUS_27980 292204 291005 gene locus_tag LOCUS_27990 gene mqnC 292204 291005 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_27990 294084 292297 gene locus_tag LOCUS_28000 294084 292297 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029699.1 protein_id gnl|my_center|LOCUS_28000 295027 294134 gene locus_tag LOCUS_28010 295027 294134 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_28010 295346 295549 gene locus_tag LOCUS_28020 295346 295549 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_28020 297724 295670 gene locus_tag LOCUS_28030 297724 295670 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029698.1 protein_id gnl|my_center|LOCUS_28030 298527 297847 gene locus_tag LOCUS_28040 298527 297847 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029695.1 protein_id gnl|my_center|LOCUS_28040 300102 298726 gene locus_tag LOCUS_28050 300102 298726 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_28050 300760 300470 gene locus_tag LOCUS_28060 300760 300470 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974452.1 protein_id gnl|my_center|LOCUS_28060 301411 300887 gene locus_tag LOCUS_28070 301411 300887 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029694.1 protein_id gnl|my_center|LOCUS_28070 302695 301517 gene locus_tag LOCUS_28080 gene mqnE 302695 301517 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 protein_id gnl|my_center|LOCUS_28080 303236 302781 gene locus_tag LOCUS_28090 303236 302781 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_28090 304069 303335 gene locus_tag LOCUS_28100 304069 303335 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_28100 304151 304768 gene locus_tag LOCUS_28110 304151 304768 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_28110 305704 304853 gene locus_tag LOCUS_28120 305704 304853 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_28120 307260 305803 gene locus_tag LOCUS_28130 307260 305803 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_28130 307348 307800 gene locus_tag LOCUS_28140 307348 307800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 307821 307851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 308988 307897 gene locus_tag LOCUS_28150 gene ccsB 308988 307897 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_28150 310835 308985 gene locus_tag LOCUS_28160 310835 308985 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_28160 311604 310840 gene locus_tag LOCUS_28170 311604 310840 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_28170 312157 311609 gene locus_tag LOCUS_28180 312157 311609 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_28180 313635 312382 gene locus_tag LOCUS_28190 313635 312382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029676.1 protein_id gnl|my_center|LOCUS_28190 314470 313793 gene locus_tag LOCUS_28200 314470 313793 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_28200 315789 314467 gene locus_tag LOCUS_28210 gene hemL 315789 314467 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_28210 316217 316654 gene locus_tag LOCUS_28220 316217 316654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974483.1 protein_id gnl|my_center|LOCUS_28220 317516 316677 gene locus_tag LOCUS_28230 317516 316677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 317802 317530 gene locus_tag LOCUS_28240 317802 317530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 321028 318353 gene locus_tag LOCUS_28250 321028 318353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 321469 321089 gene locus_tag LOCUS_28260 321469 321089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 322201 321530 gene locus_tag LOCUS_28270 322201 321530 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 protein_id gnl|my_center|LOCUS_28270 324360 322201 gene locus_tag LOCUS_28280 gene kdpB 324360 322201 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_28280 326021 324357 gene locus_tag LOCUS_28290 gene kdpA 326021 324357 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_28290 325908 326210 gene locus_tag LOCUS_28300 325908 326210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 327254 326439 gene locus_tag LOCUS_28310 327254 326439 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_28310 327527 327291 gene locus_tag LOCUS_28320 327527 327291 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_28320 327833 328432 gene locus_tag LOCUS_28330 327833 328432 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027864.1 protein_id gnl|my_center|LOCUS_28330 329482 328463 gene locus_tag LOCUS_28340 329482 328463 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975178.1 protein_id gnl|my_center|LOCUS_28340 330897 329479 gene locus_tag LOCUS_28350 330897 329479 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029220.1 protein_id gnl|my_center|LOCUS_28350 331565 331170 gene locus_tag LOCUS_28360 331565 331170 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_28360 332885 331659 gene locus_tag LOCUS_28370 332885 331659 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975333.1 protein_id gnl|my_center|LOCUS_28370 333658 333080 gene locus_tag LOCUS_28380 333658 333080 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 protein_id gnl|my_center|LOCUS_28380 333721 334533 gene locus_tag LOCUS_28390 333721 334533 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_28390 335194 334553 gene locus_tag LOCUS_28400 335194 334553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 335267 335770 gene locus_tag LOCUS_28410 335267 335770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 335840 336574 gene locus_tag LOCUS_28420 335840 336574 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_28420 337141 336605 gene locus_tag LOCUS_28430 337141 336605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 337237 337572 gene locus_tag LOCUS_28440 337237 337572 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224704.1 protein_id gnl|my_center|LOCUS_28440 337639 338415 gene locus_tag LOCUS_28450 337639 338415 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_28450 338412 338663 gene locus_tag LOCUS_28460 338412 338663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 339575 338760 gene locus_tag LOCUS_28470 339575 338760 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_28470 339783 340283 gene locus_tag LOCUS_28480 339783 340283 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895362.1 protein_id gnl|my_center|LOCUS_28480 341520 340339 gene locus_tag LOCUS_28490 341520 340339 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_28490 341776 342606 gene locus_tag LOCUS_28500 341776 342606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975534.1 protein_id gnl|my_center|LOCUS_28500 342752 343483 gene locus_tag LOCUS_28510 342752 343483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 343663 345108 gene locus_tag LOCUS_28520 343663 345108 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028895.1 protein_id gnl|my_center|LOCUS_28520 344414 344330 gene locus_tag LOCUS_t00350 344414 344330 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 346927 345182 gene locus_tag LOCUS_28530 gene lysS 346927 345182 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_28530 347104 348873 gene locus_tag LOCUS_28540 gene argS 347104 348873 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_28540 350129 348927 gene locus_tag LOCUS_28550 350129 348927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 351168 350176 gene locus_tag LOCUS_28560 351168 350176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 351324 352235 gene locus_tag LOCUS_28570 351324 352235 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028377.1 protein_id gnl|my_center|LOCUS_28570 352272 353057 gene locus_tag LOCUS_28580 352272 353057 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230274.1 protein_id gnl|my_center|LOCUS_28580 353414 353082 gene locus_tag LOCUS_28590 353414 353082 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_28590 353507 354184 gene locus_tag LOCUS_28600 353507 354184 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_28600 354184 354423 gene locus_tag LOCUS_28610 354184 354423 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_28610 354557 354784 gene locus_tag LOCUS_28620 354557 354784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 355472 354870 gene locus_tag LOCUS_28630 355472 354870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 355734 356324 gene locus_tag LOCUS_28640 355734 356324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026862.1 protein_id gnl|my_center|LOCUS_28640 356321 357190 gene locus_tag LOCUS_28650 356321 357190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 357206 359062 gene locus_tag LOCUS_28660 357206 359062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 360363 359059 gene locus_tag LOCUS_28670 360363 359059 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028900.1 protein_id gnl|my_center|LOCUS_28670 360682 361389 gene locus_tag LOCUS_28680 360682 361389 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109034961.1 protein_id gnl|my_center|LOCUS_28680 362398 361409 gene locus_tag LOCUS_28690 gene hemB 362398 361409 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_28690 363897 362506 gene locus_tag LOCUS_28700 363897 362506 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_28700 363994 364125 gene locus_tag LOCUS_28710 363994 364125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 365126 364158 gene locus_tag LOCUS_28720 gene hemC 365126 364158 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_28720 366493 365123 gene locus_tag LOCUS_28730 366493 365123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 367254 366490 gene locus_tag LOCUS_28740 367254 366490 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_28740 367852 367577 gene locus_tag LOCUS_28750 367852 367577 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_28750 368013 368957 gene locus_tag LOCUS_28760 368013 368957 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_28760 369235 370035 gene locus_tag LOCUS_28770 369235 370035 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975513.1 protein_id gnl|my_center|LOCUS_28770 370257 371474 gene locus_tag LOCUS_28780 370257 371474 CDS product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495181.1 protein_id gnl|my_center|LOCUS_28780 372829 371585 gene locus_tag LOCUS_28790 372829 371585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 373868 372831 gene locus_tag LOCUS_28800 373868 372831 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_28800 374556 374344 gene locus_tag LOCUS_28810 374556 374344 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_28810 375500 374685 gene locus_tag LOCUS_28820 375500 374685 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028912.1 protein_id gnl|my_center|LOCUS_28820 376810 375638 gene locus_tag LOCUS_28830 376810 375638 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_28830 378041 376779 gene locus_tag LOCUS_28840 378041 376779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028914.1 protein_id gnl|my_center|LOCUS_28840 378729 378085 gene locus_tag LOCUS_28850 378729 378085 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975504.1 protein_id gnl|my_center|LOCUS_28850 378922 378812 gene locus_tag LOCUS_r00010 378922 378812 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence08 594 391 gene locus_tag LOCUS_28860 594 391 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_28860 1576 830 gene locus_tag LOCUS_28870 1576 830 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325987.1 protein_id gnl|my_center|LOCUS_28870 3222 1762 gene locus_tag LOCUS_28880 3222 1762 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_28880 7813 3215 gene locus_tag LOCUS_28890 gene gltB 7813 3215 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_28890 9057 8257 gene locus_tag LOCUS_28900 9057 8257 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_28900 9144 10277 gene locus_tag LOCUS_28910 9144 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28910 10277 12049 gene locus_tag LOCUS_28920 10277 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 12091 13272 gene locus_tag LOCUS_28930 12091 13272 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028107.1 protein_id gnl|my_center|LOCUS_28930 13269 14738 gene locus_tag LOCUS_28940 13269 14738 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_28940 14735 15625 gene locus_tag LOCUS_28950 gene rbsK 14735 15625 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706158.1 protein_id gnl|my_center|LOCUS_28950 15622 16860 gene locus_tag LOCUS_28960 15622 16860 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_28960 16857 17747 gene locus_tag LOCUS_28970 16857 17747 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028109.1 protein_id gnl|my_center|LOCUS_28970 18869 17853 gene locus_tag LOCUS_28980 gene lgt 18869 17853 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_28980 19817 18972 gene locus_tag LOCUS_28990 19817 18972 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_28990 20705 19893 gene locus_tag LOCUS_29000 gene trpA 20705 19893 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_29000 21976 20702 gene locus_tag LOCUS_29010 gene trpB 21976 20702 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_29010 23188 22379 gene locus_tag LOCUS_29020 gene trpC 23188 22379 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_29020 23760 23314 gene locus_tag LOCUS_29030 23760 23314 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_29030 24266 23922 gene locus_tag LOCUS_29040 24266 23922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 25085 24402 gene locus_tag LOCUS_29050 25085 24402 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 protein_id gnl|my_center|LOCUS_29050 26615 25092 gene locus_tag LOCUS_29060 26615 25092 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_29060 27037 26627 gene locus_tag LOCUS_29070 gene hisI 27037 26627 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_29070 27114 27746 gene locus_tag LOCUS_29080 27114 27746 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_29080 29054 27753 gene locus_tag LOCUS_29090 29054 27753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976770.1 protein_id gnl|my_center|LOCUS_29090 29268 29074 gene locus_tag LOCUS_29100 29268 29074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 29896 29309 gene locus_tag LOCUS_29110 29896 29309 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976769.1 protein_id gnl|my_center|LOCUS_29110 31323 30007 gene locus_tag LOCUS_29120 31323 30007 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027309.1 protein_id gnl|my_center|LOCUS_29120 34282 31427 gene locus_tag LOCUS_29130 34282 31427 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027310.1 protein_id gnl|my_center|LOCUS_29130 35415 34441 gene locus_tag LOCUS_29140 35415 34441 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978149.1 protein_id gnl|my_center|LOCUS_29140 36385 35630 gene locus_tag LOCUS_29150 gene hisF 36385 35630 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_29150 36828 36382 gene locus_tag LOCUS_29160 36828 36382 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 protein_id gnl|my_center|LOCUS_29160 37577 36825 gene locus_tag LOCUS_29170 gene priA 37577 36825 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_29170 38212 37577 gene locus_tag LOCUS_29180 gene hisH 38212 37577 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976765.1 protein_id gnl|my_center|LOCUS_29180 38376 38209 gene locus_tag LOCUS_29190 38376 38209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 38974 38381 gene locus_tag LOCUS_29200 gene hisB 38974 38381 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_29200 40080 38971 gene locus_tag LOCUS_29210 40080 38971 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_29210 41435 40077 gene locus_tag LOCUS_29220 gene hisD 41435 40077 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_29220 41784 43403 gene locus_tag LOCUS_29230 41784 43403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028118.1 protein_id gnl|my_center|LOCUS_29230 43517 44545 gene locus_tag LOCUS_29240 43517 44545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028119.1 protein_id gnl|my_center|LOCUS_29240 44551 45291 gene locus_tag LOCUS_29250 44551 45291 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_29250 45350 45850 gene locus_tag LOCUS_29260 gene ybaK 45350 45850 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_29260 46582 45860 gene locus_tag LOCUS_29270 46582 45860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028121.1 protein_id gnl|my_center|LOCUS_29270 47408 46566 gene locus_tag LOCUS_29280 47408 46566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031846.1 protein_id gnl|my_center|LOCUS_29280 48987 48025 gene locus_tag LOCUS_29290 48987 48025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_29290 50422 49121 gene locus_tag LOCUS_29300 50422 49121 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028124.1 protein_id gnl|my_center|LOCUS_29300 50668 50844 gene locus_tag LOCUS_29310 50668 50844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 54501 50956 gene locus_tag LOCUS_29320 gene dnaE 54501 50956 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_29320 54797 56131 gene locus_tag LOCUS_29330 54797 56131 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_29330 56207 56917 gene locus_tag LOCUS_29340 56207 56917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976749.1 protein_id gnl|my_center|LOCUS_29340 57023 57838 gene locus_tag LOCUS_29350 57023 57838 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976748.1 protein_id gnl|my_center|LOCUS_29350 58560 57979 gene locus_tag LOCUS_29360 58560 57979 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976746.1 protein_id gnl|my_center|LOCUS_29360 58605 59750 gene locus_tag LOCUS_29370 58605 59750 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976745.1 protein_id gnl|my_center|LOCUS_29370 61392 59806 gene locus_tag LOCUS_29380 61392 59806 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028126.1 protein_id gnl|my_center|LOCUS_29380 62670 61576 gene locus_tag LOCUS_29390 62670 61576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 63370 62846 gene locus_tag LOCUS_29400 63370 62846 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_29400 64350 63367 gene locus_tag LOCUS_29410 64350 63367 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_29410 65010 64450 gene locus_tag LOCUS_29420 gene lspA 65010 64450 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028127.1 protein_id gnl|my_center|LOCUS_29420 65881 65069 gene locus_tag LOCUS_29430 65881 65069 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028128.1 protein_id gnl|my_center|LOCUS_29430 66490 69636 gene locus_tag LOCUS_29440 gene ileS 66490 69636 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_29440 71169 69988 gene locus_tag LOCUS_29450 71169 69988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 71515 71219 gene locus_tag LOCUS_29460 71515 71219 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_29460 72200 71583 gene locus_tag LOCUS_29470 gene sepF 72200 71583 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_29470 73044 72325 gene locus_tag LOCUS_29480 73044 72325 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_29480 73793 73041 gene locus_tag LOCUS_29490 gene pgeF 73793 73041 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_29490 75004 73790 gene locus_tag LOCUS_29500 gene ftsZ 75004 73790 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_29500 76077 75280 gene locus_tag LOCUS_29510 gene ftsQ 76077 75280 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976732.1 protein_id gnl|my_center|LOCUS_29510 77185 76091 gene locus_tag LOCUS_29520 gene murG 77185 76091 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_29520 78709 77192 gene locus_tag LOCUS_29530 gene ftsW 78709 77192 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_29530 80350 78800 gene locus_tag LOCUS_29540 gene murD 80350 78800 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_29540 81366 80296 gene locus_tag LOCUS_29550 gene mraY 81366 80296 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_29550 82793 81363 gene locus_tag LOCUS_29560 82793 81363 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_29560 84788 83073 gene locus_tag LOCUS_29570 84788 83073 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_29570 86823 84805 gene locus_tag LOCUS_29580 gene ftsI 86823 84805 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_29580 87478 86828 gene locus_tag LOCUS_29590 87478 86828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 88431 87475 gene locus_tag LOCUS_29600 gene rsmH 88431 87475 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_29600 88315 88572 gene locus_tag LOCUS_29610 88315 88572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 88809 89372 gene locus_tag LOCUS_29620 88809 89372 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 protein_id gnl|my_center|LOCUS_29620 89472 90614 gene locus_tag LOCUS_29630 89472 90614 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_29630 90614 91972 gene locus_tag LOCUS_29640 90614 91972 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_29640 91969 94392 gene locus_tag LOCUS_29650 91969 94392 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_29650 94702 94364 gene locus_tag LOCUS_29660 94702 94364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 95136 94741 gene locus_tag LOCUS_29670 95136 94741 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_29670 96207 95422 gene locus_tag LOCUS_29680 96207 95422 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_29680 96840 96301 gene locus_tag LOCUS_29690 96840 96301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 97000 97800 gene locus_tag LOCUS_29700 97000 97800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064072.1 protein_id gnl|my_center|LOCUS_29700 97772 99889 gene locus_tag LOCUS_29710 97772 99889 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878409.1 protein_id gnl|my_center|LOCUS_29710 99985 100536 gene locus_tag LOCUS_29720 99985 100536 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_29720 100712 101428 gene locus_tag LOCUS_29730 100712 101428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 101541 103076 gene locus_tag LOCUS_29740 101541 103076 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028141.1 protein_id gnl|my_center|LOCUS_29740 104159 103140 gene locus_tag LOCUS_29750 104159 103140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028142.1 protein_id gnl|my_center|LOCUS_29750 105083 104211 gene locus_tag LOCUS_29760 gene metF 105083 104211 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_29760 105942 105283 gene locus_tag LOCUS_29770 gene thiE 105942 105283 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_29770 106410 106045 gene locus_tag LOCUS_29780 106410 106045 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_29780 107745 106525 gene locus_tag LOCUS_29790 107745 106525 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_29790 107975 109258 gene locus_tag LOCUS_29800 gene thiO 107975 109258 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_29800 109255 109557 gene locus_tag LOCUS_29810 109255 109557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 109563 110357 gene locus_tag LOCUS_29820 109563 110357 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_29820 110523 112694 gene locus_tag LOCUS_29830 gene pknB 110523 112694 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_29830 112698 113585 gene locus_tag LOCUS_29840 112698 113585 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_29840 114223 113582 gene locus_tag LOCUS_29850 114223 113582 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_29850 114366 114845 gene locus_tag LOCUS_29860 gene bfr 114366 114845 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_29860 115201 114872 gene locus_tag LOCUS_29870 115201 114872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 116734 115379 gene locus_tag LOCUS_29880 116734 115379 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_29880 117024 118979 gene locus_tag LOCUS_29890 117024 118979 CDS product phenazine-specific anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028148.1 protein_id gnl|my_center|LOCUS_29890 120078 119050 gene locus_tag LOCUS_29900 120078 119050 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_29900 120950 120234 gene locus_tag LOCUS_29910 120950 120234 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_29910 122155 120947 gene locus_tag LOCUS_29920 122155 120947 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_29920 122991 122230 gene locus_tag LOCUS_29930 122991 122230 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_29930 123137 123916 gene locus_tag LOCUS_29940 123137 123916 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_29940 123909 124646 gene locus_tag LOCUS_29950 123909 124646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_29950 125542 124796 gene locus_tag LOCUS_29960 125542 124796 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_29960 126627 125686 gene locus_tag LOCUS_29970 126627 125686 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_29970 127170 126694 gene locus_tag LOCUS_29980 127170 126694 CDS product carbon catabolit repression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028152.1 protein_id gnl|my_center|LOCUS_29980 128501 127260 gene locus_tag LOCUS_29990 128501 127260 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976687.1 protein_id gnl|my_center|LOCUS_29990 129037 128552 gene locus_tag LOCUS_30000 129037 128552 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_30000 130016 129138 gene locus_tag LOCUS_30010 130016 129138 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_30010 130287 132083 gene locus_tag LOCUS_30020 130287 132083 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_30020 133271 132117 gene locus_tag LOCUS_30030 133271 132117 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_30030 132294 132203 gene locus_tag LOCUS_t00360 132294 132203 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 133553 133362 gene locus_tag LOCUS_30040 133553 133362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 133507 134709 gene locus_tag LOCUS_30050 133507 134709 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_30050 135961 134759 gene locus_tag LOCUS_30060 135961 134759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_30060 137134 136112 gene locus_tag LOCUS_30070 137134 136112 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 protein_id gnl|my_center|LOCUS_30070 138441 137416 gene locus_tag LOCUS_30080 138441 137416 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_30080 140142 138781 gene locus_tag LOCUS_30090 140142 138781 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_30090 140420 140178 gene locus_tag LOCUS_30100 140420 140178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_30100 140596 141306 gene locus_tag LOCUS_30110 140596 141306 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028161.1 protein_id gnl|my_center|LOCUS_30110 141303 141584 gene locus_tag LOCUS_30120 141303 141584 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_30120 142967 141600 gene locus_tag LOCUS_30130 142967 141600 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 protein_id gnl|my_center|LOCUS_30130 144653 143586 gene locus_tag LOCUS_30140 gene trpD 144653 143586 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_30140 146498 144870 gene locus_tag LOCUS_30150 146498 144870 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_30150 147550 146495 gene locus_tag LOCUS_30160 147550 146495 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_30160 148323 147547 gene locus_tag LOCUS_30170 148323 147547 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_30170 148961 148437 gene locus_tag LOCUS_30180 148961 148437 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_30180 148855 149232 gene locus_tag LOCUS_30190 148855 149232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 149286 149687 gene locus_tag LOCUS_30200 149286 149687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_30200 150974 149721 gene locus_tag LOCUS_30210 150974 149721 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156694785.1 protein_id gnl|my_center|LOCUS_30210 151499 151101 gene locus_tag LOCUS_30220 151499 151101 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_30220 153235 151496 gene locus_tag LOCUS_30230 gene ctaD 153235 151496 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_30230 154053 153232 gene locus_tag LOCUS_30240 gene coxB 154053 153232 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_30240 153992 154198 gene locus_tag LOCUS_30250 153992 154198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 154464 155846 gene locus_tag LOCUS_30260 154464 155846 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_30260 157079 155916 gene locus_tag LOCUS_30270 gene ispG 157079 155916 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284254.1 protein_id gnl|my_center|LOCUS_30270 159004 157076 gene locus_tag LOCUS_30280 gene dxs 159004 157076 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_30280 160083 159010 gene locus_tag LOCUS_30290 gene idsA 160083 159010 CDS product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 protein_id gnl|my_center|LOCUS_30290 161180 160161 gene locus_tag LOCUS_30300 161180 160161 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467730.1 protein_id gnl|my_center|LOCUS_30300 161383 162354 gene locus_tag LOCUS_30310 161383 162354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 162483 163064 gene locus_tag LOCUS_30320 162483 163064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 163061 163243 gene locus_tag LOCUS_30330 163061 163243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 163587 163171 gene locus_tag LOCUS_30340 163587 163171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 164749 163634 gene locus_tag LOCUS_30350 164749 163634 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_30350 165581 164823 gene locus_tag LOCUS_30360 165581 164823 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_30360 167936 165705 gene locus_tag LOCUS_30370 167936 165705 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_30370 168077 169057 gene locus_tag LOCUS_30380 168077 169057 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_30380 169820 169083 gene locus_tag LOCUS_30390 169820 169083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 171497 169878 gene locus_tag LOCUS_30400 171497 169878 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_30400 172769 171795 gene locus_tag LOCUS_30410 172769 171795 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_30410 172950 173162 gene locus_tag LOCUS_30420 172950 173162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976656.1 protein_id gnl|my_center|LOCUS_30420 173247 174767 gene locus_tag LOCUS_30430 173247 174767 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028170.1 protein_id gnl|my_center|LOCUS_30430 175232 174876 gene locus_tag LOCUS_30440 175232 174876 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_30440 175532 176728 gene locus_tag LOCUS_30450 gene nadA 175532 176728 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_30450 180053 176862 gene locus_tag LOCUS_30460 180053 176862 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976652.1 protein_id gnl|my_center|LOCUS_30460 180885 180199 gene locus_tag LOCUS_30470 180885 180199 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_30470 182108 180882 gene locus_tag LOCUS_30480 182108 180882 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_30480 182560 182279 gene locus_tag LOCUS_30490 182560 182279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_30490 183370 182570 gene locus_tag LOCUS_30500 183370 182570 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_30500 183634 184239 gene locus_tag LOCUS_30510 183634 184239 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30510 184401 185033 gene locus_tag LOCUS_30520 184401 185033 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_30520 185379 185152 gene locus_tag LOCUS_30530 185379 185152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_30530 185473 186729 gene locus_tag LOCUS_30540 185473 186729 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_30540 186928 188031 gene locus_tag LOCUS_30550 gene cobT 186928 188031 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028178.1 protein_id gnl|my_center|LOCUS_30550 188882 188070 gene locus_tag LOCUS_30560 188882 188070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028179.1 protein_id gnl|my_center|LOCUS_30560 188962 189759 gene locus_tag LOCUS_30570 188962 189759 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_30570 189878 191521 gene locus_tag LOCUS_30580 189878 191521 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_30580 191978 193366 gene locus_tag LOCUS_30590 gene lpdA 191978 193366 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_30590 193475 195307 gene locus_tag LOCUS_30600 193475 195307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30600 195449 196072 gene locus_tag LOCUS_30610 195449 196072 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_30610 196396 196166 gene locus_tag LOCUS_30620 196396 196166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 196289 198958 gene locus_tag LOCUS_30630 gene aceE 196289 198958 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976632.1 protein_id gnl|my_center|LOCUS_30630 199098 199916 gene locus_tag LOCUS_30640 199098 199916 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_30640 200143 201108 gene locus_tag LOCUS_30650 200143 201108 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976631.1 protein_id gnl|my_center|LOCUS_30650 202028 201099 gene locus_tag LOCUS_30660 202028 201099 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973098.1 protein_id gnl|my_center|LOCUS_30660 202194 202718 gene locus_tag LOCUS_30670 202194 202718 CDS product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 protein_id gnl|my_center|LOCUS_30670 203223 202729 gene locus_tag LOCUS_30680 203223 202729 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667418.1 protein_id gnl|my_center|LOCUS_30680 203269 204162 gene locus_tag LOCUS_30690 203269 204162 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_30690 204592 206133 gene locus_tag LOCUS_30700 204592 206133 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028190.1 protein_id gnl|my_center|LOCUS_30700 207787 206189 gene locus_tag LOCUS_30710 207787 206189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028191.1 protein_id gnl|my_center|LOCUS_30710 207671 208108 gene locus_tag LOCUS_30720 207671 208108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 208101 208976 gene locus_tag LOCUS_30730 gene lipB 208101 208976 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 protein_id gnl|my_center|LOCUS_30730 209175 210149 gene locus_tag LOCUS_30740 gene lipA 209175 210149 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 protein_id gnl|my_center|LOCUS_30740 210485 210727 gene locus_tag LOCUS_30750 210485 210727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028192.1 protein_id gnl|my_center|LOCUS_30750 210738 211436 gene locus_tag LOCUS_30760 210738 211436 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_30760 212040 211576 gene locus_tag LOCUS_30770 212040 211576 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_30770 212359 213768 gene locus_tag LOCUS_30780 gene glnA 212359 213768 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_30780 214622 214275 gene locus_tag LOCUS_30790 214622 214275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_30790 215390 215908 gene locus_tag LOCUS_30800 215390 215908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 216429 216058 gene locus_tag LOCUS_30810 216429 216058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 216768 216469 gene locus_tag LOCUS_30820 216768 216469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 217559 216948 gene locus_tag LOCUS_30830 217559 216948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 218143 217556 gene locus_tag LOCUS_30840 218143 217556 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225833.1 protein_id gnl|my_center|LOCUS_30840 218285 219007 gene locus_tag LOCUS_30850 218285 219007 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_30850 219633 219058 gene locus_tag LOCUS_30860 219633 219058 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225787.1 protein_id gnl|my_center|LOCUS_30860 219827 221008 gene locus_tag LOCUS_30870 219827 221008 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225786.1 protein_id gnl|my_center|LOCUS_30870 223708 221090 gene locus_tag LOCUS_30880 223708 221090 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029212.1 protein_id gnl|my_center|LOCUS_30880 224538 223711 gene locus_tag LOCUS_30890 224538 223711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029211.1 protein_id gnl|my_center|LOCUS_30890 224777 224535 gene locus_tag LOCUS_30900 224777 224535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029210.1 protein_id gnl|my_center|LOCUS_30900 224957 226282 gene locus_tag LOCUS_30910 224957 226282 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029209.1 protein_id gnl|my_center|LOCUS_30910 226270 226929 gene locus_tag LOCUS_30920 226270 226929 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030189071.1 protein_id gnl|my_center|LOCUS_30920 228211 226937 gene locus_tag LOCUS_30930 228211 226937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 228356 229714 gene locus_tag LOCUS_30940 228356 229714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 230908 229676 gene locus_tag LOCUS_30950 230908 229676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 231492 230905 gene locus_tag LOCUS_30960 231492 230905 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089004579.1 protein_id gnl|my_center|LOCUS_30960 231812 233842 gene locus_tag LOCUS_30970 231812 233842 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201368745.1 protein_id gnl|my_center|LOCUS_30970 236642 233958 gene locus_tag LOCUS_30980 236642 233958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 239290 236756 gene locus_tag LOCUS_30990 239290 236756 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_30990 241157 239400 gene locus_tag LOCUS_31000 241157 239400 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031512.1 protein_id gnl|my_center|LOCUS_31000 241674 243077 gene locus_tag LOCUS_31010 241674 243077 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110423.1 protein_id gnl|my_center|LOCUS_31010 243142 245109 gene locus_tag LOCUS_31020 243142 245109 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031791.1 protein_id gnl|my_center|LOCUS_31020 245106 245666 gene locus_tag LOCUS_31030 245106 245666 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_31030 246570 245647 gene locus_tag LOCUS_31040 246570 245647 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_31040 247124 246837 gene locus_tag LOCUS_31050 247124 246837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 247087 247407 gene locus_tag LOCUS_31060 247087 247407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 247420 248574 gene locus_tag LOCUS_31070 247420 248574 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742067.1 protein_id gnl|my_center|LOCUS_31070 248875 249552 gene locus_tag LOCUS_31080 248875 249552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224437.1 protein_id gnl|my_center|LOCUS_31080 250542 249604 gene locus_tag LOCUS_31090 250542 249604 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129251257.1 protein_id gnl|my_center|LOCUS_31090 250760 252247 gene locus_tag LOCUS_31100 250760 252247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 252244 253395 gene locus_tag LOCUS_31110 252244 253395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 253836 254396 gene locus_tag LOCUS_31120 253836 254396 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028201.1 protein_id gnl|my_center|LOCUS_31120 255985 254459 gene locus_tag LOCUS_31130 255985 254459 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027399.1 protein_id gnl|my_center|LOCUS_31130 256703 256041 gene locus_tag LOCUS_31140 256703 256041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027403.1 protein_id gnl|my_center|LOCUS_31140 256844 257875 gene locus_tag LOCUS_31150 256844 257875 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849145.1 protein_id gnl|my_center|LOCUS_31150 258161 259426 gene locus_tag LOCUS_31160 258161 259426 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_31160 259411 260064 gene locus_tag LOCUS_31170 259411 260064 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_31170 260288 261799 gene locus_tag LOCUS_31180 260288 261799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 262384 261878 gene locus_tag LOCUS_31190 262384 261878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 262546 265677 gene locus_tag LOCUS_31200 262546 265677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 265757 267712 gene locus_tag LOCUS_31210 265757 267712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028207.1 protein_id gnl|my_center|LOCUS_31210 268238 267729 gene locus_tag LOCUS_31220 268238 267729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 268315 269046 gene locus_tag LOCUS_31230 268315 269046 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_31230 269688 269053 gene locus_tag LOCUS_31240 269688 269053 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027353.1 protein_id gnl|my_center|LOCUS_31240 269976 269885 gene locus_tag LOCUS_t00370 269976 269885 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 275242 269903 gene locus_tag LOCUS_31250 gene pulA 275242 269903 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486784.1 protein_id gnl|my_center|LOCUS_31250 277106 275403 gene locus_tag LOCUS_31260 277106 275403 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_31260 278413 277364 gene locus_tag LOCUS_31270 278413 277364 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_31270 280107 278410 gene locus_tag LOCUS_31280 280107 278410 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_31280 281113 280214 gene locus_tag LOCUS_31290 281113 280214 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_31290 282123 281110 gene locus_tag LOCUS_31300 282123 281110 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_31300 283429 282158 gene locus_tag LOCUS_31310 283429 282158 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_31310 283772 284872 gene locus_tag LOCUS_31320 283772 284872 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_31320 284968 286053 gene locus_tag LOCUS_31330 284968 286053 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_31330 289106 286038 gene locus_tag LOCUS_31340 289106 286038 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_31340 289288 289800 gene locus_tag LOCUS_31350 289288 289800 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972367.1 protein_id gnl|my_center|LOCUS_31350 289939 290697 gene locus_tag LOCUS_31360 289939 290697 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_31360 291089 290679 gene locus_tag LOCUS_31370 291089 290679 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 protein_id gnl|my_center|LOCUS_31370 291206 291844 gene locus_tag LOCUS_31380 291206 291844 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140957.1 protein_id gnl|my_center|LOCUS_31380 293219 291858 gene locus_tag LOCUS_31390 gene glnA 293219 291858 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_31390 293982 293383 gene locus_tag LOCUS_31400 293982 293383 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487439.1 protein_id gnl|my_center|LOCUS_31400 294102 294491 gene locus_tag LOCUS_31410 294102 294491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 294569 295222 gene locus_tag LOCUS_31420 294569 295222 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028218.1 protein_id gnl|my_center|LOCUS_31420 295219 295905 gene locus_tag LOCUS_31430 295219 295905 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_31430 296118 296537 gene locus_tag LOCUS_31440 gene hrp1 296118 296537 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_31440 296664 298424 gene locus_tag LOCUS_31450 296664 298424 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_31450 299466 298441 gene locus_tag LOCUS_31460 299466 298441 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226238.1 protein_id gnl|my_center|LOCUS_31460 300321 299662 gene locus_tag LOCUS_31470 300321 299662 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400977.1 protein_id gnl|my_center|LOCUS_31470 302078 300417 gene locus_tag LOCUS_31480 302078 300417 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_31480 302254 303114 gene locus_tag LOCUS_31490 gene panB 302254 303114 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_31490 303354 304376 gene locus_tag LOCUS_31500 303354 304376 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976555.1 protein_id gnl|my_center|LOCUS_31500 304373 305233 gene locus_tag LOCUS_31510 304373 305233 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976554.1 protein_id gnl|my_center|LOCUS_31510 308710 305297 gene locus_tag LOCUS_31520 308710 305297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 308862 309662 gene locus_tag LOCUS_31530 308862 309662 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 protein_id gnl|my_center|LOCUS_31530 309831 309655 gene locus_tag LOCUS_31540 309831 309655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326075.1 protein_id gnl|my_center|LOCUS_31540 310727 310017 gene locus_tag LOCUS_31550 gene npdG 310727 310017 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_31550 310907 311536 gene locus_tag LOCUS_31560 310907 311536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_31560 311624 312949 gene locus_tag LOCUS_31570 311624 312949 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030908.1 protein_id gnl|my_center|LOCUS_31570 313197 312970 gene locus_tag LOCUS_31580 313197 312970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976547.1 protein_id gnl|my_center|LOCUS_31580 313268 314125 gene locus_tag LOCUS_31590 gene map 313268 314125 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_31590 314275 314433 gene locus_tag LOCUS_31600 314275 314433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 314983 315117 gene locus_tag LOCUS_31610 314983 315117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 315922 317175 gene locus_tag LOCUS_31620 315922 317175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 317299 317628 gene locus_tag LOCUS_31630 317299 317628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 317625 317816 gene locus_tag LOCUS_31640 317625 317816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 317813 317995 gene locus_tag LOCUS_31650 317813 317995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 318067 318124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 318445 318248 gene locus_tag LOCUS_31660 318445 318248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 318351 319019 gene locus_tag LOCUS_31670 318351 319019 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028236.1 protein_id gnl|my_center|LOCUS_31670 319712 319044 gene locus_tag LOCUS_31680 319712 319044 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028237.1 protein_id gnl|my_center|LOCUS_31680 321413 319836 gene locus_tag LOCUS_31690 321413 319836 CDS product HtaA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028239.1 protein_id gnl|my_center|LOCUS_31690 322983 321481 gene locus_tag LOCUS_31700 322983 321481 CDS product HtaA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028240.1 protein_id gnl|my_center|LOCUS_31700 323042 324199 gene locus_tag LOCUS_31710 323042 324199 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486763.1 protein_id gnl|my_center|LOCUS_31710 324201 325307 gene locus_tag LOCUS_31720 324201 325307 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_31720 325339 326337 gene locus_tag LOCUS_31730 325339 326337 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_31730 326334 327314 gene locus_tag LOCUS_31740 326334 327314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270025.1 protein_id gnl|my_center|LOCUS_31740 328136 327384 gene locus_tag LOCUS_31750 328136 327384 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_31750 329068 328436 gene locus_tag LOCUS_31760 329068 328436 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_31760 329296 330153 gene locus_tag LOCUS_31770 329296 330153 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_31770 331179 330145 gene locus_tag LOCUS_31780 331179 330145 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028248.1 protein_id gnl|my_center|LOCUS_31780 331395 332708 gene locus_tag LOCUS_31790 331395 332708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 334074 332755 gene locus_tag LOCUS_31800 334074 332755 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_31800 334157 335188 gene locus_tag LOCUS_31810 334157 335188 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_31810 335529 337664 gene locus_tag LOCUS_31820 335529 337664 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_31820 339416 337758 gene locus_tag LOCUS_31830 339416 337758 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_31830 339641 340387 gene locus_tag LOCUS_31840 339641 340387 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028252.1 protein_id gnl|my_center|LOCUS_31840 340459 341352 gene locus_tag LOCUS_31850 340459 341352 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_31850 341620 341970 gene locus_tag LOCUS_31860 341620 341970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 342243 341983 gene locus_tag LOCUS_31870 342243 341983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976917.1 protein_id gnl|my_center|LOCUS_31870 342806 343576 gene locus_tag LOCUS_31880 342806 343576 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028258.1 protein_id gnl|my_center|LOCUS_31880 343573 344433 gene locus_tag LOCUS_31890 343573 344433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 343733 343813 gene locus_tag LOCUS_t00380 343733 343813 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 344554 345354 gene locus_tag LOCUS_31900 gene yaaA 344554 345354 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_31900 345441 346055 gene locus_tag LOCUS_31910 gene eda 345441 346055 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_31910 347020 346154 gene locus_tag LOCUS_31920 347020 346154 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028329.1 protein_id gnl|my_center|LOCUS_31920 348306 347050 gene locus_tag LOCUS_31930 348306 347050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 348687 348307 gene locus_tag LOCUS_31940 348687 348307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 349922 349047 gene locus_tag LOCUS_31950 349922 349047 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_31950 351068 350034 gene locus_tag LOCUS_31960 351068 350034 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_31960 351251 352504 gene locus_tag LOCUS_31970 351251 352504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107098776.1 protein_id gnl|my_center|LOCUS_31970 >Feature sequence09 232 1230 gene locus_tag LOCUS_31980 232 1230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028266.1 protein_id gnl|my_center|LOCUS_31980 1230 1955 gene locus_tag LOCUS_31990 1230 1955 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028267.1 protein_id gnl|my_center|LOCUS_31990 2018 3166 gene locus_tag LOCUS_32000 2018 3166 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028268.1 protein_id gnl|my_center|LOCUS_32000 3163 3768 gene locus_tag LOCUS_32010 3163 3768 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_32010 5259 3793 gene locus_tag LOCUS_32020 5259 3793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_32020 5543 7069 gene locus_tag LOCUS_32030 5543 7069 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225330.1 protein_id gnl|my_center|LOCUS_32030 7174 7836 gene locus_tag LOCUS_32040 7174 7836 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976501.1 protein_id gnl|my_center|LOCUS_32040 7868 8848 gene locus_tag LOCUS_32050 7868 8848 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028273.1 protein_id gnl|my_center|LOCUS_32050 9148 9993 gene locus_tag LOCUS_32060 9148 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 10193 10420 gene locus_tag LOCUS_32070 10193 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976498.1 protein_id gnl|my_center|LOCUS_32070 11575 10487 gene locus_tag LOCUS_32080 11575 10487 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_32080 12312 11578 gene locus_tag LOCUS_32090 12312 11578 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_32090 13685 12363 gene locus_tag LOCUS_32100 13685 12363 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_32100 13761 14060 gene locus_tag LOCUS_32110 13761 14060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 14074 14304 gene locus_tag LOCUS_32120 14074 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 14301 15611 gene locus_tag LOCUS_32130 14301 15611 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976492.1 protein_id gnl|my_center|LOCUS_32130 15608 16273 gene locus_tag LOCUS_32140 15608 16273 CDS product SCO2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028279.1 protein_id gnl|my_center|LOCUS_32140 16404 17909 gene locus_tag LOCUS_32150 16404 17909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 17906 19621 gene locus_tag LOCUS_32160 17906 19621 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_32160 19618 20490 gene locus_tag LOCUS_32170 19618 20490 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_32170 21199 20462 gene locus_tag LOCUS_32180 21199 20462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 21775 21290 gene locus_tag LOCUS_32190 21775 21290 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029549.1 protein_id gnl|my_center|LOCUS_32190 23894 21807 gene locus_tag LOCUS_32200 23894 21807 CDS product bifunctional glycosyltransferase 87/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270029.1 protein_id gnl|my_center|LOCUS_32200 24573 24061 gene locus_tag LOCUS_32210 24573 24061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 25777 24587 gene locus_tag LOCUS_32220 25777 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 25877 27715 gene locus_tag LOCUS_32230 25877 27715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 28590 27823 gene locus_tag LOCUS_32240 28590 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 29201 28590 gene locus_tag LOCUS_32250 29201 28590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976462.1 protein_id gnl|my_center|LOCUS_32250 31437 29389 gene locus_tag LOCUS_32260 31437 29389 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028294.1 protein_id gnl|my_center|LOCUS_32260 31707 32678 gene locus_tag LOCUS_32270 31707 32678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 32827 33507 gene locus_tag LOCUS_32280 32827 33507 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 protein_id gnl|my_center|LOCUS_32280 34446 35114 gene locus_tag LOCUS_32290 34446 35114 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 protein_id gnl|my_center|LOCUS_32290 35267 36952 gene locus_tag LOCUS_32300 35267 36952 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 protein_id gnl|my_center|LOCUS_32300 37267 37704 gene locus_tag LOCUS_32310 37267 37704 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976454.1 protein_id gnl|my_center|LOCUS_32310 38054 38725 gene locus_tag LOCUS_32320 38054 38725 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976453.1 protein_id gnl|my_center|LOCUS_32320 39031 38741 gene locus_tag LOCUS_32330 39031 38741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 39030 39494 gene locus_tag LOCUS_32340 39030 39494 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061570.1 protein_id gnl|my_center|LOCUS_32340 39940 39491 gene locus_tag LOCUS_32350 39940 39491 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193539.1 protein_id gnl|my_center|LOCUS_32350 41303 39918 gene locus_tag LOCUS_32360 41303 39918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027315.1 protein_id gnl|my_center|LOCUS_32360 41876 41802 gene locus_tag LOCUS_t00390 41876 41802 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 42013 42849 gene locus_tag LOCUS_32370 42013 42849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 42924 44291 gene locus_tag LOCUS_32380 42924 44291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_32380 44455 45021 gene locus_tag LOCUS_32390 44455 45021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 45031 45258 gene locus_tag LOCUS_32400 45031 45258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 45663 45280 gene locus_tag LOCUS_32410 45663 45280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 46381 45602 gene locus_tag LOCUS_32420 46381 45602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 46481 47107 gene locus_tag LOCUS_32430 46481 47107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32430 47909 47076 gene locus_tag LOCUS_32440 47909 47076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_32440 50488 47906 gene locus_tag LOCUS_32450 50488 47906 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028307.1 protein_id gnl|my_center|LOCUS_32450 51564 50491 gene locus_tag LOCUS_32460 51564 50491 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_32460 51854 52810 gene locus_tag LOCUS_32470 51854 52810 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976440.1 protein_id gnl|my_center|LOCUS_32470 53569 52826 gene locus_tag LOCUS_32480 53569 52826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976439.1 protein_id gnl|my_center|LOCUS_32480 54826 53693 gene locus_tag LOCUS_32490 54826 53693 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028309.1 protein_id gnl|my_center|LOCUS_32490 55453 54878 gene locus_tag LOCUS_32500 55453 54878 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976437.1 protein_id gnl|my_center|LOCUS_32500 56202 55603 gene locus_tag LOCUS_32510 56202 55603 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_32510 56936 56394 gene locus_tag LOCUS_32520 56936 56394 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_32520 57549 57112 gene locus_tag LOCUS_32530 57549 57112 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_32530 58137 60881 gene locus_tag LOCUS_32540 gene aceE 58137 60881 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_32540 61005 61787 gene locus_tag LOCUS_32550 61005 61787 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_32550 62103 61828 gene locus_tag LOCUS_32560 62103 61828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028310.1 protein_id gnl|my_center|LOCUS_32560 62631 62158 gene locus_tag LOCUS_32570 62631 62158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 64405 62792 gene locus_tag LOCUS_32580 64405 62792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_32580 64546 65205 gene locus_tag LOCUS_32590 64546 65205 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_32590 65340 66608 gene locus_tag LOCUS_32600 65340 66608 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028312.1 protein_id gnl|my_center|LOCUS_32600 66844 67722 gene locus_tag LOCUS_32610 66844 67722 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976427.1 protein_id gnl|my_center|LOCUS_32610 67762 69132 gene locus_tag LOCUS_32620 67762 69132 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_32620 69129 69803 gene locus_tag LOCUS_32630 69129 69803 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_32630 70264 71304 gene locus_tag LOCUS_32640 70264 71304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029218.1 protein_id gnl|my_center|LOCUS_32640 71301 72494 gene locus_tag LOCUS_32650 71301 72494 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029217.1 protein_id gnl|my_center|LOCUS_32650 73527 72511 gene locus_tag LOCUS_32660 73527 72511 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_32660 73991 73524 gene locus_tag LOCUS_32670 73991 73524 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326123.1 protein_id gnl|my_center|LOCUS_32670 74100 74927 gene locus_tag LOCUS_32680 74100 74927 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028315.1 protein_id gnl|my_center|LOCUS_32680 75598 74924 gene locus_tag LOCUS_32690 75598 74924 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028320.1 protein_id gnl|my_center|LOCUS_32690 75648 76829 gene locus_tag LOCUS_32700 gene fasR 75648 76829 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_32700 76919 77848 gene locus_tag LOCUS_32710 76919 77848 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_32710 77864 78865 gene locus_tag LOCUS_32720 77864 78865 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_32720 78938 79186 gene locus_tag LOCUS_32730 78938 79186 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_32730 79266 80528 gene locus_tag LOCUS_32740 79266 80528 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_32740 81483 80650 gene locus_tag LOCUS_32750 81483 80650 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_32750 82084 81590 gene locus_tag LOCUS_32760 82084 81590 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_32760 82357 83307 gene locus_tag LOCUS_32770 82357 83307 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_32770 83334 84413 gene locus_tag LOCUS_32780 83334 84413 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_32780 86927 84444 gene locus_tag LOCUS_32790 86927 84444 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156722191.1 protein_id gnl|my_center|LOCUS_32790 87087 87671 gene locus_tag LOCUS_32800 87087 87671 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230338.1 protein_id gnl|my_center|LOCUS_32800 87766 89082 gene locus_tag LOCUS_32810 87766 89082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976412.1 protein_id gnl|my_center|LOCUS_32810 89991 89128 gene locus_tag LOCUS_32820 89991 89128 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_32820 90167 92734 gene locus_tag LOCUS_32830 90167 92734 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117302210.1 protein_id gnl|my_center|LOCUS_32830 93270 92842 gene locus_tag LOCUS_32840 93270 92842 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_32840 94365 93349 gene locus_tag LOCUS_32850 94365 93349 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_32850 94460 94897 gene locus_tag LOCUS_32860 94460 94897 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_32860 95760 95005 gene locus_tag LOCUS_32870 95760 95005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 95882 96484 gene locus_tag LOCUS_32880 95882 96484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976365.1 protein_id gnl|my_center|LOCUS_32880 96781 97824 gene locus_tag LOCUS_32890 96781 97824 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976353.1 protein_id gnl|my_center|LOCUS_32890 97826 99403 gene locus_tag LOCUS_32900 97826 99403 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028361.1 protein_id gnl|my_center|LOCUS_32900 101717 99522 gene locus_tag LOCUS_32910 101717 99522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 104194 101714 gene locus_tag LOCUS_32920 104194 101714 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855351.1 protein_id gnl|my_center|LOCUS_32920 104881 106074 gene locus_tag LOCUS_32930 104881 106074 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809304.1 protein_id gnl|my_center|LOCUS_32930 107015 106164 gene locus_tag LOCUS_32940 107015 106164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325235.1 protein_id gnl|my_center|LOCUS_32940 109143 107152 gene locus_tag LOCUS_32950 109143 107152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 110135 109311 gene locus_tag LOCUS_32960 gene modA 110135 109311 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 protein_id gnl|my_center|LOCUS_32960 110658 110260 gene locus_tag LOCUS_32970 110658 110260 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_32970 110957 111925 gene locus_tag LOCUS_32980 110957 111925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 111952 112758 gene locus_tag LOCUS_32990 111952 112758 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653653.1 protein_id gnl|my_center|LOCUS_32990 112873 113802 gene locus_tag LOCUS_33000 112873 113802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 114064 113988 gene locus_tag LOCUS_t00400 114064 113988 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 114381 114308 gene locus_tag LOCUS_t00410 114381 114308 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 114459 114386 gene locus_tag LOCUS_t00420 114459 114386 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 114662 114946 gene locus_tag LOCUS_33010 114662 114946 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 protein_id gnl|my_center|LOCUS_33010 115023 116474 gene locus_tag LOCUS_33020 115023 116474 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976342.1 protein_id gnl|my_center|LOCUS_33020 116584 118359 gene locus_tag LOCUS_33030 116584 118359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067016493.1 protein_id gnl|my_center|LOCUS_33030 118359 120293 gene locus_tag LOCUS_33040 118359 120293 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976340.1 protein_id gnl|my_center|LOCUS_33040 121810 120536 gene locus_tag LOCUS_33050 121810 120536 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976339.1 protein_id gnl|my_center|LOCUS_33050 123964 122027 gene locus_tag LOCUS_33060 gene dnaG 123964 122027 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_33060 125320 124034 gene locus_tag LOCUS_33070 125320 124034 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 protein_id gnl|my_center|LOCUS_33070 126755 125544 gene locus_tag LOCUS_33080 126755 125544 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_33080 127678 126752 gene locus_tag LOCUS_33090 127678 126752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 127872 128684 gene locus_tag LOCUS_33100 127872 128684 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_33100 128855 130924 gene locus_tag LOCUS_33110 128855 130924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 131935 131198 gene locus_tag LOCUS_33120 131935 131198 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976326.1 protein_id gnl|my_center|LOCUS_33120 131934 132710 gene locus_tag LOCUS_33130 131934 132710 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_33130 132932 133453 gene locus_tag LOCUS_33140 132932 133453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028375.1 protein_id gnl|my_center|LOCUS_33140 133638 134264 gene locus_tag LOCUS_33150 133638 134264 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976324.1 protein_id gnl|my_center|LOCUS_33150 135080 134301 gene locus_tag LOCUS_33160 135080 134301 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028380.1 protein_id gnl|my_center|LOCUS_33160 135386 136651 gene locus_tag LOCUS_33170 135386 136651 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028381.1 protein_id gnl|my_center|LOCUS_33170 136653 139196 gene locus_tag LOCUS_33180 gene nirB 136653 139196 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028382.1 protein_id gnl|my_center|LOCUS_33180 139193 139540 gene locus_tag LOCUS_33190 gene nirD 139193 139540 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976316.1 protein_id gnl|my_center|LOCUS_33190 139581 140165 gene locus_tag LOCUS_33200 139581 140165 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_33200 140262 141671 gene locus_tag LOCUS_33210 140262 141671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228258.1 protein_id gnl|my_center|LOCUS_33210 141739 142500 gene locus_tag LOCUS_33220 141739 142500 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_33220 142654 143814 gene locus_tag LOCUS_33230 142654 143814 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_33230 144822 143863 gene locus_tag LOCUS_33240 144822 143863 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145736531.1 protein_id gnl|my_center|LOCUS_33240 145037 145360 gene locus_tag LOCUS_33250 145037 145360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 148026 145267 gene locus_tag LOCUS_33260 gene ppdK 148026 145267 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_33260 149034 148324 gene locus_tag LOCUS_33270 149034 148324 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_33270 150158 149031 gene locus_tag LOCUS_33280 150158 149031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_33280 151107 150166 gene locus_tag LOCUS_33290 151107 150166 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_33290 152045 151095 gene locus_tag LOCUS_33300 152045 151095 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_33300 153214 152045 gene locus_tag LOCUS_33310 153214 152045 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_33310 153586 154353 gene locus_tag LOCUS_33320 153586 154353 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 protein_id gnl|my_center|LOCUS_33320 154405 155865 gene locus_tag LOCUS_33330 154405 155865 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031846.1 protein_id gnl|my_center|LOCUS_33330 155900 156562 gene locus_tag LOCUS_33340 155900 156562 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031847.1 protein_id gnl|my_center|LOCUS_33340 156877 158097 gene locus_tag LOCUS_33350 156877 158097 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029609.1 protein_id gnl|my_center|LOCUS_33350 159304 158114 gene locus_tag LOCUS_33360 gene dusB 159304 158114 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_33360 159464 160879 gene locus_tag LOCUS_33370 159464 160879 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_33370 161740 160886 gene locus_tag LOCUS_33380 161740 160886 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976301.1 protein_id gnl|my_center|LOCUS_33380 161942 161757 gene locus_tag LOCUS_33390 161942 161757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 161959 163335 gene locus_tag LOCUS_33400 161959 163335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028390.1 protein_id gnl|my_center|LOCUS_33400 163659 163396 gene locus_tag LOCUS_33410 163659 163396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 164049 163834 gene locus_tag LOCUS_33420 164049 163834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 165526 164144 gene locus_tag LOCUS_33430 165526 164144 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_33430 165668 166672 gene locus_tag LOCUS_33440 165668 166672 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_33440 166669 167601 gene locus_tag LOCUS_33450 166669 167601 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_33450 167604 168566 gene locus_tag LOCUS_33460 167604 168566 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_33460 168679 169083 gene locus_tag LOCUS_33470 168679 169083 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_33470 170004 169138 gene locus_tag LOCUS_33480 170004 169138 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_33480 170767 170018 gene locus_tag LOCUS_33490 gene recO 170767 170018 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_33490 171553 170846 gene locus_tag LOCUS_33500 171553 170846 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863748.1 protein_id gnl|my_center|LOCUS_33500 172881 171550 gene locus_tag LOCUS_33510 172881 171550 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863745.1 protein_id gnl|my_center|LOCUS_33510 175103 172980 gene locus_tag LOCUS_33520 175103 172980 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028402.1 protein_id gnl|my_center|LOCUS_33520 175999 175304 gene locus_tag LOCUS_33530 175999 175304 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028407.1 protein_id gnl|my_center|LOCUS_33530 177950 176154 gene locus_tag LOCUS_33540 gene leuA 177950 176154 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_33540 179200 178226 gene locus_tag LOCUS_33550 gene era 179200 178226 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_33550 179617 179261 gene locus_tag LOCUS_33560 179617 179261 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_33560 180035 179667 gene locus_tag LOCUS_33570 180035 179667 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224578.1 protein_id gnl|my_center|LOCUS_33570 180430 180032 gene locus_tag LOCUS_33580 180430 180032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 181225 180467 gene locus_tag LOCUS_33590 181225 180467 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_33590 181619 182050 gene locus_tag LOCUS_33600 181619 182050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 182273 183679 gene locus_tag LOCUS_33610 182273 183679 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775825.1 protein_id gnl|my_center|LOCUS_33610 184071 183694 gene locus_tag LOCUS_33620 184071 183694 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_33620 185354 184068 gene locus_tag LOCUS_33630 185354 184068 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_33630 185848 185351 gene locus_tag LOCUS_33640 gene ybeY 185848 185351 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_33640 186921 185890 gene locus_tag LOCUS_33650 186921 185890 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_33650 187759 187133 gene locus_tag LOCUS_33660 187759 187133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 188893 187781 gene locus_tag LOCUS_33670 188893 187781 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 protein_id gnl|my_center|LOCUS_33670 189920 189012 gene locus_tag LOCUS_33680 189920 189012 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028422.1 protein_id gnl|my_center|LOCUS_33680 190289 189930 gene locus_tag LOCUS_33690 190289 189930 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_33690 191117 190377 gene locus_tag LOCUS_33700 191117 190377 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_33700 192136 191114 gene locus_tag LOCUS_33710 192136 191114 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_33710 193420 192287 gene locus_tag LOCUS_33720 gene dnaJ 193420 192287 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_33720 194443 193421 gene locus_tag LOCUS_33730 gene hrcA 194443 193421 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_33730 194607 195326 gene locus_tag LOCUS_33740 194607 195326 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028425.1 protein_id gnl|my_center|LOCUS_33740 195323 196165 gene locus_tag LOCUS_33750 195323 196165 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_33750 197601 196399 gene locus_tag LOCUS_33760 gene hemW 197601 196399 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_33760 200005 197687 gene locus_tag LOCUS_33770 200005 197687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 200157 200858 gene locus_tag LOCUS_33780 200157 200858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 202757 200910 gene locus_tag LOCUS_33790 202757 200910 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_33790 204911 203046 gene locus_tag LOCUS_33800 gene lepA 204911 203046 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_33800 205111 205377 gene locus_tag LOCUS_33810 gene rpsT 205111 205377 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_33810 206637 205651 gene locus_tag LOCUS_33820 gene holA 206637 205651 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_33820 206706 206960 gene locus_tag LOCUS_33830 206706 206960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 protein_id gnl|my_center|LOCUS_33830 207905 207024 gene locus_tag LOCUS_33840 207905 207024 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028430.1 protein_id gnl|my_center|LOCUS_33840 208918 208091 gene locus_tag LOCUS_33850 208918 208091 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_33850 211547 209025 gene locus_tag LOCUS_33860 211547 209025 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_33860 212274 212365 gene locus_tag LOCUS_t00430 212274 212365 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 213702 212779 gene locus_tag LOCUS_33870 213702 212779 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_33870 214680 213853 gene locus_tag LOCUS_33880 214680 213853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028433.1 protein_id gnl|my_center|LOCUS_33880 217808 214908 gene locus_tag LOCUS_33890 gene leuS 217808 214908 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_33890 218356 219990 gene locus_tag LOCUS_33900 218356 219990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 219987 221582 gene locus_tag LOCUS_33910 219987 221582 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175647404.1 protein_id gnl|my_center|LOCUS_33910 222512 221613 gene locus_tag LOCUS_33920 222512 221613 CDS product rRNA (guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223831.1 protein_id gnl|my_center|LOCUS_33920 222660 222587 gene locus_tag LOCUS_t00440 222660 222587 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 222858 224108 gene locus_tag LOCUS_33930 222858 224108 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222901.1 protein_id gnl|my_center|LOCUS_33930 224310 224077 gene locus_tag LOCUS_33940 224310 224077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976229.1 protein_id gnl|my_center|LOCUS_33940 224478 224314 gene locus_tag LOCUS_33950 224478 224314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104632996.1 protein_id gnl|my_center|LOCUS_33950 224699 224626 gene locus_tag LOCUS_t00450 224699 224626 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 225284 224832 gene locus_tag LOCUS_33960 225284 224832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 225913 225482 gene locus_tag LOCUS_33970 gene rsfS 225913 225482 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_33970 227698 225989 gene locus_tag LOCUS_33980 gene pdtA 227698 225989 CDS product polydiglycosylphosphate transferase PdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976225.1 protein_id gnl|my_center|LOCUS_33980 228344 227718 gene locus_tag LOCUS_33990 gene nadD 228344 227718 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_33990 228547 228383 gene locus_tag LOCUS_34000 228547 228383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976223.1 protein_id gnl|my_center|LOCUS_34000 228743 229855 gene locus_tag LOCUS_34010 228743 229855 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_34010 230976 229882 gene locus_tag LOCUS_34020 230976 229882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028435.1 protein_id gnl|my_center|LOCUS_34020 231794 231108 gene locus_tag LOCUS_34030 231794 231108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326198.1 protein_id gnl|my_center|LOCUS_34030 233067 231775 gene locus_tag LOCUS_34040 233067 231775 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_34040 233688 233212 gene locus_tag LOCUS_34050 233688 233212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028437.1 protein_id gnl|my_center|LOCUS_34050 235012 233885 gene locus_tag LOCUS_34060 gene proB 235012 233885 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_34060 237454 235283 gene locus_tag LOCUS_34070 237454 235283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 protein_id gnl|my_center|LOCUS_34070 239055 237595 gene locus_tag LOCUS_34080 239055 237595 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_34080 241437 239401 gene locus_tag LOCUS_34090 241437 239401 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972899.1 protein_id gnl|my_center|LOCUS_34090 243277 241841 gene locus_tag LOCUS_34100 gene obgE 243277 241841 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_34100 243670 243413 gene locus_tag LOCUS_34110 gene rpmA 243670 243413 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_34110 244008 243685 gene locus_tag LOCUS_34120 gene rplU 244008 243685 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_34120 244861 244625 gene locus_tag LOCUS_34130 244861 244625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 245214 244876 gene locus_tag LOCUS_34140 245214 244876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34140 245555 245211 gene locus_tag LOCUS_34150 245555 245211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34150 246491 246171 gene locus_tag LOCUS_34160 246491 246171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 246924 246442 gene locus_tag LOCUS_34170 246924 246442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 247020 247748 gene locus_tag LOCUS_34180 247020 247748 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973092.1 protein_id gnl|my_center|LOCUS_34180 248253 248056 gene locus_tag LOCUS_34190 248253 248056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 248989 248267 gene locus_tag LOCUS_34200 248989 248267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 249536 249096 gene locus_tag LOCUS_34210 249536 249096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 254523 249523 gene locus_tag LOCUS_34220 254523 249523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34220 255866 254406 gene locus_tag LOCUS_34230 255866 254406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34230 256409 260575 gene locus_tag LOCUS_34240 256409 260575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 260705 261865 gene locus_tag LOCUS_34250 260705 261865 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028459.1 protein_id gnl|my_center|LOCUS_34250 261810 262409 gene locus_tag LOCUS_34260 261810 262409 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776120.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence10 612 106 gene locus_tag LOCUS_34270 612 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 1445 741 gene locus_tag LOCUS_34280 1445 741 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226773.1 protein_id gnl|my_center|LOCUS_34280 1686 2462 gene locus_tag LOCUS_34290 1686 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 3330 2539 gene locus_tag LOCUS_34300 3330 2539 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_34300 3467 4357 gene locus_tag LOCUS_34310 3467 4357 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_34310 4669 6600 gene locus_tag LOCUS_34320 4669 6600 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031188.1 protein_id gnl|my_center|LOCUS_34320 6607 7044 gene locus_tag LOCUS_34330 6607 7044 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 protein_id gnl|my_center|LOCUS_34330 7047 7418 gene locus_tag LOCUS_34340 7047 7418 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031189.1 protein_id gnl|my_center|LOCUS_34340 7396 8037 gene locus_tag LOCUS_34350 7396 8037 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327875.1 protein_id gnl|my_center|LOCUS_34350 8199 8564 gene locus_tag LOCUS_34360 8199 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 10542 8572 gene locus_tag LOCUS_34370 10542 8572 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027279.1 protein_id gnl|my_center|LOCUS_34370 11737 10577 gene locus_tag LOCUS_34380 11737 10577 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226897.1 protein_id gnl|my_center|LOCUS_34380 12801 11734 gene locus_tag LOCUS_34390 12801 11734 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226898.1 protein_id gnl|my_center|LOCUS_34390 13075 13938 gene locus_tag LOCUS_34400 13075 13938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_34400 13968 14984 gene locus_tag LOCUS_34410 13968 14984 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286161.1 protein_id gnl|my_center|LOCUS_34410 15020 15850 gene locus_tag LOCUS_34420 15020 15850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226902.1 protein_id gnl|my_center|LOCUS_34420 15974 16492 gene locus_tag LOCUS_34430 15974 16492 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218060570.1 protein_id gnl|my_center|LOCUS_34430 17563 16625 gene locus_tag LOCUS_34440 17563 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 21085 17621 gene locus_tag LOCUS_34450 21085 17621 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221463383.1 protein_id gnl|my_center|LOCUS_34450 21419 21778 gene locus_tag LOCUS_34460 21419 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 22744 21839 gene locus_tag LOCUS_34470 22744 21839 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224138.1 protein_id gnl|my_center|LOCUS_34470 23476 22790 gene locus_tag LOCUS_34480 23476 22790 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030391327.1 protein_id gnl|my_center|LOCUS_34480 23646 23720 gene locus_tag LOCUS_t00460 23646 23720 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24817 23864 gene locus_tag LOCUS_34490 gene tehA 24817 23864 CDS product dicarboxylate transporter/tellurite-resistance protein TehA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966370.1 protein_id gnl|my_center|LOCUS_34490 25940 25197 gene locus_tag LOCUS_34500 25940 25197 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_34500 26314 27297 gene locus_tag LOCUS_34510 26314 27297 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 protein_id gnl|my_center|LOCUS_34510 27312 27959 gene locus_tag LOCUS_34520 27312 27959 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729832.1 protein_id gnl|my_center|LOCUS_34520 28132 29097 gene locus_tag LOCUS_34530 28132 29097 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 protein_id gnl|my_center|LOCUS_34530 30322 29087 gene locus_tag LOCUS_34540 30322 29087 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 protein_id gnl|my_center|LOCUS_34540 30427 31134 gene locus_tag LOCUS_34550 30427 31134 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_34550 31285 32196 gene locus_tag LOCUS_34560 31285 32196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 34322 32313 gene locus_tag LOCUS_34570 34322 32313 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229532.1 protein_id gnl|my_center|LOCUS_34570 35367 34366 gene locus_tag LOCUS_34580 35367 34366 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225098.1 protein_id gnl|my_center|LOCUS_34580 36368 35367 gene locus_tag LOCUS_34590 36368 35367 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225097.1 protein_id gnl|my_center|LOCUS_34590 37873 36365 gene locus_tag LOCUS_34600 37873 36365 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225096.1 protein_id gnl|my_center|LOCUS_34600 38202 37870 gene locus_tag LOCUS_34610 38202 37870 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225095.1 protein_id gnl|my_center|LOCUS_34610 39437 38199 gene locus_tag LOCUS_34620 39437 38199 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225094.1 protein_id gnl|my_center|LOCUS_34620 40196 39603 gene locus_tag LOCUS_34630 40196 39603 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466933.1 protein_id gnl|my_center|LOCUS_34630 41532 40552 gene locus_tag LOCUS_34640 gene axeA 41532 40552 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_34640 43692 41578 gene locus_tag LOCUS_34650 43692 41578 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_34650 43834 44883 gene locus_tag LOCUS_34660 43834 44883 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_34660 44994 46235 gene locus_tag LOCUS_34670 44994 46235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 46311 47489 gene locus_tag LOCUS_34680 46311 47489 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256994.1 protein_id gnl|my_center|LOCUS_34680 47504 48451 gene locus_tag LOCUS_34690 47504 48451 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052908.1 protein_id gnl|my_center|LOCUS_34690 48566 51304 gene locus_tag LOCUS_34700 48566 51304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 51559 51377 gene locus_tag LOCUS_34710 51559 51377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 51474 52163 gene locus_tag LOCUS_34720 51474 52163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 52160 53065 gene locus_tag LOCUS_34730 52160 53065 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_34730 53222 54571 gene locus_tag LOCUS_34740 53222 54571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056820.1 protein_id gnl|my_center|LOCUS_34740 56863 54665 gene locus_tag LOCUS_34750 56863 54665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 57453 56929 gene locus_tag LOCUS_34760 57453 56929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 59015 57450 gene locus_tag LOCUS_34770 59015 57450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 59305 60111 gene locus_tag LOCUS_34780 59305 60111 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223575.1 protein_id gnl|my_center|LOCUS_34780 62607 60229 gene locus_tag LOCUS_34790 62607 60229 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228676.1 protein_id gnl|my_center|LOCUS_34790 62986 66258 gene locus_tag LOCUS_34800 62986 66258 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978377.1 protein_id gnl|my_center|LOCUS_34800 67415 66372 gene locus_tag LOCUS_34810 67415 66372 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978054.1 protein_id gnl|my_center|LOCUS_34810 68805 67717 gene locus_tag LOCUS_34820 gene rhaS 68805 67717 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978052.1 protein_id gnl|my_center|LOCUS_34820 69876 68860 gene locus_tag LOCUS_34830 69876 68860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978051.1 protein_id gnl|my_center|LOCUS_34830 70913 69873 gene locus_tag LOCUS_34840 70913 69873 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978050.1 protein_id gnl|my_center|LOCUS_34840 72466 70910 gene locus_tag LOCUS_34850 72466 70910 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978049.1 protein_id gnl|my_center|LOCUS_34850 72747 73919 gene locus_tag LOCUS_34860 gene rhaI 72747 73919 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_34860 74070 74852 gene locus_tag LOCUS_34870 74070 74852 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_34870 75585 74821 gene locus_tag LOCUS_34880 gene cobF 75585 74821 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031346.1 protein_id gnl|my_center|LOCUS_34880 75693 76412 gene locus_tag LOCUS_34890 75693 76412 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_34890 76409 77866 gene locus_tag LOCUS_34900 76409 77866 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_34900 77866 78573 gene locus_tag LOCUS_34910 77866 78573 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_34910 79144 78599 gene locus_tag LOCUS_34920 79144 78599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34920 79868 79113 gene locus_tag LOCUS_34930 79868 79113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34930 80113 79865 gene locus_tag LOCUS_34940 80113 79865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 80756 80274 gene locus_tag LOCUS_34950 80756 80274 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972173.1 protein_id gnl|my_center|LOCUS_34950 80872 80946 gene locus_tag LOCUS_t00470 80872 80946 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 82090 81398 gene locus_tag LOCUS_34960 82090 81398 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030825.1 protein_id gnl|my_center|LOCUS_34960 83230 82316 gene locus_tag LOCUS_34970 83230 82316 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_34970 83336 83971 gene locus_tag LOCUS_34980 83336 83971 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030824.1 protein_id gnl|my_center|LOCUS_34980 85696 84023 gene locus_tag LOCUS_34990 85696 84023 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225850.1 protein_id gnl|my_center|LOCUS_34990 87176 85794 gene locus_tag LOCUS_35000 87176 85794 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730480.1 protein_id gnl|my_center|LOCUS_35000 87536 89344 gene locus_tag LOCUS_35010 87536 89344 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225848.1 protein_id gnl|my_center|LOCUS_35010 89919 89470 gene locus_tag LOCUS_35020 89919 89470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 90258 90701 gene locus_tag LOCUS_35030 90258 90701 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 protein_id gnl|my_center|LOCUS_35030 90730 91308 gene locus_tag LOCUS_35040 90730 91308 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888554.1 protein_id gnl|my_center|LOCUS_35040 92664 91273 gene locus_tag LOCUS_35050 92664 91273 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206286.1 protein_id gnl|my_center|LOCUS_35050 93470 92721 gene locus_tag LOCUS_35060 93470 92721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 93828 93610 gene locus_tag LOCUS_35070 93828 93610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 93920 94321 gene locus_tag LOCUS_35080 93920 94321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 94613 95071 gene locus_tag LOCUS_35090 94613 95071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 95068 96072 gene locus_tag LOCUS_35100 95068 96072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 96118 99849 gene locus_tag LOCUS_35110 96118 99849 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_35110 99846 100613 gene locus_tag LOCUS_35120 99846 100613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 101089 100688 gene locus_tag LOCUS_35130 101089 100688 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_35130 101221 102195 gene locus_tag LOCUS_35140 101221 102195 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_35140 102334 103956 gene locus_tag LOCUS_35150 102334 103956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 105061 103994 gene locus_tag LOCUS_35160 105061 103994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 105621 105058 gene locus_tag LOCUS_35170 105621 105058 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226663.1 protein_id gnl|my_center|LOCUS_35170 107590 105626 gene locus_tag LOCUS_35180 107590 105626 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226664.1 protein_id gnl|my_center|LOCUS_35180 108030 107587 gene locus_tag LOCUS_35190 108030 107587 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_35190 108314 108027 gene locus_tag LOCUS_35200 108314 108027 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226666.1 protein_id gnl|my_center|LOCUS_35200 110321 108363 gene locus_tag LOCUS_35210 110321 108363 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_35210 111166 110321 gene locus_tag LOCUS_35220 111166 110321 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_35220 111609 111172 gene locus_tag LOCUS_35230 111609 111172 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226669.1 protein_id gnl|my_center|LOCUS_35230 112082 111654 gene locus_tag LOCUS_35240 112082 111654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 112870 113079 gene locus_tag LOCUS_35250 112870 113079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 113598 113455 gene locus_tag LOCUS_35260 113598 113455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 protein_id gnl|my_center|LOCUS_35260 114056 113595 gene locus_tag LOCUS_35270 114056 113595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_35270 114499 114056 gene locus_tag LOCUS_35280 114499 114056 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226672.1 protein_id gnl|my_center|LOCUS_35280 116146 114599 gene locus_tag LOCUS_35290 116146 114599 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_35290 116149 116355 gene locus_tag LOCUS_35300 116149 116355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 116406 120146 gene locus_tag LOCUS_35310 116406 120146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 120178 120870 gene locus_tag LOCUS_35320 120178 120870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 121388 122299 gene locus_tag LOCUS_35330 121388 122299 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_35330 122795 123076 gene locus_tag LOCUS_35340 122795 123076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973915.1 protein_id gnl|my_center|LOCUS_35340 123073 123474 gene locus_tag LOCUS_35350 123073 123474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030029.1 protein_id gnl|my_center|LOCUS_35350 125519 123489 gene locus_tag LOCUS_35360 125519 123489 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226676.1 protein_id gnl|my_center|LOCUS_35360 126250 125516 gene locus_tag LOCUS_35370 126250 125516 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_35370 128360 126267 gene locus_tag LOCUS_35380 128360 126267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 129120 128497 gene locus_tag LOCUS_35390 129120 128497 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029539.1 protein_id gnl|my_center|LOCUS_35390 129333 130667 gene locus_tag LOCUS_35400 129333 130667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226660.1 protein_id gnl|my_center|LOCUS_35400 131557 130691 gene locus_tag LOCUS_35410 131557 130691 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226675.1 protein_id gnl|my_center|LOCUS_35410 131786 132781 gene locus_tag LOCUS_35420 131786 132781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 132992 133654 gene locus_tag LOCUS_35430 132992 133654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 133661 134647 gene locus_tag LOCUS_35440 133661 134647 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029165.1 protein_id gnl|my_center|LOCUS_35440 135015 134749 gene locus_tag LOCUS_35450 135015 134749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 135524 135156 gene locus_tag LOCUS_35460 135524 135156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 135659 136324 gene locus_tag LOCUS_35470 135659 136324 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762731.1 protein_id gnl|my_center|LOCUS_35470 138283 136499 gene locus_tag LOCUS_35480 138283 136499 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486025.1 protein_id gnl|my_center|LOCUS_35480 138748 139617 gene locus_tag LOCUS_35490 138748 139617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 139614 140438 gene locus_tag LOCUS_35500 139614 140438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 140977 140570 gene locus_tag LOCUS_35510 140977 140570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 141120 141602 gene locus_tag LOCUS_35520 141120 141602 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_35520 141686 142363 gene locus_tag LOCUS_35530 141686 142363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 142419 143159 gene locus_tag LOCUS_35540 142419 143159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 143855 143211 gene locus_tag LOCUS_35550 143855 143211 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227430.1 protein_id gnl|my_center|LOCUS_35550 144476 144012 gene locus_tag LOCUS_35560 144476 144012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 144986 144549 gene locus_tag LOCUS_35570 144986 144549 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028745.1 protein_id gnl|my_center|LOCUS_35570 145142 145534 gene locus_tag LOCUS_35580 145142 145534 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029511.1 protein_id gnl|my_center|LOCUS_35580 145580 146383 gene locus_tag LOCUS_35590 145580 146383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971554.1 protein_id gnl|my_center|LOCUS_35590 146462 147442 gene locus_tag LOCUS_35600 146462 147442 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_35600 147439 148092 gene locus_tag LOCUS_35610 147439 148092 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_35610 148574 148152 gene locus_tag LOCUS_35620 148574 148152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 148705 151176 gene locus_tag LOCUS_35630 148705 151176 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850081.1 protein_id gnl|my_center|LOCUS_35630 151292 151645 gene locus_tag LOCUS_35640 151292 151645 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977882.1 protein_id gnl|my_center|LOCUS_35640 151756 151941 gene locus_tag LOCUS_35650 151756 151941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 154492 152039 gene locus_tag LOCUS_35660 154492 152039 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229634.1 protein_id gnl|my_center|LOCUS_35660 156179 154740 gene locus_tag LOCUS_35670 gene gndA 156179 154740 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027484.1 protein_id gnl|my_center|LOCUS_35670 156609 157706 gene locus_tag LOCUS_35680 156609 157706 CDS product DUF1996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031031.1 protein_id gnl|my_center|LOCUS_35680 157934 159652 gene locus_tag LOCUS_35690 157934 159652 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031032.1 protein_id gnl|my_center|LOCUS_35690 160258 161028 gene locus_tag LOCUS_35700 160258 161028 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976922.1 protein_id gnl|my_center|LOCUS_35700 161181 162539 gene locus_tag LOCUS_35710 161181 162539 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 protein_id gnl|my_center|LOCUS_35710 162536 163519 gene locus_tag LOCUS_35720 162536 163519 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976920.1 protein_id gnl|my_center|LOCUS_35720 163516 164433 gene locus_tag LOCUS_35730 163516 164433 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028038.1 protein_id gnl|my_center|LOCUS_35730 164430 165419 gene locus_tag LOCUS_35740 164430 165419 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_35740 165416 166369 gene locus_tag LOCUS_35750 165416 166369 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_35750 167790 166435 gene locus_tag LOCUS_35760 167790 166435 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_35760 168731 167853 gene locus_tag LOCUS_35770 168731 167853 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_35770 169731 168721 gene locus_tag LOCUS_35780 169731 168721 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031035.1 protein_id gnl|my_center|LOCUS_35780 171058 169742 gene locus_tag LOCUS_35790 171058 169742 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_35790 171198 172553 gene locus_tag LOCUS_35800 171198 172553 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027360.1 protein_id gnl|my_center|LOCUS_35800 173765 172620 gene locus_tag LOCUS_35810 173765 172620 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972380.1 protein_id gnl|my_center|LOCUS_35810 176538 173782 gene locus_tag LOCUS_35820 176538 173782 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031033.1 protein_id gnl|my_center|LOCUS_35820 176959 176690 gene locus_tag LOCUS_35830 176959 176690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 176871 178058 gene locus_tag LOCUS_35840 176871 178058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 179093 177939 gene locus_tag LOCUS_35850 179093 177939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 179330 180109 gene locus_tag LOCUS_35860 179330 180109 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027474.1 protein_id gnl|my_center|LOCUS_35860 180132 181346 gene locus_tag LOCUS_35870 gene glgA 180132 181346 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027473.1 protein_id gnl|my_center|LOCUS_35870 181401 182618 gene locus_tag LOCUS_35880 gene glgC 181401 182618 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027472.1 protein_id gnl|my_center|LOCUS_35880 183762 182701 gene locus_tag LOCUS_35890 183762 182701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223209.1 protein_id gnl|my_center|LOCUS_35890 184721 183759 gene locus_tag LOCUS_35900 184721 183759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223210.1 protein_id gnl|my_center|LOCUS_35900 186345 184714 gene locus_tag LOCUS_35910 186345 184714 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_35910 187435 186347 gene locus_tag LOCUS_35920 187435 186347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223212.1 protein_id gnl|my_center|LOCUS_35920 188696 187662 gene locus_tag LOCUS_35930 188696 187662 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977764.1 protein_id gnl|my_center|LOCUS_35930 188970 191588 gene locus_tag LOCUS_35940 188970 191588 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027471.1 protein_id gnl|my_center|LOCUS_35940 191744 192664 gene locus_tag LOCUS_35950 191744 192664 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015533.1 protein_id gnl|my_center|LOCUS_35950 192661 193407 gene locus_tag LOCUS_35960 192661 193407 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_35960 194048 193524 gene locus_tag LOCUS_35970 194048 193524 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971883.1 protein_id gnl|my_center|LOCUS_35970 194291 195772 gene locus_tag LOCUS_35980 194291 195772 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_35980 196077 196247 gene locus_tag LOCUS_35990 196077 196247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027467.1 protein_id gnl|my_center|LOCUS_35990 196404 197648 gene locus_tag LOCUS_36000 196404 197648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 197737 199845 gene locus_tag LOCUS_36010 197737 199845 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_36010 199971 202124 gene locus_tag LOCUS_36020 199971 202124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 202292 203266 gene locus_tag LOCUS_36030 202292 203266 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223734.1 protein_id gnl|my_center|LOCUS_36030 203263 204153 gene locus_tag LOCUS_36040 203263 204153 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223735.1 protein_id gnl|my_center|LOCUS_36040 204220 205086 gene locus_tag LOCUS_36050 204220 205086 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_36050 205794 205126 gene locus_tag LOCUS_36060 205794 205126 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977916.1 protein_id gnl|my_center|LOCUS_36060 205897 206646 gene locus_tag LOCUS_36070 205897 206646 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_36070 206777 207139 gene locus_tag LOCUS_36080 206777 207139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977612.1 protein_id gnl|my_center|LOCUS_36080 207136 208623 gene locus_tag LOCUS_36090 207136 208623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 208620 209816 gene locus_tag LOCUS_36100 208620 209816 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_36100 210408 209863 gene locus_tag LOCUS_36110 210408 209863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977917.1 protein_id gnl|my_center|LOCUS_36110 210521 210715 gene locus_tag LOCUS_36120 210521 210715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 211230 210652 gene locus_tag LOCUS_36130 211230 210652 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977918.1 protein_id gnl|my_center|LOCUS_36130 211427 211227 gene locus_tag LOCUS_36140 211427 211227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 211502 212704 gene locus_tag LOCUS_36150 211502 212704 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977919.1 protein_id gnl|my_center|LOCUS_36150 213224 212763 gene locus_tag LOCUS_36160 213224 212763 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_36160 213408 213235 gene locus_tag LOCUS_36170 213408 213235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 213407 214267 gene locus_tag LOCUS_36180 213407 214267 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868999.1 protein_id gnl|my_center|LOCUS_36180 214982 214323 gene locus_tag LOCUS_36190 214982 214323 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027455.1 protein_id gnl|my_center|LOCUS_36190 215303 215788 gene locus_tag LOCUS_36200 215303 215788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 216472 215885 gene locus_tag LOCUS_36210 216472 215885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 217539 216775 gene locus_tag LOCUS_36220 217539 216775 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_36220 217614 218162 gene locus_tag LOCUS_36230 217614 218162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 218352 219296 gene locus_tag LOCUS_36240 218352 219296 CDS product SCO0930 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027453.1 protein_id gnl|my_center|LOCUS_36240 219503 220315 gene locus_tag LOCUS_36250 219503 220315 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_36250 220315 222630 gene locus_tag LOCUS_36260 gene rmdA 220315 222630 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_36260 223627 222686 gene locus_tag LOCUS_36270 223627 222686 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_36270 223722 224474 gene locus_tag LOCUS_36280 223722 224474 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_36280 224476 226440 gene locus_tag LOCUS_36290 224476 226440 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_36290 226437 227183 gene locus_tag LOCUS_36300 226437 227183 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 protein_id gnl|my_center|LOCUS_36300 228250 227198 gene locus_tag LOCUS_36310 228250 227198 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 protein_id gnl|my_center|LOCUS_36310 228473 228961 gene locus_tag LOCUS_36320 228473 228961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977943.1 protein_id gnl|my_center|LOCUS_36320 229248 229024 gene locus_tag LOCUS_36330 229248 229024 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_36330 229363 230715 gene locus_tag LOCUS_36340 229363 230715 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027442.1 protein_id gnl|my_center|LOCUS_36340 230972 231787 gene locus_tag LOCUS_36350 230972 231787 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977938.1 protein_id gnl|my_center|LOCUS_36350 233618 232656 gene locus_tag LOCUS_36360 gene egtD 233618 232656 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_36360 234370 233615 gene locus_tag LOCUS_36370 gene egtC 234370 233615 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_36370 235737 234370 gene locus_tag LOCUS_36380 gene egtB 235737 234370 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_36380 237008 235734 gene locus_tag LOCUS_36390 gene egtA 237008 235734 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_36390 237174 238154 gene locus_tag LOCUS_36400 237174 238154 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869145.1 protein_id gnl|my_center|LOCUS_36400 238612 238139 gene locus_tag LOCUS_36410 238612 238139 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027436.1 protein_id gnl|my_center|LOCUS_36410 238982 238716 gene locus_tag LOCUS_36420 238982 238716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 239101 239445 gene locus_tag LOCUS_36430 239101 239445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 239644 240657 gene locus_tag LOCUS_36440 239644 240657 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027417.1 protein_id gnl|my_center|LOCUS_36440 240679 241098 gene locus_tag LOCUS_36450 240679 241098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 241208 242410 gene locus_tag LOCUS_36460 241208 242410 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_36460 242831 242421 gene locus_tag LOCUS_36470 gene trxA 242831 242421 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_36470 242990 244390 gene locus_tag LOCUS_36480 242990 244390 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_36480 247893 244426 gene locus_tag LOCUS_36490 247893 244426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224789.1 protein_id gnl|my_center|LOCUS_36490 247057 246979 gene locus_tag LOCUS_t00480 247057 246979 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 250193 247923 gene locus_tag LOCUS_36500 250193 247923 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223220.1 protein_id gnl|my_center|LOCUS_36500 251421 250330 gene locus_tag LOCUS_36510 251421 250330 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_36510 252712 251516 gene locus_tag LOCUS_36520 252712 251516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 252916 253689 gene locus_tag LOCUS_36530 252916 253689 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_36530 253823 254164 gene locus_tag LOCUS_36540 253823 254164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027359.1 protein_id gnl|my_center|LOCUS_36540 254202 254594 gene locus_tag LOCUS_36550 254202 254594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031411.1 protein_id gnl|my_center|LOCUS_36550 254913 255410 gene locus_tag LOCUS_36560 254913 255410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 255572 255766 gene locus_tag LOCUS_36570 255572 255766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 255767 256138 gene locus_tag LOCUS_36580 255767 256138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 256168 257136 gene locus_tag LOCUS_36590 gene ligD 256168 257136 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863172.1 protein_id gnl|my_center|LOCUS_36590 257490 257149 gene locus_tag LOCUS_36600 257490 257149 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977977.1 protein_id gnl|my_center|LOCUS_36600 257627 258592 gene locus_tag LOCUS_36610 257627 258592 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_36610 261367 260144 gene locus_tag LOCUS_36620 261367 260144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence11 106 1647 gene locus_tag LOCUS_36630 106 1647 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 protein_id gnl|my_center|LOCUS_36630 1813 2208 gene locus_tag LOCUS_36640 1813 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 2252 2638 gene locus_tag LOCUS_36650 2252 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 4283 2682 gene locus_tag LOCUS_36660 4283 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 5286 4378 gene locus_tag LOCUS_36670 5286 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028100.1 protein_id gnl|my_center|LOCUS_36670 5669 6451 gene locus_tag LOCUS_36680 5669 6451 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_36680 6904 7668 gene locus_tag LOCUS_36690 6904 7668 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_36690 8466 8990 gene locus_tag LOCUS_36700 8466 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 10751 9036 gene locus_tag LOCUS_36710 10751 9036 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804065.1 protein_id gnl|my_center|LOCUS_36710 10972 11859 gene locus_tag LOCUS_36720 10972 11859 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803679.1 protein_id gnl|my_center|LOCUS_36720 11905 12252 gene locus_tag LOCUS_36730 11905 12252 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_36730 12364 14862 gene locus_tag LOCUS_36740 gene pepN 12364 14862 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283751.1 protein_id gnl|my_center|LOCUS_36740 15052 16464 gene locus_tag LOCUS_36750 15052 16464 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_36750 18376 16562 gene locus_tag LOCUS_36760 18376 16562 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_36760 18612 19322 gene locus_tag LOCUS_36770 18612 19322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 19499 20905 gene locus_tag LOCUS_36780 gene pyk 19499 20905 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_36780 22670 20991 gene locus_tag LOCUS_36790 22670 20991 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114333.1 protein_id gnl|my_center|LOCUS_36790 24031 22712 gene locus_tag LOCUS_36800 gene rfbH 24031 22712 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227240.1 protein_id gnl|my_center|LOCUS_36800 26113 24077 gene locus_tag LOCUS_36810 gene pabB 26113 24077 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_36810 27606 26110 gene locus_tag LOCUS_36820 27606 26110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 28601 27648 gene locus_tag LOCUS_36830 28601 27648 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331295.1 protein_id gnl|my_center|LOCUS_36830 29825 28614 gene locus_tag LOCUS_36840 29825 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 30370 29822 gene locus_tag LOCUS_36850 30370 29822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 31161 30367 gene locus_tag LOCUS_36860 31161 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 32656 31169 gene locus_tag LOCUS_36870 32656 31169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 34112 32697 gene locus_tag LOCUS_36880 34112 32697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 34936 34139 gene locus_tag LOCUS_36890 gene rfbA 34936 34139 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382898.1 protein_id gnl|my_center|LOCUS_36890 35370 34987 gene locus_tag LOCUS_36900 35370 34987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 36674 35367 gene locus_tag LOCUS_36910 36674 35367 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_36910 37804 36719 gene locus_tag LOCUS_36920 37804 36719 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390556.1 protein_id gnl|my_center|LOCUS_36920 39170 38100 gene locus_tag LOCUS_36930 gene rfbB 39170 38100 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_36930 41480 39195 gene locus_tag LOCUS_36940 41480 39195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 43036 41645 gene locus_tag LOCUS_36950 43036 41645 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_36950 43971 43069 gene locus_tag LOCUS_36960 43971 43069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 45194 44001 gene locus_tag LOCUS_36970 45194 44001 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 protein_id gnl|my_center|LOCUS_36970 45865 45245 gene locus_tag LOCUS_36980 45865 45245 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729576.1 protein_id gnl|my_center|LOCUS_36980 46131 46058 gene locus_tag LOCUS_t00490 46131 46058 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46233 46886 gene locus_tag LOCUS_36990 46233 46886 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_36990 47687 46971 gene locus_tag LOCUS_37000 47687 46971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_37000 48586 47684 gene locus_tag LOCUS_37010 48586 47684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_37010 50388 48592 gene locus_tag LOCUS_37020 50388 48592 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_37020 51323 50394 gene locus_tag LOCUS_37030 51323 50394 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_37030 52665 51427 gene locus_tag LOCUS_37040 52665 51427 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_37040 53531 52935 gene locus_tag LOCUS_37050 53531 52935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028091.1 protein_id gnl|my_center|LOCUS_37050 54306 53803 gene locus_tag LOCUS_37060 54306 53803 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_37060 56862 54520 gene locus_tag LOCUS_37070 56862 54520 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_37070 57078 59720 gene locus_tag LOCUS_37080 gene polA 57078 59720 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_37080 60623 59754 gene locus_tag LOCUS_37090 60623 59754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 60863 62542 gene locus_tag LOCUS_37100 60863 62542 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028087.1 protein_id gnl|my_center|LOCUS_37100 65535 62968 gene locus_tag LOCUS_37110 gene hrpB 65535 62968 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_37110 66379 65540 gene locus_tag LOCUS_37120 66379 65540 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976818.1 protein_id gnl|my_center|LOCUS_37120 66766 68289 gene locus_tag LOCUS_37130 gene rpsA 66766 68289 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_37130 68574 69512 gene locus_tag LOCUS_37140 68574 69512 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976821.1 protein_id gnl|my_center|LOCUS_37140 69604 70239 gene locus_tag LOCUS_37150 gene coaE 69604 70239 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_37150 70317 70682 gene locus_tag LOCUS_37160 70317 70682 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976823.1 protein_id gnl|my_center|LOCUS_37160 71145 70651 gene locus_tag LOCUS_37170 71145 70651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 71196 71681 gene locus_tag LOCUS_37180 71196 71681 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028083.1 protein_id gnl|my_center|LOCUS_37180 71836 74940 gene locus_tag LOCUS_37190 71836 74940 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_37190 74937 76190 gene locus_tag LOCUS_37200 74937 76190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 76339 76354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 77415 76411 gene locus_tag LOCUS_37210 77415 76411 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031628.1 protein_id gnl|my_center|LOCUS_37210 77414 77677 gene locus_tag LOCUS_37220 77414 77677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 78050 79114 gene locus_tag LOCUS_37230 78050 79114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 79789 79256 gene locus_tag LOCUS_37240 79789 79256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484326.1 protein_id gnl|my_center|LOCUS_37240 80402 79842 gene locus_tag LOCUS_37250 80402 79842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 80527 81936 gene locus_tag LOCUS_37260 80527 81936 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028077.1 protein_id gnl|my_center|LOCUS_37260 82034 82675 gene locus_tag LOCUS_37270 82034 82675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976844.1 protein_id gnl|my_center|LOCUS_37270 83655 82687 gene locus_tag LOCUS_37280 83655 82687 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_37280 84560 83652 gene locus_tag LOCUS_37290 84560 83652 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_37290 85166 84645 gene locus_tag LOCUS_37300 85166 84645 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_37300 86168 85260 gene locus_tag LOCUS_37310 86168 85260 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_37310 86404 87324 gene locus_tag LOCUS_37320 86404 87324 CDS product MHYT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028070.1 protein_id gnl|my_center|LOCUS_37320 87365 89488 gene locus_tag LOCUS_37330 gene uvrB 87365 89488 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_37330 89625 90239 gene locus_tag LOCUS_37340 89625 90239 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976854.1 protein_id gnl|my_center|LOCUS_37340 90456 92504 gene locus_tag LOCUS_37350 90456 92504 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028068.1 protein_id gnl|my_center|LOCUS_37350 92803 93828 gene locus_tag LOCUS_37360 92803 93828 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_37360 94591 93935 gene locus_tag LOCUS_37370 94591 93935 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_37370 95288 94602 gene locus_tag LOCUS_37380 95288 94602 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_37380 95518 98532 gene locus_tag LOCUS_37390 gene uvrA 95518 98532 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_37390 98632 98883 gene locus_tag LOCUS_37400 98632 98883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 98906 100573 gene locus_tag LOCUS_37410 98906 100573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 100670 105316 gene locus_tag LOCUS_37420 100670 105316 CDS product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973240.1 protein_id gnl|my_center|LOCUS_37420 106229 105264 gene locus_tag LOCUS_37430 106229 105264 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_37430 106367 106795 gene locus_tag LOCUS_37440 106367 106795 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976864.1 protein_id gnl|my_center|LOCUS_37440 106880 108973 gene locus_tag LOCUS_37450 gene uvrC 106880 108973 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_37450 108999 109988 gene locus_tag LOCUS_37460 gene rapZ 108999 109988 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_37460 109985 111019 gene locus_tag LOCUS_37470 gene yvcK 109985 111019 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_37470 111010 111999 gene locus_tag LOCUS_37480 gene whiA 111010 111999 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_37480 112250 114577 gene locus_tag LOCUS_37490 112250 114577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 114616 114632 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 114791 115795 gene locus_tag LOCUS_37500 gene gap 114791 115795 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_37500 115954 117165 gene locus_tag LOCUS_37510 115954 117165 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_37510 117173 117973 gene locus_tag LOCUS_37520 gene tpiA 117173 117973 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_37520 118112 118348 gene locus_tag LOCUS_37530 gene secG 118112 118348 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_37530 118578 118865 gene locus_tag LOCUS_37540 118578 118865 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_37540 118977 120269 gene locus_tag LOCUS_37550 118977 120269 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222135.1 protein_id gnl|my_center|LOCUS_37550 120339 122018 gene locus_tag LOCUS_37560 gene pgi 120339 122018 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028056.1 protein_id gnl|my_center|LOCUS_37560 122023 122523 gene locus_tag LOCUS_37570 122023 122523 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_37570 122520 124037 gene locus_tag LOCUS_37580 122520 124037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 124044 124334 gene locus_tag LOCUS_37590 124044 124334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 125220 124438 gene locus_tag LOCUS_37600 gene pgl 125220 124438 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_37600 126233 125217 gene locus_tag LOCUS_37610 gene opcA 126233 125217 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_37610 127639 126230 gene locus_tag LOCUS_37620 gene zwf 127639 126230 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976881.1 protein_id gnl|my_center|LOCUS_37620 128885 127767 gene locus_tag LOCUS_37630 gene tal 128885 127767 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_37630 130998 128920 gene locus_tag LOCUS_37640 gene tkt 130998 128920 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976883.1 protein_id gnl|my_center|LOCUS_37640 131425 132282 gene locus_tag LOCUS_37650 131425 132282 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_37650 132312 132686 gene locus_tag LOCUS_37660 132312 132686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534985.1 protein_id gnl|my_center|LOCUS_37660 132779 133894 gene locus_tag LOCUS_37670 132779 133894 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028051.1 protein_id gnl|my_center|LOCUS_37670 134903 133926 gene locus_tag LOCUS_37680 134903 133926 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_37680 135754 134969 gene locus_tag LOCUS_37690 135754 134969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_37690 136662 135751 gene locus_tag LOCUS_37700 136662 135751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_37700 136782 137666 gene locus_tag LOCUS_37710 136782 137666 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_37710 137663 139084 gene locus_tag LOCUS_37720 gene sufB 137663 139084 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_37720 139154 140332 gene locus_tag LOCUS_37730 gene sufD 139154 140332 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_37730 140332 140649 gene locus_tag LOCUS_37740 140332 140649 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_37740 140657 141421 gene locus_tag LOCUS_37750 gene sufC 140657 141421 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_37750 141418 142692 gene locus_tag LOCUS_37760 141418 142692 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_37760 142704 143168 gene locus_tag LOCUS_37770 142704 143168 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976899.1 protein_id gnl|my_center|LOCUS_37770 143165 143503 gene locus_tag LOCUS_37780 143165 143503 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_37780 143666 144010 gene locus_tag LOCUS_37790 143666 144010 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976901.1 protein_id gnl|my_center|LOCUS_37790 144010 144612 gene locus_tag LOCUS_37800 144010 144612 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976902.1 protein_id gnl|my_center|LOCUS_37800 144756 145745 gene locus_tag LOCUS_37810 gene dapD 144756 145745 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_37810 145762 146490 gene locus_tag LOCUS_37820 145762 146490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 146504 147025 gene locus_tag LOCUS_37830 146504 147025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 147101 147820 gene locus_tag LOCUS_37840 147101 147820 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028043.1 protein_id gnl|my_center|LOCUS_37840 149776 147950 gene locus_tag LOCUS_37850 149776 147950 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976911.1 protein_id gnl|my_center|LOCUS_37850 149986 151524 gene locus_tag LOCUS_37860 149986 151524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 protein_id gnl|my_center|LOCUS_37860 152482 151715 gene locus_tag LOCUS_37870 gene fabG 152482 151715 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_37870 154953 152557 gene locus_tag LOCUS_37880 154953 152557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 157376 154950 gene locus_tag LOCUS_37890 157376 154950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 157737 159317 gene locus_tag LOCUS_37900 157737 159317 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976914.1 protein_id gnl|my_center|LOCUS_37900 159523 159660 gene locus_tag LOCUS_37910 159523 159660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 160994 159732 gene locus_tag LOCUS_37920 160994 159732 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 protein_id gnl|my_center|LOCUS_37920 161892 161068 gene locus_tag LOCUS_37930 161892 161068 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976923.1 protein_id gnl|my_center|LOCUS_37930 162166 163125 gene locus_tag LOCUS_37940 162166 163125 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976924.1 protein_id gnl|my_center|LOCUS_37940 163122 164306 gene locus_tag LOCUS_37950 163122 164306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028037.1 protein_id gnl|my_center|LOCUS_37950 163838 163749 gene locus_tag LOCUS_t00500 163838 163749 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 165515 164292 gene locus_tag LOCUS_37960 165515 164292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028035.1 protein_id gnl|my_center|LOCUS_37960 167012 165561 gene locus_tag LOCUS_37970 167012 165561 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976945.1 protein_id gnl|my_center|LOCUS_37970 167763 167110 gene locus_tag LOCUS_37980 167763 167110 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032008.1 protein_id gnl|my_center|LOCUS_37980 169133 167760 gene locus_tag LOCUS_37990 169133 167760 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224708.1 protein_id gnl|my_center|LOCUS_37990 170075 169362 gene locus_tag LOCUS_38000 170075 169362 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_38000 170283 171827 gene locus_tag LOCUS_38010 170283 171827 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_38010 172065 174074 gene locus_tag LOCUS_38020 172065 174074 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971555.1 protein_id gnl|my_center|LOCUS_38020 174173 174907 gene locus_tag LOCUS_38030 174173 174907 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976951.1 protein_id gnl|my_center|LOCUS_38030 174977 176026 gene locus_tag LOCUS_38040 174977 176026 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028020.1 protein_id gnl|my_center|LOCUS_38040 176993 176097 gene locus_tag LOCUS_38050 gene thpD 176993 176097 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976953.1 protein_id gnl|my_center|LOCUS_38050 177398 177000 gene locus_tag LOCUS_38060 177398 177000 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976954.1 protein_id gnl|my_center|LOCUS_38060 178781 177513 gene locus_tag LOCUS_38070 gene ectB 178781 177513 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976955.1 protein_id gnl|my_center|LOCUS_38070 179317 178841 gene locus_tag LOCUS_38080 gene ectA 179317 178841 CDS product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976956.1 protein_id gnl|my_center|LOCUS_38080 180829 179717 gene locus_tag LOCUS_38090 180829 179717 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537724.1 protein_id gnl|my_center|LOCUS_38090 180946 182037 gene locus_tag LOCUS_38100 180946 182037 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_38100 182426 182184 gene locus_tag LOCUS_38110 182426 182184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 182308 183213 gene locus_tag LOCUS_38120 182308 183213 CDS product SCO1860 family LAETG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486091.1 protein_id gnl|my_center|LOCUS_38120 184368 183277 gene locus_tag LOCUS_38130 gene cobC 184368 183277 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_38130 185302 184352 gene locus_tag LOCUS_38140 185302 184352 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_38140 185937 185299 gene locus_tag LOCUS_38150 185937 185299 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392611.1 protein_id gnl|my_center|LOCUS_38150 187658 185934 gene locus_tag LOCUS_38160 gene cobJ 187658 185934 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483898.1 protein_id gnl|my_center|LOCUS_38160 188938 187655 gene locus_tag LOCUS_38170 188938 187655 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868658.1 protein_id gnl|my_center|LOCUS_38170 189762 188935 gene locus_tag LOCUS_38180 gene cobM 189762 188935 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976965.1 protein_id gnl|my_center|LOCUS_38180 189855 190619 gene locus_tag LOCUS_38190 189855 190619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 191392 190637 gene locus_tag LOCUS_38200 gene cobI 191392 190637 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028010.1 protein_id gnl|my_center|LOCUS_38200 192900 191389 gene locus_tag LOCUS_38210 192900 191389 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 protein_id gnl|my_center|LOCUS_38210 193493 192894 gene locus_tag LOCUS_38220 gene cobO 193493 192894 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_38220 195550 193493 gene locus_tag LOCUS_38230 195550 193493 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_38230 199382 195651 gene locus_tag LOCUS_38240 gene cobN 199382 195651 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028008.1 protein_id gnl|my_center|LOCUS_38240 200941 199379 gene locus_tag LOCUS_38250 200941 199379 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_38250 201924 200938 gene locus_tag LOCUS_38260 201924 200938 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_38260 202812 202579 gene locus_tag LOCUS_38270 202812 202579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976975.1 protein_id gnl|my_center|LOCUS_38270 204131 202863 gene locus_tag LOCUS_38280 gene pitH 204131 202863 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976976.1 protein_id gnl|my_center|LOCUS_38280 204324 205136 gene locus_tag LOCUS_38290 204324 205136 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028005.1 protein_id gnl|my_center|LOCUS_38290 205271 206359 gene locus_tag LOCUS_38300 205271 206359 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_38300 206542 207975 gene locus_tag LOCUS_38310 206542 207975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976980.1 protein_id gnl|my_center|LOCUS_38310 208455 208054 gene locus_tag LOCUS_38320 208455 208054 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872956.1 protein_id gnl|my_center|LOCUS_38320 208691 210289 gene locus_tag LOCUS_38330 208691 210289 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_38330 210628 210846 gene locus_tag LOCUS_38340 210628 210846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 210977 211768 gene locus_tag LOCUS_38350 210977 211768 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_38350 212704 211976 gene locus_tag LOCUS_38360 212704 211976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028002.1 protein_id gnl|my_center|LOCUS_38360 212798 213280 gene locus_tag LOCUS_38370 212798 213280 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 protein_id gnl|my_center|LOCUS_38370 213316 213507 gene locus_tag LOCUS_38380 213316 213507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 213514 213858 gene locus_tag LOCUS_38390 213514 213858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976988.1 protein_id gnl|my_center|LOCUS_38390 213855 214550 gene locus_tag LOCUS_38400 213855 214550 CDS product DUF6286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486046.1 protein_id gnl|my_center|LOCUS_38400 214555 215133 gene locus_tag LOCUS_38410 gene amaP 214555 215133 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028000.1 protein_id gnl|my_center|LOCUS_38410 216000 215245 gene locus_tag LOCUS_38420 216000 215245 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_38420 217835 216006 gene locus_tag LOCUS_38430 217835 216006 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_38430 218653 217865 gene locus_tag LOCUS_38440 218653 217865 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_38440 219068 218772 gene locus_tag LOCUS_38450 219068 218772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_38450 220061 219069 gene locus_tag LOCUS_38460 220061 219069 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027997.1 protein_id gnl|my_center|LOCUS_38460 220264 221097 gene locus_tag LOCUS_38470 220264 221097 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_38470 221124 221756 gene locus_tag LOCUS_38480 221124 221756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 223338 221806 gene locus_tag LOCUS_38490 223338 221806 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_38490 223574 223945 gene locus_tag LOCUS_38500 223574 223945 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_38500 223942 225591 gene locus_tag LOCUS_38510 223942 225591 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_38510 225803 226792 gene locus_tag LOCUS_38520 gene moaA 225803 226792 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_38520 227032 226775 gene locus_tag LOCUS_38530 227032 226775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 227636 227262 gene locus_tag LOCUS_38540 227636 227262 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_38540 229095 227818 gene locus_tag LOCUS_38550 gene tyrS 229095 227818 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_38550 230559 229162 gene locus_tag LOCUS_38560 230559 229162 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_38560 232165 230642 gene locus_tag LOCUS_38570 232165 230642 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_38570 232356 233075 gene locus_tag LOCUS_38580 gene fabG 232356 233075 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_38580 233080 233850 gene locus_tag LOCUS_38590 gene fabI 233080 233850 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_38590 234001 234510 gene locus_tag LOCUS_38600 234001 234510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 235204 234530 gene locus_tag LOCUS_38610 235204 234530 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_38610 235309 236604 gene locus_tag LOCUS_38620 235309 236604 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486041.1 protein_id gnl|my_center|LOCUS_38620 236910 237116 gene locus_tag LOCUS_38630 236910 237116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 237202 237720 gene locus_tag LOCUS_38640 237202 237720 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_38640 239071 237836 gene locus_tag LOCUS_38650 gene serB 239071 237836 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_38650 239890 239318 gene locus_tag LOCUS_38660 239890 239318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 239930 241948 gene locus_tag LOCUS_38670 239930 241948 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_38670 242826 242077 gene locus_tag LOCUS_38680 242826 242077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 244241 243087 gene locus_tag LOCUS_38690 244241 243087 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027987.1 protein_id gnl|my_center|LOCUS_38690 244936 244238 gene locus_tag LOCUS_38700 244936 244238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027986.1 protein_id gnl|my_center|LOCUS_38700 245134 246279 gene locus_tag LOCUS_38710 245134 246279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 246272 246919 gene locus_tag LOCUS_38720 246272 246919 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_38720 247060 247305 gene locus_tag LOCUS_38730 gene chpE 247060 247305 CDS product chaplin ChpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977022.1 protein_id gnl|my_center|LOCUS_38730 248156 247395 gene locus_tag LOCUS_38740 248156 247395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_38740 248308 249099 gene locus_tag LOCUS_38750 248308 249099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_38750 249263 249691 gene locus_tag LOCUS_38760 249263 249691 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_38760 249838 250767 gene locus_tag LOCUS_38770 249838 250767 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_38770 250929 251696 gene locus_tag LOCUS_38780 250929 251696 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_38780 252324 251812 gene locus_tag LOCUS_38790 252324 251812 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977027.1 protein_id gnl|my_center|LOCUS_38790 253052 252513 gene locus_tag LOCUS_38800 253052 252513 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_38800 253920 253138 gene locus_tag LOCUS_38810 253920 253138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 253996 254637 gene locus_tag LOCUS_38820 253996 254637 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_38820 >Feature sequence12 532 1530 gene locus_tag LOCUS_38830 gene trpS 532 1530 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_38830 2498 1497 gene locus_tag LOCUS_38840 2498 1497 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975498.1 protein_id gnl|my_center|LOCUS_38840 2550 3170 gene locus_tag LOCUS_38850 2550 3170 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028916.1 protein_id gnl|my_center|LOCUS_38850 4007 3198 gene locus_tag LOCUS_38860 gene proC 4007 3198 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_38860 4937 4134 gene locus_tag LOCUS_38870 4937 4134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028918.1 protein_id gnl|my_center|LOCUS_38870 5704 4934 gene locus_tag LOCUS_38880 5704 4934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028919.1 protein_id gnl|my_center|LOCUS_38880 6880 5756 gene locus_tag LOCUS_38890 6880 5756 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189740062.1 protein_id gnl|my_center|LOCUS_38890 7798 6926 gene locus_tag LOCUS_38900 gene sigJ 7798 6926 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030761.1 protein_id gnl|my_center|LOCUS_38900 8644 7859 gene locus_tag LOCUS_38910 8644 7859 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028920.1 protein_id gnl|my_center|LOCUS_38910 9283 8714 gene locus_tag LOCUS_38920 9283 8714 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028921.1 protein_id gnl|my_center|LOCUS_38920 9705 9355 gene locus_tag LOCUS_38930 9705 9355 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326518.1 protein_id gnl|my_center|LOCUS_38930 9845 12064 gene locus_tag LOCUS_38940 9845 12064 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028924.1 protein_id gnl|my_center|LOCUS_38940 13959 12109 gene locus_tag LOCUS_38950 gene ilvD 13959 12109 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_38950 14739 14128 gene locus_tag LOCUS_38960 14739 14128 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_38960 15638 14736 gene locus_tag LOCUS_38970 15638 14736 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_38970 16718 15762 gene locus_tag LOCUS_38980 16718 15762 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_38980 16758 17603 gene locus_tag LOCUS_38990 16758 17603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_38990 19659 17737 gene locus_tag LOCUS_39000 19659 17737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172595308.1 protein_id gnl|my_center|LOCUS_39000 19813 21225 gene locus_tag LOCUS_39010 gene radA 19813 21225 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_39010 21270 22403 gene locus_tag LOCUS_39020 gene disA 21270 22403 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_39020 23385 22531 gene locus_tag LOCUS_39030 23385 22531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 protein_id gnl|my_center|LOCUS_39030 23570 24379 gene locus_tag LOCUS_39040 23570 24379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 24547 25467 gene locus_tag LOCUS_39050 24547 25467 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_39050 25799 26422 gene locus_tag LOCUS_39060 25799 26422 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975479.1 protein_id gnl|my_center|LOCUS_39060 26410 27237 gene locus_tag LOCUS_39070 26410 27237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 27257 27961 gene locus_tag LOCUS_39080 gene cseB 27257 27961 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_39080 27958 29271 gene locus_tag LOCUS_39090 27958 29271 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_39090 29854 29330 gene locus_tag LOCUS_39100 29854 29330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 30315 29857 gene locus_tag LOCUS_39110 30315 29857 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_39110 32065 30467 gene locus_tag LOCUS_39120 32065 30467 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028938.1 protein_id gnl|my_center|LOCUS_39120 32202 32780 gene locus_tag LOCUS_39130 32202 32780 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_39130 33426 32770 gene locus_tag LOCUS_39140 33426 32770 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028939.1 protein_id gnl|my_center|LOCUS_39140 36441 33976 gene locus_tag LOCUS_39150 36441 33976 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_39150 36957 37652 gene locus_tag LOCUS_39160 36957 37652 CDS product SCO3374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028943.1 protein_id gnl|my_center|LOCUS_39160 37966 37631 gene locus_tag LOCUS_39170 37966 37631 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_39170 38578 38111 gene locus_tag LOCUS_39180 38578 38111 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_39180 39232 38654 gene locus_tag LOCUS_39190 39232 38654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 39471 39292 gene locus_tag LOCUS_39200 39471 39292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028944.1 protein_id gnl|my_center|LOCUS_39200 40150 39485 gene locus_tag LOCUS_39210 40150 39485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185034146.1 protein_id gnl|my_center|LOCUS_39210 41091 40294 gene locus_tag LOCUS_39220 41091 40294 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_39220 42113 41091 gene locus_tag LOCUS_39230 gene nadC 42113 41091 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975452.1 protein_id gnl|my_center|LOCUS_39230 43906 42110 gene locus_tag LOCUS_39240 43906 42110 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028946.1 protein_id gnl|my_center|LOCUS_39240 44973 43903 gene locus_tag LOCUS_39250 gene panC 44973 43903 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_39250 45908 44970 gene locus_tag LOCUS_39260 45908 44970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 46064 47305 gene locus_tag LOCUS_39270 46064 47305 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_39270 47384 48475 gene locus_tag LOCUS_39280 47384 48475 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_39280 49111 48509 gene locus_tag LOCUS_39290 49111 48509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975445.1 protein_id gnl|my_center|LOCUS_39290 49788 49111 gene locus_tag LOCUS_39300 49788 49111 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_39300 50995 49850 gene locus_tag LOCUS_39310 50995 49850 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_39310 51152 52195 gene locus_tag LOCUS_39320 51152 52195 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_39320 52192 53343 gene locus_tag LOCUS_39330 52192 53343 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_39330 53534 54598 gene locus_tag LOCUS_39340 53534 54598 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032887275.1 protein_id gnl|my_center|LOCUS_39340 55799 54693 gene locus_tag LOCUS_39350 55799 54693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 56951 55977 gene locus_tag LOCUS_39360 56951 55977 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_39360 57838 57071 gene locus_tag LOCUS_39370 57838 57071 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092015.1 protein_id gnl|my_center|LOCUS_39370 58579 57842 gene locus_tag LOCUS_39380 58579 57842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 58723 59895 gene locus_tag LOCUS_39390 58723 59895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969992.1 protein_id gnl|my_center|LOCUS_39390 60034 60891 gene locus_tag LOCUS_39400 gene folP 60034 60891 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_39400 60888 61355 gene locus_tag LOCUS_39410 60888 61355 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_39410 61566 61925 gene locus_tag LOCUS_39420 gene folB 61566 61925 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_39420 61922 62518 gene locus_tag LOCUS_39430 gene folK 61922 62518 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_39430 62617 63147 gene locus_tag LOCUS_39440 62617 63147 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975431.1 protein_id gnl|my_center|LOCUS_39440 63790 63185 gene locus_tag LOCUS_39450 gene folE 63790 63185 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_39450 65928 63901 gene locus_tag LOCUS_39460 gene ftsH 65928 63901 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_39460 66684 66124 gene locus_tag LOCUS_39470 gene hpt 66684 66124 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_39470 67937 66753 gene locus_tag LOCUS_39480 gene tilS 67937 66753 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_39480 69202 68072 gene locus_tag LOCUS_39490 69202 68072 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_39490 70783 69281 gene locus_tag LOCUS_39500 gene dacB 70783 69281 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_39500 70972 71466 gene locus_tag LOCUS_39510 70972 71466 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_39510 71668 73335 gene locus_tag LOCUS_39520 71668 73335 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975423.1 protein_id gnl|my_center|LOCUS_39520 74229 73393 gene locus_tag LOCUS_39530 74229 73393 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028958.1 protein_id gnl|my_center|LOCUS_39530 75208 74450 gene locus_tag LOCUS_39540 75208 74450 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_39540 75207 76628 gene locus_tag LOCUS_39550 75207 76628 CDS product ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878151.1 protein_id gnl|my_center|LOCUS_39550 76802 78247 gene locus_tag LOCUS_39560 76802 78247 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028961.1 protein_id gnl|my_center|LOCUS_39560 79199 78411 gene locus_tag LOCUS_39570 79199 78411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975416.1 protein_id gnl|my_center|LOCUS_39570 80164 79196 gene locus_tag LOCUS_39580 80164 79196 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028963.1 protein_id gnl|my_center|LOCUS_39580 80923 80276 gene locus_tag LOCUS_39590 80923 80276 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 protein_id gnl|my_center|LOCUS_39590 80958 81698 gene locus_tag LOCUS_39600 80958 81698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 83179 81722 gene locus_tag LOCUS_39610 83179 81722 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028965.1 protein_id gnl|my_center|LOCUS_39610 84257 83394 gene locus_tag LOCUS_39620 84257 83394 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_39620 84633 85106 gene locus_tag LOCUS_39630 84633 85106 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_39630 85474 85217 gene locus_tag LOCUS_39640 85474 85217 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_39640 85721 86212 gene locus_tag LOCUS_39650 85721 86212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867772.1 protein_id gnl|my_center|LOCUS_39650 87517 86279 gene locus_tag LOCUS_39660 87517 86279 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_39660 87739 88305 gene locus_tag LOCUS_39670 87739 88305 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031718.1 protein_id gnl|my_center|LOCUS_39670 89268 88354 gene locus_tag LOCUS_39680 89268 88354 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223554.1 protein_id gnl|my_center|LOCUS_39680 89472 91163 gene locus_tag LOCUS_39690 89472 91163 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_39690 91397 91798 gene locus_tag LOCUS_39700 91397 91798 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_39700 93434 91869 gene locus_tag LOCUS_39710 93434 91869 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_39710 94096 96417 gene locus_tag LOCUS_39720 gene metE 94096 96417 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027494.1 protein_id gnl|my_center|LOCUS_39720 97127 96486 gene locus_tag LOCUS_39730 97127 96486 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_39730 99668 97230 gene locus_tag LOCUS_39740 99668 97230 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_39740 100459 99665 gene locus_tag LOCUS_39750 100459 99665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_39750 100980 100456 gene locus_tag LOCUS_39760 100980 100456 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_39760 101162 103777 gene locus_tag LOCUS_39770 101162 103777 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467386.1 protein_id gnl|my_center|LOCUS_39770 104240 104836 gene locus_tag LOCUS_39780 104240 104836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 105698 104895 gene locus_tag LOCUS_39790 105698 104895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 105880 106911 gene locus_tag LOCUS_39800 105880 106911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 107213 108937 gene locus_tag LOCUS_39810 107213 108937 CDS product lysyl oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031808.1 protein_id gnl|my_center|LOCUS_39810 109966 109034 gene locus_tag LOCUS_39820 109966 109034 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529557.1 protein_id gnl|my_center|LOCUS_39820 110075 110743 gene locus_tag LOCUS_39830 110075 110743 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224777.1 protein_id gnl|my_center|LOCUS_39830 110976 110902 gene locus_tag LOCUS_t00510 110976 110902 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 112620 111091 gene locus_tag LOCUS_39840 112620 111091 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_39840 113948 112743 gene locus_tag LOCUS_39850 113948 112743 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_39850 117523 114152 gene locus_tag LOCUS_39860 117523 114152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 120528 117646 gene locus_tag LOCUS_39870 gene topA 120528 117646 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_39870 121309 120935 gene locus_tag LOCUS_39880 121309 120935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 123141 121537 gene locus_tag LOCUS_39890 123141 121537 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_39890 123922 123350 gene locus_tag LOCUS_39900 123922 123350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975389.1 protein_id gnl|my_center|LOCUS_39900 126570 124162 gene locus_tag LOCUS_39910 126570 124162 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_39910 127340 126876 gene locus_tag LOCUS_39920 127340 126876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_39920 127798 127445 gene locus_tag LOCUS_39930 gene bldG 127798 127445 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_39930 128086 130461 gene locus_tag LOCUS_39940 128086 130461 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_39940 130735 130406 gene locus_tag LOCUS_39950 130735 130406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39950 131094 130759 gene locus_tag LOCUS_39960 131094 130759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 131479 131168 gene locus_tag LOCUS_39970 131479 131168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 132307 131504 gene locus_tag LOCUS_39980 132307 131504 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029081.1 protein_id gnl|my_center|LOCUS_39980 133248 132304 gene locus_tag LOCUS_39990 133248 132304 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867821.1 protein_id gnl|my_center|LOCUS_39990 134429 133248 gene locus_tag LOCUS_40000 134429 133248 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_40000 134977 134426 gene locus_tag LOCUS_40010 134977 134426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40010 135528 134890 gene locus_tag LOCUS_40020 135528 134890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40020 136111 136947 gene locus_tag LOCUS_40030 136111 136947 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_40030 138172 137327 gene locus_tag LOCUS_40040 138172 137327 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_40040 138365 139351 gene locus_tag LOCUS_40050 138365 139351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_40050 140846 139437 gene locus_tag LOCUS_40060 140846 139437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_40060 141145 143787 gene locus_tag LOCUS_40070 141145 143787 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029087.1 protein_id gnl|my_center|LOCUS_40070 143990 145945 gene locus_tag LOCUS_40080 gene acs 143990 145945 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_40080 146081 147496 gene locus_tag LOCUS_40090 gene nhaA 146081 147496 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_40090 147580 148080 gene locus_tag LOCUS_40100 147580 148080 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975371.1 protein_id gnl|my_center|LOCUS_40100 148077 149039 gene locus_tag LOCUS_40110 148077 149039 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_40110 150747 149548 gene locus_tag LOCUS_40120 150747 149548 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_40120 151546 150875 gene locus_tag LOCUS_40130 151546 150875 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_40130 152795 151848 gene locus_tag LOCUS_40140 152795 151848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 153109 153783 gene locus_tag LOCUS_40150 153109 153783 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_40150 154764 153919 gene locus_tag LOCUS_40160 154764 153919 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_40160 155630 154761 gene locus_tag LOCUS_40170 155630 154761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_40170 156241 155771 gene locus_tag LOCUS_40180 156241 155771 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_40180 156399 156238 gene locus_tag LOCUS_40190 156399 156238 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_40190 156517 157476 gene locus_tag LOCUS_40200 156517 157476 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_40200 157476 158777 gene locus_tag LOCUS_40210 157476 158777 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 protein_id gnl|my_center|LOCUS_40210 159366 158989 gene locus_tag LOCUS_40220 gene wblA 159366 158989 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_40220 160072 159782 gene locus_tag LOCUS_40230 160072 159782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 160468 162762 gene locus_tag LOCUS_40240 160468 162762 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_40240 163318 162851 gene locus_tag LOCUS_40250 163318 162851 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_40250 163427 164365 gene locus_tag LOCUS_40260 163427 164365 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 protein_id gnl|my_center|LOCUS_40260 164451 164525 gene locus_tag LOCUS_t00520 164451 164525 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 165548 165105 gene locus_tag LOCUS_40270 165548 165105 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029506.1 protein_id gnl|my_center|LOCUS_40270 166576 165836 gene locus_tag LOCUS_40280 gene phnF 166576 165836 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253458.1 protein_id gnl|my_center|LOCUS_40280 166632 167759 gene locus_tag LOCUS_40290 166632 167759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 168951 168295 gene locus_tag LOCUS_40300 168951 168295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 169814 169041 gene locus_tag LOCUS_40310 169814 169041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 169941 171236 gene locus_tag LOCUS_40320 gene dcm 169941 171236 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_40320 171233 172015 gene locus_tag LOCUS_40330 171233 172015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 172165 173724 gene locus_tag LOCUS_40340 172165 173724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 173717 174700 gene locus_tag LOCUS_40350 173717 174700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 174697 177540 gene locus_tag LOCUS_40360 174697 177540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 177969 178202 gene locus_tag LOCUS_40370 177969 178202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_40370 179849 178701 gene locus_tag LOCUS_40380 179849 178701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 180493 179954 gene locus_tag LOCUS_40390 180493 179954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 180755 180531 gene locus_tag LOCUS_40400 180755 180531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 181491 180829 gene locus_tag LOCUS_40410 181491 180829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 182642 181524 gene locus_tag LOCUS_40420 182642 181524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 182854 185130 gene locus_tag LOCUS_40430 182854 185130 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204072091.1 protein_id gnl|my_center|LOCUS_40430 185235 185999 gene locus_tag LOCUS_40440 185235 185999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 186725 186156 gene locus_tag LOCUS_40450 186725 186156 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227701.1 protein_id gnl|my_center|LOCUS_40450 186844 187026 gene locus_tag LOCUS_40460 186844 187026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971740.1 protein_id gnl|my_center|LOCUS_40460 188220 187063 gene locus_tag LOCUS_40470 188220 187063 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_40470 189145 188360 gene locus_tag LOCUS_40480 189145 188360 CDS product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 protein_id gnl|my_center|LOCUS_40480 189631 189272 gene locus_tag LOCUS_40490 189631 189272 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194678.1 protein_id gnl|my_center|LOCUS_40490 189768 190418 gene locus_tag LOCUS_40500 189768 190418 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229995.1 protein_id gnl|my_center|LOCUS_40500 191256 190357 gene locus_tag LOCUS_40510 191256 190357 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100327.1 protein_id gnl|my_center|LOCUS_40510 191379 191564 gene locus_tag LOCUS_40520 191379 191564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 191557 193389 gene locus_tag LOCUS_40530 191557 193389 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_40530 193490 194242 gene locus_tag LOCUS_40540 193490 194242 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943910.1 protein_id gnl|my_center|LOCUS_40540 195647 194340 gene locus_tag LOCUS_40550 195647 194340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 196219 195644 gene locus_tag LOCUS_40560 196219 195644 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_40560 197728 196670 gene locus_tag LOCUS_40570 197728 196670 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_40570 199025 197754 gene locus_tag LOCUS_40580 199025 197754 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_40580 199467 199303 gene locus_tag LOCUS_40590 199467 199303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 200518 199595 gene locus_tag LOCUS_40600 200518 199595 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976100.1 protein_id gnl|my_center|LOCUS_40600 201603 201025 gene locus_tag LOCUS_40610 201603 201025 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974892.1 protein_id gnl|my_center|LOCUS_40610 202715 201654 gene locus_tag LOCUS_40620 202715 201654 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029807.1 protein_id gnl|my_center|LOCUS_40620 203667 203095 gene locus_tag LOCUS_40630 203667 203095 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230395.1 protein_id gnl|my_center|LOCUS_40630 203760 204500 gene locus_tag LOCUS_40640 203760 204500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229704.1 protein_id gnl|my_center|LOCUS_40640 205196 204531 gene locus_tag LOCUS_40650 205196 204531 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_40650 205788 205189 gene locus_tag LOCUS_40660 gene recR 205788 205189 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_40660 206230 205895 gene locus_tag LOCUS_40670 206230 205895 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975320.1 protein_id gnl|my_center|LOCUS_40670 206525 207361 gene locus_tag LOCUS_40680 206525 207361 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029121.1 protein_id gnl|my_center|LOCUS_40680 208135 207467 gene locus_tag LOCUS_40690 208135 207467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975315.1 protein_id gnl|my_center|LOCUS_40690 210897 208300 gene locus_tag LOCUS_40700 210897 208300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 211586 210894 gene locus_tag LOCUS_40710 211586 210894 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777122.1 protein_id gnl|my_center|LOCUS_40710 213099 211720 gene locus_tag LOCUS_40720 213099 211720 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_40720 213288 213884 gene locus_tag LOCUS_40730 213288 213884 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_40730 213881 214360 gene locus_tag LOCUS_40740 213881 214360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 214565 216565 gene locus_tag LOCUS_40750 214565 216565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 217101 216619 gene locus_tag LOCUS_40760 217101 216619 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223826.1 protein_id gnl|my_center|LOCUS_40760 217209 217832 gene locus_tag LOCUS_40770 217209 217832 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284050.1 protein_id gnl|my_center|LOCUS_40770 217841 219052 gene locus_tag LOCUS_40780 217841 219052 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_40780 219345 220535 gene locus_tag LOCUS_40790 219345 220535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 222135 222421 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgtccgacccaccgttgtc 222522 222757 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgttgtcaccaccaccgtc 224091 223609 gene locus_tag LOCUS_40800 224091 223609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 224211 225047 gene locus_tag LOCUS_40810 224211 225047 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_40810 225044 225280 gene locus_tag LOCUS_40820 225044 225280 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_40820 226032 225325 gene locus_tag LOCUS_40830 226032 225325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 226887 226051 gene locus_tag LOCUS_40840 226887 226051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028330.1 protein_id gnl|my_center|LOCUS_40840 227188 228696 gene locus_tag LOCUS_40850 227188 228696 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028346.1 protein_id gnl|my_center|LOCUS_40850 229089 228727 gene locus_tag LOCUS_40860 229089 228727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 229715 229116 gene locus_tag LOCUS_40870 229715 229116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence13 100 210 gene locus_tag LOCUS_r00020 100 210 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 331 406 gene locus_tag LOCUS_t00530 331 406 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3063 451 gene locus_tag LOCUS_40880 3063 451 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973277.1 protein_id gnl|my_center|LOCUS_40880 3395 8944 gene locus_tag LOCUS_40890 3395 8944 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 protein_id gnl|my_center|LOCUS_40890 9225 9788 gene locus_tag LOCUS_40900 9225 9788 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_40900 9935 12802 gene locus_tag LOCUS_40910 9935 12802 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973274.1 protein_id gnl|my_center|LOCUS_40910 13012 13866 gene locus_tag LOCUS_40920 13012 13866 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_40920 14042 15592 gene locus_tag LOCUS_40930 gene rimO 14042 15592 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_40930 15589 16254 gene locus_tag LOCUS_40940 gene pgsA 15589 16254 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973271.1 protein_id gnl|my_center|LOCUS_40940 16251 16820 gene locus_tag LOCUS_40950 16251 16820 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_40950 16930 17313 gene locus_tag LOCUS_40960 16930 17313 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_40960 17548 18018 gene locus_tag LOCUS_40970 17548 18018 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_40970 18154 18537 gene locus_tag LOCUS_40980 18154 18537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 19250 18498 gene locus_tag LOCUS_40990 19250 18498 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_40990 24104 19413 gene locus_tag LOCUS_41000 24104 19413 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_41000 24001 25092 gene locus_tag LOCUS_41010 24001 25092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 25563 25117 gene locus_tag LOCUS_41020 25563 25117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41020 26278 25469 gene locus_tag LOCUS_41030 26278 25469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41030 26528 27535 gene locus_tag LOCUS_41040 26528 27535 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112815.1 protein_id gnl|my_center|LOCUS_41040 27558 28442 gene locus_tag LOCUS_41050 27558 28442 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_41050 28439 28750 gene locus_tag LOCUS_41060 28439 28750 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_41060 28859 29053 gene locus_tag LOCUS_41070 28859 29053 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_41070 29172 30335 gene locus_tag LOCUS_41080 29172 30335 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030441.1 protein_id gnl|my_center|LOCUS_41080 31015 30371 gene locus_tag LOCUS_41090 31015 30371 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_41090 32352 31015 gene locus_tag LOCUS_41100 32352 31015 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029800.1 protein_id gnl|my_center|LOCUS_41100 32551 33351 gene locus_tag LOCUS_41110 32551 33351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 protein_id gnl|my_center|LOCUS_41110 33345 35930 gene locus_tag LOCUS_41120 33345 35930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469742.1 protein_id gnl|my_center|LOCUS_41120 36009 36572 gene locus_tag LOCUS_41130 36009 36572 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803749.1 protein_id gnl|my_center|LOCUS_41130 36849 37988 gene locus_tag LOCUS_41140 gene recA 36849 37988 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_41140 37998 38582 gene locus_tag LOCUS_41150 37998 38582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41150 39112 38678 gene locus_tag LOCUS_41160 39112 38678 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 protein_id gnl|my_center|LOCUS_41160 39714 39109 gene locus_tag LOCUS_41170 39714 39109 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030444.1 protein_id gnl|my_center|LOCUS_41170 41620 39911 gene locus_tag LOCUS_41180 41620 39911 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189108986.1 protein_id gnl|my_center|LOCUS_41180 42737 41796 gene locus_tag LOCUS_41190 42737 41796 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_41190 43402 42734 gene locus_tag LOCUS_41200 43402 42734 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973248.1 protein_id gnl|my_center|LOCUS_41200 44342 43500 gene locus_tag LOCUS_41210 44342 43500 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030447.1 protein_id gnl|my_center|LOCUS_41210 45166 44381 gene locus_tag LOCUS_41220 45166 44381 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_41220 45418 46131 gene locus_tag LOCUS_41230 45418 46131 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_41230 46138 47565 gene locus_tag LOCUS_41240 46138 47565 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_41240 48582 47632 gene locus_tag LOCUS_41250 48582 47632 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030449.1 protein_id gnl|my_center|LOCUS_41250 49417 48914 gene locus_tag LOCUS_41260 49417 48914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 51349 49493 gene locus_tag LOCUS_41270 51349 49493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027064.1 protein_id gnl|my_center|LOCUS_41270 51736 53223 gene locus_tag LOCUS_41280 gene miaB 51736 53223 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_41280 53412 54113 gene locus_tag LOCUS_41290 53412 54113 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_41290 54484 54215 gene locus_tag LOCUS_41300 54484 54215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 54782 54534 gene locus_tag LOCUS_41310 54782 54534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 54964 55902 gene locus_tag LOCUS_41320 gene miaA 54964 55902 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_41320 55980 56447 gene locus_tag LOCUS_41330 55980 56447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327425.1 protein_id gnl|my_center|LOCUS_41330 56597 57523 gene locus_tag LOCUS_41340 gene dapF 56597 57523 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_41340 57684 59816 gene locus_tag LOCUS_41350 57684 59816 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030459.1 protein_id gnl|my_center|LOCUS_41350 59926 61371 gene locus_tag LOCUS_41360 59926 61371 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_41360 61607 63103 gene locus_tag LOCUS_41370 gene hflX 61607 63103 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_41370 64411 63242 gene locus_tag LOCUS_41380 64411 63242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030462.1 protein_id gnl|my_center|LOCUS_41380 66249 64609 gene locus_tag LOCUS_41390 66249 64609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 66315 68267 gene locus_tag LOCUS_41400 66315 68267 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 protein_id gnl|my_center|LOCUS_41400 68309 69067 gene locus_tag LOCUS_41410 68309 69067 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973221.1 protein_id gnl|my_center|LOCUS_41410 69128 71077 gene locus_tag LOCUS_41420 69128 71077 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904090.1 protein_id gnl|my_center|LOCUS_41420 71116 73086 gene locus_tag LOCUS_41430 71116 73086 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_41430 74025 73240 gene locus_tag LOCUS_41440 gene lexA 74025 73240 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_41440 74582 75091 gene locus_tag LOCUS_41450 gene nrdR 74582 75091 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_41450 75344 78238 gene locus_tag LOCUS_41460 75344 78238 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_41460 78493 79095 gene locus_tag LOCUS_41470 78493 79095 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_41470 79320 80069 gene locus_tag LOCUS_41480 79320 80069 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 protein_id gnl|my_center|LOCUS_41480 80160 81017 gene locus_tag LOCUS_41490 80160 81017 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_41490 81613 81086 gene locus_tag LOCUS_41500 81613 81086 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030468.1 protein_id gnl|my_center|LOCUS_41500 82721 81756 gene locus_tag LOCUS_41510 82721 81756 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641995.1 protein_id gnl|my_center|LOCUS_41510 82788 83393 gene locus_tag LOCUS_41520 82788 83393 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 protein_id gnl|my_center|LOCUS_41520 83508 84167 gene locus_tag LOCUS_41530 83508 84167 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973214.1 protein_id gnl|my_center|LOCUS_41530 84180 85097 gene locus_tag LOCUS_41540 84180 85097 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_41540 85361 87175 gene locus_tag LOCUS_41550 85361 87175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 88821 87268 gene locus_tag LOCUS_41560 88821 87268 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_41560 89017 89577 gene locus_tag LOCUS_41570 89017 89577 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896738.1 protein_id gnl|my_center|LOCUS_41570 89769 90479 gene locus_tag LOCUS_41580 89769 90479 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_41580 90634 91284 gene locus_tag LOCUS_41590 90634 91284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030472.1 protein_id gnl|my_center|LOCUS_41590 92023 91397 gene locus_tag LOCUS_41600 92023 91397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973208.1 protein_id gnl|my_center|LOCUS_41600 94424 92253 gene locus_tag LOCUS_41610 94424 92253 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_41610 94535 95920 gene locus_tag LOCUS_41620 94535 95920 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030474.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41620 96142 96939 gene locus_tag LOCUS_41630 96142 96939 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973205.1 protein_id gnl|my_center|LOCUS_41630 97139 98884 gene locus_tag LOCUS_41640 97139 98884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 99044 99931 gene locus_tag LOCUS_41650 gene whiH 99044 99931 CDS product sporulation transcriptional regulator WhiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030477.1 protein_id gnl|my_center|LOCUS_41650 100311 101858 gene locus_tag LOCUS_41660 100311 101858 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_41660 102004 102852 gene locus_tag LOCUS_41670 102004 102852 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973201.1 protein_id gnl|my_center|LOCUS_41670 103211 102981 gene locus_tag LOCUS_41680 103211 102981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_41680 103645 105771 gene locus_tag LOCUS_41690 103645 105771 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_41690 105886 107142 gene locus_tag LOCUS_41700 105886 107142 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030479.1 protein_id gnl|my_center|LOCUS_41700 107139 107807 gene locus_tag LOCUS_41710 107139 107807 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_41710 107904 108482 gene locus_tag LOCUS_41720 107904 108482 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030481.1 protein_id gnl|my_center|LOCUS_41720 108479 110137 gene locus_tag LOCUS_41730 108479 110137 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030482.1 protein_id gnl|my_center|LOCUS_41730 110831 110151 gene locus_tag LOCUS_41740 110831 110151 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_41740 112603 110828 gene locus_tag LOCUS_41750 112603 110828 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850856.1 protein_id gnl|my_center|LOCUS_41750 113108 112905 gene locus_tag LOCUS_41760 113108 112905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 113062 117183 gene locus_tag LOCUS_41770 113062 117183 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487683.1 protein_id gnl|my_center|LOCUS_41770 117353 118339 gene locus_tag LOCUS_41780 117353 118339 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_41780 118630 120051 gene locus_tag LOCUS_41790 118630 120051 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 protein_id gnl|my_center|LOCUS_41790 120178 121137 gene locus_tag LOCUS_41800 120178 121137 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_41800 121153 122082 gene locus_tag LOCUS_41810 121153 122082 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_41810 122201 123850 gene locus_tag LOCUS_41820 122201 123850 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972134.1 protein_id gnl|my_center|LOCUS_41820 124009 125745 gene locus_tag LOCUS_41830 124009 125745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 125854 126957 gene locus_tag LOCUS_41840 125854 126957 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030486.1 protein_id gnl|my_center|LOCUS_41840 129425 126975 gene locus_tag LOCUS_41850 129425 126975 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_41850 129745 131100 gene locus_tag LOCUS_41860 129745 131100 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_41860 131097 132485 gene locus_tag LOCUS_41870 131097 132485 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_41870 132869 133672 gene locus_tag LOCUS_41880 132869 133672 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030489.1 protein_id gnl|my_center|LOCUS_41880 134193 133912 gene locus_tag LOCUS_41890 134193 133912 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_41890 134327 137383 gene locus_tag LOCUS_41900 134327 137383 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030491.1 protein_id gnl|my_center|LOCUS_41900 137434 138030 gene locus_tag LOCUS_41910 137434 138030 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_41910 138030 139232 gene locus_tag LOCUS_41920 138030 139232 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_41920 139300 139944 gene locus_tag LOCUS_41930 139300 139944 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_41930 140794 140012 gene locus_tag LOCUS_41940 140794 140012 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973167.1 protein_id gnl|my_center|LOCUS_41940 141055 141891 gene locus_tag LOCUS_41950 141055 141891 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_41950 143023 141974 gene locus_tag LOCUS_41960 gene sepH 143023 141974 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_41960 143510 144388 gene locus_tag LOCUS_41970 143510 144388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030500.1 protein_id gnl|my_center|LOCUS_41970 145738 144401 gene locus_tag LOCUS_41980 145738 144401 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_41980 146945 145680 gene locus_tag LOCUS_41990 146945 145680 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_41990 147100 148227 gene locus_tag LOCUS_42000 147100 148227 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_42000 148386 149186 gene locus_tag LOCUS_42010 148386 149186 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_42010 149437 149264 gene locus_tag LOCUS_42020 149437 149264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 149795 150448 gene locus_tag LOCUS_42030 149795 150448 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_42030 150448 151695 gene locus_tag LOCUS_42040 150448 151695 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_42040 152087 152383 gene locus_tag LOCUS_42050 152087 152383 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_42050 152397 153314 gene locus_tag LOCUS_42060 152397 153314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030505.1 protein_id gnl|my_center|LOCUS_42060 153843 153355 gene locus_tag LOCUS_42070 153843 153355 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973155.1 protein_id gnl|my_center|LOCUS_42070 153902 154522 gene locus_tag LOCUS_42080 153902 154522 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_42080 154519 155034 gene locus_tag LOCUS_42090 gene dut 154519 155034 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_42090 155036 155833 gene locus_tag LOCUS_42100 155036 155833 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_42100 155944 156696 gene locus_tag LOCUS_42110 155944 156696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_42110 157098 159641 gene locus_tag LOCUS_42120 157098 159641 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_42120 159707 160393 gene locus_tag LOCUS_42130 159707 160393 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_42130 160427 160813 gene locus_tag LOCUS_42140 160427 160813 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_42140 160817 161569 gene locus_tag LOCUS_42150 160817 161569 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973147.1 protein_id gnl|my_center|LOCUS_42150 162737 162066 gene locus_tag LOCUS_42160 162737 162066 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_42160 163405 162737 gene locus_tag LOCUS_42170 163405 162737 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_42170 163699 164040 gene locus_tag LOCUS_42180 163699 164040 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109030614.1 protein_id gnl|my_center|LOCUS_42180 164037 164303 gene locus_tag LOCUS_42190 164037 164303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869150.1 protein_id gnl|my_center|LOCUS_42190 164477 166594 gene locus_tag LOCUS_42200 164477 166594 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030047.1 protein_id gnl|my_center|LOCUS_42200 166672 168765 gene locus_tag LOCUS_42210 166672 168765 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_42210 168869 170251 gene locus_tag LOCUS_42220 168869 170251 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_42220 170653 170261 gene locus_tag LOCUS_42230 170653 170261 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727730.1 protein_id gnl|my_center|LOCUS_42230 171931 170804 gene locus_tag LOCUS_42240 171931 170804 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 protein_id gnl|my_center|LOCUS_42240 172511 171921 gene locus_tag LOCUS_42250 172511 171921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 174082 172784 gene locus_tag LOCUS_42260 174082 172784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 175138 174827 gene locus_tag LOCUS_42270 175138 174827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 175020 175766 gene locus_tag LOCUS_42280 175020 175766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 175986 177002 gene locus_tag LOCUS_42290 175986 177002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 177094 177642 gene locus_tag LOCUS_42300 177094 177642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 177953 180418 gene locus_tag LOCUS_42310 177953 180418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 180405 182519 gene locus_tag LOCUS_42320 180405 182519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 182640 183488 gene locus_tag LOCUS_42330 182640 183488 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_42330 183534 184040 gene locus_tag LOCUS_42340 183534 184040 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229400.1 protein_id gnl|my_center|LOCUS_42340 184174 184479 gene locus_tag LOCUS_42350 184174 184479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 185796 184528 gene locus_tag LOCUS_42360 185796 184528 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_42360 186018 186581 gene locus_tag LOCUS_42370 186018 186581 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028548.1 protein_id gnl|my_center|LOCUS_42370 186739 187089 gene locus_tag LOCUS_42380 186739 187089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 187080 188213 gene locus_tag LOCUS_42390 187080 188213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 188206 189135 gene locus_tag LOCUS_42400 gene nuoH 188206 189135 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_42400 189190 189759 gene locus_tag LOCUS_42410 189190 189759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 189756 190061 gene locus_tag LOCUS_42420 gene nuoK 189756 190061 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_42420 190058 191929 gene locus_tag LOCUS_42430 190058 191929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 191935 193440 gene locus_tag LOCUS_42440 191935 193440 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257847.1 protein_id gnl|my_center|LOCUS_42440 193437 194870 gene locus_tag LOCUS_42450 193437 194870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 194970 195929 gene locus_tag LOCUS_42460 194970 195929 CDS product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028418.1 protein_id gnl|my_center|LOCUS_42460 196005 197366 gene locus_tag LOCUS_42470 196005 197366 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185933582.1 protein_id gnl|my_center|LOCUS_42470 197402 197908 gene locus_tag LOCUS_42480 197402 197908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 198021 198617 gene locus_tag LOCUS_42490 198021 198617 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 protein_id gnl|my_center|LOCUS_42490 199324 198749 gene locus_tag LOCUS_42500 199324 198749 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_42500 199659 199967 gene locus_tag LOCUS_42510 199659 199967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 200279 200025 gene locus_tag LOCUS_42520 200279 200025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 200295 200633 gene locus_tag LOCUS_42530 200295 200633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 200710 202017 gene locus_tag LOCUS_42540 200710 202017 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_42540 202017 202298 gene locus_tag LOCUS_42550 202017 202298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 202300 202752 gene locus_tag LOCUS_42560 202300 202752 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486580.1 protein_id gnl|my_center|LOCUS_42560 203752 202793 gene locus_tag LOCUS_42570 203752 202793 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980195.1 protein_id gnl|my_center|LOCUS_42570 204525 203842 gene locus_tag LOCUS_42580 204525 203842 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029545.1 protein_id gnl|my_center|LOCUS_42580 205396 204602 gene locus_tag LOCUS_42590 205396 204602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42590 205665 205333 gene locus_tag LOCUS_42600 205665 205333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42600 207228 205816 gene locus_tag LOCUS_42610 207228 205816 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029326.1 protein_id gnl|my_center|LOCUS_42610 207418 207645 gene locus_tag LOCUS_42620 207418 207645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 209174 207630 gene locus_tag LOCUS_42630 209174 207630 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031573.1 protein_id gnl|my_center|LOCUS_42630 210829 209171 gene locus_tag LOCUS_42640 210829 209171 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_42640 211272 213188 gene locus_tag LOCUS_42650 211272 213188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 214057 213410 gene locus_tag LOCUS_42660 214057 213410 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_42660 214197 215228 gene locus_tag LOCUS_42670 gene scbA 214197 215228 CDS product gamma-butyrolactone biosynthesis protein ScbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972659.1 protein_id gnl|my_center|LOCUS_42670 215353 215138 gene locus_tag LOCUS_42680 215353 215138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 215460 216488 gene locus_tag LOCUS_42690 215460 216488 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218938748.1 protein_id gnl|my_center|LOCUS_42690 217635 216454 gene locus_tag LOCUS_42700 217635 216454 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_42700 218182 218946 gene locus_tag LOCUS_42710 gene scbB 218182 218946 CDS product A-factor type gamma-butyrolactone 6-reductase ScbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030779.1 protein_id gnl|my_center|LOCUS_42710 219640 218924 gene locus_tag LOCUS_42720 219640 218924 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030795.1 protein_id gnl|my_center|LOCUS_42720 221022 219796 gene locus_tag LOCUS_42730 221022 219796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 221372 222151 gene locus_tag LOCUS_42740 221372 222151 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226773.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence14 385 834 gene locus_tag LOCUS_42750 385 834 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_42750 936 2606 gene locus_tag LOCUS_42760 gene ptsP 936 2606 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_42760 3627 2665 gene locus_tag LOCUS_42770 3627 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977433.1 protein_id gnl|my_center|LOCUS_42770 5691 3703 gene locus_tag LOCUS_42780 5691 3703 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 protein_id gnl|my_center|LOCUS_42780 6064 8283 gene locus_tag LOCUS_42790 6064 8283 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027761.1 protein_id gnl|my_center|LOCUS_42790 8872 8315 gene locus_tag LOCUS_42800 8872 8315 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 protein_id gnl|my_center|LOCUS_42800 8927 9793 gene locus_tag LOCUS_42810 8927 9793 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 protein_id gnl|my_center|LOCUS_42810 9941 10297 gene locus_tag LOCUS_42820 9941 10297 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_42820 11036 10428 gene locus_tag LOCUS_42830 11036 10428 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_42830 11412 11017 gene locus_tag LOCUS_42840 11412 11017 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_42840 11869 11423 gene locus_tag LOCUS_42850 11869 11423 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_42850 14781 11866 gene locus_tag LOCUS_42860 14781 11866 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027766.1 protein_id gnl|my_center|LOCUS_42860 15515 15105 gene locus_tag LOCUS_42870 15515 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 15397 15741 gene locus_tag LOCUS_42880 15397 15741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 20715 15832 gene locus_tag LOCUS_42890 20715 15832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224660.1 protein_id gnl|my_center|LOCUS_42890 21714 20800 gene locus_tag LOCUS_42900 21714 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027772.1 protein_id gnl|my_center|LOCUS_42900 23392 21848 gene locus_tag LOCUS_42910 23392 21848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977417.1 protein_id gnl|my_center|LOCUS_42910 27139 23513 gene locus_tag LOCUS_42920 27139 23513 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899883.1 protein_id gnl|my_center|LOCUS_42920 28146 27136 gene locus_tag LOCUS_42930 28146 27136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 29597 28143 gene locus_tag LOCUS_42940 29597 28143 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_42940 30823 29594 gene locus_tag LOCUS_42950 30823 29594 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_42950 32513 31095 gene locus_tag LOCUS_42960 32513 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977413.1 protein_id gnl|my_center|LOCUS_42960 33135 32719 gene locus_tag LOCUS_42970 33135 32719 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_42970 33389 33583 gene locus_tag LOCUS_42980 33389 33583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977410.1 protein_id gnl|my_center|LOCUS_42980 33630 35309 gene locus_tag LOCUS_42990 33630 35309 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027776.1 protein_id gnl|my_center|LOCUS_42990 36843 35335 gene locus_tag LOCUS_43000 36843 35335 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 protein_id gnl|my_center|LOCUS_43000 36948 37616 gene locus_tag LOCUS_43010 36948 37616 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_43010 37613 38377 gene locus_tag LOCUS_43020 37613 38377 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_43020 38424 39782 gene locus_tag LOCUS_43030 38424 39782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_43030 40037 40411 gene locus_tag LOCUS_43040 40037 40411 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_43040 40457 40468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 41135 40524 gene locus_tag LOCUS_43050 41135 40524 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977403.1 protein_id gnl|my_center|LOCUS_43050 41956 41189 gene locus_tag LOCUS_43060 41956 41189 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_43060 44148 42508 gene locus_tag LOCUS_43070 44148 42508 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_43070 44727 44266 gene locus_tag LOCUS_43080 44727 44266 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_43080 44910 45311 gene locus_tag LOCUS_43090 44910 45311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977399.1 protein_id gnl|my_center|LOCUS_43090 46632 45460 gene locus_tag LOCUS_43100 46632 45460 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_43100 47016 48260 gene locus_tag LOCUS_43110 47016 48260 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027783.1 protein_id gnl|my_center|LOCUS_43110 48983 48327 gene locus_tag LOCUS_43120 48983 48327 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977395.1 protein_id gnl|my_center|LOCUS_43120 50460 49096 gene locus_tag LOCUS_43130 50460 49096 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 protein_id gnl|my_center|LOCUS_43130 50698 51327 gene locus_tag LOCUS_43140 50698 51327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 51678 53594 gene locus_tag LOCUS_43150 51678 53594 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027787.1 protein_id gnl|my_center|LOCUS_43150 53750 54028 gene locus_tag LOCUS_43160 53750 54028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 54021 54524 gene locus_tag LOCUS_43170 54021 54524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43170 55381 54494 gene locus_tag LOCUS_43180 55381 54494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 56169 55381 gene locus_tag LOCUS_43190 56169 55381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975569.1 protein_id gnl|my_center|LOCUS_43190 56643 56317 gene locus_tag LOCUS_43200 56643 56317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43200 57007 56720 gene locus_tag LOCUS_43210 57007 56720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43210 57729 57004 gene locus_tag LOCUS_43220 57729 57004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 58937 57849 gene locus_tag LOCUS_43230 58937 57849 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 protein_id gnl|my_center|LOCUS_43230 60400 58934 gene locus_tag LOCUS_43240 60400 58934 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977389.1 protein_id gnl|my_center|LOCUS_43240 61158 60583 gene locus_tag LOCUS_43250 61158 60583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 62021 61173 gene locus_tag LOCUS_43260 gene hisG 62021 61173 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_43260 62431 62159 gene locus_tag LOCUS_43270 62431 62159 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 protein_id gnl|my_center|LOCUS_43270 62951 62466 gene locus_tag LOCUS_43280 gene ribH 62951 62466 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_43280 64342 63050 gene locus_tag LOCUS_43290 64342 63050 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_43290 65007 64339 gene locus_tag LOCUS_43300 65007 64339 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_43300 65621 65004 gene locus_tag LOCUS_43310 65621 65004 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_43310 66800 65622 gene locus_tag LOCUS_43320 gene ribD 66800 65622 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976111.1 protein_id gnl|my_center|LOCUS_43320 67260 68006 gene locus_tag LOCUS_43330 67260 68006 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_43330 69304 68120 gene locus_tag LOCUS_43340 69304 68120 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977378.1 protein_id gnl|my_center|LOCUS_43340 69436 70656 gene locus_tag LOCUS_43350 69436 70656 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_43350 72077 70731 gene locus_tag LOCUS_43360 72077 70731 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093953461.1 protein_id gnl|my_center|LOCUS_43360 72285 73685 gene locus_tag LOCUS_43370 72285 73685 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_43370 73740 74477 gene locus_tag LOCUS_43380 73740 74477 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 protein_id gnl|my_center|LOCUS_43380 76256 74535 gene locus_tag LOCUS_43390 76256 74535 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027792.1 protein_id gnl|my_center|LOCUS_43390 77149 76322 gene locus_tag LOCUS_43400 77149 76322 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_43400 77451 78041 gene locus_tag LOCUS_43410 77451 78041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 78577 78122 gene locus_tag LOCUS_43420 78577 78122 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_43420 78801 79811 gene locus_tag LOCUS_43430 78801 79811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 79885 80283 gene locus_tag LOCUS_43440 79885 80283 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027404.1 protein_id gnl|my_center|LOCUS_43440 81312 80440 gene locus_tag LOCUS_43450 81312 80440 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975743.1 protein_id gnl|my_center|LOCUS_43450 83014 81572 gene locus_tag LOCUS_43460 83014 81572 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_43460 84265 83240 gene locus_tag LOCUS_43470 84265 83240 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 protein_id gnl|my_center|LOCUS_43470 85073 84390 gene locus_tag LOCUS_43480 gene rpe 85073 84390 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_43480 85286 86878 gene locus_tag LOCUS_43490 85286 86878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 88518 87085 gene locus_tag LOCUS_43500 88518 87085 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_43500 89546 88590 gene locus_tag LOCUS_43510 gene fmt 89546 88590 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_43510 89841 90377 gene locus_tag LOCUS_43520 89841 90377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027806.1 protein_id gnl|my_center|LOCUS_43520 92655 90493 gene locus_tag LOCUS_43530 92655 90493 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_43530 93991 92783 gene locus_tag LOCUS_43540 gene metK 93991 92783 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_43540 95494 94250 gene locus_tag LOCUS_43550 gene coaBC 95494 94250 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_43550 95851 95579 gene locus_tag LOCUS_43560 gene rpoZ 95851 95579 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_43560 96495 95932 gene locus_tag LOCUS_43570 gene gmk 96495 95932 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_43570 96857 96534 gene locus_tag LOCUS_43580 96857 96534 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_43580 97999 97115 gene locus_tag LOCUS_43590 gene pyrF 97999 97115 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_43590 99105 97996 gene locus_tag LOCUS_43600 99105 97996 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_43600 99104 99352 gene locus_tag LOCUS_43610 99104 99352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 102688 99362 gene locus_tag LOCUS_43620 gene carB 102688 99362 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_43620 103847 102681 gene locus_tag LOCUS_43630 gene carA 103847 102681 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_43630 104521 103844 gene locus_tag LOCUS_43640 104521 103844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977341.1 protein_id gnl|my_center|LOCUS_43640 105804 104518 gene locus_tag LOCUS_43650 105804 104518 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_43650 106829 105807 gene locus_tag LOCUS_43660 106829 105807 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_43660 107542 106952 gene locus_tag LOCUS_43670 gene pyrR 107542 106952 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_43670 107760 108260 gene locus_tag LOCUS_43680 gene bldD 107760 108260 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_43680 109097 108666 gene locus_tag LOCUS_43690 gene nusB 109097 108666 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_43690 109666 109100 gene locus_tag LOCUS_43700 gene efp 109666 109100 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_43700 110860 109748 gene locus_tag LOCUS_43710 110860 109748 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977334.1 protein_id gnl|my_center|LOCUS_43710 111671 110988 gene locus_tag LOCUS_43720 111671 110988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 112614 112174 gene locus_tag LOCUS_43730 gene aroQ 112614 112174 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_43730 113711 112611 gene locus_tag LOCUS_43740 gene aroB 113711 112611 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_43740 114298 113708 gene locus_tag LOCUS_43750 114298 113708 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_43750 115470 114295 gene locus_tag LOCUS_43760 gene aroC 115470 114295 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_43760 116462 115617 gene locus_tag LOCUS_43770 116462 115617 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_43770 118383 116449 gene locus_tag LOCUS_43780 gene mltG 118383 116449 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977327.1 protein_id gnl|my_center|LOCUS_43780 119052 118576 gene locus_tag LOCUS_43790 gene ruvX 119052 118576 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_43790 121785 119116 gene locus_tag LOCUS_43800 gene alaS 121785 119116 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_43800 122162 121785 gene locus_tag LOCUS_43810 122162 121785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977324.1 protein_id gnl|my_center|LOCUS_43810 122634 122170 gene locus_tag LOCUS_43820 122634 122170 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_43820 122815 125136 gene locus_tag LOCUS_43830 122815 125136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_43830 125782 125168 gene locus_tag LOCUS_43840 gene rpsD 125782 125168 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_43840 126017 126643 gene locus_tag LOCUS_43850 126017 126643 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222102.1 protein_id gnl|my_center|LOCUS_43850 128054 126687 gene locus_tag LOCUS_43860 128054 126687 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_43860 128762 128127 gene locus_tag LOCUS_43870 128762 128127 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 protein_id gnl|my_center|LOCUS_43870 130217 128955 gene locus_tag LOCUS_43880 gene hisS 130217 128955 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_43880 130944 130231 gene locus_tag LOCUS_43890 130944 130231 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_43890 131124 131912 gene locus_tag LOCUS_43900 131124 131912 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_43900 132160 133389 gene locus_tag LOCUS_43910 132160 133389 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_43910 135849 133462 gene locus_tag LOCUS_43920 gene relA 135849 133462 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_43920 135752 136027 gene locus_tag LOCUS_43930 135752 136027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 136866 136321 gene locus_tag LOCUS_43940 136866 136321 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_43940 138002 136863 gene locus_tag LOCUS_43950 gene secF 138002 136863 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_43950 139782 138004 gene locus_tag LOCUS_43960 gene secD 139782 138004 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_43960 140445 139927 gene locus_tag LOCUS_43970 gene yajC 140445 139927 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027824.1 protein_id gnl|my_center|LOCUS_43970 141716 140610 gene locus_tag LOCUS_43980 gene ruvB 141716 140610 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_43980 142453 141827 gene locus_tag LOCUS_43990 gene ruvA 142453 141827 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_43990 143007 142450 gene locus_tag LOCUS_44000 gene ruvC 143007 142450 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_44000 143945 143193 gene locus_tag LOCUS_44010 143945 143193 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_44010 144613 144008 gene locus_tag LOCUS_44020 gene pdxT 144613 144008 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_44020 145517 144603 gene locus_tag LOCUS_44030 gene pdxS 145517 144603 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977304.1 protein_id gnl|my_center|LOCUS_44030 146200 145658 gene locus_tag LOCUS_44040 146200 145658 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_44040 147850 146687 gene locus_tag LOCUS_44050 147850 146687 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_44050 148800 147847 gene locus_tag LOCUS_44060 148800 147847 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_44060 149453 148797 gene locus_tag LOCUS_44070 149453 148797 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_44070 149717 151930 gene locus_tag LOCUS_44080 149717 151930 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027831.1 protein_id gnl|my_center|LOCUS_44080 152099 153754 gene locus_tag LOCUS_44090 152099 153754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027832.1 protein_id gnl|my_center|LOCUS_44090 154327 153761 gene locus_tag LOCUS_44100 154327 153761 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_44100 154394 155119 gene locus_tag LOCUS_44110 154394 155119 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270384.1 protein_id gnl|my_center|LOCUS_44110 157140 155158 gene locus_tag LOCUS_44120 gene thrS 157140 155158 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_44120 157334 158059 gene locus_tag LOCUS_44130 157334 158059 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977293.1 protein_id gnl|my_center|LOCUS_44130 158207 158134 gene locus_tag LOCUS_t00540 158207 158134 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 158702 158247 gene locus_tag LOCUS_44140 158702 158247 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_44140 158759 161263 gene locus_tag LOCUS_44150 158759 161263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031780.1 protein_id gnl|my_center|LOCUS_44150 161413 161340 gene locus_tag LOCUS_t00550 161413 161340 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 161843 161469 gene locus_tag LOCUS_44160 161843 161469 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027839.1 protein_id gnl|my_center|LOCUS_44160 162118 162531 gene locus_tag LOCUS_44170 162118 162531 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_44170 162731 163288 gene locus_tag LOCUS_44180 162731 163288 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_44180 163444 163292 gene locus_tag LOCUS_44190 163444 163292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 164034 163573 gene locus_tag LOCUS_44200 164034 163573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_44200 164240 164752 gene locus_tag LOCUS_44210 164240 164752 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325815.1 protein_id gnl|my_center|LOCUS_44210 165581 164793 gene locus_tag LOCUS_44220 165581 164793 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485797.1 protein_id gnl|my_center|LOCUS_44220 166496 165675 gene locus_tag LOCUS_44230 166496 165675 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_44230 167552 166497 gene locus_tag LOCUS_44240 167552 166497 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_44240 167733 167806 gene locus_tag LOCUS_t00560 167733 167806 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 167841 167914 gene locus_tag LOCUS_t00570 167841 167914 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 167916 167988 gene locus_tag LOCUS_t00580 167916 167988 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 168008 168080 gene locus_tag LOCUS_t00590 168008 168080 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 168103 168175 gene locus_tag LOCUS_t00600 168103 168175 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 168526 168230 gene locus_tag LOCUS_44250 168526 168230 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_44250 169608 168595 gene locus_tag LOCUS_44260 169608 168595 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_44260 170034 169828 gene locus_tag LOCUS_44270 170034 169828 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977275.1 protein_id gnl|my_center|LOCUS_44270 170481 170224 gene locus_tag LOCUS_44280 170481 170224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 170693 171958 gene locus_tag LOCUS_44290 170693 171958 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715246.1 protein_id gnl|my_center|LOCUS_44290 172800 171979 gene locus_tag LOCUS_44300 172800 171979 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_44300 174040 172793 gene locus_tag LOCUS_44310 gene cobA 174040 172793 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_44310 177912 174358 gene locus_tag LOCUS_44320 177912 174358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 179469 178249 gene locus_tag LOCUS_44330 gene cbiE 179469 178249 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977269.1 protein_id gnl|my_center|LOCUS_44330 180297 179647 gene locus_tag LOCUS_44340 180297 179647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 protein_id gnl|my_center|LOCUS_44340 181264 180404 gene locus_tag LOCUS_44350 181264 180404 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_44350 182027 181359 gene locus_tag LOCUS_44360 182027 181359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_44360 183124 182024 gene locus_tag LOCUS_44370 183124 182024 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_44370 183647 184105 gene locus_tag LOCUS_44380 183647 184105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 184108 184548 gene locus_tag LOCUS_44390 184108 184548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977262.1 protein_id gnl|my_center|LOCUS_44390 185067 184564 gene locus_tag LOCUS_44400 185067 184564 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977261.1 protein_id gnl|my_center|LOCUS_44400 186593 185427 gene locus_tag LOCUS_44410 186593 185427 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_44410 186830 187504 gene locus_tag LOCUS_44420 186830 187504 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_44420 188861 187578 gene locus_tag LOCUS_44430 188861 187578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 189526 188858 gene locus_tag LOCUS_44440 189526 188858 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225902.1 protein_id gnl|my_center|LOCUS_44440 190612 189710 gene locus_tag LOCUS_44450 190612 189710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 191576 190626 gene locus_tag LOCUS_44460 191576 190626 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 protein_id gnl|my_center|LOCUS_44460 192583 191573 gene locus_tag LOCUS_44470 192583 191573 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226780.1 protein_id gnl|my_center|LOCUS_44470 193629 192580 gene locus_tag LOCUS_44480 193629 192580 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_44480 193871 193626 gene locus_tag LOCUS_44490 193871 193626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44490 194729 193944 gene locus_tag LOCUS_44500 194729 193944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44500 195529 194753 gene locus_tag LOCUS_44510 195529 194753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44510 196101 195529 gene locus_tag LOCUS_44520 196101 195529 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_44520 196197 198416 gene locus_tag LOCUS_44530 196197 198416 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_44530 199907 198480 gene locus_tag LOCUS_44540 gene argH 199907 198480 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_44540 201195 200002 gene locus_tag LOCUS_44550 201195 200002 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_44550 201664 201257 gene locus_tag LOCUS_44560 201664 201257 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_44560 201731 202345 gene locus_tag LOCUS_44570 201731 202345 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_44570 202425 203168 gene locus_tag LOCUS_44580 202425 203168 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027855.1 protein_id gnl|my_center|LOCUS_44580 203798 203196 gene locus_tag LOCUS_44590 203798 203196 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_44590 205020 203806 gene locus_tag LOCUS_44600 205020 203806 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_44600 205955 205017 gene locus_tag LOCUS_44610 gene argB 205955 205017 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_44610 207121 205952 gene locus_tag LOCUS_44620 gene argJ 207121 205952 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_44620 208210 207182 gene locus_tag LOCUS_44630 gene argC 208210 207182 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_44630 208351 208929 gene locus_tag LOCUS_44640 208351 208929 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228802.1 protein_id gnl|my_center|LOCUS_44640 209374 208952 gene locus_tag LOCUS_44650 209374 208952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 209793 210077 gene locus_tag LOCUS_44660 209793 210077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44660 211066 210044 gene locus_tag LOCUS_44670 211066 210044 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894933.1 protein_id gnl|my_center|LOCUS_44670 211716 211063 gene locus_tag LOCUS_44680 211716 211063 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729106.1 protein_id gnl|my_center|LOCUS_44680 211895 212401 gene locus_tag LOCUS_44690 211895 212401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 213027 212452 gene locus_tag LOCUS_44700 213027 212452 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027864.1 protein_id gnl|my_center|LOCUS_44700 213556 213059 gene locus_tag LOCUS_44710 213556 213059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027865.1 protein_id gnl|my_center|LOCUS_44710 214903 213566 gene locus_tag LOCUS_44720 214903 213566 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_44720 215001 215897 gene locus_tag LOCUS_44730 215001 215897 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027867.1 protein_id gnl|my_center|LOCUS_44730 >Feature sequence15 1558 44 gene locus_tag LOCUS_44740 1558 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 2946 1555 gene locus_tag LOCUS_44750 2946 1555 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_44750 3743 2943 gene locus_tag LOCUS_44760 3743 2943 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031700.1 protein_id gnl|my_center|LOCUS_44760 4825 3755 gene locus_tag LOCUS_44770 4825 3755 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_44770 5036 6436 gene locus_tag LOCUS_44780 5036 6436 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_44780 6468 7481 gene locus_tag LOCUS_44790 6468 7481 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_44790 7481 8347 gene locus_tag LOCUS_44800 7481 8347 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 protein_id gnl|my_center|LOCUS_44800 8386 9582 gene locus_tag LOCUS_44810 8386 9582 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 protein_id gnl|my_center|LOCUS_44810 9617 10558 gene locus_tag LOCUS_44820 9617 10558 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535503.1 protein_id gnl|my_center|LOCUS_44820 10878 11576 gene locus_tag LOCUS_44830 10878 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 12376 13398 gene locus_tag LOCUS_44840 12376 13398 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031515.1 protein_id gnl|my_center|LOCUS_44840 15705 13618 gene locus_tag LOCUS_44850 15705 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 16190 16975 gene locus_tag LOCUS_44860 16190 16975 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943037.1 protein_id gnl|my_center|LOCUS_44860 17274 16939 gene locus_tag LOCUS_44870 17274 16939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 17967 18410 gene locus_tag LOCUS_44880 17967 18410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 20038 18812 gene locus_tag LOCUS_44890 20038 18812 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_44890 21267 22124 gene locus_tag LOCUS_44900 21267 22124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 22278 22487 gene locus_tag LOCUS_44910 22278 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 22550 22747 gene locus_tag LOCUS_44920 22550 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 22769 23023 gene locus_tag LOCUS_44930 22769 23023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 23441 24058 gene locus_tag LOCUS_44940 23441 24058 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977728.1 protein_id gnl|my_center|LOCUS_44940 25607 24108 gene locus_tag LOCUS_44950 25607 24108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_44950 25797 26471 gene locus_tag LOCUS_44960 25797 26471 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_44960 27189 26521 gene locus_tag LOCUS_44970 27189 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 27442 28836 gene locus_tag LOCUS_44980 27442 28836 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_44980 29029 29943 gene locus_tag LOCUS_44990 29029 29943 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487081.1 protein_id gnl|my_center|LOCUS_44990 30093 31181 gene locus_tag LOCUS_45000 30093 31181 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484633.1 protein_id gnl|my_center|LOCUS_45000 31225 31899 gene locus_tag LOCUS_45010 31225 31899 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027583.1 protein_id gnl|my_center|LOCUS_45010 31896 32900 gene locus_tag LOCUS_45020 31896 32900 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 protein_id gnl|my_center|LOCUS_45020 33083 33916 gene locus_tag LOCUS_45030 33083 33916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 protein_id gnl|my_center|LOCUS_45030 35106 34033 gene locus_tag LOCUS_45040 35106 34033 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_45040 35792 35289 gene locus_tag LOCUS_45050 35792 35289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 35871 36470 gene locus_tag LOCUS_45060 35871 36470 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026950.1 protein_id gnl|my_center|LOCUS_45060 36755 36462 gene locus_tag LOCUS_45070 36755 36462 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228474.1 protein_id gnl|my_center|LOCUS_45070 36782 37624 gene locus_tag LOCUS_45080 36782 37624 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_45080 38205 37726 gene locus_tag LOCUS_45090 38205 37726 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_45090 38802 38383 gene locus_tag LOCUS_45100 38802 38383 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977449.1 protein_id gnl|my_center|LOCUS_45100 39002 40153 gene locus_tag LOCUS_45110 gene efeO 39002 40153 CDS product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028244.1 protein_id gnl|my_center|LOCUS_45110 40164 41468 gene locus_tag LOCUS_45120 gene efeB 40164 41468 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028245.1 protein_id gnl|my_center|LOCUS_45120 41518 42504 gene locus_tag LOCUS_45130 41518 42504 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_45130 42830 42438 gene locus_tag LOCUS_45140 42830 42438 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_45140 42979 43959 gene locus_tag LOCUS_45150 42979 43959 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920427.1 protein_id gnl|my_center|LOCUS_45150 45702 43987 gene locus_tag LOCUS_45160 45702 43987 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528172.1 protein_id gnl|my_center|LOCUS_45160 45793 46806 gene locus_tag LOCUS_45170 45793 46806 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225254.1 protein_id gnl|my_center|LOCUS_45170 48393 46828 gene locus_tag LOCUS_45180 48393 46828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 49142 48567 gene locus_tag LOCUS_45190 49142 48567 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_45190 49339 49797 gene locus_tag LOCUS_45200 49339 49797 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971698.1 protein_id gnl|my_center|LOCUS_45200 49923 50591 gene locus_tag LOCUS_45210 49923 50591 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978174.1 protein_id gnl|my_center|LOCUS_45210 50588 51616 gene locus_tag LOCUS_45220 50588 51616 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027298.1 protein_id gnl|my_center|LOCUS_45220 51613 53712 gene locus_tag LOCUS_45230 51613 53712 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_45230 54470 53805 gene locus_tag LOCUS_45240 54470 53805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 55966 54467 gene locus_tag LOCUS_45250 55966 54467 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971914.1 protein_id gnl|my_center|LOCUS_45250 56646 55963 gene locus_tag LOCUS_45260 56646 55963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971915.1 protein_id gnl|my_center|LOCUS_45260 58378 56669 gene locus_tag LOCUS_45270 58378 56669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 59628 58375 gene locus_tag LOCUS_45280 gene femY 59628 58375 CDS product peptidoglycan bridge formation glycyltransferase FemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027237.1 protein_id gnl|my_center|LOCUS_45280 59866 61062 gene locus_tag LOCUS_45290 59866 61062 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_45290 61209 62711 gene locus_tag LOCUS_45300 61209 62711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919016.1 protein_id gnl|my_center|LOCUS_45300 64715 62775 gene locus_tag LOCUS_45310 64715 62775 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227746.1 protein_id gnl|my_center|LOCUS_45310 66226 64781 gene locus_tag LOCUS_45320 66226 64781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_45320 67161 66364 gene locus_tag LOCUS_45330 67161 66364 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_45330 68797 67301 gene locus_tag LOCUS_45340 68797 67301 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227742.1 protein_id gnl|my_center|LOCUS_45340 70373 68865 gene locus_tag LOCUS_45350 70373 68865 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227743.1 protein_id gnl|my_center|LOCUS_45350 70868 71569 gene locus_tag LOCUS_45360 70868 71569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 72586 71576 gene locus_tag LOCUS_45370 72586 71576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 73657 72758 gene locus_tag LOCUS_45380 73657 72758 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029227.1 protein_id gnl|my_center|LOCUS_45380 74616 73654 gene locus_tag LOCUS_45390 74616 73654 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029226.1 protein_id gnl|my_center|LOCUS_45390 74773 75744 gene locus_tag LOCUS_45400 gene bla 74773 75744 CDS product class A beta-lactamase Bla1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181667.1 protein_id gnl|my_center|LOCUS_45400 76492 75770 gene locus_tag LOCUS_45410 76492 75770 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 protein_id gnl|my_center|LOCUS_45410 77646 76504 gene locus_tag LOCUS_45420 gene hypE 77646 76504 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_45420 78746 77643 gene locus_tag LOCUS_45430 gene hypD 78746 77643 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_45430 79039 78743 gene locus_tag LOCUS_45440 79039 78743 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_45440 81665 79083 gene locus_tag LOCUS_45450 gene hypF 81665 79083 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 protein_id gnl|my_center|LOCUS_45450 82216 81668 gene locus_tag LOCUS_45460 82216 81668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 82429 82223 gene locus_tag LOCUS_45470 82429 82223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 82577 82458 gene locus_tag LOCUS_45480 82577 82458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 84076 82574 gene locus_tag LOCUS_45490 84076 82574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728540.1 protein_id gnl|my_center|LOCUS_45490 84765 84073 gene locus_tag LOCUS_45500 84765 84073 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728541.1 protein_id gnl|my_center|LOCUS_45500 85520 84762 gene locus_tag LOCUS_45510 85520 84762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45510 86509 85517 gene locus_tag LOCUS_45520 86509 85517 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894102.1 protein_id gnl|my_center|LOCUS_45520 88274 86502 gene locus_tag LOCUS_45530 88274 86502 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_45530 89441 88386 gene locus_tag LOCUS_45540 89441 88386 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728543.1 protein_id gnl|my_center|LOCUS_45540 89629 89958 gene locus_tag LOCUS_45550 89629 89958 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894106.1 protein_id gnl|my_center|LOCUS_45550 89962 90756 gene locus_tag LOCUS_45560 gene hypB 89962 90756 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_45560 93293 90786 gene locus_tag LOCUS_45570 93293 90786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 93683 94234 gene locus_tag LOCUS_45580 93683 94234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 94995 94654 gene locus_tag LOCUS_45590 94995 94654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45590 96097 95081 gene locus_tag LOCUS_45600 96097 95081 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972442.1 protein_id gnl|my_center|LOCUS_45600 96417 96190 gene locus_tag LOCUS_45610 96417 96190 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 protein_id gnl|my_center|LOCUS_45610 96829 97068 gene locus_tag LOCUS_45620 96829 97068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 97191 97949 gene locus_tag LOCUS_45630 97191 97949 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971784.1 protein_id gnl|my_center|LOCUS_45630 98771 97968 gene locus_tag LOCUS_45640 98771 97968 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027189.1 protein_id gnl|my_center|LOCUS_45640 98895 100319 gene locus_tag LOCUS_45650 98895 100319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027710.1 protein_id gnl|my_center|LOCUS_45650 100444 101697 gene locus_tag LOCUS_45660 100444 101697 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977524.1 protein_id gnl|my_center|LOCUS_45660 101694 102992 gene locus_tag LOCUS_45670 101694 102992 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495330.1 protein_id gnl|my_center|LOCUS_45670 105987 103222 gene locus_tag LOCUS_45680 105987 103222 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_45680 108878 105984 gene locus_tag LOCUS_45690 108878 105984 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226436.1 protein_id gnl|my_center|LOCUS_45690 109710 108889 gene locus_tag LOCUS_45700 109710 108889 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775955.1 protein_id gnl|my_center|LOCUS_45700 110678 109707 gene locus_tag LOCUS_45710 110678 109707 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_45710 111964 110675 gene locus_tag LOCUS_45720 111964 110675 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775953.1 protein_id gnl|my_center|LOCUS_45720 113180 112179 gene locus_tag LOCUS_45730 113180 112179 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947192.1 protein_id gnl|my_center|LOCUS_45730 113442 115679 gene locus_tag LOCUS_45740 113442 115679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 116719 115727 gene locus_tag LOCUS_45750 gene gap 116719 115727 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971634.1 protein_id gnl|my_center|LOCUS_45750 117910 116831 gene locus_tag LOCUS_45760 117910 116831 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031713.1 protein_id gnl|my_center|LOCUS_45760 117966 118217 gene locus_tag LOCUS_45770 117966 118217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 118231 119184 gene locus_tag LOCUS_45780 118231 119184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229013.1 protein_id gnl|my_center|LOCUS_45780 119625 119203 gene locus_tag LOCUS_45790 119625 119203 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_45790 119728 120813 gene locus_tag LOCUS_45800 119728 120813 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_45800 121720 120893 gene locus_tag LOCUS_45810 gene mltG 121720 120893 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027606.1 protein_id gnl|my_center|LOCUS_45810 123706 121823 gene locus_tag LOCUS_45820 123706 121823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_45820 123849 124304 gene locus_tag LOCUS_45830 123849 124304 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027607.1 protein_id gnl|my_center|LOCUS_45830 124534 126039 gene locus_tag LOCUS_45840 124534 126039 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027183.1 protein_id gnl|my_center|LOCUS_45840 126200 128110 gene locus_tag LOCUS_45850 126200 128110 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030253.1 protein_id gnl|my_center|LOCUS_45850 128107 129897 gene locus_tag LOCUS_45860 128107 129897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_45860 130070 133336 gene locus_tag LOCUS_45870 130070 133336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 134174 133383 gene locus_tag LOCUS_45880 134174 133383 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_45880 134342 136864 gene locus_tag LOCUS_45890 134342 136864 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_45890 136904 137776 gene locus_tag LOCUS_45900 136904 137776 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027614.1 protein_id gnl|my_center|LOCUS_45900 137828 138316 gene locus_tag LOCUS_45910 137828 138316 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223545.1 protein_id gnl|my_center|LOCUS_45910 138511 139032 gene locus_tag LOCUS_45920 138511 139032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 140297 139053 gene locus_tag LOCUS_45930 140297 139053 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_45930 140451 141095 gene locus_tag LOCUS_45940 140451 141095 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_45940 141666 141130 gene locus_tag LOCUS_45950 gene def 141666 141130 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325677.1 protein_id gnl|my_center|LOCUS_45950 141941 143218 gene locus_tag LOCUS_45960 141941 143218 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225276.1 protein_id gnl|my_center|LOCUS_45960 143224 144513 gene locus_tag LOCUS_45970 143224 144513 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043786697.1 protein_id gnl|my_center|LOCUS_45970 144530 145504 gene locus_tag LOCUS_45980 144530 145504 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225177.1 protein_id gnl|my_center|LOCUS_45980 145501 146328 gene locus_tag LOCUS_45990 145501 146328 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225176.1 protein_id gnl|my_center|LOCUS_45990 146394 147863 gene locus_tag LOCUS_46000 146394 147863 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_46000 147860 149065 gene locus_tag LOCUS_46010 gene nagA 147860 149065 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_46010 149046 149333 gene locus_tag LOCUS_46020 149046 149333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 149433 150671 gene locus_tag LOCUS_46030 149433 150671 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_46030 150677 151432 gene locus_tag LOCUS_46040 150677 151432 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_46040 151571 152596 gene locus_tag LOCUS_46050 151571 152596 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977617.1 protein_id gnl|my_center|LOCUS_46050 152747 153697 gene locus_tag LOCUS_46060 152747 153697 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_46060 153765 153929 gene locus_tag LOCUS_46070 153765 153929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 154402 153974 gene locus_tag LOCUS_46080 154402 153974 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896562.1 protein_id gnl|my_center|LOCUS_46080 154549 155520 gene locus_tag LOCUS_46090 154549 155520 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204065824.1 protein_id gnl|my_center|LOCUS_46090 156001 155528 gene locus_tag LOCUS_46100 156001 155528 CDS product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889078.1 protein_id gnl|my_center|LOCUS_46100 156075 156581 gene locus_tag LOCUS_46110 156075 156581 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_46110 156639 156803 gene locus_tag LOCUS_46120 gene rpmG 156639 156803 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_46120 158050 156890 gene locus_tag LOCUS_46130 158050 156890 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228114.1 protein_id gnl|my_center|LOCUS_46130 158336 158115 gene locus_tag LOCUS_46140 158336 158115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 158853 158458 gene locus_tag LOCUS_46150 158853 158458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971466.1 protein_id gnl|my_center|LOCUS_46150 159362 158964 gene locus_tag LOCUS_46160 159362 158964 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031820.1 protein_id gnl|my_center|LOCUS_46160 159967 159401 gene locus_tag LOCUS_46170 159967 159401 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971468.1 protein_id gnl|my_center|LOCUS_46170 160767 160156 gene locus_tag LOCUS_46180 160767 160156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973985.1 protein_id gnl|my_center|LOCUS_46180 161494 162300 gene locus_tag LOCUS_46190 161494 162300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 162647 165499 gene locus_tag LOCUS_46200 162647 165499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 165716 184867 gene locus_tag LOCUS_46210 165716 184867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 184905 188036 gene locus_tag LOCUS_46220 184905 188036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 189335 188244 gene locus_tag LOCUS_46230 gene thiO 189335 188244 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_46230 191419 189332 gene locus_tag LOCUS_46240 191419 189332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 192014 191451 gene locus_tag LOCUS_46250 gene fcoT 192014 191451 CDS product fatty acyl CoA thioesterase FcoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899810.1 protein_id gnl|my_center|LOCUS_46250 202585 192011 gene locus_tag LOCUS_46260 202585 192011 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222551.1 protein_id gnl|my_center|LOCUS_46260 204230 202632 gene locus_tag LOCUS_46270 204230 202632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 204457 205398 gene locus_tag LOCUS_46280 204457 205398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 205651 205415 gene locus_tag LOCUS_46290 205651 205415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 205769 207283 gene locus_tag LOCUS_46300 205769 207283 CDS product D-alanine--poly(phosphoribitol) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225537.1 protein_id gnl|my_center|LOCUS_46300 207862 207266 gene locus_tag LOCUS_46310 207862 207266 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_46310 208126 207935 gene locus_tag LOCUS_46320 208126 207935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 208038 209528 gene locus_tag LOCUS_46330 208038 209528 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870095.1 protein_id gnl|my_center|LOCUS_46330 210875 209640 gene locus_tag LOCUS_46340 210875 209640 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966466.1 protein_id gnl|my_center|LOCUS_46340 <214052 210924 gene locus_tag LOCUS_46350 <214052 210924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030787.1:type I polyketide synthase >Feature sequence16 1566 559 gene locus_tag LOCUS_46360 1566 559 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975791.1 protein_id gnl|my_center|LOCUS_46360 1686 2633 gene locus_tag LOCUS_46370 1686 2633 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975790.1 protein_id gnl|my_center|LOCUS_46370 3360 2668 gene locus_tag LOCUS_46380 3360 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975789.1 protein_id gnl|my_center|LOCUS_46380 4926 3469 gene locus_tag LOCUS_46390 gene ahcY 4926 3469 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_46390 6360 5293 gene locus_tag LOCUS_46400 6360 5293 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_46400 7629 6460 gene locus_tag LOCUS_46410 gene manA 7629 6460 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_46410 8881 7745 gene locus_tag LOCUS_46420 8881 7745 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_46420 9160 8978 gene locus_tag LOCUS_46430 9160 8978 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_46430 10727 9369 gene locus_tag LOCUS_46440 10727 9369 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_46440 12438 10822 gene locus_tag LOCUS_46450 12438 10822 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 protein_id gnl|my_center|LOCUS_46450 13107 12679 gene locus_tag LOCUS_46460 13107 12679 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_46460 13449 13808 gene locus_tag LOCUS_46470 13449 13808 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_46470 15457 13838 gene locus_tag LOCUS_46480 15457 13838 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_46480 19242 15454 gene locus_tag LOCUS_46490 19242 15454 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_46490 19784 19521 gene locus_tag LOCUS_46500 19784 19521 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_46500 20426 20926 gene locus_tag LOCUS_46510 20426 20926 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 protein_id gnl|my_center|LOCUS_46510 20910 21908 gene locus_tag LOCUS_46520 gene cofD 20910 21908 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_46520 21935 23230 gene locus_tag LOCUS_46530 21935 23230 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_46530 24192 23257 gene locus_tag LOCUS_46540 24192 23257 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_46540 26351 25269 gene locus_tag LOCUS_46550 26351 25269 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_46550 27683 26415 gene locus_tag LOCUS_46560 27683 26415 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028730.1 protein_id gnl|my_center|LOCUS_46560 27821 28585 gene locus_tag LOCUS_46570 27821 28585 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_46570 28765 30153 gene locus_tag LOCUS_46580 28765 30153 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028731.1 protein_id gnl|my_center|LOCUS_46580 30378 32264 gene locus_tag LOCUS_46590 30378 32264 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486660.1 protein_id gnl|my_center|LOCUS_46590 32348 34096 gene locus_tag LOCUS_46600 32348 34096 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486662.1 protein_id gnl|my_center|LOCUS_46600 35259 34228 gene locus_tag LOCUS_46610 35259 34228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 35448 37025 gene locus_tag LOCUS_46620 35448 37025 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_46620 37607 37050 gene locus_tag LOCUS_46630 37607 37050 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_46630 37817 38995 gene locus_tag LOCUS_46640 37817 38995 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284299.1 protein_id gnl|my_center|LOCUS_46640 40234 39062 gene locus_tag LOCUS_46650 40234 39062 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_46650 40464 41810 gene locus_tag LOCUS_46660 40464 41810 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_46660 43089 41890 gene locus_tag LOCUS_46670 43089 41890 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028741.1 protein_id gnl|my_center|LOCUS_46670 44424 43231 gene locus_tag LOCUS_46680 44424 43231 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_46680 44956 44432 gene locus_tag LOCUS_46690 gene purE 44956 44432 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_46690 46092 44953 gene locus_tag LOCUS_46700 46092 44953 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_46700 46070 46741 gene locus_tag LOCUS_46710 46070 46741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 47999 46734 gene locus_tag LOCUS_46720 gene draK 47999 46734 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_46720 48747 48070 gene locus_tag LOCUS_46730 48747 48070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_46730 49008 50561 gene locus_tag LOCUS_46740 49008 50561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_46740 51165 50677 gene locus_tag LOCUS_46750 51165 50677 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028746.1 protein_id gnl|my_center|LOCUS_46750 51725 51357 gene locus_tag LOCUS_46760 51725 51357 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_46760 52054 52959 gene locus_tag LOCUS_46770 52054 52959 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975743.1 protein_id gnl|my_center|LOCUS_46770 53164 54366 gene locus_tag LOCUS_46780 53164 54366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 54386 56512 gene locus_tag LOCUS_46790 54386 56512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 56590 56775 gene locus_tag LOCUS_46800 56590 56775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978025.1 protein_id gnl|my_center|LOCUS_46800 56789 57481 gene locus_tag LOCUS_46810 56789 57481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027379.1 protein_id gnl|my_center|LOCUS_46810 57478 58485 gene locus_tag LOCUS_46820 57478 58485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027378.1 protein_id gnl|my_center|LOCUS_46820 58482 59426 gene locus_tag LOCUS_46830 58482 59426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978028.1 protein_id gnl|my_center|LOCUS_46830 59423 60499 gene locus_tag LOCUS_46840 59423 60499 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978029.1 protein_id gnl|my_center|LOCUS_46840 61600 60518 gene locus_tag LOCUS_46850 61600 60518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 61980 61600 gene locus_tag LOCUS_46860 61980 61600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 63893 61977 gene locus_tag LOCUS_46870 63893 61977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 64843 64043 gene locus_tag LOCUS_46880 64843 64043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 66186 64840 gene locus_tag LOCUS_46890 66186 64840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 67481 66246 gene locus_tag LOCUS_46900 67481 66246 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_46900 67847 69337 gene locus_tag LOCUS_46910 67847 69337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 69334 69792 gene locus_tag LOCUS_46920 69334 69792 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977672.1 protein_id gnl|my_center|LOCUS_46920 69789 70148 gene locus_tag LOCUS_46930 69789 70148 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 protein_id gnl|my_center|LOCUS_46930 70126 70836 gene locus_tag LOCUS_46940 70126 70836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 70850 72178 gene locus_tag LOCUS_46950 70850 72178 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027221.1 protein_id gnl|my_center|LOCUS_46950 72190 73464 gene locus_tag LOCUS_46960 72190 73464 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031650.1 protein_id gnl|my_center|LOCUS_46960 73623 74891 gene locus_tag LOCUS_46970 73623 74891 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027355.1 protein_id gnl|my_center|LOCUS_46970 76232 74979 gene locus_tag LOCUS_46980 gene hutI 76232 74979 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_46980 77617 76250 gene locus_tag LOCUS_46990 77617 76250 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_46990 78951 77608 gene locus_tag LOCUS_47000 78951 77608 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_47000 80540 78948 gene locus_tag LOCUS_47010 80540 78948 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_47010 80738 82174 gene locus_tag LOCUS_47020 80738 82174 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 protein_id gnl|my_center|LOCUS_47020 82311 83711 gene locus_tag LOCUS_47030 82311 83711 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777010.1 protein_id gnl|my_center|LOCUS_47030 83981 84391 gene locus_tag LOCUS_47040 83981 84391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027293.1 protein_id gnl|my_center|LOCUS_47040 84388 85191 gene locus_tag LOCUS_47050 84388 85191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978179.1 protein_id gnl|my_center|LOCUS_47050 85188 85700 gene locus_tag LOCUS_47060 85188 85700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47060 85764 86138 gene locus_tag LOCUS_47070 85764 86138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_47070 86856 86107 gene locus_tag LOCUS_47080 86856 86107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028752.1 protein_id gnl|my_center|LOCUS_47080 87769 86933 gene locus_tag LOCUS_47090 87769 86933 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 protein_id gnl|my_center|LOCUS_47090 89364 87766 gene locus_tag LOCUS_47100 89364 87766 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224336.1 protein_id gnl|my_center|LOCUS_47100 89639 90064 gene locus_tag LOCUS_47110 89639 90064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469765.1 protein_id gnl|my_center|LOCUS_47110 91837 90440 gene locus_tag LOCUS_47120 91837 90440 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_47120 92009 93022 gene locus_tag LOCUS_47130 92009 93022 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_47130 93210 94427 gene locus_tag LOCUS_47140 93210 94427 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_47140 94825 95907 gene locus_tag LOCUS_47150 94825 95907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 96235 95891 gene locus_tag LOCUS_47160 96235 95891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975730.1 protein_id gnl|my_center|LOCUS_47160 96338 96568 gene locus_tag LOCUS_47170 96338 96568 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975729.1 protein_id gnl|my_center|LOCUS_47170 97544 96663 gene locus_tag LOCUS_47180 97544 96663 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_47180 98073 97989 gene locus_tag LOCUS_t00610 98073 97989 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 98501 99271 gene locus_tag LOCUS_47190 98501 99271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_47190 99470 102010 gene locus_tag LOCUS_47200 99470 102010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_47200 103431 102139 gene locus_tag LOCUS_47210 103431 102139 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_47210 105058 103703 gene locus_tag LOCUS_47220 105058 103703 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_47220 106505 105579 gene locus_tag LOCUS_47230 106505 105579 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_47230 107101 106502 gene locus_tag LOCUS_47240 107101 106502 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_47240 107599 107126 gene locus_tag LOCUS_47250 gene divIC 107599 107126 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_47250 109035 107755 gene locus_tag LOCUS_47260 gene eno 109035 107755 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_47260 110039 109356 gene locus_tag LOCUS_47270 gene rpfA 110039 109356 CDS product resuscitation-promoting factor protein RpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028764.1 protein_id gnl|my_center|LOCUS_47270 111431 110478 gene locus_tag LOCUS_47280 gene rpfC 111431 110478 CDS product resuscitation-promoting factor protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028765.1 protein_id gnl|my_center|LOCUS_47280 112825 111572 gene locus_tag LOCUS_47290 112825 111572 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_47290 113641 112952 gene locus_tag LOCUS_47300 113641 112952 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974527.1 protein_id gnl|my_center|LOCUS_47300 113753 114310 gene locus_tag LOCUS_47310 113753 114310 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225840.1 protein_id gnl|my_center|LOCUS_47310 115290 114307 gene locus_tag LOCUS_47320 115290 114307 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_47320 115984 115325 gene locus_tag LOCUS_47330 115984 115325 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_47330 116520 116071 gene locus_tag LOCUS_47340 116520 116071 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974096.1 protein_id gnl|my_center|LOCUS_47340 116705 116517 gene locus_tag LOCUS_47350 116705 116517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 118009 116780 gene locus_tag LOCUS_47360 118009 116780 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029853.1 protein_id gnl|my_center|LOCUS_47360 118177 120003 gene locus_tag LOCUS_47370 118177 120003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 121515 119947 gene locus_tag LOCUS_47380 gene pkaE 121515 119947 CDS product serine/threonine protein kinase PkaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028766.1 protein_id gnl|my_center|LOCUS_47380 122168 121512 gene locus_tag LOCUS_47390 122168 121512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028767.1 protein_id gnl|my_center|LOCUS_47390 123031 122285 gene locus_tag LOCUS_47400 123031 122285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971044.1 protein_id gnl|my_center|LOCUS_47400 123915 123103 gene locus_tag LOCUS_47410 123915 123103 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_47410 127463 123912 gene locus_tag LOCUS_47420 gene mfd 127463 123912 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_47420 127383 127712 gene locus_tag LOCUS_47430 127383 127712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 128045 129040 gene locus_tag LOCUS_47440 128045 129040 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107451924.1 protein_id gnl|my_center|LOCUS_47440 129378 129097 gene locus_tag LOCUS_47450 129378 129097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 130679 129381 gene locus_tag LOCUS_47460 130679 129381 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224442.1 protein_id gnl|my_center|LOCUS_47460 130886 131062 gene locus_tag LOCUS_47470 130886 131062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 133174 131186 gene locus_tag LOCUS_47480 133174 131186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 134007 133171 gene locus_tag LOCUS_47490 134007 133171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 135011 134088 gene locus_tag LOCUS_47500 135011 134088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_47500 136195 135071 gene locus_tag LOCUS_47510 136195 135071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 137232 136192 gene locus_tag LOCUS_47520 137232 136192 CDS product thiopeptide-type bacteriocin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 protein_id gnl|my_center|LOCUS_47520 140063 137229 gene locus_tag LOCUS_47530 140063 137229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 141718 140093 gene locus_tag LOCUS_47540 141718 140093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 143694 141745 gene locus_tag LOCUS_47550 143694 141745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 146023 143684 gene locus_tag LOCUS_47560 146023 143684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 147834 146029 gene locus_tag LOCUS_47570 147834 146029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47570 148129 147845 gene locus_tag LOCUS_47580 148129 147845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 150953 148377 gene locus_tag LOCUS_47590 150953 148377 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_47590 151738 150950 gene locus_tag LOCUS_47600 151738 150950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_47600 152255 153889 gene locus_tag LOCUS_47610 152255 153889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 154796 153906 gene locus_tag LOCUS_47620 154796 153906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028777.1 protein_id gnl|my_center|LOCUS_47620 157451 155055 gene locus_tag LOCUS_47630 157451 155055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47630 158434 157457 gene locus_tag LOCUS_47640 158434 157457 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028779.1 protein_id gnl|my_center|LOCUS_47640 158697 159317 gene locus_tag LOCUS_47650 158697 159317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 159325 159813 gene locus_tag LOCUS_47660 159325 159813 CDS product SUKH-3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975695.1 protein_id gnl|my_center|LOCUS_47660 161184 159835 gene locus_tag LOCUS_47670 161184 159835 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975694.1 protein_id gnl|my_center|LOCUS_47670 161361 161435 gene locus_tag LOCUS_t00620 161361 161435 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 161552 163000 gene locus_tag LOCUS_47680 gene glmU 161552 163000 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_47680 163111 164088 gene locus_tag LOCUS_47690 163111 164088 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_47690 164311 164901 gene locus_tag LOCUS_47700 164311 164901 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_47700 165022 165618 gene locus_tag LOCUS_47710 gene pth 165022 165618 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_47710 165716 166186 gene locus_tag LOCUS_47720 165716 166186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028783.1 protein_id gnl|my_center|LOCUS_47720 169088 166293 gene locus_tag LOCUS_47730 gene ppc 169088 166293 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_47730 169288 169085 gene locus_tag LOCUS_47740 169288 169085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 169313 170323 gene locus_tag LOCUS_47750 169313 170323 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_47750 170320 171012 gene locus_tag LOCUS_47760 170320 171012 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_47760 172052 171183 gene locus_tag LOCUS_47770 172052 171183 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_47770 172092 172682 gene locus_tag LOCUS_47780 gene tamR 172092 172682 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_47780 173482 172712 gene locus_tag LOCUS_47790 173482 172712 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_47790 173740 174183 gene locus_tag LOCUS_47800 173740 174183 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975678.1 protein_id gnl|my_center|LOCUS_47800 175359 174199 gene locus_tag LOCUS_47810 gene galK 175359 174199 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_47810 176324 175356 gene locus_tag LOCUS_47820 gene galE 176324 175356 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_47820 177367 176321 gene locus_tag LOCUS_47830 gene galT 177367 176321 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 protein_id gnl|my_center|LOCUS_47830 177587 179269 gene locus_tag LOCUS_47840 177587 179269 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_47840 179289 179585 gene locus_tag LOCUS_47850 179289 179585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975673.1 protein_id gnl|my_center|LOCUS_47850 180341 179619 gene locus_tag LOCUS_47860 180341 179619 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028791.1 protein_id gnl|my_center|LOCUS_47860 182472 180658 gene locus_tag LOCUS_47870 182472 180658 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486695.1 protein_id gnl|my_center|LOCUS_47870 184378 182570 gene locus_tag LOCUS_47880 184378 182570 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456319.1 protein_id gnl|my_center|LOCUS_47880 186456 184636 gene locus_tag LOCUS_47890 186456 184636 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_47890 186722 187186 gene locus_tag LOCUS_47900 186722 187186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 187372 188511 gene locus_tag LOCUS_47910 187372 188511 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_47910 188847 189047 gene locus_tag LOCUS_47920 188847 189047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 189168 189575 gene locus_tag LOCUS_47930 189168 189575 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_47930 189584 190747 gene locus_tag LOCUS_47940 189584 190747 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_47940 191389 190838 gene locus_tag LOCUS_47950 191389 190838 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031866.1 protein_id gnl|my_center|LOCUS_47950 191826 191425 gene locus_tag LOCUS_47960 191826 191425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 192589 191831 gene locus_tag LOCUS_47970 192589 191831 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971606.1 protein_id gnl|my_center|LOCUS_47970 192840 195068 gene locus_tag LOCUS_47980 192840 195068 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_47980 195827 195138 gene locus_tag LOCUS_47990 195827 195138 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_47990 195940 196476 gene locus_tag LOCUS_48000 195940 196476 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_48000 197427 196522 gene locus_tag LOCUS_48010 197427 196522 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_48010 198293 197424 gene locus_tag LOCUS_48020 gene rsmA 198293 197424 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_48020 199633 198290 gene locus_tag LOCUS_48030 gene rpfB 199633 198290 CDS product resuscitation-promoting factor protein RpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405187.1 protein_id gnl|my_center|LOCUS_48030 200679 199795 gene locus_tag LOCUS_48040 200679 199795 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_48040 201254 200775 gene locus_tag LOCUS_48050 201254 200775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028797.1 protein_id gnl|my_center|LOCUS_48050 202298 201384 gene locus_tag LOCUS_48060 gene rsmI 202298 201384 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_48060 202566 204185 gene locus_tag LOCUS_48070 202566 204185 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_48070 204343 205992 gene locus_tag LOCUS_48080 204343 205992 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010985034.1 protein_id gnl|my_center|LOCUS_48080 >Feature sequence17 <1 4130 gene locus_tag LOCUS_48090 <1 4130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase 4127 6730 gene locus_tag LOCUS_48100 4127 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 6762 7523 gene locus_tag LOCUS_48110 6762 7523 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_48110 7554 8834 gene locus_tag LOCUS_48120 7554 8834 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973676.1 protein_id gnl|my_center|LOCUS_48120 8831 9064 gene locus_tag LOCUS_48130 8831 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 9992 9132 gene locus_tag LOCUS_48140 9992 9132 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096460324.1 protein_id gnl|my_center|LOCUS_48140 10801 10055 gene locus_tag LOCUS_48150 10801 10055 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228658.1 protein_id gnl|my_center|LOCUS_48150 11562 10858 gene locus_tag LOCUS_48160 11562 10858 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_48160 11449 11895 gene locus_tag LOCUS_48170 11449 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 12148 11921 gene locus_tag LOCUS_48180 12148 11921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 12972 12238 gene locus_tag LOCUS_48190 12972 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 13718 13326 gene locus_tag LOCUS_48200 13718 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 14122 14751 gene locus_tag LOCUS_48210 14122 14751 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 protein_id gnl|my_center|LOCUS_48210 15279 14851 gene locus_tag LOCUS_48220 15279 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 15851 15600 gene locus_tag LOCUS_48230 15851 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 16139 15927 gene locus_tag LOCUS_48240 16139 15927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 16171 16554 gene locus_tag LOCUS_48250 16171 16554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 16943 16737 gene locus_tag LOCUS_48260 16943 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 17242 16958 gene locus_tag LOCUS_48270 17242 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 17319 17792 gene locus_tag LOCUS_48280 17319 17792 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 protein_id gnl|my_center|LOCUS_48280 18076 20523 gene locus_tag LOCUS_48290 18076 20523 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668834.1 protein_id gnl|my_center|LOCUS_48290 20658 23129 gene locus_tag LOCUS_48300 20658 23129 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485626.1 protein_id gnl|my_center|LOCUS_48300 23175 23903 gene locus_tag LOCUS_48310 23175 23903 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030956.1 protein_id gnl|my_center|LOCUS_48310 23985 24818 gene locus_tag LOCUS_48320 23985 24818 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030957.1 protein_id gnl|my_center|LOCUS_48320 24811 26172 gene locus_tag LOCUS_48330 24811 26172 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_48330 26184 28205 gene locus_tag LOCUS_48340 26184 28205 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_48340 28202 29170 gene locus_tag LOCUS_48350 28202 29170 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_48350 29219 29797 gene locus_tag LOCUS_48360 29219 29797 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030960.1 protein_id gnl|my_center|LOCUS_48360 30125 29778 gene locus_tag LOCUS_48370 30125 29778 CDS product DUF6204 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972487.1 protein_id gnl|my_center|LOCUS_48370 30193 31089 gene locus_tag LOCUS_48380 30193 31089 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970130.1 protein_id gnl|my_center|LOCUS_48380 31198 33210 gene locus_tag LOCUS_48390 31198 33210 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_48390 33648 33289 gene locus_tag LOCUS_48400 33648 33289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972485.1 protein_id gnl|my_center|LOCUS_48400 34516 33707 gene locus_tag LOCUS_48410 34516 33707 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_48410 35244 34606 gene locus_tag LOCUS_48420 35244 34606 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_48420 36743 35241 gene locus_tag LOCUS_48430 36743 35241 CDS product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030974.1 protein_id gnl|my_center|LOCUS_48430 35509 35414 gene locus_tag LOCUS_t00630 35509 35414 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 36848 37420 gene locus_tag LOCUS_48440 36848 37420 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_48440 37472 38695 gene locus_tag LOCUS_48450 37472 38695 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_48450 38785 39870 gene locus_tag LOCUS_48460 38785 39870 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_48460 40578 39850 gene locus_tag LOCUS_48470 40578 39850 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030986.1 protein_id gnl|my_center|LOCUS_48470 41363 40575 gene locus_tag LOCUS_48480 41363 40575 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_48480 41615 42019 gene locus_tag LOCUS_48490 41615 42019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030988.1 protein_id gnl|my_center|LOCUS_48490 42140 44263 gene locus_tag LOCUS_48500 42140 44263 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030989.1 protein_id gnl|my_center|LOCUS_48500 44536 44901 gene locus_tag LOCUS_48510 44536 44901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 44984 45145 gene locus_tag LOCUS_48520 44984 45145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 46198 45206 gene locus_tag LOCUS_48530 46198 45206 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030996.1 protein_id gnl|my_center|LOCUS_48530 46261 48105 gene locus_tag LOCUS_48540 46261 48105 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_48540 48190 48723 gene locus_tag LOCUS_48550 48190 48723 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_48550 48881 49159 gene locus_tag LOCUS_48560 48881 49159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 49167 49520 gene locus_tag LOCUS_48570 49167 49520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48570 49421 49711 gene locus_tag LOCUS_48580 49421 49711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48580 50507 49887 gene locus_tag LOCUS_48590 50507 49887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 50779 52236 gene locus_tag LOCUS_48600 50779 52236 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_48600 52226 53206 gene locus_tag LOCUS_48610 52226 53206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 53350 54669 gene locus_tag LOCUS_48620 53350 54669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48620 54674 54976 gene locus_tag LOCUS_48630 54674 54976 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972439.1 protein_id gnl|my_center|LOCUS_48630 55052 55993 gene locus_tag LOCUS_48640 55052 55993 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_48640 56975 56136 gene locus_tag LOCUS_48650 56975 56136 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_48650 58886 57063 gene locus_tag LOCUS_48660 58886 57063 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972428.1 protein_id gnl|my_center|LOCUS_48660 60134 59205 gene locus_tag LOCUS_48670 60134 59205 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972425.1 protein_id gnl|my_center|LOCUS_48670 60278 61396 gene locus_tag LOCUS_48680 60278 61396 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972424.1 protein_id gnl|my_center|LOCUS_48680 62394 61555 gene locus_tag LOCUS_48690 gene fdhD 62394 61555 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_48690 63308 62451 gene locus_tag LOCUS_48700 63308 62451 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972421.1 protein_id gnl|my_center|LOCUS_48700 65368 63305 gene locus_tag LOCUS_48710 65368 63305 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327774.1 protein_id gnl|my_center|LOCUS_48710 67333 65375 gene locus_tag LOCUS_48720 67333 65375 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972418.1 protein_id gnl|my_center|LOCUS_48720 68461 67490 gene locus_tag LOCUS_48730 68461 67490 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031008.1 protein_id gnl|my_center|LOCUS_48730 68655 70031 gene locus_tag LOCUS_48740 68655 70031 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972416.1 protein_id gnl|my_center|LOCUS_48740 70338 71285 gene locus_tag LOCUS_48750 70338 71285 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_48750 71409 72062 gene locus_tag LOCUS_48760 71409 72062 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972414.1 protein_id gnl|my_center|LOCUS_48760 72373 73506 gene locus_tag LOCUS_48770 72373 73506 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_48770 73726 75258 gene locus_tag LOCUS_48780 73726 75258 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_48780 75255 76328 gene locus_tag LOCUS_48790 75255 76328 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972411.1 protein_id gnl|my_center|LOCUS_48790 76408 77442 gene locus_tag LOCUS_48800 76408 77442 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972410.1 protein_id gnl|my_center|LOCUS_48800 77617 78843 gene locus_tag LOCUS_48810 77617 78843 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_48810 78856 79860 gene locus_tag LOCUS_48820 78856 79860 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972408.1 protein_id gnl|my_center|LOCUS_48820 80495 80001 gene locus_tag LOCUS_48830 80495 80001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 80376 83897 gene locus_tag LOCUS_48840 80376 83897 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031012.1 protein_id gnl|my_center|LOCUS_48840 84212 87847 gene locus_tag LOCUS_48850 84212 87847 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031012.1 protein_id gnl|my_center|LOCUS_48850 87975 89102 gene locus_tag LOCUS_48860 87975 89102 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031013.1 protein_id gnl|my_center|LOCUS_48860 89099 90541 gene locus_tag LOCUS_48870 89099 90541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 90538 91383 gene locus_tag LOCUS_48880 90538 91383 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031015.1 protein_id gnl|my_center|LOCUS_48880 91380 91976 gene locus_tag LOCUS_48890 91380 91976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 91976 92824 gene locus_tag LOCUS_48900 91976 92824 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031017.1 protein_id gnl|my_center|LOCUS_48900 92828 93997 gene locus_tag LOCUS_48910 gene eboE 92828 93997 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_48910 93994 95421 gene locus_tag LOCUS_48920 93994 95421 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_48920 95439 96506 gene locus_tag LOCUS_48930 95439 96506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48930 97988 96600 gene locus_tag LOCUS_48940 97988 96600 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327784.1 protein_id gnl|my_center|LOCUS_48940 100317 98170 gene locus_tag LOCUS_48950 100317 98170 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031021.1 protein_id gnl|my_center|LOCUS_48950 101591 100317 gene locus_tag LOCUS_48960 gene frc 101591 100317 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972395.1 protein_id gnl|my_center|LOCUS_48960 103285 101603 gene locus_tag LOCUS_48970 103285 101603 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_48970 103466 104605 gene locus_tag LOCUS_48980 gene sucC 103466 104605 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031022.1 protein_id gnl|my_center|LOCUS_48980 104650 105537 gene locus_tag LOCUS_48990 gene sucD 104650 105537 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031023.1 protein_id gnl|my_center|LOCUS_48990 105868 107409 gene locus_tag LOCUS_49000 105868 107409 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067284407.1 protein_id gnl|my_center|LOCUS_49000 107557 107952 gene locus_tag LOCUS_49010 107557 107952 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_49010 108012 108425 gene locus_tag LOCUS_49020 108012 108425 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_49020 108664 108751 gene locus_tag LOCUS_t00640 108664 108751 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 108953 109909 gene locus_tag LOCUS_49030 108953 109909 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031375.1 protein_id gnl|my_center|LOCUS_49030 111131 109839 gene locus_tag LOCUS_49040 111131 109839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 112714 111128 gene locus_tag LOCUS_49050 112714 111128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 116162 112701 gene locus_tag LOCUS_49060 116162 112701 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031394.1 protein_id gnl|my_center|LOCUS_49060 118622 116391 gene locus_tag LOCUS_49070 118622 116391 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518812.1 protein_id gnl|my_center|LOCUS_49070 119880 118753 gene locus_tag LOCUS_49080 119880 118753 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225151.1 protein_id gnl|my_center|LOCUS_49080 121425 120145 gene locus_tag LOCUS_49090 gene aldO 121425 120145 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_49090 124497 121573 gene locus_tag LOCUS_49100 124497 121573 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027334.1 protein_id gnl|my_center|LOCUS_49100 126643 124499 gene locus_tag LOCUS_49110 126643 124499 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027333.1 protein_id gnl|my_center|LOCUS_49110 127626 126820 gene locus_tag LOCUS_49120 127626 126820 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978107.1 protein_id gnl|my_center|LOCUS_49120 128002 127775 gene locus_tag LOCUS_49130 128002 127775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978108.1 protein_id gnl|my_center|LOCUS_49130 128303 128794 gene locus_tag LOCUS_49140 128303 128794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 128819 129028 gene locus_tag LOCUS_49150 128819 129028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 129315 130088 gene locus_tag LOCUS_49160 129315 130088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 130097 132742 gene locus_tag LOCUS_49170 130097 132742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 132735 132998 gene locus_tag LOCUS_49180 132735 132998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 132995 134281 gene locus_tag LOCUS_49190 132995 134281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 135285 134278 gene locus_tag LOCUS_49200 135285 134278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229181.1 protein_id gnl|my_center|LOCUS_49200 135436 137001 gene locus_tag LOCUS_49210 135436 137001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49210 136998 138137 gene locus_tag LOCUS_49220 136998 138137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49220 139641 138307 gene locus_tag LOCUS_49230 139641 138307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 140721 139798 gene locus_tag LOCUS_49240 140721 139798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229446.1 protein_id gnl|my_center|LOCUS_49240 141204 142847 gene locus_tag LOCUS_49250 141204 142847 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977196.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49250 142844 143251 gene locus_tag LOCUS_49260 142844 143251 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977197.1 protein_id gnl|my_center|LOCUS_49260 143248 143619 gene locus_tag LOCUS_49270 143248 143619 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977198.1 protein_id gnl|my_center|LOCUS_49270 143675 144211 gene locus_tag LOCUS_49280 143675 144211 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 protein_id gnl|my_center|LOCUS_49280 144267 145820 gene locus_tag LOCUS_49290 144267 145820 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027891.1 protein_id gnl|my_center|LOCUS_49290 146942 145860 gene locus_tag LOCUS_49300 146942 145860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 148822 147233 gene locus_tag LOCUS_49310 148822 147233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 149173 150198 gene locus_tag LOCUS_49320 gene tdh 149173 150198 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_49320 150266 151447 gene locus_tag LOCUS_49330 150266 151447 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_49330 151490 152404 gene locus_tag LOCUS_49340 151490 152404 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_49340 152543 153373 gene locus_tag LOCUS_49350 gene pduF 152543 153373 CDS product propanediol diffusion facilitator PduF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004699353.1 protein_id gnl|my_center|LOCUS_49350 154263 153391 gene locus_tag LOCUS_49360 154263 153391 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_49360 155497 154376 gene locus_tag LOCUS_49370 155497 154376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 157148 155673 gene locus_tag LOCUS_49380 gene xylB 157148 155673 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027626.1 protein_id gnl|my_center|LOCUS_49380 157401 158570 gene locus_tag LOCUS_49390 gene xylA 157401 158570 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_49390 160080 158842 gene locus_tag LOCUS_49400 160080 158842 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_49400 160255 162444 gene locus_tag LOCUS_49410 160255 162444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 162571 163857 gene locus_tag LOCUS_49420 162571 163857 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_49420 163859 164806 gene locus_tag LOCUS_49430 163859 164806 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_49430 164806 165660 gene locus_tag LOCUS_49440 164806 165660 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445531.1 protein_id gnl|my_center|LOCUS_49440 165657 167825 gene locus_tag LOCUS_49450 165657 167825 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111257634.1 protein_id gnl|my_center|LOCUS_49450 167896 168657 gene locus_tag LOCUS_49460 167896 168657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031481.1 protein_id gnl|my_center|LOCUS_49460 168743 169516 gene locus_tag LOCUS_49470 168743 169516 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230779.1 protein_id gnl|my_center|LOCUS_49470 169528 170658 gene locus_tag LOCUS_49480 gene dgoD 169528 170658 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230776.1 protein_id gnl|my_center|LOCUS_49480 170652 171455 gene locus_tag LOCUS_49490 170652 171455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49490 171836 172486 gene locus_tag LOCUS_49500 171836 172486 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027391.1 protein_id gnl|my_center|LOCUS_49500 172483 173466 gene locus_tag LOCUS_49510 172483 173466 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027390.1 protein_id gnl|my_center|LOCUS_49510 173935 173507 gene locus_tag LOCUS_49520 173935 173507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209006.1 protein_id gnl|my_center|LOCUS_49520 174390 173929 gene locus_tag LOCUS_49530 174390 173929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_49530 174648 175451 gene locus_tag LOCUS_49540 174648 175451 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_49540 175452 175688 gene locus_tag LOCUS_49550 175452 175688 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 protein_id gnl|my_center|LOCUS_49550 175904 176704 gene locus_tag LOCUS_49560 175904 176704 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972443.1 protein_id gnl|my_center|LOCUS_49560 177021 177503 gene locus_tag LOCUS_49570 177021 177503 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_49570 178575 177544 gene locus_tag LOCUS_49580 178575 177544 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_49580 178647 179714 gene locus_tag LOCUS_49590 gene ligD 178647 179714 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_49590 182086 179858 gene locus_tag LOCUS_49600 182086 179858 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031124.1 protein_id gnl|my_center|LOCUS_49600 184518 182083 gene locus_tag LOCUS_49610 184518 182083 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031125.1 protein_id gnl|my_center|LOCUS_49610 184758 185807 gene locus_tag LOCUS_49620 184758 185807 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972284.1 protein_id gnl|my_center|LOCUS_49620 185983 186777 gene locus_tag LOCUS_49630 185983 186777 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031127.1 protein_id gnl|my_center|LOCUS_49630 186863 187174 gene locus_tag LOCUS_49640 186863 187174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 188472 187498 gene locus_tag LOCUS_49650 188472 187498 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_49650 189364 188588 gene locus_tag LOCUS_49660 gene ddaH 189364 188588 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972278.1 protein_id gnl|my_center|LOCUS_49660 191763 189493 gene locus_tag LOCUS_49670 191763 189493 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031131.1 protein_id gnl|my_center|LOCUS_49670 193529 191895 gene locus_tag LOCUS_49680 193529 191895 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_49680 194229 193813 gene locus_tag LOCUS_49690 194229 193813 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972274.1 protein_id gnl|my_center|LOCUS_49690 194428 195168 gene locus_tag LOCUS_49700 194428 195168 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_49700 196454 195264 gene locus_tag LOCUS_49710 196454 195264 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_49710 196716 197912 gene locus_tag LOCUS_49720 196716 197912 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_49720 197928 199142 gene locus_tag LOCUS_49730 197928 199142 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031183.1 protein_id gnl|my_center|LOCUS_49730 199195 201369 gene locus_tag LOCUS_49740 199195 201369 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 protein_id gnl|my_center|LOCUS_49740 202173 201388 gene locus_tag LOCUS_49750 202173 201388 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_49750 202419 203291 gene locus_tag LOCUS_49760 202419 203291 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_49760 >Feature sequence18 235 1572 gene locus_tag LOCUS_49770 235 1572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978040.1 protein_id gnl|my_center|LOCUS_49770 2322 1687 gene locus_tag LOCUS_49780 2322 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 2420 5056 gene locus_tag LOCUS_49790 2420 5056 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_49790 5174 6289 gene locus_tag LOCUS_49800 5174 6289 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974547.1 protein_id gnl|my_center|LOCUS_49800 8079 6496 gene locus_tag LOCUS_49810 8079 6496 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029652.1 protein_id gnl|my_center|LOCUS_49810 8703 8494 gene locus_tag LOCUS_49820 8703 8494 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 protein_id gnl|my_center|LOCUS_49820 9746 8889 gene locus_tag LOCUS_49830 9746 8889 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_49830 10767 10048 gene locus_tag LOCUS_49840 10767 10048 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974541.1 protein_id gnl|my_center|LOCUS_49840 10969 13767 gene locus_tag LOCUS_49850 10969 13767 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284555.1 protein_id gnl|my_center|LOCUS_49850 13967 15802 gene locus_tag LOCUS_49860 13967 15802 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 protein_id gnl|my_center|LOCUS_49860 16924 15842 gene locus_tag LOCUS_49870 16924 15842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 17480 16998 gene locus_tag LOCUS_49880 gene pgsC 17480 16998 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943109.1 protein_id gnl|my_center|LOCUS_49880 19276 17477 gene locus_tag LOCUS_49890 19276 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 21682 19283 gene locus_tag LOCUS_49900 21682 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 23359 22058 gene locus_tag LOCUS_49910 23359 22058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 23380 24381 gene locus_tag LOCUS_49920 23380 24381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 24790 25992 gene locus_tag LOCUS_49930 24790 25992 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031320.1 protein_id gnl|my_center|LOCUS_49930 26629 26057 gene locus_tag LOCUS_49940 26629 26057 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972200.1 protein_id gnl|my_center|LOCUS_49940 27252 26626 gene locus_tag LOCUS_49950 27252 26626 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004561734.1 protein_id gnl|my_center|LOCUS_49950 27640 27266 gene locus_tag LOCUS_49960 27640 27266 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031189.1 protein_id gnl|my_center|LOCUS_49960 28076 27642 gene locus_tag LOCUS_49970 28076 27642 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972203.1 protein_id gnl|my_center|LOCUS_49970 30249 28120 gene locus_tag LOCUS_49980 30249 28120 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031188.1 protein_id gnl|my_center|LOCUS_49980 32830 31115 gene locus_tag LOCUS_49990 32830 31115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 34466 33090 gene locus_tag LOCUS_50000 34466 33090 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284773.1 protein_id gnl|my_center|LOCUS_50000 34606 35523 gene locus_tag LOCUS_50010 34606 35523 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_50010 35573 35743 gene locus_tag LOCUS_50020 35573 35743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 35824 37242 gene locus_tag LOCUS_50030 35824 37242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020109.1 protein_id gnl|my_center|LOCUS_50030 37650 38645 gene locus_tag LOCUS_50040 37650 38645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 38983 38792 gene locus_tag LOCUS_50050 38983 38792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 42016 39143 gene locus_tag LOCUS_50060 42016 39143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50060 43001 42609 gene locus_tag LOCUS_50070 43001 42609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 43321 42998 gene locus_tag LOCUS_50080 43321 42998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 43740 43312 gene locus_tag LOCUS_50090 43740 43312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 44221 43787 gene locus_tag LOCUS_50100 44221 43787 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055467863.1 protein_id gnl|my_center|LOCUS_50100 44310 45431 gene locus_tag LOCUS_50110 44310 45431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 45575 45500 gene locus_tag LOCUS_t00650 45575 45500 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 45791 46129 gene locus_tag LOCUS_50120 45791 46129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50120 48425 46176 gene locus_tag LOCUS_50130 48425 46176 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_50130 48828 50228 gene locus_tag LOCUS_50140 48828 50228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 50270 51658 gene locus_tag LOCUS_50150 50270 51658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50150 51717 53345 gene locus_tag LOCUS_50160 51717 53345 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112961.1 protein_id gnl|my_center|LOCUS_50160 53592 54974 gene locus_tag LOCUS_50170 53592 54974 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888648.1 protein_id gnl|my_center|LOCUS_50170 55199 57841 gene locus_tag LOCUS_50180 55199 57841 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_50180 57910 57927 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58461 58201 gene locus_tag LOCUS_50190 58461 58201 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469699.1 protein_id gnl|my_center|LOCUS_50190 59743 58586 gene locus_tag LOCUS_50200 gene ispG 59743 58586 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_50200 61545 59740 gene locus_tag LOCUS_50210 gene dxs 61545 59740 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_50210 62102 61596 gene locus_tag LOCUS_50220 62102 61596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 63025 62102 gene locus_tag LOCUS_50230 63025 62102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 64219 63095 gene locus_tag LOCUS_50240 64219 63095 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064100.1 protein_id gnl|my_center|LOCUS_50240 65551 64223 gene locus_tag LOCUS_50250 65551 64223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 66549 65608 gene locus_tag LOCUS_50260 66549 65608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 67642 66539 gene locus_tag LOCUS_50270 67642 66539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50270 68788 67721 gene locus_tag LOCUS_50280 68788 67721 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729667.1 protein_id gnl|my_center|LOCUS_50280 69898 68951 gene locus_tag LOCUS_50290 69898 68951 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_50290 70212 71420 gene locus_tag LOCUS_50300 70212 71420 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948532.1 protein_id gnl|my_center|LOCUS_50300 71417 72598 gene locus_tag LOCUS_50310 71417 72598 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530155.1 protein_id gnl|my_center|LOCUS_50310 72700 73965 gene locus_tag LOCUS_50320 72700 73965 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_50320 74074 76086 gene locus_tag LOCUS_50330 74074 76086 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083709.1 protein_id gnl|my_center|LOCUS_50330 76126 77562 gene locus_tag LOCUS_50340 76126 77562 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090583.1 protein_id gnl|my_center|LOCUS_50340 77688 77894 gene locus_tag LOCUS_50350 77688 77894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 77881 78915 gene locus_tag LOCUS_50360 gene ppk2 77881 78915 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 protein_id gnl|my_center|LOCUS_50360 79542 78916 gene locus_tag LOCUS_50370 79542 78916 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_50370 79600 80634 gene locus_tag LOCUS_50380 79600 80634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 81908 80607 gene locus_tag LOCUS_50390 81908 80607 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975609.1 protein_id gnl|my_center|LOCUS_50390 82163 82816 gene locus_tag LOCUS_50400 82163 82816 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029222.1 protein_id gnl|my_center|LOCUS_50400 83051 84598 gene locus_tag LOCUS_50410 83051 84598 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_50410 85241 84735 gene locus_tag LOCUS_50420 85241 84735 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_50420 85361 86143 gene locus_tag LOCUS_50430 85361 86143 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_50430 86324 87613 gene locus_tag LOCUS_50440 86324 87613 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776530.1 protein_id gnl|my_center|LOCUS_50440 87603 88613 gene locus_tag LOCUS_50450 87603 88613 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776529.1 protein_id gnl|my_center|LOCUS_50450 88610 89437 gene locus_tag LOCUS_50460 88610 89437 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776528.1 protein_id gnl|my_center|LOCUS_50460 89434 90936 gene locus_tag LOCUS_50470 89434 90936 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_50470 91381 92307 gene locus_tag LOCUS_50480 91381 92307 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_50480 93370 92384 gene locus_tag LOCUS_50490 93370 92384 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_50490 93433 94935 gene locus_tag LOCUS_50500 93433 94935 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_50500 96688 94946 gene locus_tag LOCUS_50510 96688 94946 CDS product MOSC and FAD-binding oxidoreductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225744.1 protein_id gnl|my_center|LOCUS_50510 97596 96727 gene locus_tag LOCUS_50520 97596 96727 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 protein_id gnl|my_center|LOCUS_50520 98881 98027 gene locus_tag LOCUS_50530 98881 98027 CDS product DUF6227 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975622.1 protein_id gnl|my_center|LOCUS_50530 100058 99027 gene locus_tag LOCUS_50540 100058 99027 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_50540 100140 100397 gene locus_tag LOCUS_50550 100140 100397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 100927 100439 gene locus_tag LOCUS_50560 gene mscL 100927 100439 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975627.1 protein_id gnl|my_center|LOCUS_50560 101525 101106 gene locus_tag LOCUS_50570 101525 101106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 101524 101913 gene locus_tag LOCUS_50580 101524 101913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 102769 101900 gene locus_tag LOCUS_50590 102769 101900 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_50590 102708 103121 gene locus_tag LOCUS_50600 102708 103121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50600 104709 103342 gene locus_tag LOCUS_50610 104709 103342 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 protein_id gnl|my_center|LOCUS_50610 106597 105023 gene locus_tag LOCUS_50620 106597 105023 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_50620 106820 109636 gene locus_tag LOCUS_50630 106820 109636 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_50630 110255 109659 gene locus_tag LOCUS_50640 110255 109659 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_50640 110349 111251 gene locus_tag LOCUS_50650 gene galU 110349 111251 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_50650 111256 112596 gene locus_tag LOCUS_50660 111256 112596 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_50660 112668 113237 gene locus_tag LOCUS_50670 gene moaC 112668 113237 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_50670 113234 113764 gene locus_tag LOCUS_50680 113234 113764 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_50680 113761 114384 gene locus_tag LOCUS_50690 113761 114384 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_50690 114527 115603 gene locus_tag LOCUS_50700 114527 115603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975639.1 protein_id gnl|my_center|LOCUS_50700 115664 115738 gene locus_tag LOCUS_t00660 115664 115738 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 115908 117362 gene locus_tag LOCUS_50710 115908 117362 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246984.1 protein_id gnl|my_center|LOCUS_50710 117399 118592 gene locus_tag LOCUS_50720 117399 118592 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224665.1 protein_id gnl|my_center|LOCUS_50720 119890 118649 gene locus_tag LOCUS_50730 119890 118649 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728434.1 protein_id gnl|my_center|LOCUS_50730 120067 120573 gene locus_tag LOCUS_50740 120067 120573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 120793 120587 gene locus_tag LOCUS_50750 120793 120587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 120902 121570 gene locus_tag LOCUS_50760 120902 121570 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 protein_id gnl|my_center|LOCUS_50760 122023 121724 gene locus_tag LOCUS_50770 122023 121724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50770 122872 122171 gene locus_tag LOCUS_50780 122872 122171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976096.1 protein_id gnl|my_center|LOCUS_50780 123388 123149 gene locus_tag LOCUS_50790 123388 123149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 123823 123572 gene locus_tag LOCUS_50800 gene chpF 123823 123572 CDS product chaplin ChpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028524.1 protein_id gnl|my_center|LOCUS_50800 124054 125220 gene locus_tag LOCUS_50810 124054 125220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 125436 126509 gene locus_tag LOCUS_50820 125436 126509 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028527.1 protein_id gnl|my_center|LOCUS_50820 126506 128146 gene locus_tag LOCUS_50830 126506 128146 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028528.1 protein_id gnl|my_center|LOCUS_50830 128148 129629 gene locus_tag LOCUS_50840 128148 129629 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028529.1 protein_id gnl|my_center|LOCUS_50840 129626 131452 gene locus_tag LOCUS_50850 129626 131452 CDS product lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866257.1 protein_id gnl|my_center|LOCUS_50850 131442 132233 gene locus_tag LOCUS_50860 131442 132233 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_50860 132230 133417 gene locus_tag LOCUS_50870 132230 133417 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028531.1 protein_id gnl|my_center|LOCUS_50870 133425 134090 gene locus_tag LOCUS_50880 133425 134090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028532.1 protein_id gnl|my_center|LOCUS_50880 134090 135298 gene locus_tag LOCUS_50890 134090 135298 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028533.1 protein_id gnl|my_center|LOCUS_50890 136386 135331 gene locus_tag LOCUS_50900 136386 135331 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028534.1 protein_id gnl|my_center|LOCUS_50900 136653 138071 gene locus_tag LOCUS_50910 136653 138071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028535.1 protein_id gnl|my_center|LOCUS_50910 138134 139432 gene locus_tag LOCUS_50920 138134 139432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50920 140427 139528 gene locus_tag LOCUS_50930 gene chpC 140427 139528 CDS product LAXTG-anchored chaplin ChpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027911.1 protein_id gnl|my_center|LOCUS_50930 140821 140588 gene locus_tag LOCUS_50940 140821 140588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 141516 141106 gene locus_tag LOCUS_50950 gene rdlB 141516 141106 CDS product rodlin RdlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976081.1 protein_id gnl|my_center|LOCUS_50950 141737 142147 gene locus_tag LOCUS_50960 gene rdlB 141737 142147 CDS product rodlin RdlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976081.1 protein_id gnl|my_center|LOCUS_50960 142339 142746 gene locus_tag LOCUS_50970 gene rdlA 142339 142746 CDS product rodlin RdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976082.1 protein_id gnl|my_center|LOCUS_50970 143353 142829 gene locus_tag LOCUS_50980 143353 142829 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_50980 143346 144146 gene locus_tag LOCUS_50990 143346 144146 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_50990 144801 144151 gene locus_tag LOCUS_51000 144801 144151 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975643.1 protein_id gnl|my_center|LOCUS_51000 144965 146470 gene locus_tag LOCUS_51010 144965 146470 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_51010 146467 147375 gene locus_tag LOCUS_51020 146467 147375 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028808.1 protein_id gnl|my_center|LOCUS_51020 147372 148253 gene locus_tag LOCUS_51030 147372 148253 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028807.1 protein_id gnl|my_center|LOCUS_51030 148344 148556 gene locus_tag LOCUS_51040 148344 148556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 152067 148639 gene locus_tag LOCUS_51050 152067 148639 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486705.1 protein_id gnl|my_center|LOCUS_51050 152296 152868 gene locus_tag LOCUS_51060 152296 152868 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_51060 153055 155313 gene locus_tag LOCUS_51070 153055 155313 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_51070 155788 155375 gene locus_tag LOCUS_51080 155788 155375 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972274.1 protein_id gnl|my_center|LOCUS_51080 156031 157143 gene locus_tag LOCUS_51090 156031 157143 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_51090 157145 157909 gene locus_tag LOCUS_51100 gene cbiQ 157145 157909 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_51100 158013 158771 gene locus_tag LOCUS_51110 158013 158771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_51110 158874 160067 gene locus_tag LOCUS_51120 158874 160067 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_51120 160075 160860 gene locus_tag LOCUS_51130 160075 160860 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_51130 160939 161748 gene locus_tag LOCUS_51140 160939 161748 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_51140 161794 162756 gene locus_tag LOCUS_51150 161794 162756 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223218.1 protein_id gnl|my_center|LOCUS_51150 164341 162761 gene locus_tag LOCUS_51160 164341 162761 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030470.1 protein_id gnl|my_center|LOCUS_51160 166262 164493 gene locus_tag LOCUS_51170 166262 164493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 167647 166595 gene locus_tag LOCUS_51180 167647 166595 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_51180 167839 168060 gene locus_tag LOCUS_51190 167839 168060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 168057 168773 gene locus_tag LOCUS_51200 168057 168773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 protein_id gnl|my_center|LOCUS_51200 168910 169860 gene locus_tag LOCUS_51210 168910 169860 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971447.1 protein_id gnl|my_center|LOCUS_51210 170286 169876 gene locus_tag LOCUS_51220 170286 169876 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972172.1 protein_id gnl|my_center|LOCUS_51220 171065 170406 gene locus_tag LOCUS_51230 171065 170406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 171665 172585 gene locus_tag LOCUS_51240 171665 172585 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230494.1 protein_id gnl|my_center|LOCUS_51240 173965 172592 gene locus_tag LOCUS_51250 173965 172592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468787.1 protein_id gnl|my_center|LOCUS_51250 174485 174886 gene locus_tag LOCUS_51260 174485 174886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 175075 175365 gene locus_tag LOCUS_51270 175075 175365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990666.1 protein_id gnl|my_center|LOCUS_51270 176179 175688 gene locus_tag LOCUS_51280 176179 175688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 177563 178156 gene locus_tag LOCUS_51290 177563 178156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 178199 178426 gene locus_tag LOCUS_51300 178199 178426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 181175 178743 gene locus_tag LOCUS_51310 181175 178743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443220.1 protein_id gnl|my_center|LOCUS_51310 182446 181676 gene locus_tag LOCUS_51320 182446 181676 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029319.1 protein_id gnl|my_center|LOCUS_51320 182608 182970 gene locus_tag LOCUS_51330 182608 182970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029320.1 protein_id gnl|my_center|LOCUS_51330 182970 184259 gene locus_tag LOCUS_51340 182970 184259 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028864.1 protein_id gnl|my_center|LOCUS_51340 184256 184450 gene locus_tag LOCUS_51350 184256 184450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029322.1 protein_id gnl|my_center|LOCUS_51350 184730 186133 gene locus_tag LOCUS_51360 184730 186133 CDS product plasmid replication initiator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108990145.1 protein_id gnl|my_center|LOCUS_51360 187706 186261 gene locus_tag LOCUS_51370 187706 186261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 188469 187693 gene locus_tag LOCUS_51380 188469 187693 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028804.1 protein_id gnl|my_center|LOCUS_51380 188975 188466 gene locus_tag LOCUS_51390 188975 188466 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_51390 190058 189066 gene locus_tag LOCUS_51400 190058 189066 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002248.1 protein_id gnl|my_center|LOCUS_51400 190491 190024 gene locus_tag LOCUS_51410 190491 190024 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223897.1 protein_id gnl|my_center|LOCUS_51410 191566 190517 gene locus_tag LOCUS_51420 191566 190517 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 protein_id gnl|my_center|LOCUS_51420 191630 192304 gene locus_tag LOCUS_51430 191630 192304 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092983.1 protein_id gnl|my_center|LOCUS_51430 192304 192765 gene locus_tag LOCUS_51440 192304 192765 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_51440 192903 194078 gene locus_tag LOCUS_51450 192903 194078 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726720.1 protein_id gnl|my_center|LOCUS_51450 >Feature sequence19 738 436 gene locus_tag LOCUS_51460 738 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 1407 919 gene locus_tag LOCUS_51470 1407 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 1501 2025 gene locus_tag LOCUS_51480 1501 2025 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_51480 3774 2029 gene locus_tag LOCUS_51490 3774 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 4642 3815 gene locus_tag LOCUS_51500 4642 3815 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039612.1 protein_id gnl|my_center|LOCUS_51500 4877 6421 gene locus_tag LOCUS_51510 4877 6421 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_51510 7210 6704 gene locus_tag LOCUS_51520 7210 6704 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087154.1 protein_id gnl|my_center|LOCUS_51520 7468 10284 gene locus_tag LOCUS_51530 7468 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 10601 10768 gene locus_tag LOCUS_51540 10601 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 11492 10977 gene locus_tag LOCUS_51550 11492 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51550 11677 12384 gene locus_tag LOCUS_51560 11677 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51560 14866 12425 gene locus_tag LOCUS_51570 14866 12425 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029643.1 protein_id gnl|my_center|LOCUS_51570 15897 15112 gene locus_tag LOCUS_51580 15897 15112 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029642.1 protein_id gnl|my_center|LOCUS_51580 16191 16838 gene locus_tag LOCUS_51590 16191 16838 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_51590 17514 16924 gene locus_tag LOCUS_51600 17514 16924 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_51600 17581 18336 gene locus_tag LOCUS_51610 17581 18336 CDS product pyridoxal 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974564.1 protein_id gnl|my_center|LOCUS_51610 18724 18341 gene locus_tag LOCUS_51620 18724 18341 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029469.1 protein_id gnl|my_center|LOCUS_51620 18842 19249 gene locus_tag LOCUS_51630 18842 19249 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_51630 19431 20597 gene locus_tag LOCUS_51640 19431 20597 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029639.1 protein_id gnl|my_center|LOCUS_51640 21906 20584 gene locus_tag LOCUS_51650 21906 20584 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029637.1 protein_id gnl|my_center|LOCUS_51650 23263 21965 gene locus_tag LOCUS_51660 23263 21965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031193.1 protein_id gnl|my_center|LOCUS_51660 23408 24535 gene locus_tag LOCUS_51670 23408 24535 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_51670 25079 24522 gene locus_tag LOCUS_51680 25079 24522 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_51680 26059 25547 gene locus_tag LOCUS_51690 gene calD 26059 25547 CDS product calcium binding protein CalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974571.1 protein_id gnl|my_center|LOCUS_51690 26535 26161 gene locus_tag LOCUS_51700 26535 26161 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974572.1 protein_id gnl|my_center|LOCUS_51700 26814 27395 gene locus_tag LOCUS_51710 26814 27395 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974573.1 protein_id gnl|my_center|LOCUS_51710 27392 28951 gene locus_tag LOCUS_51720 27392 28951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 29934 29035 gene locus_tag LOCUS_51730 gene purU 29934 29035 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_51730 30461 30015 gene locus_tag LOCUS_51740 30461 30015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974580.1 protein_id gnl|my_center|LOCUS_51740 30848 30576 gene locus_tag LOCUS_51750 30848 30576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 30793 31938 gene locus_tag LOCUS_51760 30793 31938 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974581.1 protein_id gnl|my_center|LOCUS_51760 33957 32272 gene locus_tag LOCUS_51770 33957 32272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 35650 34268 gene locus_tag LOCUS_51780 35650 34268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_51780 35962 36657 gene locus_tag LOCUS_51790 35962 36657 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974584.1 protein_id gnl|my_center|LOCUS_51790 36679 37584 gene locus_tag LOCUS_51800 36679 37584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_51800 37581 39257 gene locus_tag LOCUS_51810 37581 39257 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_51810 39297 39749 gene locus_tag LOCUS_51820 39297 39749 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230404.1 protein_id gnl|my_center|LOCUS_51820 40646 39786 gene locus_tag LOCUS_51830 40646 39786 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_51830 42013 41318 gene locus_tag LOCUS_51840 42013 41318 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_51840 42238 42993 gene locus_tag LOCUS_51850 42238 42993 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_51850 44562 43108 gene locus_tag LOCUS_51860 44562 43108 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051815090.1 protein_id gnl|my_center|LOCUS_51860 45606 44941 gene locus_tag LOCUS_51870 gene pdxH 45606 44941 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_51870 45837 46937 gene locus_tag LOCUS_51880 45837 46937 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_51880 47671 47084 gene locus_tag LOCUS_51890 47671 47084 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_51890 48393 47659 gene locus_tag LOCUS_51900 48393 47659 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_51900 49389 48610 gene locus_tag LOCUS_51910 49389 48610 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389403.1 protein_id gnl|my_center|LOCUS_51910 49543 50391 gene locus_tag LOCUS_51920 49543 50391 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_51920 50638 50429 gene locus_tag LOCUS_51930 50638 50429 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030403591.1 protein_id gnl|my_center|LOCUS_51930 51462 50620 gene locus_tag LOCUS_51940 51462 50620 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974794.1 protein_id gnl|my_center|LOCUS_51940 51646 51927 gene locus_tag LOCUS_51950 51646 51927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 51924 52199 gene locus_tag LOCUS_51960 51924 52199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 protein_id gnl|my_center|LOCUS_51960 52196 52351 gene locus_tag LOCUS_51970 52196 52351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 52348 53550 gene locus_tag LOCUS_51980 52348 53550 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_51980 55130 53532 gene locus_tag LOCUS_51990 55130 53532 CDS product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029620.1 protein_id gnl|my_center|LOCUS_51990 56316 55174 gene locus_tag LOCUS_52000 56316 55174 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029619.1 protein_id gnl|my_center|LOCUS_52000 58259 56313 gene locus_tag LOCUS_52010 58259 56313 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029618.1 protein_id gnl|my_center|LOCUS_52010 59879 58275 gene locus_tag LOCUS_52020 59879 58275 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_52020 61609 59876 gene locus_tag LOCUS_52030 61609 59876 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029617.1 protein_id gnl|my_center|LOCUS_52030 62403 61612 gene locus_tag LOCUS_52040 62403 61612 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270155.1 protein_id gnl|my_center|LOCUS_52040 63571 62504 gene locus_tag LOCUS_52050 63571 62504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 66648 63784 gene locus_tag LOCUS_52060 66648 63784 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 protein_id gnl|my_center|LOCUS_52060 66774 67892 gene locus_tag LOCUS_52070 gene serC 66774 67892 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_52070 68144 67929 gene locus_tag LOCUS_52080 68144 67929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 69086 68259 gene locus_tag LOCUS_52090 69086 68259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029603.1 protein_id gnl|my_center|LOCUS_52090 70063 69083 gene locus_tag LOCUS_52100 70063 69083 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 protein_id gnl|my_center|LOCUS_52100 70163 70930 gene locus_tag LOCUS_52110 70163 70930 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_52110 71951 70944 gene locus_tag LOCUS_52120 71951 70944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 72018 72734 gene locus_tag LOCUS_52130 72018 72734 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974625.1 protein_id gnl|my_center|LOCUS_52130 72997 72836 gene locus_tag LOCUS_52140 72997 72836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 73101 74084 gene locus_tag LOCUS_52150 73101 74084 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 protein_id gnl|my_center|LOCUS_52150 74973 74341 gene locus_tag LOCUS_52160 gene thpR 74973 74341 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_52160 76399 75041 gene locus_tag LOCUS_52170 76399 75041 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_52170 76956 76519 gene locus_tag LOCUS_52180 76956 76519 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 protein_id gnl|my_center|LOCUS_52180 77122 77304 gene locus_tag LOCUS_52190 77122 77304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974640.1 protein_id gnl|my_center|LOCUS_52190 78771 77353 gene locus_tag LOCUS_52200 78771 77353 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029586.1 protein_id gnl|my_center|LOCUS_52200 78938 79201 gene locus_tag LOCUS_52210 78938 79201 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029585.1 protein_id gnl|my_center|LOCUS_52210 79300 81756 gene locus_tag LOCUS_52220 79300 81756 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_52220 82687 81833 gene locus_tag LOCUS_52230 82687 81833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 85955 82815 gene locus_tag LOCUS_52240 85955 82815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_52240 87043 86261 gene locus_tag LOCUS_52250 87043 86261 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_52250 87585 88925 gene locus_tag LOCUS_52260 87585 88925 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_52260 88953 89450 gene locus_tag LOCUS_52270 88953 89450 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668749.1 protein_id gnl|my_center|LOCUS_52270 89495 90199 gene locus_tag LOCUS_52280 89495 90199 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_52280 90196 91053 gene locus_tag LOCUS_52290 90196 91053 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_52290 91496 91113 gene locus_tag LOCUS_52300 91496 91113 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_52300 91736 92041 gene locus_tag LOCUS_52310 91736 92041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974651.1 protein_id gnl|my_center|LOCUS_52310 92667 91960 gene locus_tag LOCUS_52320 92667 91960 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_52320 92813 93847 gene locus_tag LOCUS_52330 92813 93847 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_52330 93844 94956 gene locus_tag LOCUS_52340 93844 94956 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_52340 94965 95792 gene locus_tag LOCUS_52350 94965 95792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_52350 97101 96046 gene locus_tag LOCUS_52360 97101 96046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029579.1 protein_id gnl|my_center|LOCUS_52360 98095 97181 gene locus_tag LOCUS_52370 98095 97181 CDS product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975523.1 protein_id gnl|my_center|LOCUS_52370 98554 101088 gene locus_tag LOCUS_52380 98554 101088 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 protein_id gnl|my_center|LOCUS_52380 101938 101114 gene locus_tag LOCUS_52390 101938 101114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 102905 102126 gene locus_tag LOCUS_52400 102905 102126 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030662.1 protein_id gnl|my_center|LOCUS_52400 104425 102902 gene locus_tag LOCUS_52410 104425 102902 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_52410 105690 104458 gene locus_tag LOCUS_52420 105690 104458 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030660.1 protein_id gnl|my_center|LOCUS_52420 105998 107815 gene locus_tag LOCUS_52430 105998 107815 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_52430 107866 108825 gene locus_tag LOCUS_52440 107866 108825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972807.1 protein_id gnl|my_center|LOCUS_52440 108822 109718 gene locus_tag LOCUS_52450 108822 109718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972808.1 protein_id gnl|my_center|LOCUS_52450 109715 111424 gene locus_tag LOCUS_52460 109715 111424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030658.1 protein_id gnl|my_center|LOCUS_52460 111421 112356 gene locus_tag LOCUS_52470 111421 112356 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972810.1 protein_id gnl|my_center|LOCUS_52470 112501 114144 gene locus_tag LOCUS_52480 112501 114144 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_52480 115409 114102 gene locus_tag LOCUS_52490 115409 114102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 115729 115520 gene locus_tag LOCUS_52500 115729 115520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974657.1 protein_id gnl|my_center|LOCUS_52500 116077 118374 gene locus_tag LOCUS_52510 116077 118374 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_52510 118389 119108 gene locus_tag LOCUS_52520 118389 119108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 119902 119198 gene locus_tag LOCUS_52530 119902 119198 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_52530 121078 120068 gene locus_tag LOCUS_52540 121078 120068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027540.1 protein_id gnl|my_center|LOCUS_52540 121240 123561 gene locus_tag LOCUS_52550 121240 123561 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027542.1 protein_id gnl|my_center|LOCUS_52550 123783 124634 gene locus_tag LOCUS_52560 123783 124634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 124859 126535 gene locus_tag LOCUS_52570 124859 126535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 126604 127857 gene locus_tag LOCUS_52580 126604 127857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031724.1 protein_id gnl|my_center|LOCUS_52580 128207 127938 gene locus_tag LOCUS_52590 128207 127938 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_52590 128598 128209 gene locus_tag LOCUS_52600 128598 128209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_52600 128697 129614 gene locus_tag LOCUS_52610 128697 129614 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 protein_id gnl|my_center|LOCUS_52610 129705 130709 gene locus_tag LOCUS_52620 gene murQ 129705 130709 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_52620 130723 131340 gene locus_tag LOCUS_52630 130723 131340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 132037 131366 gene locus_tag LOCUS_52640 132037 131366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 132388 132155 gene locus_tag LOCUS_52650 132388 132155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52650 132624 132385 gene locus_tag LOCUS_52660 132624 132385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52660 132748 133590 gene locus_tag LOCUS_52670 132748 133590 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_52670 133571 133849 gene locus_tag LOCUS_52680 133571 133849 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029565.1 protein_id gnl|my_center|LOCUS_52680 133858 134541 gene locus_tag LOCUS_52690 133858 134541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 134775 135212 gene locus_tag LOCUS_52700 134775 135212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 135485 135264 gene locus_tag LOCUS_52710 135485 135264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 135720 135469 gene locus_tag LOCUS_52720 135720 135469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 136259 135978 gene locus_tag LOCUS_52730 136259 135978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 136431 138554 gene locus_tag LOCUS_52740 136431 138554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 138609 139964 gene locus_tag LOCUS_52750 138609 139964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 141047 140040 gene locus_tag LOCUS_52760 141047 140040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 141210 142496 gene locus_tag LOCUS_52770 141210 142496 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903324.1 protein_id gnl|my_center|LOCUS_52770 142603 143127 gene locus_tag LOCUS_52780 142603 143127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_52780 143198 144034 gene locus_tag LOCUS_52790 143198 144034 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_52790 144295 145302 gene locus_tag LOCUS_52800 144295 145302 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_52800 145299 146132 gene locus_tag LOCUS_52810 145299 146132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_52810 147869 146244 gene locus_tag LOCUS_52820 gene groL 147869 146244 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_52820 148409 148206 gene locus_tag LOCUS_52830 148409 148206 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_52830 149065 148790 gene locus_tag LOCUS_52840 149065 148790 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_52840 150419 149106 gene locus_tag LOCUS_52850 gene thrC 150419 149106 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_52850 150680 151621 gene locus_tag LOCUS_52860 150680 151621 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_52860 151861 153297 gene locus_tag LOCUS_52870 151861 153297 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_52870 154737 153334 gene locus_tag LOCUS_52880 154737 153334 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_52880 155700 154858 gene locus_tag LOCUS_52890 gene otsB 155700 154858 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_52890 156099 155752 gene locus_tag LOCUS_52900 156099 155752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 157377 156112 gene locus_tag LOCUS_52910 157377 156112 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_52910 157623 158555 gene locus_tag LOCUS_52920 157623 158555 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_52920 158555 159742 gene locus_tag LOCUS_52930 gene nagA 158555 159742 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_52930 159945 160904 gene locus_tag LOCUS_52940 159945 160904 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_52940 160882 161760 gene locus_tag LOCUS_52950 160882 161760 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030498.1 protein_id gnl|my_center|LOCUS_52950 162819 161794 gene locus_tag LOCUS_52960 162819 161794 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029552.1 protein_id gnl|my_center|LOCUS_52960 164917 163025 gene locus_tag LOCUS_52970 164917 163025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 165300 165947 gene locus_tag LOCUS_52980 165300 165947 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_52980 166412 165981 gene locus_tag LOCUS_52990 gene arfB 166412 165981 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_52990 166559 167134 gene locus_tag LOCUS_53000 166559 167134 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 protein_id gnl|my_center|LOCUS_53000 168803 167325 gene locus_tag LOCUS_53010 168803 167325 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_53010 168884 169381 gene locus_tag LOCUS_53020 168884 169381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974706.1 protein_id gnl|my_center|LOCUS_53020 170334 169717 gene locus_tag LOCUS_53030 170334 169717 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027096.1 protein_id gnl|my_center|LOCUS_53030 171188 170532 gene locus_tag LOCUS_53040 171188 170532 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326845.1 protein_id gnl|my_center|LOCUS_53040 171354 172553 gene locus_tag LOCUS_53050 171354 172553 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974708.1 protein_id gnl|my_center|LOCUS_53050 172640 173659 gene locus_tag LOCUS_53060 172640 173659 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_53060 174297 173776 gene locus_tag LOCUS_53070 174297 173776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224277.1 protein_id gnl|my_center|LOCUS_53070 174836 174357 gene locus_tag LOCUS_53080 174836 174357 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088503.1 protein_id gnl|my_center|LOCUS_53080 175625 174861 gene locus_tag LOCUS_53090 175625 174861 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_53090 175869 177515 gene locus_tag LOCUS_53100 175869 177515 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 protein_id gnl|my_center|LOCUS_53100 177632 178534 gene locus_tag LOCUS_53110 177632 178534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 178555 178947 gene locus_tag LOCUS_53120 178555 178947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53120 178944 179132 gene locus_tag LOCUS_53130 178944 179132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53130 179129 179449 gene locus_tag LOCUS_53140 179129 179449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 179446 179760 gene locus_tag LOCUS_53150 179446 179760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 180188 179946 gene locus_tag LOCUS_53160 180188 179946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 180187 180453 gene locus_tag LOCUS_53170 180187 180453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53170 180453 180845 gene locus_tag LOCUS_53180 180453 180845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 181595 182284 gene locus_tag LOCUS_53190 181595 182284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 182251 182433 gene locus_tag LOCUS_53200 182251 182433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 >Feature sequence20 1283 108 gene locus_tag LOCUS_53210 1283 108 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_53210 2334 1276 gene locus_tag LOCUS_53220 2334 1276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_53220 3314 2346 gene locus_tag LOCUS_53230 3314 2346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_53230 4236 3307 gene locus_tag LOCUS_53240 4236 3307 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_53240 6027 4384 gene locus_tag LOCUS_53250 6027 4384 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_53250 8390 6504 gene locus_tag LOCUS_53260 gene typA 8390 6504 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_53260 11363 8721 gene locus_tag LOCUS_53270 11363 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53270 11685 11927 gene locus_tag LOCUS_53280 11685 11927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973869.1 protein_id gnl|my_center|LOCUS_53280 12134 12955 gene locus_tag LOCUS_53290 12134 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_53290 12977 14902 gene locus_tag LOCUS_53300 12977 14902 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_53300 14899 15762 gene locus_tag LOCUS_53310 14899 15762 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973872.1 protein_id gnl|my_center|LOCUS_53310 16762 15845 gene locus_tag LOCUS_53320 16762 15845 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 protein_id gnl|my_center|LOCUS_53320 16878 18524 gene locus_tag LOCUS_53330 16878 18524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870095.1 protein_id gnl|my_center|LOCUS_53330 18627 19697 gene locus_tag LOCUS_53340 18627 19697 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 protein_id gnl|my_center|LOCUS_53340 21066 20065 gene locus_tag LOCUS_53350 21066 20065 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970872.1 protein_id gnl|my_center|LOCUS_53350 21297 22541 gene locus_tag LOCUS_53360 21297 22541 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733127.1 protein_id gnl|my_center|LOCUS_53360 22547 23527 gene locus_tag LOCUS_53370 22547 23527 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_53370 23524 24453 gene locus_tag LOCUS_53380 23524 24453 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_53380 24544 26391 gene locus_tag LOCUS_53390 24544 26391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 26566 28059 gene locus_tag LOCUS_53400 26566 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 28265 30334 gene locus_tag LOCUS_53410 28265 30334 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 protein_id gnl|my_center|LOCUS_53410 30376 30525 gene locus_tag LOCUS_53420 30376 30525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 33095 30537 gene locus_tag LOCUS_53430 33095 30537 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030059.1 protein_id gnl|my_center|LOCUS_53430 33667 33242 gene locus_tag LOCUS_53440 33667 33242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_53440 34176 33757 gene locus_tag LOCUS_53450 34176 33757 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_53450 34422 34243 gene locus_tag LOCUS_53460 34422 34243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973877.1 protein_id gnl|my_center|LOCUS_53460 35441 34689 gene locus_tag LOCUS_53470 35441 34689 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_53470 35598 36710 gene locus_tag LOCUS_53480 35598 36710 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226442.1 protein_id gnl|my_center|LOCUS_53480 37203 36721 gene locus_tag LOCUS_53490 37203 36721 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972016.1 protein_id gnl|my_center|LOCUS_53490 37775 37359 gene locus_tag LOCUS_53500 37775 37359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 38056 37841 gene locus_tag LOCUS_53510 38056 37841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 37982 38716 gene locus_tag LOCUS_53520 37982 38716 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083055.1 protein_id gnl|my_center|LOCUS_53520 40748 39105 gene locus_tag LOCUS_53530 40748 39105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 42128 41040 gene locus_tag LOCUS_53540 gene ychF 42128 41040 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_53540 42378 42989 gene locus_tag LOCUS_53550 42378 42989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030028.1 protein_id gnl|my_center|LOCUS_53550 43739 43002 gene locus_tag LOCUS_53560 43739 43002 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_53560 44811 43774 gene locus_tag LOCUS_53570 44811 43774 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_53570 44888 46468 gene locus_tag LOCUS_53580 44888 46468 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973921.1 protein_id gnl|my_center|LOCUS_53580 46545 47753 gene locus_tag LOCUS_53590 gene xseA 46545 47753 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_53590 47850 48116 gene locus_tag LOCUS_53600 47850 48116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53600 48699 48181 gene locus_tag LOCUS_53610 48699 48181 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973929.1 protein_id gnl|my_center|LOCUS_53610 48831 49862 gene locus_tag LOCUS_53620 gene glpX 48831 49862 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_53620 50359 49985 gene locus_tag LOCUS_53630 50359 49985 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030021.1 protein_id gnl|my_center|LOCUS_53630 51239 50571 gene locus_tag LOCUS_53640 51239 50571 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_53640 51457 53130 gene locus_tag LOCUS_53650 51457 53130 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_53650 54751 53201 gene locus_tag LOCUS_53660 54751 53201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 54858 56297 gene locus_tag LOCUS_53670 54858 56297 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_53670 56425 57099 gene locus_tag LOCUS_53680 56425 57099 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_53680 57603 59540 gene locus_tag LOCUS_53690 57603 59540 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487155.1 protein_id gnl|my_center|LOCUS_53690 59748 61211 gene locus_tag LOCUS_53700 59748 61211 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_53700 63501 61222 gene locus_tag LOCUS_53710 63501 61222 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973938.1 protein_id gnl|my_center|LOCUS_53710 63786 64700 gene locus_tag LOCUS_53720 63786 64700 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_53720 64697 64966 gene locus_tag LOCUS_53730 64697 64966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53730 64976 65539 gene locus_tag LOCUS_53740 64976 65539 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_53740 66362 65526 gene locus_tag LOCUS_53750 66362 65526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 67762 66359 gene locus_tag LOCUS_53760 67762 66359 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_53760 68597 67899 gene locus_tag LOCUS_53770 68597 67899 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 protein_id gnl|my_center|LOCUS_53770 70281 68989 gene locus_tag LOCUS_53780 70281 68989 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_53780 71491 70718 gene locus_tag LOCUS_53790 71491 70718 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_53790 71673 72710 gene locus_tag LOCUS_53800 gene mgrA 71673 72710 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_53800 73344 72973 gene locus_tag LOCUS_53810 73344 72973 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742073.1 protein_id gnl|my_center|LOCUS_53810 73457 74239 gene locus_tag LOCUS_53820 73457 74239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53820 74315 74683 gene locus_tag LOCUS_53830 74315 74683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53830 75496 74705 gene locus_tag LOCUS_53840 75496 74705 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742118.1 protein_id gnl|my_center|LOCUS_53840 76542 75577 gene locus_tag LOCUS_53850 76542 75577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 76668 77039 gene locus_tag LOCUS_53860 76668 77039 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487141.1 protein_id gnl|my_center|LOCUS_53860 77876 77064 gene locus_tag LOCUS_53870 77876 77064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 78381 77968 gene locus_tag LOCUS_53880 78381 77968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 78782 78390 gene locus_tag LOCUS_53890 78782 78390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 80512 78782 gene locus_tag LOCUS_53900 80512 78782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 80986 80594 gene locus_tag LOCUS_53910 80986 80594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 82434 80986 gene locus_tag LOCUS_53920 82434 80986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 83047 82814 gene locus_tag LOCUS_53930 83047 82814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 83993 83325 gene locus_tag LOCUS_53940 83993 83325 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030005.1 protein_id gnl|my_center|LOCUS_53940 84577 83993 gene locus_tag LOCUS_53950 84577 83993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030004.1 protein_id gnl|my_center|LOCUS_53950 85276 84608 gene locus_tag LOCUS_53960 85276 84608 CDS product pilus assembly protein TadG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030003.1 protein_id gnl|my_center|LOCUS_53960 85512 85279 gene locus_tag LOCUS_53970 85512 85279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 86840 85734 gene locus_tag LOCUS_53980 86840 85734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 88273 86942 gene locus_tag LOCUS_53990 88273 86942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 89222 88332 gene locus_tag LOCUS_54000 89222 88332 CDS product DUF5936 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030001.1 protein_id gnl|my_center|LOCUS_54000 90184 89243 gene locus_tag LOCUS_54010 90184 89243 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030000.1 protein_id gnl|my_center|LOCUS_54010 91550 90255 gene locus_tag LOCUS_54020 91550 90255 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973968.1 protein_id gnl|my_center|LOCUS_54020 91994 91614 gene locus_tag LOCUS_54030 91994 91614 CDS product TadE/TadG family type IV pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029999.1 protein_id gnl|my_center|LOCUS_54030 92412 91996 gene locus_tag LOCUS_54040 92412 91996 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973970.1 protein_id gnl|my_center|LOCUS_54040 93738 92494 gene locus_tag LOCUS_54050 93738 92494 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973971.1 protein_id gnl|my_center|LOCUS_54050 94459 93746 gene locus_tag LOCUS_54060 gene cpaB 94459 93746 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973972.1 protein_id gnl|my_center|LOCUS_54060 95467 94589 gene locus_tag LOCUS_54070 95467 94589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029997.1 protein_id gnl|my_center|LOCUS_54070 95880 97412 gene locus_tag LOCUS_54080 95880 97412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 97447 98082 gene locus_tag LOCUS_54090 97447 98082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 98093 98515 gene locus_tag LOCUS_54100 98093 98515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 98583 99026 gene locus_tag LOCUS_54110 98583 99026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54110 99280 100947 gene locus_tag LOCUS_54120 99280 100947 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029996.1 protein_id gnl|my_center|LOCUS_54120 101172 102182 gene locus_tag LOCUS_54130 101172 102182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 103579 102269 gene locus_tag LOCUS_54140 103579 102269 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327153.1 protein_id gnl|my_center|LOCUS_54140 103996 103694 gene locus_tag LOCUS_54150 103996 103694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 103887 104141 gene locus_tag LOCUS_54160 103887 104141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54160 105655 104177 gene locus_tag LOCUS_54170 105655 104177 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029989.1 protein_id gnl|my_center|LOCUS_54170 106198 105779 gene locus_tag LOCUS_54180 106198 105779 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973987.1 protein_id gnl|my_center|LOCUS_54180 106983 106195 gene locus_tag LOCUS_54190 106983 106195 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_54190 108074 106980 gene locus_tag LOCUS_54200 108074 106980 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029988.1 protein_id gnl|my_center|LOCUS_54200 108216 109505 gene locus_tag LOCUS_54210 108216 109505 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_54210 109518 111146 gene locus_tag LOCUS_54220 109518 111146 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029987.1 protein_id gnl|my_center|LOCUS_54220 111509 111162 gene locus_tag LOCUS_54230 111509 111162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 111502 112530 gene locus_tag LOCUS_54240 111502 112530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 114195 112549 gene locus_tag LOCUS_54250 114195 112549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 114378 115589 gene locus_tag LOCUS_54260 114378 115589 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973993.1 protein_id gnl|my_center|LOCUS_54260 115670 116068 gene locus_tag LOCUS_54270 115670 116068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973994.1 protein_id gnl|my_center|LOCUS_54270 117362 116115 gene locus_tag LOCUS_54280 117362 116115 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_54280 118062 117637 gene locus_tag LOCUS_54290 118062 117637 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742210.1 protein_id gnl|my_center|LOCUS_54290 120170 118272 gene locus_tag LOCUS_54300 120170 118272 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_54300 120406 121119 gene locus_tag LOCUS_54310 120406 121119 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_54310 121232 122785 gene locus_tag LOCUS_54320 121232 122785 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025727111.1 protein_id gnl|my_center|LOCUS_54320 122791 123414 gene locus_tag LOCUS_54330 122791 123414 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_54330 125499 123433 gene locus_tag LOCUS_54340 125499 123433 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974002.1 protein_id gnl|my_center|LOCUS_54340 126187 125660 gene locus_tag LOCUS_54350 126187 125660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227099.1 protein_id gnl|my_center|LOCUS_54350 126531 127202 gene locus_tag LOCUS_54360 126531 127202 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971862.1 protein_id gnl|my_center|LOCUS_54360 127199 127822 gene locus_tag LOCUS_54370 127199 127822 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971863.1 protein_id gnl|my_center|LOCUS_54370 128335 127931 gene locus_tag LOCUS_54380 128335 127931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 128638 131868 gene locus_tag LOCUS_54390 128638 131868 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270179.1 protein_id gnl|my_center|LOCUS_54390 132240 131980 gene locus_tag LOCUS_54400 132240 131980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974008.1 protein_id gnl|my_center|LOCUS_54400 133114 132233 gene locus_tag LOCUS_54410 gene mca 133114 132233 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_54410 133199 133609 gene locus_tag LOCUS_54420 133199 133609 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974010.1 protein_id gnl|my_center|LOCUS_54420 133829 134326 gene locus_tag LOCUS_54430 gene greA 133829 134326 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_54430 135280 134414 gene locus_tag LOCUS_54440 135280 134414 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_54440 136353 135277 gene locus_tag LOCUS_54450 136353 135277 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_54450 138018 136753 gene locus_tag LOCUS_54460 gene ilvA 138018 136753 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_54460 138162 138827 gene locus_tag LOCUS_54470 138162 138827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 138858 139358 gene locus_tag LOCUS_54480 138858 139358 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974016.1 protein_id gnl|my_center|LOCUS_54480 139355 139606 gene locus_tag LOCUS_54490 139355 139606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974017.1 protein_id gnl|my_center|LOCUS_54490 140785 139640 gene locus_tag LOCUS_54500 140785 139640 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_54500 140853 141956 gene locus_tag LOCUS_54510 140853 141956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_54510 142102 143196 gene locus_tag LOCUS_54520 142102 143196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_54520 143248 143958 gene locus_tag LOCUS_54530 143248 143958 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074041.1 protein_id gnl|my_center|LOCUS_54530 144337 145956 gene locus_tag LOCUS_54540 144337 145956 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226759.1 protein_id gnl|my_center|LOCUS_54540 146990 145992 gene locus_tag LOCUS_54550 146990 145992 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972532.1 protein_id gnl|my_center|LOCUS_54550 148444 147176 gene locus_tag LOCUS_54560 148444 147176 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 protein_id gnl|my_center|LOCUS_54560 149002 148622 gene locus_tag LOCUS_54570 149002 148622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 149108 149296 gene locus_tag LOCUS_54580 149108 149296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54580 150892 149345 gene locus_tag LOCUS_54590 gene hutH 150892 149345 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 protein_id gnl|my_center|LOCUS_54590 152397 151222 gene locus_tag LOCUS_54600 152397 151222 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870180.1 protein_id gnl|my_center|LOCUS_54600 153288 152476 gene locus_tag LOCUS_54610 153288 152476 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_54610 154511 153348 gene locus_tag LOCUS_54620 154511 153348 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_54620 155553 154675 gene locus_tag LOCUS_54630 155553 154675 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_54630 155698 157293 gene locus_tag LOCUS_54640 155698 157293 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_54640 157311 157517 gene locus_tag LOCUS_54650 157311 157517 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974048.1 protein_id gnl|my_center|LOCUS_54650 157617 157745 gene locus_tag LOCUS_54660 157617 157745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974049.1 protein_id gnl|my_center|LOCUS_54660 157867 158898 gene locus_tag LOCUS_54670 157867 158898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54670 158913 159518 gene locus_tag LOCUS_54680 158913 159518 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_54680 160014 159553 gene locus_tag LOCUS_54690 160014 159553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029951.1 protein_id gnl|my_center|LOCUS_54690 >Feature sequence21 487 137 gene locus_tag LOCUS_54700 487 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54700 741 526 gene locus_tag LOCUS_54710 741 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54710 700 1014 gene locus_tag LOCUS_54720 700 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 2360 1143 gene locus_tag LOCUS_54730 2360 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 3537 3154 gene locus_tag LOCUS_54740 3537 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 4204 3800 gene locus_tag LOCUS_54750 4204 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 5606 4248 gene locus_tag LOCUS_54760 5606 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54760 7375 5603 gene locus_tag LOCUS_54770 7375 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 9429 7375 gene locus_tag LOCUS_54780 9429 7375 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084908292.1 protein_id gnl|my_center|LOCUS_54780 10367 9426 gene locus_tag LOCUS_54790 10367 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54790 10318 10569 gene locus_tag LOCUS_54800 10318 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 10804 13179 gene locus_tag LOCUS_54810 10804 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 13172 16738 gene locus_tag LOCUS_54820 13172 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54820 16776 22397 gene locus_tag LOCUS_54830 16776 22397 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189716469.1 protein_id gnl|my_center|LOCUS_54830 24753 22435 gene locus_tag LOCUS_54840 24753 22435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 25152 24925 gene locus_tag LOCUS_54850 25152 24925 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_54850 36853 25169 gene locus_tag LOCUS_54860 36853 25169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 37136 36930 gene locus_tag LOCUS_54870 37136 36930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 37522 37274 gene locus_tag LOCUS_54880 37522 37274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 39550 37631 gene locus_tag LOCUS_54890 39550 37631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 40198 39920 gene locus_tag LOCUS_54900 40198 39920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 40860 40240 gene locus_tag LOCUS_54910 40860 40240 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258321.1 protein_id gnl|my_center|LOCUS_54910 41366 40860 gene locus_tag LOCUS_54920 41366 40860 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_54920 41711 41370 gene locus_tag LOCUS_54930 41711 41370 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081309.1 protein_id gnl|my_center|LOCUS_54930 42141 41743 gene locus_tag LOCUS_54940 42141 41743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 42513 42677 gene locus_tag LOCUS_54950 42513 42677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54950 43527 43111 gene locus_tag LOCUS_54960 43527 43111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 44165 43527 gene locus_tag LOCUS_54970 44165 43527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 44503 44162 gene locus_tag LOCUS_54980 44503 44162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 44481 44822 gene locus_tag LOCUS_54990 44481 44822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 44869 45012 gene locus_tag LOCUS_55000 44869 45012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 45942 45013 gene locus_tag LOCUS_55010 45942 45013 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026969.1 protein_id gnl|my_center|LOCUS_55010 46056 46583 gene locus_tag LOCUS_55020 46056 46583 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026968.1 protein_id gnl|my_center|LOCUS_55020 48154 47048 gene locus_tag LOCUS_55030 48154 47048 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_55030 48298 48780 gene locus_tag LOCUS_55040 48298 48780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55040 49417 50508 gene locus_tag LOCUS_55050 49417 50508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 50542 51705 gene locus_tag LOCUS_55060 50542 51705 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 protein_id gnl|my_center|LOCUS_55060 52135 51770 gene locus_tag LOCUS_55070 52135 51770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 52019 52354 gene locus_tag LOCUS_55080 52019 52354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 52690 53232 gene locus_tag LOCUS_55090 52690 53232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 54340 54113 gene locus_tag LOCUS_55100 54340 54113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55100 54413 55549 gene locus_tag LOCUS_55110 54413 55549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 56442 56131 gene locus_tag LOCUS_55120 56442 56131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 56821 57381 gene locus_tag LOCUS_55130 56821 57381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 57537 57956 gene locus_tag LOCUS_55140 57537 57956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55140 58323 59201 gene locus_tag LOCUS_55150 58323 59201 CDS product DUF1963 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227205.1 protein_id gnl|my_center|LOCUS_55150 59286 59879 gene locus_tag LOCUS_55160 59286 59879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55160 60805 59831 gene locus_tag LOCUS_55170 60805 59831 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267512.1 protein_id gnl|my_center|LOCUS_55170 61230 60934 gene locus_tag LOCUS_55180 61230 60934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 62327 62800 gene locus_tag LOCUS_55190 62327 62800 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091711.1 protein_id gnl|my_center|LOCUS_55190 62826 63374 gene locus_tag LOCUS_55200 62826 63374 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974323.1 protein_id gnl|my_center|LOCUS_55200 64256 63756 gene locus_tag LOCUS_55210 64256 63756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 65509 64778 gene locus_tag LOCUS_55220 65509 64778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 66294 65497 gene locus_tag LOCUS_55230 66294 65497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 66602 66396 gene locus_tag LOCUS_55240 66602 66396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 67422 66571 gene locus_tag LOCUS_55250 67422 66571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 68318 67911 gene locus_tag LOCUS_55260 68318 67911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 69209 68394 gene locus_tag LOCUS_55270 69209 68394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 69833 69657 gene locus_tag LOCUS_55280 69833 69657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55280 70320 69904 gene locus_tag LOCUS_55290 70320 69904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 71931 70567 gene locus_tag LOCUS_55300 71931 70567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 73457 72180 gene locus_tag LOCUS_55310 73457 72180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 74119 75486 gene locus_tag LOCUS_55320 74119 75486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 75714 76364 gene locus_tag LOCUS_55330 75714 76364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 76631 77758 gene locus_tag LOCUS_55340 76631 77758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 77939 78487 gene locus_tag LOCUS_55350 77939 78487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 80028 78529 gene locus_tag LOCUS_55360 80028 78529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 81123 80038 gene locus_tag LOCUS_55370 81123 80038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 81755 81135 gene locus_tag LOCUS_55380 81755 81135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 81968 83269 gene locus_tag LOCUS_55390 81968 83269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 83253 84227 gene locus_tag LOCUS_55400 83253 84227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 84463 84711 gene locus_tag LOCUS_55410 84463 84711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 84599 84859 gene locus_tag LOCUS_55420 84599 84859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 84865 85245 gene locus_tag LOCUS_55430 84865 85245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55430 85355 85681 gene locus_tag LOCUS_55440 85355 85681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55440 85926 86189 gene locus_tag LOCUS_55450 85926 86189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55450 86222 86359 gene locus_tag LOCUS_55460 86222 86359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55460 86866 86423 gene locus_tag LOCUS_55470 86866 86423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 87434 87120 gene locus_tag LOCUS_55480 87434 87120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55480 87589 88359 gene locus_tag LOCUS_55490 87589 88359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 88777 89436 gene locus_tag LOCUS_55500 88777 89436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 89506 90417 gene locus_tag LOCUS_55510 89506 90417 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225297.1 protein_id gnl|my_center|LOCUS_55510 90494 91513 gene locus_tag LOCUS_55520 90494 91513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229405.1 protein_id gnl|my_center|LOCUS_55520 91791 91612 gene locus_tag LOCUS_55530 91791 91612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 91921 92178 gene locus_tag LOCUS_55540 91921 92178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 92502 92708 gene locus_tag LOCUS_55550 92502 92708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 93097 93600 gene locus_tag LOCUS_55560 93097 93600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 94011 93760 gene locus_tag LOCUS_55570 94011 93760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 94340 94065 gene locus_tag LOCUS_55580 94340 94065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 95023 94400 gene locus_tag LOCUS_55590 95023 94400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 95941 95489 gene locus_tag LOCUS_55600 95941 95489 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975682.1 protein_id gnl|my_center|LOCUS_55600 96297 99881 gene locus_tag LOCUS_55610 96297 99881 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228485.1 protein_id gnl|my_center|LOCUS_55610 101614 100103 gene locus_tag LOCUS_55620 101614 100103 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_55620 102519 101668 gene locus_tag LOCUS_55630 102519 101668 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976374.1 protein_id gnl|my_center|LOCUS_55630 103472 102516 gene locus_tag LOCUS_55640 103472 102516 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971641.1 protein_id gnl|my_center|LOCUS_55640 104806 103469 gene locus_tag LOCUS_55650 104806 103469 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028349.1 protein_id gnl|my_center|LOCUS_55650 105366 106271 gene locus_tag LOCUS_55660 105366 106271 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399412.1 protein_id gnl|my_center|LOCUS_55660 106370 107065 gene locus_tag LOCUS_55670 106370 107065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 107065 107937 gene locus_tag LOCUS_55680 107065 107937 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228232.1 protein_id gnl|my_center|LOCUS_55680 109333 108077 gene locus_tag LOCUS_55690 109333 108077 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114201.1 protein_id gnl|my_center|LOCUS_55690 109351 109875 gene locus_tag LOCUS_55700 109351 109875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55700 110347 109952 gene locus_tag LOCUS_55710 110347 109952 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776272.1 protein_id gnl|my_center|LOCUS_55710 111206 110451 gene locus_tag LOCUS_55720 111206 110451 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730379.1 protein_id gnl|my_center|LOCUS_55720 111301 111918 gene locus_tag LOCUS_55730 111301 111918 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730380.1 protein_id gnl|my_center|LOCUS_55730 112804 112364 gene locus_tag LOCUS_55740 112804 112364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 115125 113128 gene locus_tag LOCUS_55750 115125 113128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552179.1 protein_id gnl|my_center|LOCUS_55750 115324 116670 gene locus_tag LOCUS_55760 115324 116670 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_55760 116667 117596 gene locus_tag LOCUS_55770 116667 117596 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_55770 117593 118471 gene locus_tag LOCUS_55780 117593 118471 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_55780 118474 120324 gene locus_tag LOCUS_55790 118474 120324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 120321 121319 gene locus_tag LOCUS_55800 120321 121319 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_55800 121477 122658 gene locus_tag LOCUS_55810 121477 122658 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187247289.1 protein_id gnl|my_center|LOCUS_55810 122655 123506 gene locus_tag LOCUS_55820 122655 123506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55820 123655 123494 gene locus_tag LOCUS_55830 123655 123494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55830 123728 124717 gene locus_tag LOCUS_55840 123728 124717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227554.1 protein_id gnl|my_center|LOCUS_55840 124875 126212 gene locus_tag LOCUS_55850 gene selA 124875 126212 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_55850 126218 128059 gene locus_tag LOCUS_55860 gene selB 126218 128059 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_55860 128094 128001 gene locus_tag LOCUS_t00670 128094 128001 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 128205 129236 gene locus_tag LOCUS_55870 gene selD 128205 129236 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_55870 132546 129289 gene locus_tag LOCUS_55880 gene fdh 132546 129289 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 transl_except (pos:complement(131977..131979),aa:Sec) note codon on position 190 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_55880 133022 133183 gene locus_tag LOCUS_55890 133022 133183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 133180 134154 gene locus_tag LOCUS_55900 133180 134154 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145933610.1 protein_id gnl|my_center|LOCUS_55900 134151 135200 gene locus_tag LOCUS_55910 gene nrfD 134151 135200 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227549.1 protein_id gnl|my_center|LOCUS_55910 135619 135855 gene locus_tag LOCUS_55920 135619 135855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55920 136273 137322 gene locus_tag LOCUS_55930 136273 137322 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_55930 138117 137641 gene locus_tag LOCUS_55940 138117 137641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 138627 138301 gene locus_tag LOCUS_55950 138627 138301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55950 139576 138851 gene locus_tag LOCUS_55960 139576 138851 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027230.1 protein_id gnl|my_center|LOCUS_55960 139575 139778 gene locus_tag LOCUS_55970 139575 139778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 140769 139810 gene locus_tag LOCUS_55980 140769 139810 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 protein_id gnl|my_center|LOCUS_55980 141000 141410 gene locus_tag LOCUS_55990 141000 141410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 142560 141931 gene locus_tag LOCUS_56000 142560 141931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 143221 142613 gene locus_tag LOCUS_56010 143221 142613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56010 143772 143218 gene locus_tag LOCUS_56020 143772 143218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56020 143942 144301 gene locus_tag LOCUS_56030 143942 144301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 144552 144298 gene locus_tag LOCUS_56040 144552 144298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56040 145595 146482 gene locus_tag LOCUS_56050 145595 146482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 146984 146667 gene locus_tag LOCUS_56060 146984 146667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 147105 147314 gene locus_tag LOCUS_56070 147105 147314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56070 147496 147705 gene locus_tag LOCUS_56080 147496 147705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56080 148111 148893 gene locus_tag LOCUS_56090 148111 148893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485338.1 protein_id gnl|my_center|LOCUS_56090 149717 149055 gene locus_tag LOCUS_56100 149717 149055 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223792.1 protein_id gnl|my_center|LOCUS_56100 149779 150405 gene locus_tag LOCUS_56110 149779 150405 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898852.1 protein_id gnl|my_center|LOCUS_56110 150710 150519 gene locus_tag LOCUS_56120 150710 150519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 151511 151972 gene locus_tag LOCUS_56130 151511 151972 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225461.1 protein_id gnl|my_center|LOCUS_56130 152335 152036 gene locus_tag LOCUS_56140 152335 152036 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 protein_id gnl|my_center|LOCUS_56140 153720 152527 gene locus_tag LOCUS_56150 153720 152527 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727870.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_56150 154172 154525 gene locus_tag LOCUS_56160 154172 154525 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224148.1 protein_id gnl|my_center|LOCUS_56160 156054 154609 gene locus_tag LOCUS_56170 156054 154609 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284768.1 protein_id gnl|my_center|LOCUS_56170 156167 156682 gene locus_tag LOCUS_56180 156167 156682 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 protein_id gnl|my_center|LOCUS_56180 157136 157277 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 157353 157811 gene locus_tag LOCUS_56190 157353 157811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 >Feature sequence22 1529 270 gene locus_tag LOCUS_56200 1529 270 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027868.1 protein_id gnl|my_center|LOCUS_56200 1715 2575 gene locus_tag LOCUS_56210 1715 2575 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_56210 3182 2643 gene locus_tag LOCUS_56220 3182 2643 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_56220 4571 3234 gene locus_tag LOCUS_56230 4571 3234 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027869.1 protein_id gnl|my_center|LOCUS_56230 7529 4980 gene locus_tag LOCUS_56240 gene pheT 7529 4980 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_56240 8659 7529 gene locus_tag LOCUS_56250 gene pheS 8659 7529 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_56250 10193 8952 gene locus_tag LOCUS_56260 10193 8952 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_56260 11128 10289 gene locus_tag LOCUS_56270 11128 10289 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_56270 11666 11280 gene locus_tag LOCUS_56280 gene rplT 11666 11280 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_56280 11958 11764 gene locus_tag LOCUS_56290 gene rpmI 11958 11764 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_56290 12797 12081 gene locus_tag LOCUS_56300 gene infC 12797 12081 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_56300 13122 13484 gene locus_tag LOCUS_56310 13122 13484 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977223.1 protein_id gnl|my_center|LOCUS_56310 14224 13475 gene locus_tag LOCUS_56320 14224 13475 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_56320 14302 15024 gene locus_tag LOCUS_56330 14302 15024 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135794525.1 protein_id gnl|my_center|LOCUS_56330 16258 14999 gene locus_tag LOCUS_56340 gene mycP 16258 14999 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_56340 17067 16255 gene locus_tag LOCUS_56350 17067 16255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283992.1 protein_id gnl|my_center|LOCUS_56350 17903 19105 gene locus_tag LOCUS_56360 17903 19105 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_56360 20105 19152 gene locus_tag LOCUS_56370 20105 19152 CDS product DUF2510 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027881.1 protein_id gnl|my_center|LOCUS_56370 20924 20121 gene locus_tag LOCUS_56380 20924 20121 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_56380 22307 20928 gene locus_tag LOCUS_56390 22307 20928 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495124.1 protein_id gnl|my_center|LOCUS_56390 23689 22319 gene locus_tag LOCUS_56400 gene glnA4 23689 22319 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_56400 23767 24519 gene locus_tag LOCUS_56410 23767 24519 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027884.1 protein_id gnl|my_center|LOCUS_56410 24681 26198 gene locus_tag LOCUS_56420 gene eat 24681 26198 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727732.1 protein_id gnl|my_center|LOCUS_56420 26310 27026 gene locus_tag LOCUS_56430 26310 27026 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027885.1 protein_id gnl|my_center|LOCUS_56430 27138 28604 gene locus_tag LOCUS_56440 27138 28604 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028042.1 protein_id gnl|my_center|LOCUS_56440 29605 28679 gene locus_tag LOCUS_56450 29605 28679 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_56450 29676 30872 gene locus_tag LOCUS_56460 29676 30872 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 protein_id gnl|my_center|LOCUS_56460 31557 30811 gene locus_tag LOCUS_56470 31557 30811 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_56470 32106 31558 gene locus_tag LOCUS_56480 32106 31558 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977207.1 protein_id gnl|my_center|LOCUS_56480 34999 32378 gene locus_tag LOCUS_56490 34999 32378 CDS product ABC transporter permease/substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027888.1 protein_id gnl|my_center|LOCUS_56490 36158 34992 gene locus_tag LOCUS_56500 36158 34992 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977205.1 protein_id gnl|my_center|LOCUS_56500 36440 37360 gene locus_tag LOCUS_56510 36440 37360 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_56510 37475 38320 gene locus_tag LOCUS_56520 37475 38320 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_56520 38610 39194 gene locus_tag LOCUS_56530 38610 39194 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027261.1 protein_id gnl|my_center|LOCUS_56530 39191 39949 gene locus_tag LOCUS_56540 39191 39949 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_56540 40094 41674 gene locus_tag LOCUS_56550 40094 41674 CDS product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027201.1 protein_id gnl|my_center|LOCUS_56550 41723 42367 gene locus_tag LOCUS_56560 41723 42367 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978224.1 protein_id gnl|my_center|LOCUS_56560 45301 42449 gene locus_tag LOCUS_56570 45301 42449 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_56570 46255 45323 gene locus_tag LOCUS_56580 46255 45323 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_56580 47194 46259 gene locus_tag LOCUS_56590 gene tatC 47194 46259 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_56590 47555 47262 gene locus_tag LOCUS_56600 gene tatA 47555 47262 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_56600 47959 47762 gene locus_tag LOCUS_56610 47959 47762 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977192.1 protein_id gnl|my_center|LOCUS_56610 48237 47977 gene locus_tag LOCUS_56620 48237 47977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977191.1 protein_id gnl|my_center|LOCUS_56620 49220 48252 gene locus_tag LOCUS_56630 49220 48252 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_56630 50195 49239 gene locus_tag LOCUS_56640 50195 49239 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_56640 50753 50379 gene locus_tag LOCUS_56650 50753 50379 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_56650 51732 50797 gene locus_tag LOCUS_56660 51732 50797 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_56660 53219 51858 gene locus_tag LOCUS_56670 gene pafA 53219 51858 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_56670 54500 53229 gene locus_tag LOCUS_56680 54500 53229 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_56680 54715 55692 gene locus_tag LOCUS_56690 54715 55692 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977184.1 protein_id gnl|my_center|LOCUS_56690 56560 55787 gene locus_tag LOCUS_56700 gene prcA 56560 55787 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_56700 57459 56614 gene locus_tag LOCUS_56710 gene prcB 57459 56614 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_56710 57823 57605 gene locus_tag LOCUS_56720 57823 57605 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_56720 59469 57958 gene locus_tag LOCUS_56730 gene dop 59469 57958 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_56730 61472 59706 gene locus_tag LOCUS_56740 gene arc 61472 59706 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_56740 61726 62046 gene locus_tag LOCUS_56750 61726 62046 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_56750 62715 62122 gene locus_tag LOCUS_56760 62715 62122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977175.1 protein_id gnl|my_center|LOCUS_56760 63835 62933 gene locus_tag LOCUS_56770 63835 62933 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_56770 65136 63889 gene locus_tag LOCUS_56780 65136 63889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 65299 66159 gene locus_tag LOCUS_56790 65299 66159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 66387 67058 gene locus_tag LOCUS_56800 66387 67058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_56800 68763 67159 gene locus_tag LOCUS_56810 68763 67159 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977170.1 protein_id gnl|my_center|LOCUS_56810 69929 69228 gene locus_tag LOCUS_56820 69929 69228 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_56820 73660 70139 gene locus_tag LOCUS_56830 gene metH 73660 70139 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_56830 73659 74645 gene locus_tag LOCUS_56840 73659 74645 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977167.1 protein_id gnl|my_center|LOCUS_56840 74873 75664 gene locus_tag LOCUS_56850 74873 75664 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 protein_id gnl|my_center|LOCUS_56850 75711 77264 gene locus_tag LOCUS_56860 gene glpK 75711 77264 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_56860 77295 78908 gene locus_tag LOCUS_56870 77295 78908 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977164.1 protein_id gnl|my_center|LOCUS_56870 79062 79733 gene locus_tag LOCUS_56880 79062 79733 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223733.1 protein_id gnl|my_center|LOCUS_56880 80844 79813 gene locus_tag LOCUS_56890 80844 79813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224954.1 protein_id gnl|my_center|LOCUS_56890 82409 80841 gene locus_tag LOCUS_56900 82409 80841 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224953.1 protein_id gnl|my_center|LOCUS_56900 83482 82412 gene locus_tag LOCUS_56910 83482 82412 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224952.1 protein_id gnl|my_center|LOCUS_56910 84312 83524 gene locus_tag LOCUS_56920 84312 83524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027048.1 protein_id gnl|my_center|LOCUS_56920 85628 84309 gene locus_tag LOCUS_56930 85628 84309 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223728.1 protein_id gnl|my_center|LOCUS_56930 85883 86950 gene locus_tag LOCUS_56940 gene parJ 85883 86950 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_56940 87115 87534 gene locus_tag LOCUS_56950 87115 87534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 88902 87673 gene locus_tag LOCUS_56960 gene mshC 88902 87673 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_56960 89835 89035 gene locus_tag LOCUS_56970 89835 89035 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_56970 90422 89832 gene locus_tag LOCUS_56980 90422 89832 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_56980 91233 90529 gene locus_tag LOCUS_56990 91233 90529 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_56990 91376 92383 gene locus_tag LOCUS_57000 gene corA 91376 92383 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_57000 93219 92437 gene locus_tag LOCUS_57010 93219 92437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027907.1 protein_id gnl|my_center|LOCUS_57010 94513 93461 gene locus_tag LOCUS_57020 94513 93461 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_57020 94665 95648 gene locus_tag LOCUS_57030 94665 95648 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_57030 95645 97843 gene locus_tag LOCUS_57040 95645 97843 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027909.1 protein_id gnl|my_center|LOCUS_57040 98601 97930 gene locus_tag LOCUS_57050 98601 97930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027910.1 protein_id gnl|my_center|LOCUS_57050 98649 98837 gene locus_tag LOCUS_57060 98649 98837 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977152.1 protein_id gnl|my_center|LOCUS_57060 99644 98922 gene locus_tag LOCUS_57070 gene chpC 99644 98922 CDS product LAXTG-anchored chaplin ChpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027911.1 protein_id gnl|my_center|LOCUS_57070 100013 99780 gene locus_tag LOCUS_57080 gene chpH 100013 99780 CDS product chaplin ChpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977150.1 protein_id gnl|my_center|LOCUS_57080 101472 100147 gene locus_tag LOCUS_57090 101472 100147 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_57090 101600 101687 gene locus_tag LOCUS_t00680 101600 101687 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101897 102682 gene locus_tag LOCUS_57100 101897 102682 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_57100 103376 102711 gene locus_tag LOCUS_57110 103376 102711 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_57110 104464 103376 gene locus_tag LOCUS_57120 104464 103376 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_57120 105235 104534 gene locus_tag LOCUS_57130 105235 104534 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027913.1 protein_id gnl|my_center|LOCUS_57130 105367 105906 gene locus_tag LOCUS_57140 105367 105906 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_57140 105947 107353 gene locus_tag LOCUS_57150 105947 107353 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296681.1 protein_id gnl|my_center|LOCUS_57150 108225 107548 gene locus_tag LOCUS_57160 108225 107548 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967002.1 protein_id gnl|my_center|LOCUS_57160 108892 108167 gene locus_tag LOCUS_57170 108892 108167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 108978 109412 gene locus_tag LOCUS_57180 108978 109412 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229974.1 protein_id gnl|my_center|LOCUS_57180 111098 109443 gene locus_tag LOCUS_57190 111098 109443 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_57190 111170 111718 gene locus_tag LOCUS_57200 111170 111718 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485846.1 protein_id gnl|my_center|LOCUS_57200 111797 112177 gene locus_tag LOCUS_57210 111797 112177 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977138.1 protein_id gnl|my_center|LOCUS_57210 112177 112497 gene locus_tag LOCUS_57220 112177 112497 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027919.1 protein_id gnl|my_center|LOCUS_57220 112704 113009 gene locus_tag LOCUS_57230 112704 113009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226834.1 protein_id gnl|my_center|LOCUS_57230 113168 114190 gene locus_tag LOCUS_57240 113168 114190 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_57240 114198 115412 gene locus_tag LOCUS_57250 114198 115412 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027921.1 protein_id gnl|my_center|LOCUS_57250 116021 115419 gene locus_tag LOCUS_57260 116021 115419 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_57260 116911 116147 gene locus_tag LOCUS_57270 116911 116147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977133.1 protein_id gnl|my_center|LOCUS_57270 117257 117868 gene locus_tag LOCUS_57280 117257 117868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977130.1 protein_id gnl|my_center|LOCUS_57280 118529 118029 gene locus_tag LOCUS_57290 gene soxR 118529 118029 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_57290 118641 119102 gene locus_tag LOCUS_57300 118641 119102 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_57300 119755 119093 gene locus_tag LOCUS_57310 119755 119093 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_57310 119876 120532 gene locus_tag LOCUS_57320 119876 120532 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977123.1 protein_id gnl|my_center|LOCUS_57320 120547 121314 gene locus_tag LOCUS_57330 120547 121314 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 protein_id gnl|my_center|LOCUS_57330 121348 122319 gene locus_tag LOCUS_57340 121348 122319 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027928.1 protein_id gnl|my_center|LOCUS_57340 123443 122364 gene locus_tag LOCUS_57350 123443 122364 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_57350 124857 123463 gene locus_tag LOCUS_57360 124857 123463 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_57360 126380 125028 gene locus_tag LOCUS_57370 126380 125028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_57370 126651 126466 gene locus_tag LOCUS_57380 126651 126466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 127885 126605 gene locus_tag LOCUS_57390 127885 126605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027932.1 protein_id gnl|my_center|LOCUS_57390 128496 127885 gene locus_tag LOCUS_57400 128496 127885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 128648 128436 gene locus_tag LOCUS_57410 128648 128436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 131024 128787 gene locus_tag LOCUS_57420 131024 128787 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_57420 131842 131183 gene locus_tag LOCUS_57430 131842 131183 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_57430 132170 133519 gene locus_tag LOCUS_57440 gene hmgA 132170 133519 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977111.1 protein_id gnl|my_center|LOCUS_57440 133578 134327 gene locus_tag LOCUS_57450 133578 134327 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 protein_id gnl|my_center|LOCUS_57450 134437 135630 gene locus_tag LOCUS_57460 134437 135630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325881.1 protein_id gnl|my_center|LOCUS_57460 136371 135658 gene locus_tag LOCUS_57470 136371 135658 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977108.1 protein_id gnl|my_center|LOCUS_57470 136440 137474 gene locus_tag LOCUS_57480 136440 137474 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027938.1 protein_id gnl|my_center|LOCUS_57480 137471 138253 gene locus_tag LOCUS_57490 137471 138253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027939.1 protein_id gnl|my_center|LOCUS_57490 138808 138482 gene locus_tag LOCUS_57500 138808 138482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57500 139814 139011 gene locus_tag LOCUS_57510 139814 139011 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_57510 140322 141284 gene locus_tag LOCUS_57520 140322 141284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 141281 142357 gene locus_tag LOCUS_57530 141281 142357 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 protein_id gnl|my_center|LOCUS_57530 142354 143193 gene locus_tag LOCUS_57540 142354 143193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 143254 144372 gene locus_tag LOCUS_57550 143254 144372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57550 144436 144891 gene locus_tag LOCUS_57560 144436 144891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 144888 145871 gene locus_tag LOCUS_57570 144888 145871 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897923.1 protein_id gnl|my_center|LOCUS_57570 145831 146691 gene locus_tag LOCUS_57580 145831 146691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_57580 147109 146729 gene locus_tag LOCUS_57590 147109 146729 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_57590 147196 148116 gene locus_tag LOCUS_57600 147196 148116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977097.1 protein_id gnl|my_center|LOCUS_57600 148097 148645 gene locus_tag LOCUS_57610 148097 148645 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027944.1 protein_id gnl|my_center|LOCUS_57610 149747 148611 gene locus_tag LOCUS_57620 149747 148611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 151428 149923 gene locus_tag LOCUS_57630 151428 149923 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027604.1 protein_id gnl|my_center|LOCUS_57630 151971 151432 gene locus_tag LOCUS_57640 151971 151432 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027603.1 protein_id gnl|my_center|LOCUS_57640 153002 151968 gene locus_tag LOCUS_57650 153002 151968 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715268.1 protein_id gnl|my_center|LOCUS_57650 >Feature sequence23 3864 2662 gene locus_tag LOCUS_57660 3864 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 4436 4158 gene locus_tag LOCUS_57670 4436 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 4597 4433 gene locus_tag LOCUS_57680 4597 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57680 4881 4597 gene locus_tag LOCUS_57690 4881 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 5301 4972 gene locus_tag LOCUS_57700 5301 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 5745 5368 gene locus_tag LOCUS_57710 5745 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 6035 5742 gene locus_tag LOCUS_57720 6035 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 6229 6032 gene locus_tag LOCUS_57730 6229 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57730 7422 6241 gene locus_tag LOCUS_57740 7422 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 7669 7412 gene locus_tag LOCUS_57750 7669 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57750 7893 7666 gene locus_tag LOCUS_57760 7893 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 7942 8550 gene locus_tag LOCUS_57770 7942 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57770 8550 9752 gene locus_tag LOCUS_57780 8550 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 9920 9846 gene locus_tag LOCUS_t00690 9920 9846 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10126 11265 gene locus_tag LOCUS_57790 gene msiK 10126 11265 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_57790 11491 11913 gene locus_tag LOCUS_57800 11491 11913 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029526.1 protein_id gnl|my_center|LOCUS_57800 11976 12668 gene locus_tag LOCUS_57810 11976 12668 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974737.1 protein_id gnl|my_center|LOCUS_57810 14664 12889 gene locus_tag LOCUS_57820 14664 12889 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739108.1 protein_id gnl|my_center|LOCUS_57820 15826 14876 gene locus_tag LOCUS_57830 gene rlmB 15826 14876 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 protein_id gnl|my_center|LOCUS_57830 17463 15985 gene locus_tag LOCUS_57840 gene cysS 17463 15985 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_57840 17998 17591 gene locus_tag LOCUS_57850 17998 17591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 18731 18186 gene locus_tag LOCUS_57860 gene ispF 18731 18186 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_57860 19467 18721 gene locus_tag LOCUS_57870 gene ispD 19467 18721 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_57870 20450 19968 gene locus_tag LOCUS_57880 20450 19968 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_57880 21108 21878 gene locus_tag LOCUS_57890 21108 21878 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029520.1 protein_id gnl|my_center|LOCUS_57890 22768 22088 gene locus_tag LOCUS_57900 22768 22088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_57900 24024 22765 gene locus_tag LOCUS_57910 24024 22765 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_57910 24307 24987 gene locus_tag LOCUS_57920 gene phoU 24307 24987 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_57920 25173 25322 gene locus_tag LOCUS_57930 25173 25322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 26155 25394 gene locus_tag LOCUS_57940 26155 25394 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_57940 26313 27746 gene locus_tag LOCUS_57950 26313 27746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_57950 29457 27751 gene locus_tag LOCUS_57960 29457 27751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 30136 29576 gene locus_tag LOCUS_57970 30136 29576 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_57970 31472 30129 gene locus_tag LOCUS_57980 gene mshA 31472 30129 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_57980 31666 32538 gene locus_tag LOCUS_57990 31666 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_57990 33018 32656 gene locus_tag LOCUS_58000 33018 32656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 32939 33889 gene locus_tag LOCUS_58010 32939 33889 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029498.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58010 34238 35530 gene locus_tag LOCUS_58020 34238 35530 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 protein_id gnl|my_center|LOCUS_58020 35944 35594 gene locus_tag LOCUS_58030 35944 35594 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_58030 36741 36052 gene locus_tag LOCUS_58040 36741 36052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974772.1 protein_id gnl|my_center|LOCUS_58040 37235 36759 gene locus_tag LOCUS_58050 37235 36759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58050 39263 38136 gene locus_tag LOCUS_58060 39263 38136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 40057 39302 gene locus_tag LOCUS_58070 40057 39302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58070 40115 40384 gene locus_tag LOCUS_58080 40115 40384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58080 40598 41344 gene locus_tag LOCUS_58090 40598 41344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028451.1 protein_id gnl|my_center|LOCUS_58090 41341 41598 gene locus_tag LOCUS_58100 41341 41598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58100 42972 41746 gene locus_tag LOCUS_58110 42972 41746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_58110 43091 43708 gene locus_tag LOCUS_58120 43091 43708 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027066.1 protein_id gnl|my_center|LOCUS_58120 43781 44671 gene locus_tag LOCUS_58130 43781 44671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58130 45652 44717 gene locus_tag LOCUS_58140 45652 44717 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223829.1 protein_id gnl|my_center|LOCUS_58140 45752 46531 gene locus_tag LOCUS_58150 45752 46531 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974027.1 protein_id gnl|my_center|LOCUS_58150 48371 47136 gene locus_tag LOCUS_58160 48371 47136 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225041.1 protein_id gnl|my_center|LOCUS_58160 48528 49226 gene locus_tag LOCUS_58170 48528 49226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58170 49732 49205 gene locus_tag LOCUS_58180 49732 49205 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409241.1 protein_id gnl|my_center|LOCUS_58180 49837 50283 gene locus_tag LOCUS_58190 49837 50283 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030385.1 protein_id gnl|my_center|LOCUS_58190 50280 51179 gene locus_tag LOCUS_58200 50280 51179 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_58200 53303 51219 gene locus_tag LOCUS_58210 53303 51219 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029494.1 protein_id gnl|my_center|LOCUS_58210 54012 53347 gene locus_tag LOCUS_58220 54012 53347 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_58220 54545 54057 gene locus_tag LOCUS_58230 54545 54057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 54688 56271 gene locus_tag LOCUS_58240 54688 56271 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227868.1 protein_id gnl|my_center|LOCUS_58240 56785 56252 gene locus_tag LOCUS_58250 56785 56252 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026937.1 protein_id gnl|my_center|LOCUS_58250 58328 56811 gene locus_tag LOCUS_58260 58328 56811 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484272.1 protein_id gnl|my_center|LOCUS_58260 59163 58345 gene locus_tag LOCUS_58270 59163 58345 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_58270 59275 60270 gene locus_tag LOCUS_58280 59275 60270 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_58280 60263 61051 gene locus_tag LOCUS_58290 gene lieB 60263 61051 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_58290 63055 61055 gene locus_tag LOCUS_58300 63055 61055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58300 64300 63398 gene locus_tag LOCUS_58310 64300 63398 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974781.1 protein_id gnl|my_center|LOCUS_58310 65176 64472 gene locus_tag LOCUS_58320 65176 64472 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974780.1 protein_id gnl|my_center|LOCUS_58320 66223 65333 gene locus_tag LOCUS_58330 66223 65333 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029489.1 protein_id gnl|my_center|LOCUS_58330 66469 66639 gene locus_tag LOCUS_58340 66469 66639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58340 67929 66682 gene locus_tag LOCUS_58350 67929 66682 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974785.1 protein_id gnl|my_center|LOCUS_58350 69024 68023 gene locus_tag LOCUS_58360 69024 68023 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_58360 69676 69071 gene locus_tag LOCUS_58370 69676 69071 CDS product aerial mycelium formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029488.1 protein_id gnl|my_center|LOCUS_58370 69801 70238 gene locus_tag LOCUS_58380 gene dtd 69801 70238 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_58380 71279 70299 gene locus_tag LOCUS_58390 71279 70299 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_58390 71738 71301 gene locus_tag LOCUS_58400 71738 71301 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_58400 72354 71782 gene locus_tag LOCUS_58410 72354 71782 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_58410 72595 73008 gene locus_tag LOCUS_58420 72595 73008 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_58420 73330 73055 gene locus_tag LOCUS_58430 73330 73055 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326801.1 protein_id gnl|my_center|LOCUS_58430 73729 73442 gene locus_tag LOCUS_58440 73729 73442 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_58440 74653 73814 gene locus_tag LOCUS_58450 74653 73814 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_58450 75954 75208 gene locus_tag LOCUS_58460 75954 75208 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_58460 77563 76208 gene locus_tag LOCUS_58470 77563 76208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029476.1 protein_id gnl|my_center|LOCUS_58470 77768 77514 gene locus_tag LOCUS_58480 77768 77514 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_58480 78171 79070 gene locus_tag LOCUS_58490 gene glnR 78171 79070 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_58490 79095 80117 gene locus_tag LOCUS_58500 79095 80117 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974813.1 protein_id gnl|my_center|LOCUS_58500 81120 80161 gene locus_tag LOCUS_58510 81120 80161 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 protein_id gnl|my_center|LOCUS_58510 81554 81237 gene locus_tag LOCUS_58520 81554 81237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 81698 82603 gene locus_tag LOCUS_58530 81698 82603 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229445.1 protein_id gnl|my_center|LOCUS_58530 83454 82669 gene locus_tag LOCUS_58540 83454 82669 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029358.1 protein_id gnl|my_center|LOCUS_58540 83993 83451 gene locus_tag LOCUS_58550 83993 83451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58550 84148 84588 gene locus_tag LOCUS_58560 84148 84588 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_58560 84694 85731 gene locus_tag LOCUS_58570 84694 85731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58570 85808 86566 gene locus_tag LOCUS_58580 85808 86566 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 protein_id gnl|my_center|LOCUS_58580 86563 87978 gene locus_tag LOCUS_58590 86563 87978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_58590 88758 88018 gene locus_tag LOCUS_58600 88758 88018 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978487.1 protein_id gnl|my_center|LOCUS_58600 88892 89398 gene locus_tag LOCUS_58610 88892 89398 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_58610 90402 89467 gene locus_tag LOCUS_58620 gene plcA 90402 89467 CDS product phosphatidylinositol-specific phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733144.1 protein_id gnl|my_center|LOCUS_58620 90748 90551 gene locus_tag LOCUS_58630 90748 90551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 91487 91293 gene locus_tag LOCUS_58640 91487 91293 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 protein_id gnl|my_center|LOCUS_58640 92350 91499 gene locus_tag LOCUS_58650 gene whiJ 92350 91499 CDS product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 protein_id gnl|my_center|LOCUS_58650 92549 93010 gene locus_tag LOCUS_58660 92549 93010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 93181 93618 gene locus_tag LOCUS_58670 93181 93618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101257084.1 protein_id gnl|my_center|LOCUS_58670 93718 94203 gene locus_tag LOCUS_58680 93718 94203 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228553.1 protein_id gnl|my_center|LOCUS_58680 94196 94558 gene locus_tag LOCUS_58690 94196 94558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 96449 94629 gene locus_tag LOCUS_58700 96449 94629 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_58700 96567 96752 gene locus_tag LOCUS_58710 96567 96752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58710 96749 97669 gene locus_tag LOCUS_58720 gene mshD 96749 97669 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_58720 97763 98200 gene locus_tag LOCUS_58730 97763 98200 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978036.1 protein_id gnl|my_center|LOCUS_58730 98197 99096 gene locus_tag LOCUS_58740 98197 99096 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978035.1 protein_id gnl|my_center|LOCUS_58740 99093 100121 gene locus_tag LOCUS_58750 99093 100121 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229214.1 protein_id gnl|my_center|LOCUS_58750 100425 102650 gene locus_tag LOCUS_58760 100425 102650 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_58760 102616 103758 gene locus_tag LOCUS_58770 102616 103758 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487611.1 protein_id gnl|my_center|LOCUS_58770 103755 104261 gene locus_tag LOCUS_58780 103755 104261 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029461.1 protein_id gnl|my_center|LOCUS_58780 104842 104273 gene locus_tag LOCUS_58790 104842 104273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 105323 104877 gene locus_tag LOCUS_58800 105323 104877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 105834 106967 gene locus_tag LOCUS_58810 gene pstS 105834 106967 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_58810 107068 108066 gene locus_tag LOCUS_58820 gene pstC 107068 108066 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_58820 108063 109139 gene locus_tag LOCUS_58830 gene pstA 108063 109139 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_58830 109194 109970 gene locus_tag LOCUS_58840 gene pstB 109194 109970 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_58840 111287 110289 gene locus_tag LOCUS_58850 gene pitH 111287 110289 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_58850 111913 111293 gene locus_tag LOCUS_58860 111913 111293 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_58860 112125 112529 gene locus_tag LOCUS_58870 112125 112529 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029458.1 protein_id gnl|my_center|LOCUS_58870 112779 112603 gene locus_tag LOCUS_58880 112779 112603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 113718 112885 gene locus_tag LOCUS_58890 113718 112885 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029457.1 protein_id gnl|my_center|LOCUS_58890 114159 115751 gene locus_tag LOCUS_58900 114159 115751 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222690.1 protein_id gnl|my_center|LOCUS_58900 116488 115763 gene locus_tag LOCUS_58910 116488 115763 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974837.1 protein_id gnl|my_center|LOCUS_58910 117840 116815 gene locus_tag LOCUS_58920 gene tgdA 117840 116815 CDS product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 protein_id gnl|my_center|LOCUS_58920 119581 117902 gene locus_tag LOCUS_58930 119581 117902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 120178 119624 gene locus_tag LOCUS_58940 120178 119624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 122022 120175 gene locus_tag LOCUS_58950 122022 120175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 122420 122019 gene locus_tag LOCUS_58960 122420 122019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 122931 123239 gene locus_tag LOCUS_58970 122931 123239 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974839.1 protein_id gnl|my_center|LOCUS_58970 123486 124352 gene locus_tag LOCUS_58980 123486 124352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029454.1 protein_id gnl|my_center|LOCUS_58980 124342 125709 gene locus_tag LOCUS_58990 124342 125709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668748.1 protein_id gnl|my_center|LOCUS_58990 125706 127274 gene locus_tag LOCUS_59000 125706 127274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326782.1 protein_id gnl|my_center|LOCUS_59000 127399 128847 gene locus_tag LOCUS_59010 127399 128847 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974843.1 protein_id gnl|my_center|LOCUS_59010 128844 130379 gene locus_tag LOCUS_59020 128844 130379 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029453.1 protein_id gnl|my_center|LOCUS_59020 130974 130411 gene locus_tag LOCUS_59030 130974 130411 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974845.1 protein_id gnl|my_center|LOCUS_59030 131083 132129 gene locus_tag LOCUS_59040 131083 132129 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228269.1 protein_id gnl|my_center|LOCUS_59040 132126 132947 gene locus_tag LOCUS_59050 132126 132947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030858.1 protein_id gnl|my_center|LOCUS_59050 132994 134235 gene locus_tag LOCUS_59060 132994 134235 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487607.1 protein_id gnl|my_center|LOCUS_59060 134232 134918 gene locus_tag LOCUS_59070 134232 134918 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029450.1 protein_id gnl|my_center|LOCUS_59070 135096 134986 gene locus_tag LOCUS_r00030 135096 134986 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence24 670 110 gene locus_tag LOCUS_59080 670 110 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225996.1 protein_id gnl|my_center|LOCUS_59080 826 1431 gene locus_tag LOCUS_59090 826 1431 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027098.1 protein_id gnl|my_center|LOCUS_59090 2643 1531 gene locus_tag LOCUS_59100 2643 1531 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225511.1 protein_id gnl|my_center|LOCUS_59100 2916 3692 gene locus_tag LOCUS_59110 2916 3692 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_59110 4848 3706 gene locus_tag LOCUS_59120 4848 3706 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138052126.1 protein_id gnl|my_center|LOCUS_59120 4986 5651 gene locus_tag LOCUS_59130 4986 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59130 6352 5657 gene locus_tag LOCUS_59140 6352 5657 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269945.1 protein_id gnl|my_center|LOCUS_59140 6435 7004 gene locus_tag LOCUS_59150 6435 7004 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089165.1 protein_id gnl|my_center|LOCUS_59150 8210 6993 gene locus_tag LOCUS_59160 8210 6993 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_59160 9202 8324 gene locus_tag LOCUS_59170 9202 8324 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398188.1 protein_id gnl|my_center|LOCUS_59170 9552 9313 gene locus_tag LOCUS_59180 9552 9313 CDS product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224533.1 protein_id gnl|my_center|LOCUS_59180 10471 9617 gene locus_tag LOCUS_59190 10471 9617 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136617434.1 protein_id gnl|my_center|LOCUS_59190 10926 10576 gene locus_tag LOCUS_59200 10926 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 10828 11985 gene locus_tag LOCUS_59210 10828 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 11994 12725 gene locus_tag LOCUS_59220 11994 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 12722 13474 gene locus_tag LOCUS_59230 12722 13474 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665624.1 protein_id gnl|my_center|LOCUS_59230 14027 13515 gene locus_tag LOCUS_59240 14027 13515 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 protein_id gnl|my_center|LOCUS_59240 14113 14679 gene locus_tag LOCUS_59250 14113 14679 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_59250 15131 14766 gene locus_tag LOCUS_59260 15131 14766 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031557.1 protein_id gnl|my_center|LOCUS_59260 16739 15687 gene locus_tag LOCUS_59270 16739 15687 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_59270 18064 16967 gene locus_tag LOCUS_59280 18064 16967 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199431534.1 protein_id gnl|my_center|LOCUS_59280 18475 19401 gene locus_tag LOCUS_59290 18475 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 19419 20762 gene locus_tag LOCUS_59300 19419 20762 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668699.1 protein_id gnl|my_center|LOCUS_59300 21958 20861 gene locus_tag LOCUS_59310 21958 20861 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966730.1 protein_id gnl|my_center|LOCUS_59310 22040 22426 gene locus_tag LOCUS_59320 22040 22426 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728052.1 protein_id gnl|my_center|LOCUS_59320 24257 22965 gene locus_tag LOCUS_59330 24257 22965 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_59330 24857 24345 gene locus_tag LOCUS_59340 24857 24345 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_59340 24921 25664 gene locus_tag LOCUS_59350 24921 25664 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804160.1 protein_id gnl|my_center|LOCUS_59350 27418 26009 gene locus_tag LOCUS_59360 gene mrx(A) 27418 26009 CDS product macrolide resistance MFS transporter Mrx(A) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004159.1 protein_id gnl|my_center|LOCUS_59360 28104 27415 gene locus_tag LOCUS_59370 28104 27415 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226757.1 protein_id gnl|my_center|LOCUS_59370 28732 28199 gene locus_tag LOCUS_59380 28732 28199 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 protein_id gnl|my_center|LOCUS_59380 28773 29711 gene locus_tag LOCUS_59390 28773 29711 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 protein_id gnl|my_center|LOCUS_59390 30550 29771 gene locus_tag LOCUS_59400 30550 29771 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_59400 30847 31569 gene locus_tag LOCUS_59410 30847 31569 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037896947.1 protein_id gnl|my_center|LOCUS_59410 31975 31589 gene locus_tag LOCUS_59420 31975 31589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 32540 32169 gene locus_tag LOCUS_59430 32540 32169 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864690.1 protein_id gnl|my_center|LOCUS_59430 32968 32711 gene locus_tag LOCUS_59440 32968 32711 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_59440 33173 33739 gene locus_tag LOCUS_59450 33173 33739 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729836.1 protein_id gnl|my_center|LOCUS_59450 34655 33840 gene locus_tag LOCUS_59460 34655 33840 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484635.1 protein_id gnl|my_center|LOCUS_59460 35587 34772 gene locus_tag LOCUS_59470 35587 34772 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325650.1 protein_id gnl|my_center|LOCUS_59470 35836 36978 gene locus_tag LOCUS_59480 35836 36978 CDS product galactosyldiacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484813.1 protein_id gnl|my_center|LOCUS_59480 37135 38265 gene locus_tag LOCUS_59490 37135 38265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 41658 38359 gene locus_tag LOCUS_59500 41658 38359 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027471.1 protein_id gnl|my_center|LOCUS_59500 42003 43241 gene locus_tag LOCUS_59510 gene thrS 42003 43241 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485230.1 protein_id gnl|my_center|LOCUS_59510 43501 43355 gene locus_tag LOCUS_59520 43501 43355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59520 44251 44982 gene locus_tag LOCUS_59530 44251 44982 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226077.1 protein_id gnl|my_center|LOCUS_59530 45117 47012 gene locus_tag LOCUS_59540 45117 47012 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_59540 48054 47041 gene locus_tag LOCUS_59550 48054 47041 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_59550 48609 48142 gene locus_tag LOCUS_59560 48609 48142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 49471 48683 gene locus_tag LOCUS_59570 49471 48683 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495273.1 protein_id gnl|my_center|LOCUS_59570 49850 50164 gene locus_tag LOCUS_59580 49850 50164 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325219.1 protein_id gnl|my_center|LOCUS_59580 50224 50988 gene locus_tag LOCUS_59590 50224 50988 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_59590 51607 51116 gene locus_tag LOCUS_59600 51607 51116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 51657 51848 gene locus_tag LOCUS_59610 51657 51848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 52678 52025 gene locus_tag LOCUS_59620 52678 52025 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971839.1 protein_id gnl|my_center|LOCUS_59620 53714 52770 gene locus_tag LOCUS_59630 53714 52770 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_59630 55287 53938 gene locus_tag LOCUS_59640 55287 53938 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112212.1 protein_id gnl|my_center|LOCUS_59640 55885 55409 gene locus_tag LOCUS_59650 55885 55409 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_59650 57302 55944 gene locus_tag LOCUS_59660 57302 55944 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727463.1 protein_id gnl|my_center|LOCUS_59660 57899 57393 gene locus_tag LOCUS_59670 57899 57393 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_59670 59331 58210 gene locus_tag LOCUS_59680 59331 58210 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226155.1 protein_id gnl|my_center|LOCUS_59680 60465 59638 gene locus_tag LOCUS_59690 60465 59638 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228166.1 protein_id gnl|my_center|LOCUS_59690 62092 60557 gene locus_tag LOCUS_59700 62092 60557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027383.1 protein_id gnl|my_center|LOCUS_59700 63329 62175 gene locus_tag LOCUS_59710 63329 62175 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028309.1 protein_id gnl|my_center|LOCUS_59710 63510 64403 gene locus_tag LOCUS_59720 63510 64403 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978261.1 protein_id gnl|my_center|LOCUS_59720 65671 64469 gene locus_tag LOCUS_59730 65671 64469 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031879.1 protein_id gnl|my_center|LOCUS_59730 65821 66339 gene locus_tag LOCUS_59740 65821 66339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 66915 66466 gene locus_tag LOCUS_59750 66915 66466 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_59750 68681 66912 gene locus_tag LOCUS_59760 68681 66912 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027406.1 protein_id gnl|my_center|LOCUS_59760 69982 68681 gene locus_tag LOCUS_59770 69982 68681 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247588.1 protein_id gnl|my_center|LOCUS_59770 70250 71209 gene locus_tag LOCUS_59780 70250 71209 CDS product TIGR03557 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227034.1 protein_id gnl|my_center|LOCUS_59780 71426 74638 gene locus_tag LOCUS_59790 71426 74638 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226935.1 protein_id gnl|my_center|LOCUS_59790 76049 74712 gene locus_tag LOCUS_59800 76049 74712 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866777.1 protein_id gnl|my_center|LOCUS_59800 77288 76146 gene locus_tag LOCUS_59810 77288 76146 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739097.1 protein_id gnl|my_center|LOCUS_59810 77362 78663 gene locus_tag LOCUS_59820 77362 78663 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_59820 78678 79631 gene locus_tag LOCUS_59830 78678 79631 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972115.1 protein_id gnl|my_center|LOCUS_59830 79631 80449 gene locus_tag LOCUS_59840 79631 80449 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972114.1 protein_id gnl|my_center|LOCUS_59840 80446 82863 gene locus_tag LOCUS_59850 80446 82863 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026995.1 protein_id gnl|my_center|LOCUS_59850 82919 84541 gene locus_tag LOCUS_59860 82919 84541 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_59860 84908 85774 gene locus_tag LOCUS_59870 84908 85774 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_59870 85803 86588 gene locus_tag LOCUS_59880 85803 86588 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031037.1 protein_id gnl|my_center|LOCUS_59880 86710 86982 gene locus_tag LOCUS_59890 86710 86982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 88061 87051 gene locus_tag LOCUS_59900 88061 87051 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_59900 89362 88346 gene locus_tag LOCUS_59910 89362 88346 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029094.1 protein_id gnl|my_center|LOCUS_59910 90148 89564 gene locus_tag LOCUS_59920 90148 89564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 90075 91139 gene locus_tag LOCUS_59930 90075 91139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59930 91230 91421 gene locus_tag LOCUS_59940 91230 91421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59940 91418 91714 gene locus_tag LOCUS_59950 91418 91714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189750483.1 protein_id gnl|my_center|LOCUS_59950 93679 91778 gene locus_tag LOCUS_59960 93679 91778 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284089.1 protein_id gnl|my_center|LOCUS_59960 93813 94529 gene locus_tag LOCUS_59970 93813 94529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 95130 94561 gene locus_tag LOCUS_59980 95130 94561 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031405.1 protein_id gnl|my_center|LOCUS_59980 95205 96017 gene locus_tag LOCUS_59990 95205 96017 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224573.1 protein_id gnl|my_center|LOCUS_59990 96546 95956 gene locus_tag LOCUS_60000 96546 95956 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027648.1 protein_id gnl|my_center|LOCUS_60000 96660 98300 gene locus_tag LOCUS_60010 96660 98300 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729718.1 protein_id gnl|my_center|LOCUS_60010 99009 98338 gene locus_tag LOCUS_60020 99009 98338 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775785.1 protein_id gnl|my_center|LOCUS_60020 99222 99686 gene locus_tag LOCUS_60030 99222 99686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 99683 101011 gene locus_tag LOCUS_60040 99683 101011 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223277.1 protein_id gnl|my_center|LOCUS_60040 101597 101040 gene locus_tag LOCUS_60050 101597 101040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971403.1 protein_id gnl|my_center|LOCUS_60050 103748 101601 gene locus_tag LOCUS_60060 103748 101601 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031868.1 protein_id gnl|my_center|LOCUS_60060 105303 103858 gene locus_tag LOCUS_60070 105303 103858 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_60070 106408 105479 gene locus_tag LOCUS_60080 106408 105479 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971587.1 protein_id gnl|my_center|LOCUS_60080 107501 106428 gene locus_tag LOCUS_60090 107501 106428 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971588.1 protein_id gnl|my_center|LOCUS_60090 108986 107622 gene locus_tag LOCUS_60100 108986 107622 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971589.1 protein_id gnl|my_center|LOCUS_60100 109260 110288 gene locus_tag LOCUS_60110 109260 110288 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971590.1 protein_id gnl|my_center|LOCUS_60110 110492 111730 gene locus_tag LOCUS_60120 110492 111730 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_60120 111763 112638 gene locus_tag LOCUS_60130 111763 112638 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_60130 112684 113355 gene locus_tag LOCUS_60140 112684 113355 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_60140 113917 113378 gene locus_tag LOCUS_60150 113917 113378 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002063889.1 protein_id gnl|my_center|LOCUS_60150 118284 113914 gene locus_tag LOCUS_60160 118284 113914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60160 118830 118369 gene locus_tag LOCUS_60170 118830 118369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 119838 118846 gene locus_tag LOCUS_60180 119838 118846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 120297 121502 gene locus_tag LOCUS_60190 120297 121502 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031724.1 protein_id gnl|my_center|LOCUS_60190 121600 121989 gene locus_tag LOCUS_60200 121600 121989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 122077 122799 gene locus_tag LOCUS_60210 122077 122799 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028974.1 protein_id gnl|my_center|LOCUS_60210 123958 122900 gene locus_tag LOCUS_60220 123958 122900 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978084.1 protein_id gnl|my_center|LOCUS_60220 124440 124955 gene locus_tag LOCUS_60230 124440 124955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 125332 125135 gene locus_tag LOCUS_60240 125332 125135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 125855 125523 gene locus_tag LOCUS_60250 125855 125523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 125901 125966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 126797 125973 gene locus_tag LOCUS_60260 126797 125973 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730620.1 protein_id gnl|my_center|LOCUS_60260 127311 126901 gene locus_tag LOCUS_60270 127311 126901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 >Feature sequence25 1150 551 gene locus_tag LOCUS_60280 1150 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 1256 2164 gene locus_tag LOCUS_60290 1256 2164 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971873.1 protein_id gnl|my_center|LOCUS_60290 2167 2841 gene locus_tag LOCUS_60300 2167 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60300 3434 3042 gene locus_tag LOCUS_60310 3434 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 4235 4693 gene locus_tag LOCUS_60320 gene crcB 4235 4693 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_60320 4690 5061 gene locus_tag LOCUS_60330 gene crcB 4690 5061 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_60330 5925 5353 gene locus_tag LOCUS_60340 5925 5353 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530368.1 protein_id gnl|my_center|LOCUS_60340 6357 7184 gene locus_tag LOCUS_60350 6357 7184 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037318.1 protein_id gnl|my_center|LOCUS_60350 7768 7475 gene locus_tag LOCUS_60360 7768 7475 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031812.1 protein_id gnl|my_center|LOCUS_60360 8306 7779 gene locus_tag LOCUS_60370 8306 7779 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031813.1 protein_id gnl|my_center|LOCUS_60370 8754 8476 gene locus_tag LOCUS_60380 8754 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 8885 9577 gene locus_tag LOCUS_60390 8885 9577 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730773.1 protein_id gnl|my_center|LOCUS_60390 9665 10627 gene locus_tag LOCUS_60400 9665 10627 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_60400 10758 11750 gene locus_tag LOCUS_60410 10758 11750 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107014379.1 protein_id gnl|my_center|LOCUS_60410 12673 12942 gene locus_tag LOCUS_60420 12673 12942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 13612 13010 gene locus_tag LOCUS_60430 13612 13010 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892317.1 protein_id gnl|my_center|LOCUS_60430 14223 13708 gene locus_tag LOCUS_60440 14223 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 14892 14224 gene locus_tag LOCUS_60450 14892 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60450 15200 14886 gene locus_tag LOCUS_60460 15200 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60460 15692 17431 gene locus_tag LOCUS_60470 15692 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60470 17556 17819 gene locus_tag LOCUS_60480 17556 17819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60480 18085 17732 gene locus_tag LOCUS_60490 18085 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 18467 17982 gene locus_tag LOCUS_60500 18467 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 19412 18519 gene locus_tag LOCUS_60510 19412 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60510 20131 19646 gene locus_tag LOCUS_60520 20131 19646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 20452 21102 gene locus_tag LOCUS_60530 20452 21102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 21673 21849 gene locus_tag LOCUS_60540 21673 21849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60540 22697 22263 gene locus_tag LOCUS_60550 22697 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60550 24229 22967 gene locus_tag LOCUS_60560 24229 22967 CDS product IS701-like element ISBj6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038951335.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_60560 24534 26702 gene locus_tag LOCUS_60570 24534 26702 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031424.1 protein_id gnl|my_center|LOCUS_60570 26710 27969 gene locus_tag LOCUS_60580 26710 27969 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027103.1 protein_id gnl|my_center|LOCUS_60580 27966 28658 gene locus_tag LOCUS_60590 27966 28658 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978444.1 protein_id gnl|my_center|LOCUS_60590 29939 28743 gene locus_tag LOCUS_60600 29939 28743 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030555.1 protein_id gnl|my_center|LOCUS_60600 31378 29936 gene locus_tag LOCUS_60610 31378 29936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973075.1 protein_id gnl|my_center|LOCUS_60610 32723 31809 gene locus_tag LOCUS_60620 32723 31809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 33037 33189 gene locus_tag LOCUS_60630 33037 33189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 33332 34189 gene locus_tag LOCUS_60640 33332 34189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 34241 34498 gene locus_tag LOCUS_60650 34241 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 34956 34561 gene locus_tag LOCUS_60660 34956 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 34891 35226 gene locus_tag LOCUS_60670 34891 35226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60670 35223 36587 gene locus_tag LOCUS_60680 35223 36587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 36924 37100 gene locus_tag LOCUS_60690 36924 37100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976837.1 protein_id gnl|my_center|LOCUS_60690 38079 37126 gene locus_tag LOCUS_60700 38079 37126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60700 38990 38076 gene locus_tag LOCUS_60710 38990 38076 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380364.1 protein_id gnl|my_center|LOCUS_60710 40433 39075 gene locus_tag LOCUS_60720 40433 39075 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552177.1 protein_id gnl|my_center|LOCUS_60720 41700 40717 gene locus_tag LOCUS_60730 41700 40717 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_60730 41872 42915 gene locus_tag LOCUS_60740 41872 42915 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_60740 44394 43090 gene locus_tag LOCUS_60750 44394 43090 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_60750 45529 44567 gene locus_tag LOCUS_60760 45529 44567 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_60760 46382 45600 gene locus_tag LOCUS_60770 46382 45600 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_60770 47030 46608 gene locus_tag LOCUS_60780 47030 46608 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_60780 47123 47539 gene locus_tag LOCUS_60790 47123 47539 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_60790 47716 48438 gene locus_tag LOCUS_60800 47716 48438 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_60800 49212 48520 gene locus_tag LOCUS_60810 49212 48520 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098829.1 protein_id gnl|my_center|LOCUS_60810 50419 49349 gene locus_tag LOCUS_60820 50419 49349 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_60820 51183 50416 gene locus_tag LOCUS_60830 51183 50416 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_60830 52695 51298 gene locus_tag LOCUS_60840 52695 51298 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977741.1 protein_id gnl|my_center|LOCUS_60840 52991 53641 gene locus_tag LOCUS_60850 52991 53641 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027567.1 protein_id gnl|my_center|LOCUS_60850 54652 53732 gene locus_tag LOCUS_60860 54652 53732 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_60860 54811 55731 gene locus_tag LOCUS_60870 54811 55731 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223330.1 protein_id gnl|my_center|LOCUS_60870 56266 55706 gene locus_tag LOCUS_60880 56266 55706 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_60880 57326 56415 gene locus_tag LOCUS_60890 57326 56415 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_60890 58246 57326 gene locus_tag LOCUS_60900 58246 57326 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969645.1 protein_id gnl|my_center|LOCUS_60900 59232 58243 gene locus_tag LOCUS_60910 59232 58243 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_60910 60638 59256 gene locus_tag LOCUS_60920 60638 59256 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972377.1 protein_id gnl|my_center|LOCUS_60920 60787 61581 gene locus_tag LOCUS_60930 60787 61581 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976948.1 protein_id gnl|my_center|LOCUS_60930 61686 62972 gene locus_tag LOCUS_60940 61686 62972 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971515.1 protein_id gnl|my_center|LOCUS_60940 62969 63655 gene locus_tag LOCUS_60950 62969 63655 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803815.1 protein_id gnl|my_center|LOCUS_60950 63640 64719 gene locus_tag LOCUS_60960 63640 64719 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803814.1 protein_id gnl|my_center|LOCUS_60960 65033 68206 gene locus_tag LOCUS_60970 65033 68206 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_60970 68199 70595 gene locus_tag LOCUS_60980 68199 70595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 72022 70751 gene locus_tag LOCUS_60990 72022 70751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 72405 73064 gene locus_tag LOCUS_61000 72405 73064 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027575.1 protein_id gnl|my_center|LOCUS_61000 73158 74093 gene locus_tag LOCUS_61010 73158 74093 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027576.1 protein_id gnl|my_center|LOCUS_61010 74127 74831 gene locus_tag LOCUS_61020 74127 74831 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977730.1 protein_id gnl|my_center|LOCUS_61020 74851 75546 gene locus_tag LOCUS_61030 74851 75546 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027577.1 protein_id gnl|my_center|LOCUS_61030 75928 77277 gene locus_tag LOCUS_61040 75928 77277 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_61040 78267 77353 gene locus_tag LOCUS_61050 78267 77353 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328866.1 protein_id gnl|my_center|LOCUS_61050 78519 80750 gene locus_tag LOCUS_61060 78519 80750 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_61060 81458 80880 gene locus_tag LOCUS_61070 81458 80880 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898165.1 protein_id gnl|my_center|LOCUS_61070 81655 82794 gene locus_tag LOCUS_61080 81655 82794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 82831 82877 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 83910 82966 gene locus_tag LOCUS_61090 83910 82966 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226531.1 protein_id gnl|my_center|LOCUS_61090 83955 84836 gene locus_tag LOCUS_61100 83955 84836 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_61100 85086 86108 gene locus_tag LOCUS_61110 85086 86108 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083943.1 protein_id gnl|my_center|LOCUS_61110 86322 87692 gene locus_tag LOCUS_61120 86322 87692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61120 88236 89552 gene locus_tag LOCUS_61130 88236 89552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61130 89982 89566 gene locus_tag LOCUS_61140 89982 89566 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226985.1 protein_id gnl|my_center|LOCUS_61140 91079 89979 gene locus_tag LOCUS_61150 91079 89979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61150 91732 91076 gene locus_tag LOCUS_61160 91732 91076 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226988.1 protein_id gnl|my_center|LOCUS_61160 92214 91765 gene locus_tag LOCUS_61170 92214 91765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61170 93335 92319 gene locus_tag LOCUS_61180 93335 92319 CDS product anti-sigma factor RsbA family regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027235.1 protein_id gnl|my_center|LOCUS_61180 93642 94742 gene locus_tag LOCUS_61190 93642 94742 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031591.1 protein_id gnl|my_center|LOCUS_61190 95391 94834 gene locus_tag LOCUS_61200 95391 94834 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 protein_id gnl|my_center|LOCUS_61200 95699 96355 gene locus_tag LOCUS_61210 95699 96355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 97114 96422 gene locus_tag LOCUS_61220 97114 96422 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727713.1 protein_id gnl|my_center|LOCUS_61220 98322 97300 gene locus_tag LOCUS_61230 98322 97300 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726677.1 protein_id gnl|my_center|LOCUS_61230 98486 99202 gene locus_tag LOCUS_61240 98486 99202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139575.1 protein_id gnl|my_center|LOCUS_61240 100426 99293 gene locus_tag LOCUS_61250 100426 99293 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229937.1 protein_id gnl|my_center|LOCUS_61250 101719 100757 gene locus_tag LOCUS_61260 101719 100757 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225890812.1 protein_id gnl|my_center|LOCUS_61260 103695 102439 gene locus_tag LOCUS_61270 103695 102439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 104036 103773 gene locus_tag LOCUS_61280 104036 103773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 105201 104173 gene locus_tag LOCUS_61290 105201 104173 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224942.1 protein_id gnl|my_center|LOCUS_61290 106553 105651 gene locus_tag LOCUS_61300 106553 105651 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229445.1 protein_id gnl|my_center|LOCUS_61300 107718 106726 gene locus_tag LOCUS_61310 107718 106726 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_61310 108051 109775 gene locus_tag LOCUS_61320 108051 109775 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_61320 109958 111328 gene locus_tag LOCUS_61330 109958 111328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61330 112004 111519 gene locus_tag LOCUS_61340 112004 111519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 112182 112709 gene locus_tag LOCUS_61350 112182 112709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 112790 113665 gene locus_tag LOCUS_61360 112790 113665 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_61360 114025 114441 gene locus_tag LOCUS_61370 114025 114441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 114438 117329 gene locus_tag LOCUS_61380 114438 117329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 117891 117580 gene locus_tag LOCUS_61390 117891 117580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 118495 118136 gene locus_tag LOCUS_61400 118495 118136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61400 >Feature sequence26 <1 660 gene locus_tag LOCUS_61410 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031635.1:3'-5' exonuclease 1081 668 gene locus_tag LOCUS_61420 1081 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 1169 1609 gene locus_tag LOCUS_61430 1169 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 2461 1859 gene locus_tag LOCUS_61440 2461 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486010.1 protein_id gnl|my_center|LOCUS_61440 2600 4333 gene locus_tag LOCUS_61450 2600 4333 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_61450 4870 4370 gene locus_tag LOCUS_61460 4870 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325223.1 protein_id gnl|my_center|LOCUS_61460 4964 5527 gene locus_tag LOCUS_61470 4964 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 5601 6512 gene locus_tag LOCUS_61480 5601 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61480 6509 7270 gene locus_tag LOCUS_61490 6509 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 7851 7378 gene locus_tag LOCUS_61500 7851 7378 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225071.1 protein_id gnl|my_center|LOCUS_61500 8523 7966 gene locus_tag LOCUS_61510 8523 7966 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_61510 9624 8695 gene locus_tag LOCUS_61520 9624 8695 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027243.1 protein_id gnl|my_center|LOCUS_61520 9848 10576 gene locus_tag LOCUS_61530 9848 10576 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819623.1 protein_id gnl|my_center|LOCUS_61530 11095 10589 gene locus_tag LOCUS_61540 11095 10589 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048389.1 protein_id gnl|my_center|LOCUS_61540 11390 12058 gene locus_tag LOCUS_61550 11390 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 13270 12107 gene locus_tag LOCUS_61560 13270 12107 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728503.1 protein_id gnl|my_center|LOCUS_61560 14555 13365 gene locus_tag LOCUS_61570 14555 13365 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728502.1 protein_id gnl|my_center|LOCUS_61570 15168 14614 gene locus_tag LOCUS_61580 gene ssuE 15168 14614 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808029.1 protein_id gnl|my_center|LOCUS_61580 15419 15213 gene locus_tag LOCUS_61590 15419 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 15805 16758 gene locus_tag LOCUS_61600 15805 16758 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943414.1 protein_id gnl|my_center|LOCUS_61600 17830 16790 gene locus_tag LOCUS_61610 17830 16790 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284494.1 protein_id gnl|my_center|LOCUS_61610 18296 17904 gene locus_tag LOCUS_61620 18296 17904 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864582.1 protein_id gnl|my_center|LOCUS_61620 19293 18364 gene locus_tag LOCUS_61630 19293 18364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 19608 19766 gene locus_tag LOCUS_61640 19608 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 21095 19827 gene locus_tag LOCUS_61650 21095 19827 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026984.1 protein_id gnl|my_center|LOCUS_61650 24188 21099 gene locus_tag LOCUS_61660 24188 21099 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_61660 25571 24198 gene locus_tag LOCUS_61670 25571 24198 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_61670 26338 25568 gene locus_tag LOCUS_61680 26338 25568 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891901.1 protein_id gnl|my_center|LOCUS_61680 26446 27501 gene locus_tag LOCUS_61690 26446 27501 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223243.1 protein_id gnl|my_center|LOCUS_61690 27541 28821 gene locus_tag LOCUS_61700 27541 28821 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775953.1 protein_id gnl|my_center|LOCUS_61700 28823 29782 gene locus_tag LOCUS_61710 28823 29782 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_61710 29819 30646 gene locus_tag LOCUS_61720 29819 30646 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775955.1 protein_id gnl|my_center|LOCUS_61720 30643 33591 gene locus_tag LOCUS_61730 30643 33591 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084830245.1 protein_id gnl|my_center|LOCUS_61730 33716 34198 gene locus_tag LOCUS_61740 33716 34198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 34439 35095 gene locus_tag LOCUS_61750 34439 35095 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028033.1 protein_id gnl|my_center|LOCUS_61750 35128 36030 gene locus_tag LOCUS_61760 35128 36030 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976931.1 protein_id gnl|my_center|LOCUS_61760 36027 37790 gene locus_tag LOCUS_61770 gene araD 36027 37790 CDS product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028032.1 protein_id gnl|my_center|LOCUS_61770 37835 38764 gene locus_tag LOCUS_61780 37835 38764 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976933.1 protein_id gnl|my_center|LOCUS_61780 38761 39672 gene locus_tag LOCUS_61790 38761 39672 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976934.1 protein_id gnl|my_center|LOCUS_61790 39669 40853 gene locus_tag LOCUS_61800 39669 40853 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028031.1 protein_id gnl|my_center|LOCUS_61800 40850 41674 gene locus_tag LOCUS_61810 40850 41674 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976936.1 protein_id gnl|my_center|LOCUS_61810 41671 43356 gene locus_tag LOCUS_61820 41671 43356 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_61820 43353 44690 gene locus_tag LOCUS_61830 43353 44690 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325939.1 protein_id gnl|my_center|LOCUS_61830 45414 44920 gene locus_tag LOCUS_61840 45414 44920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61840 47208 45658 gene locus_tag LOCUS_61850 47208 45658 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967746.1 protein_id gnl|my_center|LOCUS_61850 49486 47513 gene locus_tag LOCUS_61860 49486 47513 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_61860 50015 49602 gene locus_tag LOCUS_61870 50015 49602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 50323 51186 gene locus_tag LOCUS_61880 50323 51186 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_61880 52174 51308 gene locus_tag LOCUS_61890 52174 51308 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 protein_id gnl|my_center|LOCUS_61890 53005 52334 gene locus_tag LOCUS_61900 53005 52334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 53942 53112 gene locus_tag LOCUS_61910 53942 53112 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072477587.1 protein_id gnl|my_center|LOCUS_61910 57335 54084 gene locus_tag LOCUS_61920 57335 54084 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308744.1 protein_id gnl|my_center|LOCUS_61920 57591 58511 gene locus_tag LOCUS_61930 57591 58511 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225469.1 protein_id gnl|my_center|LOCUS_61930 58780 59991 gene locus_tag LOCUS_61940 58780 59991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 60287 60706 gene locus_tag LOCUS_61950 60287 60706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031939.1 protein_id gnl|my_center|LOCUS_61950 61788 60949 gene locus_tag LOCUS_61960 61788 60949 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_61960 61934 62812 gene locus_tag LOCUS_61970 61934 62812 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971433.1 protein_id gnl|my_center|LOCUS_61970 62923 63489 gene locus_tag LOCUS_61980 62923 63489 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 protein_id gnl|my_center|LOCUS_61980 64534 63788 gene locus_tag LOCUS_61990 64534 63788 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057383.1 protein_id gnl|my_center|LOCUS_61990 66045 64531 gene locus_tag LOCUS_62000 66045 64531 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730746.1 protein_id gnl|my_center|LOCUS_62000 66149 66784 gene locus_tag LOCUS_62010 66149 66784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 66791 66958 gene locus_tag LOCUS_62020 66791 66958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 67027 67551 gene locus_tag LOCUS_62030 67027 67551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 67569 67979 gene locus_tag LOCUS_62040 67569 67979 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_62040 68038 68697 gene locus_tag LOCUS_62050 68038 68697 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228116.1 protein_id gnl|my_center|LOCUS_62050 69024 68707 gene locus_tag LOCUS_62060 69024 68707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 69249 69986 gene locus_tag LOCUS_62070 69249 69986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62070 70257 74030 gene locus_tag LOCUS_62080 70257 74030 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031481.1 protein_id gnl|my_center|LOCUS_62080 74814 74149 gene locus_tag LOCUS_62090 74814 74149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 75573 74836 gene locus_tag LOCUS_62100 75573 74836 CDS product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 protein_id gnl|my_center|LOCUS_62100 76292 75570 gene locus_tag LOCUS_62110 76292 75570 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 protein_id gnl|my_center|LOCUS_62110 77129 77674 gene locus_tag LOCUS_62120 77129 77674 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 protein_id gnl|my_center|LOCUS_62120 78020 78487 gene locus_tag LOCUS_62130 78020 78487 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469843.1 protein_id gnl|my_center|LOCUS_62130 78471 78650 gene locus_tag LOCUS_62140 78471 78650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 79515 78619 gene locus_tag LOCUS_62150 79515 78619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 80018 79578 gene locus_tag LOCUS_62160 80018 79578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 80238 80969 gene locus_tag LOCUS_62170 80238 80969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 81422 81048 gene locus_tag LOCUS_62180 81422 81048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 81842 82663 gene locus_tag LOCUS_62190 81842 82663 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031781.1 protein_id gnl|my_center|LOCUS_62190 82660 82911 gene locus_tag LOCUS_62200 82660 82911 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971528.1 protein_id gnl|my_center|LOCUS_62200 82995 83831 gene locus_tag LOCUS_62210 82995 83831 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971527.1 protein_id gnl|my_center|LOCUS_62210 84878 83976 gene locus_tag LOCUS_62220 84878 83976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 85458 85102 gene locus_tag LOCUS_62230 85458 85102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 85623 88640 gene locus_tag LOCUS_62240 85623 88640 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228172.1 protein_id gnl|my_center|LOCUS_62240 88812 89687 gene locus_tag LOCUS_62250 88812 89687 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976361.1 protein_id gnl|my_center|LOCUS_62250 89803 92148 gene locus_tag LOCUS_62260 89803 92148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 92327 93118 gene locus_tag LOCUS_62270 92327 93118 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527060.1 protein_id gnl|my_center|LOCUS_62270 93254 93619 gene locus_tag LOCUS_62280 93254 93619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 93565 93828 gene locus_tag LOCUS_62290 93565 93828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 95468 93924 gene locus_tag LOCUS_62300 95468 93924 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485437.1 protein_id gnl|my_center|LOCUS_62300 96078 95656 gene locus_tag LOCUS_62310 96078 95656 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087865.1 protein_id gnl|my_center|LOCUS_62310 96275 97003 gene locus_tag LOCUS_62320 96275 97003 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_62320 97289 97597 gene locus_tag LOCUS_62330 97289 97597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 97602 98288 gene locus_tag LOCUS_62340 97602 98288 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325244.1 protein_id gnl|my_center|LOCUS_62340 98269 98541 gene locus_tag LOCUS_62350 98269 98541 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484482.1 protein_id gnl|my_center|LOCUS_62350 98538 99560 gene locus_tag LOCUS_62360 98538 99560 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_62360 99898 100218 gene locus_tag LOCUS_62370 99898 100218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 100276 100794 gene locus_tag LOCUS_62380 100276 100794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 100794 101540 gene locus_tag LOCUS_62390 100794 101540 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027273.1 protein_id gnl|my_center|LOCUS_62390 101542 101880 gene locus_tag LOCUS_62400 101542 101880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 101889 102257 gene locus_tag LOCUS_62410 101889 102257 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978207.1 protein_id gnl|my_center|LOCUS_62410 102254 103054 gene locus_tag LOCUS_62420 102254 103054 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027276.1 protein_id gnl|my_center|LOCUS_62420 103057 103287 gene locus_tag LOCUS_62430 103057 103287 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978205.1 protein_id gnl|my_center|LOCUS_62430 103284 103562 gene locus_tag LOCUS_62440 103284 103562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62440 103801 105924 gene locus_tag LOCUS_62450 103801 105924 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_62450 107020 107460 gene locus_tag LOCUS_62460 107020 107460 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810737.1 protein_id gnl|my_center|LOCUS_62460 107571 108425 gene locus_tag LOCUS_62470 107571 108425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031647.1 protein_id gnl|my_center|LOCUS_62470 108854 108432 gene locus_tag LOCUS_62480 108854 108432 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027404.1 protein_id gnl|my_center|LOCUS_62480 109457 109777 gene locus_tag LOCUS_62490 109457 109777 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974275.1 protein_id gnl|my_center|LOCUS_62490 109945 110202 gene locus_tag LOCUS_62500 109945 110202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62500 111237 110305 gene locus_tag LOCUS_62510 111237 110305 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_62510 111476 111802 gene locus_tag LOCUS_62520 111476 111802 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429484.1 protein_id gnl|my_center|LOCUS_62520 111799 112155 gene locus_tag LOCUS_62530 111799 112155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 112157 112483 gene locus_tag LOCUS_62540 112157 112483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 >Feature sequence27 252 1043 gene locus_tag LOCUS_62550 252 1043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_62550 4164 1024 gene locus_tag LOCUS_62560 4164 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 4775 4368 gene locus_tag LOCUS_62570 4775 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 5873 5094 gene locus_tag LOCUS_62580 5873 5094 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223724.1 protein_id gnl|my_center|LOCUS_62580 5760 6149 gene locus_tag LOCUS_62590 5760 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 6343 7320 gene locus_tag LOCUS_62600 6343 7320 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093945347.1 protein_id gnl|my_center|LOCUS_62600 7510 7725 gene locus_tag LOCUS_62610 7510 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62610 7994 8827 gene locus_tag LOCUS_62620 7994 8827 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971512.1 protein_id gnl|my_center|LOCUS_62620 9209 8925 gene locus_tag LOCUS_62630 9209 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62630 11385 9520 gene locus_tag LOCUS_62640 11385 9520 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_62640 13260 11473 gene locus_tag LOCUS_62650 13260 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62650 13742 15484 gene locus_tag LOCUS_62660 13742 15484 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_62660 16209 15400 gene locus_tag LOCUS_62670 16209 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 16761 16279 gene locus_tag LOCUS_62680 16761 16279 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_62680 17095 17718 gene locus_tag LOCUS_62690 17095 17718 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_62690 17892 18776 gene locus_tag LOCUS_62700 17892 18776 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_62700 18940 19632 gene locus_tag LOCUS_62710 18940 19632 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_62710 21424 19745 gene locus_tag LOCUS_62720 21424 19745 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029615.1 protein_id gnl|my_center|LOCUS_62720 21720 22928 gene locus_tag LOCUS_62730 21720 22928 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 protein_id gnl|my_center|LOCUS_62730 23070 23366 gene locus_tag LOCUS_62740 23070 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 24245 23418 gene locus_tag LOCUS_62750 24245 23418 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967091.1 protein_id gnl|my_center|LOCUS_62750 25960 24383 gene locus_tag LOCUS_62760 25960 24383 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 protein_id gnl|my_center|LOCUS_62760 26395 27168 gene locus_tag LOCUS_62770 26395 27168 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849049.1 protein_id gnl|my_center|LOCUS_62770 28973 27198 gene locus_tag LOCUS_62780 28973 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62780 29481 28993 gene locus_tag LOCUS_62790 29481 28993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 29449 29613 gene locus_tag LOCUS_62800 29449 29613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 29745 30665 gene locus_tag LOCUS_62810 29745 30665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 31439 30843 gene locus_tag LOCUS_62820 31439 30843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 31843 31622 gene locus_tag LOCUS_62830 31843 31622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 33348 32035 gene locus_tag LOCUS_62840 33348 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 36116 33813 gene locus_tag LOCUS_62850 36116 33813 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027019.1 protein_id gnl|my_center|LOCUS_62850 36997 36359 gene locus_tag LOCUS_62860 36997 36359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 37522 37034 gene locus_tag LOCUS_62870 37522 37034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62870 38723 37680 gene locus_tag LOCUS_62880 38723 37680 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226261.1 protein_id gnl|my_center|LOCUS_62880 38833 39600 gene locus_tag LOCUS_62890 38833 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 39611 42334 gene locus_tag LOCUS_62900 39611 42334 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131337810.1 protein_id gnl|my_center|LOCUS_62900 42549 42782 gene locus_tag LOCUS_62910 42549 42782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62910 43446 45122 gene locus_tag LOCUS_62920 43446 45122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 46072 45230 gene locus_tag LOCUS_62930 46072 45230 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029194.1 protein_id gnl|my_center|LOCUS_62930 46154 46822 gene locus_tag LOCUS_62940 46154 46822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121717242.1 protein_id gnl|my_center|LOCUS_62940 47481 46840 gene locus_tag LOCUS_62950 47481 46840 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225192.1 protein_id gnl|my_center|LOCUS_62950 48217 47630 gene locus_tag LOCUS_62960 48217 47630 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974472.1 protein_id gnl|my_center|LOCUS_62960 48933 48355 gene locus_tag LOCUS_62970 48933 48355 CDS product snapalysin family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971509.1 protein_id gnl|my_center|LOCUS_62970 50389 49148 gene locus_tag LOCUS_62980 50389 49148 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747155.1 protein_id gnl|my_center|LOCUS_62980 51631 50528 gene locus_tag LOCUS_62990 51631 50528 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 protein_id gnl|my_center|LOCUS_62990 52206 51631 gene locus_tag LOCUS_63000 52206 51631 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_63000 52362 53390 gene locus_tag LOCUS_63010 52362 53390 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868968.1 protein_id gnl|my_center|LOCUS_63010 54264 53488 gene locus_tag LOCUS_63020 54264 53488 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325987.1 protein_id gnl|my_center|LOCUS_63020 54464 56653 gene locus_tag LOCUS_63030 54464 56653 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_63030 58933 56693 gene locus_tag LOCUS_63040 58933 56693 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019547503.1 protein_id gnl|my_center|LOCUS_63040 59643 59005 gene locus_tag LOCUS_63050 59643 59005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 59905 59669 gene locus_tag LOCUS_63060 59905 59669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63060 60160 60678 gene locus_tag LOCUS_63070 60160 60678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63070 63129 60682 gene locus_tag LOCUS_63080 63129 60682 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_63080 64394 63291 gene locus_tag LOCUS_63090 64394 63291 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529023.1 protein_id gnl|my_center|LOCUS_63090 64504 65142 gene locus_tag LOCUS_63100 64504 65142 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030557.1 protein_id gnl|my_center|LOCUS_63100 65380 66366 gene locus_tag LOCUS_63110 65380 66366 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031570.1 protein_id gnl|my_center|LOCUS_63110 66543 67103 gene locus_tag LOCUS_63120 66543 67103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027741.1 protein_id gnl|my_center|LOCUS_63120 70693 67694 gene locus_tag LOCUS_63130 70693 67694 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484768.1 protein_id gnl|my_center|LOCUS_63130 71109 72128 gene locus_tag LOCUS_63140 71109 72128 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225357.1 protein_id gnl|my_center|LOCUS_63140 72884 72198 gene locus_tag LOCUS_63150 72884 72198 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_63150 74065 72881 gene locus_tag LOCUS_63160 74065 72881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 74225 75211 gene locus_tag LOCUS_63170 74225 75211 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_63170 75208 76728 gene locus_tag LOCUS_63180 75208 76728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103962448.1 protein_id gnl|my_center|LOCUS_63180 76725 77501 gene locus_tag LOCUS_63190 76725 77501 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_63190 77898 78263 gene locus_tag LOCUS_63200 77898 78263 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975148.1 protein_id gnl|my_center|LOCUS_63200 79434 78292 gene locus_tag LOCUS_63210 79434 78292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 81974 79449 gene locus_tag LOCUS_63220 81974 79449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63220 82758 81967 gene locus_tag LOCUS_63230 82758 81967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 83909 82755 gene locus_tag LOCUS_63240 83909 82755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 84813 84010 gene locus_tag LOCUS_63250 84813 84010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 87104 84867 gene locus_tag LOCUS_63260 87104 84867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63260 88293 87223 gene locus_tag LOCUS_63270 88293 87223 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027499.1 protein_id gnl|my_center|LOCUS_63270 88507 89238 gene locus_tag LOCUS_63280 88507 89238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027495.1 protein_id gnl|my_center|LOCUS_63280 89310 90038 gene locus_tag LOCUS_63290 89310 90038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63290 91292 90057 gene locus_tag LOCUS_63300 91292 90057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027503.1 protein_id gnl|my_center|LOCUS_63300 92536 91289 gene locus_tag LOCUS_63310 92536 91289 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027502.1 protein_id gnl|my_center|LOCUS_63310 93609 92533 gene locus_tag LOCUS_63320 93609 92533 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027501.1 protein_id gnl|my_center|LOCUS_63320 94494 93703 gene locus_tag LOCUS_63330 94494 93703 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 protein_id gnl|my_center|LOCUS_63330 94690 95961 gene locus_tag LOCUS_63340 94690 95961 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031571.1 protein_id gnl|my_center|LOCUS_63340 97521 95968 gene locus_tag LOCUS_63350 97521 95968 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028399.1 protein_id gnl|my_center|LOCUS_63350 98266 97649 gene locus_tag LOCUS_63360 98266 97649 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 protein_id gnl|my_center|LOCUS_63360 98353 99126 gene locus_tag LOCUS_63370 98353 99126 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972643.1 protein_id gnl|my_center|LOCUS_63370 99701 100324 gene locus_tag LOCUS_63380 99701 100324 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964891.1 protein_id gnl|my_center|LOCUS_63380 100321 101655 gene locus_tag LOCUS_63390 100321 101655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 101775 102512 gene locus_tag LOCUS_63400 101775 102512 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895777.1 protein_id gnl|my_center|LOCUS_63400 103078 102491 gene locus_tag LOCUS_63410 103078 102491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 103199 103984 gene locus_tag LOCUS_63420 103199 103984 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031055.1 protein_id gnl|my_center|LOCUS_63420 103981 104184 gene locus_tag LOCUS_63430 103981 104184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 104704 106827 gene locus_tag LOCUS_63440 104704 106827 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190850422.1 protein_id gnl|my_center|LOCUS_63440 108526 106853 gene locus_tag LOCUS_63450 108526 106853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484458.1 protein_id gnl|my_center|LOCUS_63450 108668 109744 gene locus_tag LOCUS_63460 108668 109744 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029199.1 protein_id gnl|my_center|LOCUS_63460 >Feature sequence28 1477 65 gene locus_tag LOCUS_63470 1477 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63470 2937 1654 gene locus_tag LOCUS_63480 2937 1654 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_63480 3133 3990 gene locus_tag LOCUS_63490 3133 3990 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029127.1 protein_id gnl|my_center|LOCUS_63490 4563 4021 gene locus_tag LOCUS_63500 4563 4021 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_63500 4695 5669 gene locus_tag LOCUS_63510 4695 5669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_63510 5666 7324 gene locus_tag LOCUS_63520 5666 7324 CDS product ABC transporter membrane-spanning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029130.1 protein_id gnl|my_center|LOCUS_63520 8703 7375 gene locus_tag LOCUS_63530 8703 7375 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_63530 9567 8908 gene locus_tag LOCUS_63540 9567 8908 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_63540 10928 9564 gene locus_tag LOCUS_63550 10928 9564 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029134.1 protein_id gnl|my_center|LOCUS_63550 12012 11095 gene locus_tag LOCUS_63560 12012 11095 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_63560 13433 12174 gene locus_tag LOCUS_63570 13433 12174 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205624253.1 protein_id gnl|my_center|LOCUS_63570 14773 13556 gene locus_tag LOCUS_63580 gene kynU 14773 13556 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_63580 15611 14766 gene locus_tag LOCUS_63590 15611 14766 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_63590 16537 15704 gene locus_tag LOCUS_63600 16537 15704 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030168.1 protein_id gnl|my_center|LOCUS_63600 17237 16824 gene locus_tag LOCUS_63610 17237 16824 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_63610 18867 17359 gene locus_tag LOCUS_63620 18867 17359 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_63620 20064 18892 gene locus_tag LOCUS_63630 20064 18892 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027114.1 protein_id gnl|my_center|LOCUS_63630 21187 20156 gene locus_tag LOCUS_63640 gene fbaA 21187 20156 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_63640 21837 21292 gene locus_tag LOCUS_63650 gene pyrE 21837 21292 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_63650 22692 21874 gene locus_tag LOCUS_63660 22692 21874 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_63660 23837 22728 gene locus_tag LOCUS_63670 23837 22728 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029331.1 protein_id gnl|my_center|LOCUS_63670 25577 23919 gene locus_tag LOCUS_63680 25577 23919 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029148.1 protein_id gnl|my_center|LOCUS_63680 26213 25695 gene locus_tag LOCUS_63690 26213 25695 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_63690 27232 28476 gene locus_tag LOCUS_63700 27232 28476 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_63700 29109 28795 gene locus_tag LOCUS_63710 29109 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63710 29615 29106 gene locus_tag LOCUS_63720 29615 29106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63720 29517 30377 gene locus_tag LOCUS_63730 29517 30377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63730 30987 30418 gene locus_tag LOCUS_63740 30987 30418 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 protein_id gnl|my_center|LOCUS_63740 33828 31159 gene locus_tag LOCUS_63750 gene clpB 33828 31159 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_63750 33998 34402 gene locus_tag LOCUS_63760 33998 34402 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_63760 34854 34534 gene locus_tag LOCUS_63770 34854 34534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975277.1 protein_id gnl|my_center|LOCUS_63770 35147 36130 gene locus_tag LOCUS_63780 35147 36130 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680919.1 protein_id gnl|my_center|LOCUS_63780 36258 37274 gene locus_tag LOCUS_63790 36258 37274 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680919.1 protein_id gnl|my_center|LOCUS_63790 37933 37457 gene locus_tag LOCUS_63800 37933 37457 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_63800 39144 37939 gene locus_tag LOCUS_63810 gene dnaJ 39144 37939 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_63810 39887 39207 gene locus_tag LOCUS_63820 gene grpE 39887 39207 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_63820 41749 39884 gene locus_tag LOCUS_63830 gene dnaK 41749 39884 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_63830 42003 42788 gene locus_tag LOCUS_63840 42003 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 42886 45165 gene locus_tag LOCUS_63850 42886 45165 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_63850 45391 46530 gene locus_tag LOCUS_63860 45391 46530 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029157.1 protein_id gnl|my_center|LOCUS_63860 47098 46589 gene locus_tag LOCUS_63870 47098 46589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63870 47021 47626 gene locus_tag LOCUS_63880 47021 47626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63880 47970 47692 gene locus_tag LOCUS_63890 47970 47692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63890 48015 48251 gene locus_tag LOCUS_63900 48015 48251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 48769 48194 gene locus_tag LOCUS_63910 gene dcd 48769 48194 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_63910 49202 49275 gene locus_tag LOCUS_t00700 49202 49275 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 50764 49559 gene locus_tag LOCUS_63920 50764 49559 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_63920 51075 50761 gene locus_tag LOCUS_63930 51075 50761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 51392 51135 gene locus_tag LOCUS_63940 51392 51135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 51990 52892 gene locus_tag LOCUS_63950 51990 52892 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031306.1 protein_id gnl|my_center|LOCUS_63950 52900 53715 gene locus_tag LOCUS_63960 52900 53715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031305.1 protein_id gnl|my_center|LOCUS_63960 53712 54653 gene locus_tag LOCUS_63970 53712 54653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63970 54580 55029 gene locus_tag LOCUS_63980 54580 55029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63980 55051 55317 gene locus_tag LOCUS_63990 55051 55317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63990 55354 56025 gene locus_tag LOCUS_64000 55354 56025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64000 56033 57745 gene locus_tag LOCUS_64010 56033 57745 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031300.1 protein_id gnl|my_center|LOCUS_64010 59049 58180 gene locus_tag LOCUS_64020 59049 58180 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_64020 59327 60250 gene locus_tag LOCUS_64030 59327 60250 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_64030 61180 60278 gene locus_tag LOCUS_64040 61180 60278 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058333.1 protein_id gnl|my_center|LOCUS_64040 61485 61252 gene locus_tag LOCUS_64050 61485 61252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64050 62123 61515 gene locus_tag LOCUS_64060 62123 61515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64060 63191 62208 gene locus_tag LOCUS_64070 63191 62208 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 protein_id gnl|my_center|LOCUS_64070 63419 64108 gene locus_tag LOCUS_64080 63419 64108 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_64080 64105 64977 gene locus_tag LOCUS_64090 64105 64977 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978666.1 protein_id gnl|my_center|LOCUS_64090 65052 66098 gene locus_tag LOCUS_64100 65052 66098 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_64100 66112 66834 gene locus_tag LOCUS_64110 66112 66834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 66970 68688 gene locus_tag LOCUS_64120 66970 68688 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_64120 68863 69324 gene locus_tag LOCUS_64130 68863 69324 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_64130 70127 69399 gene locus_tag LOCUS_64140 70127 69399 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_64140 70344 72758 gene locus_tag LOCUS_64150 70344 72758 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_64150 72755 75226 gene locus_tag LOCUS_64160 72755 75226 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_64160 76226 75195 gene locus_tag LOCUS_64170 76226 75195 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_64170 77789 76320 gene locus_tag LOCUS_64180 77789 76320 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228517.1 protein_id gnl|my_center|LOCUS_64180 78109 77789 gene locus_tag LOCUS_64190 78109 77789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_64190 78403 78321 gene locus_tag LOCUS_t00710 78403 78321 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78733 80028 gene locus_tag LOCUS_64200 78733 80028 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_64200 80040 80477 gene locus_tag LOCUS_64210 80040 80477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 80470 81252 gene locus_tag LOCUS_64220 80470 81252 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027858.1 protein_id gnl|my_center|LOCUS_64220 82007 81321 gene locus_tag LOCUS_64230 82007 81321 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 protein_id gnl|my_center|LOCUS_64230 82239 82928 gene locus_tag LOCUS_64240 82239 82928 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978717.1 protein_id gnl|my_center|LOCUS_64240 83164 83310 gene locus_tag LOCUS_64250 83164 83310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 83339 83875 gene locus_tag LOCUS_64260 83339 83875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64260 83865 84164 gene locus_tag LOCUS_64270 83865 84164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 85181 84183 gene locus_tag LOCUS_64280 gene trxB 85181 84183 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031219.1 protein_id gnl|my_center|LOCUS_64280 85591 85178 gene locus_tag LOCUS_64290 85591 85178 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029173.1 protein_id gnl|my_center|LOCUS_64290 85684 85998 gene locus_tag LOCUS_64300 85684 85998 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031221.1 protein_id gnl|my_center|LOCUS_64300 85995 87122 gene locus_tag LOCUS_64310 gene arsB 85995 87122 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031222.1 protein_id gnl|my_center|LOCUS_64310 87119 88189 gene locus_tag LOCUS_64320 87119 88189 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_64320 88988 88248 gene locus_tag LOCUS_64330 88988 88248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 89524 89045 gene locus_tag LOCUS_64340 89524 89045 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_64340 89949 89590 gene locus_tag LOCUS_64350 89949 89590 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975241.1 protein_id gnl|my_center|LOCUS_64350 91075 90017 gene locus_tag LOCUS_64360 91075 90017 CDS product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_64360 91183 92589 gene locus_tag LOCUS_64370 91183 92589 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031199.1 protein_id gnl|my_center|LOCUS_64370 92586 93797 gene locus_tag LOCUS_64380 92586 93797 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031197.1 protein_id gnl|my_center|LOCUS_64380 93914 95842 gene locus_tag LOCUS_64390 93914 95842 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963667.1 protein_id gnl|my_center|LOCUS_64390 96832 95993 gene locus_tag LOCUS_64400 96832 95993 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029811.1 protein_id gnl|my_center|LOCUS_64400 97836 96841 gene locus_tag LOCUS_64410 97836 96841 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038752.1 protein_id gnl|my_center|LOCUS_64410 99482 98112 gene locus_tag LOCUS_64420 99482 98112 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193385004.1 protein_id gnl|my_center|LOCUS_64420 100020 99583 gene locus_tag LOCUS_64430 100020 99583 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820618.1 protein_id gnl|my_center|LOCUS_64430 101315 100110 gene locus_tag LOCUS_64440 101315 100110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182893188.1 protein_id gnl|my_center|LOCUS_64440 101565 102512 gene locus_tag LOCUS_64450 101565 102512 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_64450 102873 104141 gene locus_tag LOCUS_64460 102873 104141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 104157 104747 gene locus_tag LOCUS_64470 104157 104747 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613181.1 protein_id gnl|my_center|LOCUS_64470 104744 105733 gene locus_tag LOCUS_64480 104744 105733 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027599.1 protein_id gnl|my_center|LOCUS_64480 >Feature sequence29 826 509 gene locus_tag LOCUS_64490 826 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 965 1441 gene locus_tag LOCUS_64500 965 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 1554 3608 gene locus_tag LOCUS_64510 1554 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 4121 3807 gene locus_tag LOCUS_64520 4121 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 4102 4914 gene locus_tag LOCUS_64530 4102 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64530 5169 5498 gene locus_tag LOCUS_64540 5169 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 7973 6036 gene locus_tag LOCUS_64550 7973 6036 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_64550 9814 8321 gene locus_tag LOCUS_64560 9814 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 10987 10166 gene locus_tag LOCUS_64570 10987 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 11044 11760 gene locus_tag LOCUS_64580 11044 11760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 12348 12638 gene locus_tag LOCUS_64590 12348 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 12635 12976 gene locus_tag LOCUS_64600 12635 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 12973 13851 gene locus_tag LOCUS_64610 12973 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 13851 14237 gene locus_tag LOCUS_64620 13851 14237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029773.1 protein_id gnl|my_center|LOCUS_64620 14323 15912 gene locus_tag LOCUS_64630 14323 15912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 15912 18032 gene locus_tag LOCUS_64640 15912 18032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64640 18245 18553 gene locus_tag LOCUS_64650 18245 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 19603 18629 gene locus_tag LOCUS_64660 19603 18629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 19814 20515 gene locus_tag LOCUS_64670 19814 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 20512 21414 gene locus_tag LOCUS_64680 20512 21414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 21411 21767 gene locus_tag LOCUS_64690 21411 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64690 21764 23017 gene locus_tag LOCUS_64700 21764 23017 CDS product DUF3631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899416.1 protein_id gnl|my_center|LOCUS_64700 23193 23405 gene locus_tag LOCUS_64710 23193 23405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64710 23492 24775 gene locus_tag LOCUS_64720 23492 24775 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012477091.1 protein_id gnl|my_center|LOCUS_64720 24927 24840 gene locus_tag LOCUS_t00720 24927 24840 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25142 27409 gene locus_tag LOCUS_64730 25142 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 27017 27114 gene locus_tag LOCUS_t00730 27017 27114 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27507 28763 gene locus_tag LOCUS_64740 gene purD 27507 28763 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_64740 29089 30879 gene locus_tag LOCUS_64750 29089 30879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 31110 32567 gene locus_tag LOCUS_64760 31110 32567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_64760 32677 33576 gene locus_tag LOCUS_64770 32677 33576 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_64770 33715 33642 gene locus_tag LOCUS_t00740 33715 33642 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 34382 33738 gene locus_tag LOCUS_64780 34382 33738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_64780 35812 34379 gene locus_tag LOCUS_64790 35812 34379 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029419.1 protein_id gnl|my_center|LOCUS_64790 36714 35902 gene locus_tag LOCUS_64800 36714 35902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_64800 37604 36711 gene locus_tag LOCUS_64810 37604 36711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_64810 37914 37840 gene locus_tag LOCUS_t00750 37914 37840 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38480 38154 gene locus_tag LOCUS_64820 38480 38154 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974896.1 protein_id gnl|my_center|LOCUS_64820 38932 39114 gene locus_tag LOCUS_64830 38932 39114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 39111 39791 gene locus_tag LOCUS_64840 gene purQ 39111 39791 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_64840 39791 42049 gene locus_tag LOCUS_64850 gene purL 39791 42049 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_64850 42204 42737 gene locus_tag LOCUS_64860 42204 42737 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029420.1 protein_id gnl|my_center|LOCUS_64860 42757 43629 gene locus_tag LOCUS_64870 42757 43629 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974890.1 protein_id gnl|my_center|LOCUS_64870 43640 44434 gene locus_tag LOCUS_64880 43640 44434 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 protein_id gnl|my_center|LOCUS_64880 44507 45349 gene locus_tag LOCUS_64890 44507 45349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 45494 47011 gene locus_tag LOCUS_64900 gene purF 45494 47011 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_64900 47220 48314 gene locus_tag LOCUS_64910 gene purM 47220 48314 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_64910 48664 48416 gene locus_tag LOCUS_64920 48664 48416 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974884.1 protein_id gnl|my_center|LOCUS_64920 50131 48965 gene locus_tag LOCUS_64930 50131 48965 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_64930 50217 51065 gene locus_tag LOCUS_64940 50217 51065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_64940 51613 51819 gene locus_tag LOCUS_64950 gene bldC 51613 51819 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_64950 52731 52656 gene locus_tag LOCUS_t00760 52731 52656 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 56785 52835 gene locus_tag LOCUS_64960 gene hrpA 56785 52835 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_64960 56974 56900 gene locus_tag LOCUS_t00770 56974 56900 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 57071 56996 gene locus_tag LOCUS_t00780 57071 56996 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 57182 57109 gene locus_tag LOCUS_t00790 57182 57109 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 58900 57263 gene locus_tag LOCUS_64970 58900 57263 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_64970 58985 59362 gene locus_tag LOCUS_64980 58985 59362 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_64980 59359 59892 gene locus_tag LOCUS_64990 gene crcB 59359 59892 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_64990 59889 60242 gene locus_tag LOCUS_65000 gene crcB 59889 60242 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_65000 61088 60369 gene locus_tag LOCUS_65010 61088 60369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65010 61237 63411 gene locus_tag LOCUS_65020 61237 63411 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974877.1 protein_id gnl|my_center|LOCUS_65020 63567 63641 gene locus_tag LOCUS_t00800 63567 63641 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 64488 63814 gene locus_tag LOCUS_65030 64488 63814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 65276 64740 gene locus_tag LOCUS_65040 65276 64740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030243.1 protein_id gnl|my_center|LOCUS_65040 65360 65836 gene locus_tag LOCUS_65050 65360 65836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_65050 65877 66875 gene locus_tag LOCUS_65060 65877 66875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65060 67414 66956 gene locus_tag LOCUS_65070 67414 66956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65070 67310 67729 gene locus_tag LOCUS_65080 67310 67729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65080 68401 68736 gene locus_tag LOCUS_65090 68401 68736 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973104.1 protein_id gnl|my_center|LOCUS_65090 69116 69319 gene locus_tag LOCUS_65100 69116 69319 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973099.1 protein_id gnl|my_center|LOCUS_65100 69642 71153 gene locus_tag LOCUS_65110 69642 71153 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973100.1 protein_id gnl|my_center|LOCUS_65110 71200 71604 gene locus_tag LOCUS_65120 71200 71604 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030532.1 protein_id gnl|my_center|LOCUS_65120 71660 71971 gene locus_tag LOCUS_65130 71660 71971 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973102.1 protein_id gnl|my_center|LOCUS_65130 72438 72079 gene locus_tag LOCUS_65140 72438 72079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974276.1 protein_id gnl|my_center|LOCUS_65140 73363 72860 gene locus_tag LOCUS_65150 73363 72860 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_65150 73421 73795 gene locus_tag LOCUS_65160 73421 73795 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_65160 73792 74898 gene locus_tag LOCUS_65170 gene arsB 73792 74898 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222674.1 protein_id gnl|my_center|LOCUS_65170 74891 75304 gene locus_tag LOCUS_65180 74891 75304 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_65180 75301 75816 gene locus_tag LOCUS_65190 75301 75816 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205378591.1 protein_id gnl|my_center|LOCUS_65190 76151 75891 gene locus_tag LOCUS_65200 76151 75891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65200 76033 76686 gene locus_tag LOCUS_65210 76033 76686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65210 78774 76717 gene locus_tag LOCUS_65220 78774 76717 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027426.1 protein_id gnl|my_center|LOCUS_65220 78959 79837 gene locus_tag LOCUS_65230 78959 79837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027427.1 protein_id gnl|my_center|LOCUS_65230 80474 79875 gene locus_tag LOCUS_65240 80474 79875 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836424.1 protein_id gnl|my_center|LOCUS_65240 80554 80985 gene locus_tag LOCUS_65250 80554 80985 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968401.1 protein_id gnl|my_center|LOCUS_65250 81306 81100 gene locus_tag LOCUS_65260 81306 81100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 81491 81703 gene locus_tag LOCUS_65270 81491 81703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064732467.1 protein_id gnl|my_center|LOCUS_65270 82399 81743 gene locus_tag LOCUS_65280 82399 81743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 82501 82680 gene locus_tag LOCUS_65290 82501 82680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 82751 82825 gene locus_tag LOCUS_t00810 82751 82825 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 82967 83716 gene locus_tag LOCUS_65300 82967 83716 CDS product TipAS antibiotic-recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230943.1 protein_id gnl|my_center|LOCUS_65300 83937 85391 gene locus_tag LOCUS_65310 83937 85391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 85810 86874 gene locus_tag LOCUS_65320 85810 86874 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029440.1 protein_id gnl|my_center|LOCUS_65320 88284 86932 gene locus_tag LOCUS_65330 88284 86932 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029441.1 protein_id gnl|my_center|LOCUS_65330 89212 88352 gene locus_tag LOCUS_65340 gene trmB 89212 88352 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_65340 90565 89312 gene locus_tag LOCUS_65350 gene lhgO 90565 89312 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974860.1 protein_id gnl|my_center|LOCUS_65350 92264 90714 gene locus_tag LOCUS_65360 92264 90714 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974859.1 protein_id gnl|my_center|LOCUS_65360 92838 94943 gene locus_tag LOCUS_65370 92838 94943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 96829 94997 gene locus_tag LOCUS_65380 96829 94997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_65380 98167 97349 gene locus_tag LOCUS_65390 98167 97349 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029446.1 protein_id gnl|my_center|LOCUS_65390 98492 99979 gene locus_tag LOCUS_65400 98492 99979 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_65400 100117 101958 gene locus_tag LOCUS_65410 100117 101958 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029448.1 protein_id gnl|my_center|LOCUS_65410 103254 101971 gene locus_tag LOCUS_65420 103254 101971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029449.1 protein_id gnl|my_center|LOCUS_65420 103409 103951 gene locus_tag LOCUS_65430 103409 103951 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974850.1 protein_id gnl|my_center|LOCUS_65430 >Feature sequence30 1430 120 gene locus_tag LOCUS_65440 1430 120 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028719.1 protein_id gnl|my_center|LOCUS_65440 2338 1442 gene locus_tag LOCUS_65450 2338 1442 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897409.1 protein_id gnl|my_center|LOCUS_65450 3720 2422 gene locus_tag LOCUS_65460 3720 2422 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484831.1 protein_id gnl|my_center|LOCUS_65460 4406 3717 gene locus_tag LOCUS_65470 4406 3717 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247888.1 protein_id gnl|my_center|LOCUS_65470 5598 4411 gene locus_tag LOCUS_65480 5598 4411 CDS product glycerophosphoryl diester phosphodiesterase membrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975797.1 protein_id gnl|my_center|LOCUS_65480 5492 5848 gene locus_tag LOCUS_65490 5492 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 5890 6993 gene locus_tag LOCUS_65500 gene mtnA 5890 6993 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028716.1 protein_id gnl|my_center|LOCUS_65500 7226 7903 gene locus_tag LOCUS_65510 gene mtrA 7226 7903 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_65510 7905 9995 gene locus_tag LOCUS_65520 gene mtrB 7905 9995 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_65520 9985 11835 gene locus_tag LOCUS_65530 9985 11835 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_65530 12075 12686 gene locus_tag LOCUS_65540 12075 12686 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028713.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65540 12782 12961 gene locus_tag LOCUS_65550 12782 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 13003 13692 gene locus_tag LOCUS_65560 gene raiA 13003 13692 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_65560 13884 14645 gene locus_tag LOCUS_65570 13884 14645 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_65570 15828 14638 gene locus_tag LOCUS_65580 15828 14638 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_65580 16490 15876 gene locus_tag LOCUS_65590 16490 15876 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028711.1 protein_id gnl|my_center|LOCUS_65590 16730 19579 gene locus_tag LOCUS_65600 gene secA 16730 19579 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_65600 20326 19973 gene locus_tag LOCUS_65610 20326 19973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 20664 21221 gene locus_tag LOCUS_65620 20664 21221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_65620 21236 21937 gene locus_tag LOCUS_65630 21236 21937 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_65630 22339 27378 gene locus_tag LOCUS_65640 22339 27378 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_65640 28305 27454 gene locus_tag LOCUS_65650 28305 27454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_65650 29245 28298 gene locus_tag LOCUS_65660 29245 28298 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_65660 29458 30027 gene locus_tag LOCUS_65670 29458 30027 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896738.1 protein_id gnl|my_center|LOCUS_65670 30724 31308 gene locus_tag LOCUS_65680 30724 31308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 31805 32113 gene locus_tag LOCUS_65690 31805 32113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 32838 32275 gene locus_tag LOCUS_65700 32838 32275 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026857.1 protein_id gnl|my_center|LOCUS_65700 33079 33873 gene locus_tag LOCUS_65710 33079 33873 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161376.1 protein_id gnl|my_center|LOCUS_65710 34297 35913 gene locus_tag LOCUS_65720 34297 35913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65720 36106 36903 gene locus_tag LOCUS_65730 36106 36903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 36981 37826 gene locus_tag LOCUS_65740 36981 37826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 37928 41524 gene locus_tag LOCUS_65750 37928 41524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65750 41521 44454 gene locus_tag LOCUS_65760 41521 44454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65760 44451 45617 gene locus_tag LOCUS_65770 44451 45617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 45785 48328 gene locus_tag LOCUS_65780 gene ppsA 45785 48328 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201372230.1 protein_id gnl|my_center|LOCUS_65780 50627 48336 gene locus_tag LOCUS_65790 50627 48336 CDS product bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975830.1 protein_id gnl|my_center|LOCUS_65790 51683 50766 gene locus_tag LOCUS_65800 51683 50766 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_65800 53008 51680 gene locus_tag LOCUS_65810 53008 51680 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_65810 54371 53049 gene locus_tag LOCUS_65820 54371 53049 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_65820 58181 54771 gene locus_tag LOCUS_65830 58181 54771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65830 58529 60250 gene locus_tag LOCUS_65840 58529 60250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 60375 60133 gene locus_tag LOCUS_65850 60375 60133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 60427 61677 gene locus_tag LOCUS_65860 60427 61677 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028691.1 protein_id gnl|my_center|LOCUS_65860 61775 62881 gene locus_tag LOCUS_65870 gene prfB 61775 62881 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_65870 63205 64026 gene locus_tag LOCUS_65880 63205 64026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65880 64314 64117 gene locus_tag LOCUS_65890 64314 64117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975842.1 protein_id gnl|my_center|LOCUS_65890 64584 65273 gene locus_tag LOCUS_65900 gene ftsE 64584 65273 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_65900 65309 66226 gene locus_tag LOCUS_65910 gene ftsX 65309 66226 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_65910 66294 67487 gene locus_tag LOCUS_65920 66294 67487 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668732.1 protein_id gnl|my_center|LOCUS_65920 67506 67991 gene locus_tag LOCUS_65930 gene smpB 67506 67991 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_65930 68102 68486 gene locus_tag LOCUS_tm00010 68102 68486 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 68831 69517 gene locus_tag LOCUS_65940 68831 69517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65940 69607 71727 gene locus_tag LOCUS_65950 69607 71727 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028686.1 protein_id gnl|my_center|LOCUS_65950 71724 72998 gene locus_tag LOCUS_65960 71724 72998 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975851.1 protein_id gnl|my_center|LOCUS_65960 73232 74143 gene locus_tag LOCUS_65970 73232 74143 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_65970 74284 75690 gene locus_tag LOCUS_65980 74284 75690 CDS product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028683.1 protein_id gnl|my_center|LOCUS_65980 75741 76883 gene locus_tag LOCUS_65990 75741 76883 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_65990 76985 77512 gene locus_tag LOCUS_66000 gene rimJ 76985 77512 CDS product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263577.1 protein_id gnl|my_center|LOCUS_66000 77730 78332 gene locus_tag LOCUS_66010 77730 78332 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028679.1 protein_id gnl|my_center|LOCUS_66010 78446 79078 gene locus_tag LOCUS_66020 78446 79078 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_66020 79075 79956 gene locus_tag LOCUS_66030 gene rsuA 79075 79956 CDS product anti-sigma U factor RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975858.1 protein_id gnl|my_center|LOCUS_66030 80018 82549 gene locus_tag LOCUS_66040 80018 82549 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975859.1 protein_id gnl|my_center|LOCUS_66040 83228 83464 gene locus_tag LOCUS_66050 83228 83464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 83892 83671 gene locus_tag LOCUS_66060 83892 83671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 83891 84274 gene locus_tag LOCUS_66070 83891 84274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 84298 84537 gene locus_tag LOCUS_66080 84298 84537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66080 85062 84733 gene locus_tag LOCUS_66090 85062 84733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 85061 85387 gene locus_tag LOCUS_66100 85061 85387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66100 86109 85519 gene locus_tag LOCUS_66110 86109 85519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 87185 86106 gene locus_tag LOCUS_66120 87185 86106 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226521.1 protein_id gnl|my_center|LOCUS_66120 87492 87310 gene locus_tag LOCUS_66130 87492 87310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66130 87839 87507 gene locus_tag LOCUS_66140 87839 87507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 88272 87841 gene locus_tag LOCUS_66150 88272 87841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 88541 88272 gene locus_tag LOCUS_66160 88541 88272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 89445 88603 gene locus_tag LOCUS_66170 89445 88603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 89886 89509 gene locus_tag LOCUS_66180 89886 89509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66180 90589 89918 gene locus_tag LOCUS_66190 90589 89918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66190 91270 90602 gene locus_tag LOCUS_66200 91270 90602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 92358 91267 gene locus_tag LOCUS_66210 92358 91267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 94597 92360 gene locus_tag LOCUS_66220 94597 92360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 >Feature sequence31 346 657 gene locus_tag LOCUS_66230 346 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 1032 703 gene locus_tag LOCUS_66240 1032 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66240 1520 1044 gene locus_tag LOCUS_66250 1520 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66250 1764 2411 gene locus_tag LOCUS_66260 1764 2411 CDS product DUF6518 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376257.1 protein_id gnl|my_center|LOCUS_66260 2562 2735 gene locus_tag LOCUS_66270 2562 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66270 2847 3026 gene locus_tag LOCUS_66280 2847 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 3217 5913 gene locus_tag LOCUS_66290 3217 5913 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104583.1 protein_id gnl|my_center|LOCUS_66290 6789 5971 gene locus_tag LOCUS_66300 6789 5971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158641380.1 protein_id gnl|my_center|LOCUS_66300 7583 6867 gene locus_tag LOCUS_66310 7583 6867 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_66310 9514 8075 gene locus_tag LOCUS_66320 gene zwf 9514 8075 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_66320 10248 10424 gene locus_tag LOCUS_66330 10248 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_66330 10609 10836 gene locus_tag LOCUS_66340 10609 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66340 12018 10909 gene locus_tag LOCUS_66350 12018 10909 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_66350 12721 12260 gene locus_tag LOCUS_66360 12721 12260 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977376.1 protein_id gnl|my_center|LOCUS_66360 13967 12957 gene locus_tag LOCUS_66370 13967 12957 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 protein_id gnl|my_center|LOCUS_66370 14081 14965 gene locus_tag LOCUS_66380 14081 14965 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228693.1 protein_id gnl|my_center|LOCUS_66380 16655 15006 gene locus_tag LOCUS_66390 16655 15006 CDS product alpha-keto acid decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020643.1 protein_id gnl|my_center|LOCUS_66390 17894 16962 gene locus_tag LOCUS_66400 17894 16962 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_66400 20188 18479 gene locus_tag LOCUS_66410 20188 18479 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899485.1 protein_id gnl|my_center|LOCUS_66410 21823 20390 gene locus_tag LOCUS_66420 21823 20390 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031455.1 protein_id gnl|my_center|LOCUS_66420 22106 22939 gene locus_tag LOCUS_66430 22106 22939 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031456.1 protein_id gnl|my_center|LOCUS_66430 23090 24073 gene locus_tag LOCUS_66440 23090 24073 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967883.1 protein_id gnl|my_center|LOCUS_66440 24672 24142 gene locus_tag LOCUS_66450 24672 24142 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 protein_id gnl|my_center|LOCUS_66450 25776 24742 gene locus_tag LOCUS_66460 25776 24742 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228342.1 protein_id gnl|my_center|LOCUS_66460 26941 25889 gene locus_tag LOCUS_66470 26941 25889 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090352.1 protein_id gnl|my_center|LOCUS_66470 27311 28318 gene locus_tag LOCUS_66480 27311 28318 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 protein_id gnl|my_center|LOCUS_66480 28518 29441 gene locus_tag LOCUS_66490 28518 29441 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_66490 30273 29554 gene locus_tag LOCUS_66500 30273 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 32107 31475 gene locus_tag LOCUS_66510 32107 31475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 33841 32453 gene locus_tag LOCUS_66520 33841 32453 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 protein_id gnl|my_center|LOCUS_66520 34159 35013 gene locus_tag LOCUS_66530 34159 35013 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531451.1 protein_id gnl|my_center|LOCUS_66530 35048 36937 gene locus_tag LOCUS_66540 35048 36937 CDS product sugar phosphate isomerase/epimerase and 4-hydroxyphenylpyruvate domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226206.1 protein_id gnl|my_center|LOCUS_66540 37000 37653 gene locus_tag LOCUS_66550 37000 37653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_66550 40191 37909 gene locus_tag LOCUS_66560 40191 37909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 40403 40822 gene locus_tag LOCUS_66570 40403 40822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66570 41701 40991 gene locus_tag LOCUS_66580 41701 40991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 42421 42113 gene locus_tag LOCUS_66590 42421 42113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66590 42549 42770 gene locus_tag LOCUS_66600 42549 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66600 42879 43115 gene locus_tag LOCUS_66610 42879 43115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66610 43082 43318 gene locus_tag LOCUS_66620 43082 43318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66620 43898 44812 gene locus_tag LOCUS_66630 43898 44812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228283.1 protein_id gnl|my_center|LOCUS_66630 44914 45690 gene locus_tag LOCUS_66640 44914 45690 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144635466.1 protein_id gnl|my_center|LOCUS_66640 45739 46443 gene locus_tag LOCUS_66650 45739 46443 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225022.1 protein_id gnl|my_center|LOCUS_66650 46440 47957 gene locus_tag LOCUS_66660 46440 47957 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225021.1 protein_id gnl|my_center|LOCUS_66660 48294 50492 gene locus_tag LOCUS_66670 48294 50492 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027104.1 protein_id gnl|my_center|LOCUS_66670 50599 51762 gene locus_tag LOCUS_66680 50599 51762 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027103.1 protein_id gnl|my_center|LOCUS_66680 51779 52450 gene locus_tag LOCUS_66690 51779 52450 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978444.1 protein_id gnl|my_center|LOCUS_66690 53894 53727 gene locus_tag LOCUS_66700 53894 53727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_66700 54797 62440 gene locus_tag LOCUS_66710 54797 62440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 62440 62985 gene locus_tag LOCUS_66720 62440 62985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 63241 63065 gene locus_tag LOCUS_66730 63241 63065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 64770 63832 gene locus_tag LOCUS_66740 64770 63832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 64952 64767 gene locus_tag LOCUS_66750 64952 64767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66750 65142 64945 gene locus_tag LOCUS_66760 65142 64945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 65448 66491 gene locus_tag LOCUS_66770 65448 66491 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229345.1 protein_id gnl|my_center|LOCUS_66770 67748 68122 gene locus_tag LOCUS_66780 67748 68122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66780 68658 68179 gene locus_tag LOCUS_66790 68658 68179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 70346 69126 gene locus_tag LOCUS_66800 70346 69126 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317270.1 protein_id gnl|my_center|LOCUS_66800 71001 70585 gene locus_tag LOCUS_66810 71001 70585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66810 71117 72031 gene locus_tag LOCUS_66820 71117 72031 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860032.1 protein_id gnl|my_center|LOCUS_66820 72601 72206 gene locus_tag LOCUS_66830 72601 72206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 72778 73704 gene locus_tag LOCUS_66840 72778 73704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 73738 74013 gene locus_tag LOCUS_66850 73738 74013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66850 74239 75606 gene locus_tag LOCUS_66860 74239 75606 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838527.1 protein_id gnl|my_center|LOCUS_66860 75609 76802 gene locus_tag LOCUS_66870 75609 76802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66870 77609 76818 gene locus_tag LOCUS_66880 77609 76818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_66880 78177 78569 gene locus_tag LOCUS_66890 78177 78569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 79740 79171 gene locus_tag LOCUS_66900 79740 79171 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_66900 81023 79953 gene locus_tag LOCUS_66910 81023 79953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_66910 81737 81273 gene locus_tag LOCUS_66920 81737 81273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66920 82749 81838 gene locus_tag LOCUS_66930 82749 81838 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030266.1 protein_id gnl|my_center|LOCUS_66930 82996 83919 gene locus_tag LOCUS_66940 82996 83919 CDS product endo-beta-N-acetylglucosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031790.1 protein_id gnl|my_center|LOCUS_66940 84957 84298 gene locus_tag LOCUS_66950 84957 84298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 85101 85550 gene locus_tag LOCUS_66960 85101 85550 CDS product DUF6228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108989910.1 protein_id gnl|my_center|LOCUS_66960 86010 85684 gene locus_tag LOCUS_66970 86010 85684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 86225 87298 gene locus_tag LOCUS_66980 86225 87298 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_66980 87306 88652 gene locus_tag LOCUS_66990 87306 88652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816310.1 protein_id gnl|my_center|LOCUS_66990 89853 88933 gene locus_tag LOCUS_67000 89853 88933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67000 >Feature sequence32 <1 960 gene locus_tag LOCUS_67010 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727118.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1584 1309 gene locus_tag LOCUS_67020 1584 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 2577 2227 gene locus_tag LOCUS_67030 2577 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67030 2813 3688 gene locus_tag LOCUS_67040 2813 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67040 3765 4616 gene locus_tag LOCUS_67050 3765 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_67050 4613 4996 gene locus_tag LOCUS_67060 4613 4996 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_67060 5160 5921 gene locus_tag LOCUS_67070 gene fabG 5160 5921 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_67070 5939 6715 gene locus_tag LOCUS_67080 5939 6715 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027733.1 protein_id gnl|my_center|LOCUS_67080 6823 8403 gene locus_tag LOCUS_67090 6823 8403 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325733.1 protein_id gnl|my_center|LOCUS_67090 8473 9156 gene locus_tag LOCUS_67100 gene ung 8473 9156 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_67100 9302 9757 gene locus_tag LOCUS_67110 9302 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027732.1 protein_id gnl|my_center|LOCUS_67110 10138 9764 gene locus_tag LOCUS_67120 10138 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247768.1 protein_id gnl|my_center|LOCUS_67120 10438 11343 gene locus_tag LOCUS_67130 10438 11343 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455728.1 protein_id gnl|my_center|LOCUS_67130 12868 11267 gene locus_tag LOCUS_67140 gene lnt 12868 11267 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027728.1 protein_id gnl|my_center|LOCUS_67140 13526 13077 gene locus_tag LOCUS_67150 13526 13077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 13873 13703 gene locus_tag LOCUS_67160 13873 13703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 14988 14116 gene locus_tag LOCUS_67170 14988 14116 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_67170 15339 17249 gene locus_tag LOCUS_67180 15339 17249 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_67180 17246 19447 gene locus_tag LOCUS_67190 gene scpA 17246 19447 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_67190 19452 20468 gene locus_tag LOCUS_67200 gene meaB 19452 20468 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_67200 20465 21529 gene locus_tag LOCUS_67210 20465 21529 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109991.1 protein_id gnl|my_center|LOCUS_67210 22487 21579 gene locus_tag LOCUS_67220 22487 21579 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030923.1 protein_id gnl|my_center|LOCUS_67220 23680 22571 gene locus_tag LOCUS_67230 23680 22571 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030922.1 protein_id gnl|my_center|LOCUS_67230 25080 23677 gene locus_tag LOCUS_67240 25080 23677 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 protein_id gnl|my_center|LOCUS_67240 25841 25089 gene locus_tag LOCUS_67250 25841 25089 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972538.1 protein_id gnl|my_center|LOCUS_67250 26816 26067 gene locus_tag LOCUS_67260 26816 26067 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027720.1 protein_id gnl|my_center|LOCUS_67260 26927 27655 gene locus_tag LOCUS_67270 26927 27655 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977507.1 protein_id gnl|my_center|LOCUS_67270 27983 29161 gene locus_tag LOCUS_67280 gene tuf 27983 29161 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 protein_id gnl|my_center|LOCUS_67280 29257 30102 gene locus_tag LOCUS_67290 29257 30102 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027718.1 protein_id gnl|my_center|LOCUS_67290 31243 30188 gene locus_tag LOCUS_67300 31243 30188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 31352 31789 gene locus_tag LOCUS_67310 31352 31789 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_67310 31912 32604 gene locus_tag LOCUS_67320 31912 32604 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_67320 33145 32615 gene locus_tag LOCUS_67330 33145 32615 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_67330 33350 34576 gene locus_tag LOCUS_67340 33350 34576 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027220.1 protein_id gnl|my_center|LOCUS_67340 35956 34658 gene locus_tag LOCUS_67350 35956 34658 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027221.1 protein_id gnl|my_center|LOCUS_67350 36567 35953 gene locus_tag LOCUS_67360 36567 35953 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862774.1 protein_id gnl|my_center|LOCUS_67360 36907 36548 gene locus_tag LOCUS_67370 36907 36548 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978275.1 protein_id gnl|my_center|LOCUS_67370 37335 36904 gene locus_tag LOCUS_67380 37335 36904 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078495246.1 protein_id gnl|my_center|LOCUS_67380 39296 37506 gene locus_tag LOCUS_67390 39296 37506 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027225.1 protein_id gnl|my_center|LOCUS_67390 39634 40377 gene locus_tag LOCUS_67400 39634 40377 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_67400 41265 40399 gene locus_tag LOCUS_67410 41265 40399 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_67410 41361 41933 gene locus_tag LOCUS_67420 41361 41933 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_67420 42012 42575 gene locus_tag LOCUS_67430 42012 42575 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027714.1 protein_id gnl|my_center|LOCUS_67430 43043 42636 gene locus_tag LOCUS_67440 43043 42636 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_67440 43122 43748 gene locus_tag LOCUS_67450 43122 43748 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_67450 43797 44963 gene locus_tag LOCUS_67460 43797 44963 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_67460 44960 47983 gene locus_tag LOCUS_67470 44960 47983 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027705.1 protein_id gnl|my_center|LOCUS_67470 48066 49013 gene locus_tag LOCUS_67480 48066 49013 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_67480 51041 49359 gene locus_tag LOCUS_67490 51041 49359 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 protein_id gnl|my_center|LOCUS_67490 51585 51085 gene locus_tag LOCUS_67500 51585 51085 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977536.1 protein_id gnl|my_center|LOCUS_67500 51637 52905 gene locus_tag LOCUS_67510 51637 52905 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_67510 54247 52826 gene locus_tag LOCUS_67520 54247 52826 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_67520 56116 54512 gene locus_tag LOCUS_67530 56116 54512 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027698.1 protein_id gnl|my_center|LOCUS_67530 57806 56325 gene locus_tag LOCUS_67540 57806 56325 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027697.1 protein_id gnl|my_center|LOCUS_67540 58067 58831 gene locus_tag LOCUS_67550 58067 58831 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027677.1 protein_id gnl|my_center|LOCUS_67550 60026 58869 gene locus_tag LOCUS_67560 60026 58869 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 protein_id gnl|my_center|LOCUS_67560 60797 60225 gene locus_tag LOCUS_67570 gene mug 60797 60225 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027672.1 protein_id gnl|my_center|LOCUS_67570 62235 60808 gene locus_tag LOCUS_67580 gene purB 62235 60808 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_67580 63147 62341 gene locus_tag LOCUS_67590 63147 62341 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977577.1 protein_id gnl|my_center|LOCUS_67590 64215 63193 gene locus_tag LOCUS_67600 64215 63193 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977578.1 protein_id gnl|my_center|LOCUS_67600 65561 64212 gene locus_tag LOCUS_67610 65561 64212 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027670.1 protein_id gnl|my_center|LOCUS_67610 66695 65817 gene locus_tag LOCUS_67620 66695 65817 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_67620 66832 67080 gene locus_tag LOCUS_67630 66832 67080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977581.1 protein_id gnl|my_center|LOCUS_67630 67133 67966 gene locus_tag LOCUS_67640 67133 67966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_67640 68016 68429 gene locus_tag LOCUS_67650 68016 68429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027668.1 protein_id gnl|my_center|LOCUS_67650 69162 68482 gene locus_tag LOCUS_67660 69162 68482 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_67660 70008 69265 gene locus_tag LOCUS_67670 gene bioD 70008 69265 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_67670 71326 70010 gene locus_tag LOCUS_67680 71326 70010 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_67680 72479 71319 gene locus_tag LOCUS_67690 gene bioB 72479 71319 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_67690 72623 73828 gene locus_tag LOCUS_67700 72623 73828 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 protein_id gnl|my_center|LOCUS_67700 74071 74502 gene locus_tag LOCUS_67710 74071 74502 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027663.1 protein_id gnl|my_center|LOCUS_67710 75005 74535 gene locus_tag LOCUS_67720 75005 74535 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977591.1 protein_id gnl|my_center|LOCUS_67720 75858 75550 gene locus_tag LOCUS_67730 75858 75550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977592.1 protein_id gnl|my_center|LOCUS_67730 76612 75866 gene locus_tag LOCUS_67740 76612 75866 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977593.1 protein_id gnl|my_center|LOCUS_67740 76586 76870 gene locus_tag LOCUS_67750 76586 76870 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977594.1 protein_id gnl|my_center|LOCUS_67750 78007 77012 gene locus_tag LOCUS_67760 78007 77012 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727143.1 protein_id gnl|my_center|LOCUS_67760 78131 78757 gene locus_tag LOCUS_67770 78131 78757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 78893 79195 gene locus_tag LOCUS_67780 78893 79195 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977595.1 protein_id gnl|my_center|LOCUS_67780 79212 79523 gene locus_tag LOCUS_67790 79212 79523 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 protein_id gnl|my_center|LOCUS_67790 79516 81237 gene locus_tag LOCUS_67800 79516 81237 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977597.1 protein_id gnl|my_center|LOCUS_67800 81237 81911 gene locus_tag LOCUS_67810 81237 81911 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 protein_id gnl|my_center|LOCUS_67810 81966 82661 gene locus_tag LOCUS_67820 gene ureG 81966 82661 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977599.1 protein_id gnl|my_center|LOCUS_67820 82658 83449 gene locus_tag LOCUS_67830 82658 83449 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 protein_id gnl|my_center|LOCUS_67830 83610 85208 gene locus_tag LOCUS_67840 83610 85208 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027660.1 protein_id gnl|my_center|LOCUS_67840 86043 85327 gene locus_tag LOCUS_67850 86043 85327 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_67850 86956 86186 gene locus_tag LOCUS_67860 86956 86186 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229866.1 protein_id gnl|my_center|LOCUS_67860 87212 87625 gene locus_tag LOCUS_67870 87212 87625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 >Feature sequence33 1315 368 gene locus_tag LOCUS_67880 1315 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67880 1781 2464 gene locus_tag LOCUS_67890 1781 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67890 2497 2829 gene locus_tag LOCUS_67900 2497 2829 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030169.1 protein_id gnl|my_center|LOCUS_67900 2841 4097 gene locus_tag LOCUS_67910 2841 4097 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227255.1 protein_id gnl|my_center|LOCUS_67910 4094 5305 gene locus_tag LOCUS_67920 4094 5305 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 protein_id gnl|my_center|LOCUS_67920 5424 5693 gene locus_tag LOCUS_67930 5424 5693 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_67930 5845 6630 gene locus_tag LOCUS_67940 5845 6630 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973892.1 protein_id gnl|my_center|LOCUS_67940 6672 7640 gene locus_tag LOCUS_67950 6672 7640 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030049.1 protein_id gnl|my_center|LOCUS_67950 7643 10126 gene locus_tag LOCUS_67960 7643 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 10224 11747 gene locus_tag LOCUS_67970 10224 11747 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284773.1 protein_id gnl|my_center|LOCUS_67970 11763 12335 gene locus_tag LOCUS_67980 11763 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 12332 13174 gene locus_tag LOCUS_67990 12332 13174 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230130.1 protein_id gnl|my_center|LOCUS_67990 13193 14737 gene locus_tag LOCUS_68000 13193 14737 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_68000 14734 15474 gene locus_tag LOCUS_68010 14734 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68010 15682 16953 gene locus_tag LOCUS_68020 15682 16953 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_68020 16950 17822 gene locus_tag LOCUS_68030 16950 17822 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730107.1 protein_id gnl|my_center|LOCUS_68030 18091 19578 gene locus_tag LOCUS_68040 18091 19578 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189229593.1 protein_id gnl|my_center|LOCUS_68040 19844 20080 gene locus_tag LOCUS_68050 19844 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 20203 20796 gene locus_tag LOCUS_68060 20203 20796 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_68060 20900 21817 gene locus_tag LOCUS_68070 20900 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 21907 23532 gene locus_tag LOCUS_68080 21907 23532 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_68080 23770 24390 gene locus_tag LOCUS_68090 gene frnE 23770 24390 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_68090 24915 26180 gene locus_tag LOCUS_68100 24915 26180 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_68100 26243 27448 gene locus_tag LOCUS_68110 26243 27448 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_68110 27452 28051 gene locus_tag LOCUS_68120 27452 28051 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080532.1 protein_id gnl|my_center|LOCUS_68120 28065 29132 gene locus_tag LOCUS_68130 28065 29132 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_68130 29129 30118 gene locus_tag LOCUS_68140 gene rfbB 29129 30118 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_68140 30120 31424 gene locus_tag LOCUS_68150 gene rfbH 30120 31424 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222568.1 protein_id gnl|my_center|LOCUS_68150 31421 32896 gene locus_tag LOCUS_68160 31421 32896 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_68160 32890 33882 gene locus_tag LOCUS_68170 32890 33882 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 protein_id gnl|my_center|LOCUS_68170 33980 34489 gene locus_tag LOCUS_68180 33980 34489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 35863 34532 gene locus_tag LOCUS_68190 35863 34532 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_68190 36154 37335 gene locus_tag LOCUS_68200 36154 37335 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223248.1 protein_id gnl|my_center|LOCUS_68200 37352 38023 gene locus_tag LOCUS_68210 37352 38023 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972222.1 protein_id gnl|my_center|LOCUS_68210 38146 39111 gene locus_tag LOCUS_68220 38146 39111 CDS product ADP-dependent ribose-1-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867540.1 protein_id gnl|my_center|LOCUS_68220 40131 39130 gene locus_tag LOCUS_68230 40131 39130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229816.1 protein_id gnl|my_center|LOCUS_68230 40571 40242 gene locus_tag LOCUS_68240 40571 40242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 40741 41688 gene locus_tag LOCUS_68250 40741 41688 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412109.1 protein_id gnl|my_center|LOCUS_68250 41685 42653 gene locus_tag LOCUS_68260 41685 42653 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042080.1 protein_id gnl|my_center|LOCUS_68260 42634 43800 gene locus_tag LOCUS_68270 42634 43800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 43787 44665 gene locus_tag LOCUS_68280 43787 44665 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_68280 44665 46026 gene locus_tag LOCUS_68290 44665 46026 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_68290 46034 46888 gene locus_tag LOCUS_68300 46034 46888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 47708 46908 gene locus_tag LOCUS_68310 47708 46908 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_68310 48804 47878 gene locus_tag LOCUS_68320 48804 47878 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031172.1 protein_id gnl|my_center|LOCUS_68320 49369 50181 gene locus_tag LOCUS_68330 49369 50181 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_68330 50401 50216 gene locus_tag LOCUS_68340 50401 50216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 51108 50458 gene locus_tag LOCUS_68350 51108 50458 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031170.1 protein_id gnl|my_center|LOCUS_68350 52662 51214 gene locus_tag LOCUS_68360 52662 51214 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_68360 54591 52693 gene locus_tag LOCUS_68370 gene dxs 54591 52693 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_68370 55739 54720 gene locus_tag LOCUS_68380 gene hpnH 55739 54720 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_68380 56458 55745 gene locus_tag LOCUS_68390 56458 55745 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972232.1 protein_id gnl|my_center|LOCUS_68390 58530 56458 gene locus_tag LOCUS_68400 gene shc 58530 56458 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_68400 59736 58678 gene locus_tag LOCUS_68410 59736 58678 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_68410 61283 59895 gene locus_tag LOCUS_68420 gene hpnE 61283 59895 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_68420 62334 61384 gene locus_tag LOCUS_68430 gene hpnD 62334 61384 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_68430 63251 62331 gene locus_tag LOCUS_68440 gene hpnC 63251 62331 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_68440 64377 63688 gene locus_tag LOCUS_68450 64377 63688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803750.1 protein_id gnl|my_center|LOCUS_68450 64464 66674 gene locus_tag LOCUS_68460 64464 66674 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_68460 67555 66770 gene locus_tag LOCUS_68470 67555 66770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_68470 68486 67548 gene locus_tag LOCUS_68480 68486 67548 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972239.1 protein_id gnl|my_center|LOCUS_68480 69467 68586 gene locus_tag LOCUS_68490 69467 68586 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_68490 70147 69464 gene locus_tag LOCUS_68500 70147 69464 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_68500 71282 70221 gene locus_tag LOCUS_68510 71282 70221 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_68510 72007 71270 gene locus_tag LOCUS_68520 72007 71270 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_68520 73854 72004 gene locus_tag LOCUS_68530 73854 72004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 74295 75278 gene locus_tag LOCUS_68540 gene galE 74295 75278 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_68540 75427 76368 gene locus_tag LOCUS_68550 75427 76368 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_68550 76610 77428 gene locus_tag LOCUS_68560 76610 77428 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_68560 77641 78174 gene locus_tag LOCUS_68570 gene idi 77641 78174 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 protein_id gnl|my_center|LOCUS_68570 78757 78197 gene locus_tag LOCUS_68580 78757 78197 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327856.1 protein_id gnl|my_center|LOCUS_68580 79064 79831 gene locus_tag LOCUS_68590 79064 79831 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_68590 79905 80768 gene locus_tag LOCUS_68600 79905 80768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972252.1 protein_id gnl|my_center|LOCUS_68600 80803 80982 gene locus_tag LOCUS_68610 80803 80982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 81120 83513 gene locus_tag LOCUS_68620 81120 83513 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 protein_id gnl|my_center|LOCUS_68620 85283 83625 gene locus_tag LOCUS_68630 85283 83625 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 protein_id gnl|my_center|LOCUS_68630 >Feature sequence34 217 1851 gene locus_tag LOCUS_68640 217 1851 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_68640 1964 2887 gene locus_tag LOCUS_68650 1964 2887 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_68650 2880 3857 gene locus_tag LOCUS_68660 2880 3857 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_68660 3869 4846 gene locus_tag LOCUS_68670 3869 4846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_68670 4836 6011 gene locus_tag LOCUS_68680 4836 6011 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_68680 6260 7351 gene locus_tag LOCUS_68690 6260 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690 9640 7415 gene locus_tag LOCUS_68700 9640 7415 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_68700 9821 10015 gene locus_tag LOCUS_68710 9821 10015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973854.1 protein_id gnl|my_center|LOCUS_68710 10113 11021 gene locus_tag LOCUS_68720 gene mshB 10113 11021 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030070.1 protein_id gnl|my_center|LOCUS_68720 11018 11545 gene locus_tag LOCUS_68730 11018 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68730 11753 13942 gene locus_tag LOCUS_68740 11753 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 14890 14042 gene locus_tag LOCUS_68750 14890 14042 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 protein_id gnl|my_center|LOCUS_68750 15909 14908 gene locus_tag LOCUS_68760 15909 14908 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_68760 16013 16375 gene locus_tag LOCUS_68770 16013 16375 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_68770 16562 16338 gene locus_tag LOCUS_68780 16562 16338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68780 16474 17568 gene locus_tag LOCUS_68790 16474 17568 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_68790 18113 17673 gene locus_tag LOCUS_68800 18113 17673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973840.1 protein_id gnl|my_center|LOCUS_68800 19470 18403 gene locus_tag LOCUS_68810 19470 18403 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_68810 19494 20585 gene locus_tag LOCUS_68820 gene dapE 19494 20585 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_68820 20753 21502 gene locus_tag LOCUS_68830 20753 21502 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_68830 22378 21506 gene locus_tag LOCUS_68840 gene folP 22378 21506 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_68840 22490 22843 gene locus_tag LOCUS_68850 22490 22843 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973835.1 protein_id gnl|my_center|LOCUS_68850 22840 23439 gene locus_tag LOCUS_68860 22840 23439 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_68860 24399 23599 gene locus_tag LOCUS_68870 24399 23599 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_68870 24725 24892 gene locus_tag LOCUS_68880 24725 24892 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_68880 25667 25002 gene locus_tag LOCUS_68890 25667 25002 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_68890 25885 26568 gene locus_tag LOCUS_68900 gene sigE 25885 26568 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_68900 26565 27449 gene locus_tag LOCUS_68910 26565 27449 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030084.1 protein_id gnl|my_center|LOCUS_68910 27540 29426 gene locus_tag LOCUS_68920 27540 29426 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456948.1 protein_id gnl|my_center|LOCUS_68920 29553 30014 gene locus_tag LOCUS_68930 29553 30014 CDS product sec-independent translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030086.1 protein_id gnl|my_center|LOCUS_68930 30131 30811 gene locus_tag LOCUS_68940 30131 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327210.1 protein_id gnl|my_center|LOCUS_68940 32073 30886 gene locus_tag LOCUS_68950 32073 30886 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_68950 32691 32089 gene locus_tag LOCUS_68960 32691 32089 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_68960 33955 32681 gene locus_tag LOCUS_68970 33955 32681 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_68970 34180 34959 gene locus_tag LOCUS_68980 34180 34959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973822.1 protein_id gnl|my_center|LOCUS_68980 35503 34976 gene locus_tag LOCUS_68990 35503 34976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_68990 36639 35524 gene locus_tag LOCUS_69000 36639 35524 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_69000 36988 37749 gene locus_tag LOCUS_69010 36988 37749 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030091.1 protein_id gnl|my_center|LOCUS_69010 37945 38583 gene locus_tag LOCUS_69020 37945 38583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_69020 38693 39562 gene locus_tag LOCUS_69030 38693 39562 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_69030 39762 39496 gene locus_tag LOCUS_69040 39762 39496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 39692 40297 gene locus_tag LOCUS_69050 39692 40297 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_69050 40531 40379 gene locus_tag LOCUS_69060 40531 40379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444413.1 protein_id gnl|my_center|LOCUS_69060 40708 41619 gene locus_tag LOCUS_69070 40708 41619 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_69070 42615 41644 gene locus_tag LOCUS_69080 42615 41644 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_69080 44475 42628 gene locus_tag LOCUS_69090 44475 42628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_69090 44982 45752 gene locus_tag LOCUS_69100 44982 45752 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_69100 46095 45826 gene locus_tag LOCUS_69110 46095 45826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973810.1 protein_id gnl|my_center|LOCUS_69110 46494 46267 gene locus_tag LOCUS_69120 46494 46267 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69120 47439 46678 gene locus_tag LOCUS_69130 47439 46678 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_69130 47795 47529 gene locus_tag LOCUS_69140 47795 47529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973806.1 protein_id gnl|my_center|LOCUS_69140 47958 49034 gene locus_tag LOCUS_69150 47958 49034 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_69150 49043 50503 gene locus_tag LOCUS_69160 49043 50503 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030095.1 protein_id gnl|my_center|LOCUS_69160 50707 52566 gene locus_tag LOCUS_69170 50707 52566 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030096.1 protein_id gnl|my_center|LOCUS_69170 52559 53722 gene locus_tag LOCUS_69180 52559 53722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867977.1 protein_id gnl|my_center|LOCUS_69180 53901 54884 gene locus_tag LOCUS_69190 53901 54884 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134112038.1 protein_id gnl|my_center|LOCUS_69190 54872 55633 gene locus_tag LOCUS_69200 54872 55633 CDS product spherulation-specific family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973799.1 protein_id gnl|my_center|LOCUS_69200 55705 56883 gene locus_tag LOCUS_69210 gene moeZ 55705 56883 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_69210 58638 56986 gene locus_tag LOCUS_69220 58638 56986 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_69220 61564 58748 gene locus_tag LOCUS_69230 61564 58748 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_69230 61783 62193 gene locus_tag LOCUS_69240 61783 62193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 62532 65789 gene locus_tag LOCUS_69250 62532 65789 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030103.1 protein_id gnl|my_center|LOCUS_69250 65912 66784 gene locus_tag LOCUS_69260 65912 66784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69260 66921 70592 gene locus_tag LOCUS_69270 66921 70592 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486348.1 protein_id gnl|my_center|LOCUS_69270 70602 72008 gene locus_tag LOCUS_69280 70602 72008 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_69280 72046 72996 gene locus_tag LOCUS_69290 gene nudC 72046 72996 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_69290 73308 73066 gene locus_tag LOCUS_69300 73308 73066 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_69300 73459 75660 gene locus_tag LOCUS_69310 73459 75660 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_69310 75815 76162 gene locus_tag LOCUS_69320 75815 76162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973787.1 protein_id gnl|my_center|LOCUS_69320 76335 76703 gene locus_tag LOCUS_69330 76335 76703 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973786.1 protein_id gnl|my_center|LOCUS_69330 76700 77023 gene locus_tag LOCUS_69340 76700 77023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973785.1 protein_id gnl|my_center|LOCUS_69340 >Feature sequence35 341 12 gene locus_tag LOCUS_69350 341 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 246 1646 gene locus_tag LOCUS_69360 246 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 1705 3162 gene locus_tag LOCUS_69370 1705 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 3159 5720 gene locus_tag LOCUS_69380 3159 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 6045 6860 gene locus_tag LOCUS_69390 6045 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69390 7986 6838 gene locus_tag LOCUS_69400 7986 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69400 7985 8443 gene locus_tag LOCUS_69410 7985 8443 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270054.1 protein_id gnl|my_center|LOCUS_69410 9475 8558 gene locus_tag LOCUS_69420 9475 8558 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_69420 10219 9632 gene locus_tag LOCUS_69430 10219 9632 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69430 11695 10442 gene locus_tag LOCUS_69440 11695 10442 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878220.1 protein_id gnl|my_center|LOCUS_69440 11883 12227 gene locus_tag LOCUS_69450 11883 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 13569 12919 gene locus_tag LOCUS_69460 13569 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 14127 14435 gene locus_tag LOCUS_69470 14127 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69470 14534 14881 gene locus_tag LOCUS_69480 14534 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69480 15542 15150 gene locus_tag LOCUS_69490 15542 15150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69490 16349 15603 gene locus_tag LOCUS_69500 16349 15603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974670.1 protein_id gnl|my_center|LOCUS_69500 16444 17076 gene locus_tag LOCUS_69510 16444 17076 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 protein_id gnl|my_center|LOCUS_69510 17910 17641 gene locus_tag LOCUS_69520 17910 17641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 18564 18091 gene locus_tag LOCUS_69530 18564 18091 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971698.1 protein_id gnl|my_center|LOCUS_69530 20050 18686 gene locus_tag LOCUS_69540 20050 18686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69540 21258 20047 gene locus_tag LOCUS_69550 21258 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69550 21641 21255 gene locus_tag LOCUS_69560 21641 21255 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 protein_id gnl|my_center|LOCUS_69560 22108 21668 gene locus_tag LOCUS_69570 22108 21668 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 protein_id gnl|my_center|LOCUS_69570 22965 22105 gene locus_tag LOCUS_69580 22965 22105 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 protein_id gnl|my_center|LOCUS_69580 23473 24690 gene locus_tag LOCUS_69590 23473 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69590 25830 24925 gene locus_tag LOCUS_69600 25830 24925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225819.1 protein_id gnl|my_center|LOCUS_69600 26884 25916 gene locus_tag LOCUS_69610 26884 25916 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876395.1 protein_id gnl|my_center|LOCUS_69610 27480 27169 gene locus_tag LOCUS_69620 27480 27169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69620 27839 27483 gene locus_tag LOCUS_69630 27839 27483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 28826 28053 gene locus_tag LOCUS_69640 28826 28053 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202239.1 protein_id gnl|my_center|LOCUS_69640 29272 29964 gene locus_tag LOCUS_69650 29272 29964 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202239.1 protein_id gnl|my_center|LOCUS_69650 30115 30591 gene locus_tag LOCUS_69660 30115 30591 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155361521.1 protein_id gnl|my_center|LOCUS_69660 31527 30664 gene locus_tag LOCUS_69670 31527 30664 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037199.1 protein_id gnl|my_center|LOCUS_69670 31590 31928 gene locus_tag LOCUS_69680 31590 31928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 32285 32106 gene locus_tag LOCUS_69690 32285 32106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69690 34299 32479 gene locus_tag LOCUS_69700 34299 32479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_69700 35766 34774 gene locus_tag LOCUS_69710 35766 34774 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487139.1 protein_id gnl|my_center|LOCUS_69710 36136 36315 gene locus_tag LOCUS_69720 36136 36315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69720 36359 37381 gene locus_tag LOCUS_69730 36359 37381 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225476.1 protein_id gnl|my_center|LOCUS_69730 38799 37501 gene locus_tag LOCUS_69740 38799 37501 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_69740 41915 38796 gene locus_tag LOCUS_69750 41915 38796 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 protein_id gnl|my_center|LOCUS_69750 42209 42048 gene locus_tag LOCUS_69760 42209 42048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 42637 43032 gene locus_tag LOCUS_69770 42637 43032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 43803 43300 gene locus_tag LOCUS_69780 43803 43300 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381091.1 protein_id gnl|my_center|LOCUS_69780 44057 46003 gene locus_tag LOCUS_69790 44057 46003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69790 46427 48205 gene locus_tag LOCUS_69800 46427 48205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69800 48340 50241 gene locus_tag LOCUS_69810 48340 50241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69810 52163 50376 gene locus_tag LOCUS_69820 gene selB 52163 50376 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_69820 53440 52166 gene locus_tag LOCUS_69830 gene selA 53440 52166 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226943.1 protein_id gnl|my_center|LOCUS_69830 53602 53509 gene locus_tag LOCUS_t00820 53602 53509 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 53657 54736 gene locus_tag LOCUS_69840 gene selD 53657 54736 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226944.1 protein_id gnl|my_center|LOCUS_69840 55729 54791 gene locus_tag LOCUS_69850 55729 54791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 57512 55764 gene locus_tag LOCUS_69860 57512 55764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 58163 57576 gene locus_tag LOCUS_69870 58163 57576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 58967 58494 gene locus_tag LOCUS_69880 58967 58494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 59258 59070 gene locus_tag LOCUS_69890 59258 59070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69890 60176 59259 gene locus_tag LOCUS_69900 60176 59259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 60718 60173 gene locus_tag LOCUS_69910 60718 60173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 61302 60694 gene locus_tag LOCUS_69920 61302 60694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 62014 61313 gene locus_tag LOCUS_69930 62014 61313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 62950 62306 gene locus_tag LOCUS_69940 62950 62306 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228116.1 protein_id gnl|my_center|LOCUS_69940 63177 64409 gene locus_tag LOCUS_69950 63177 64409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69950 >Feature sequence36 571 212 gene locus_tag LOCUS_69960 571 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 2099 1092 gene locus_tag LOCUS_69970 2099 1092 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 protein_id gnl|my_center|LOCUS_69970 2905 2132 gene locus_tag LOCUS_69980 2905 2132 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_69980 4028 2907 gene locus_tag LOCUS_69990 4028 2907 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_69990 5074 4025 gene locus_tag LOCUS_70000 5074 4025 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027501.1 protein_id gnl|my_center|LOCUS_70000 6089 4995 gene locus_tag LOCUS_70010 6089 4995 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544457.1 protein_id gnl|my_center|LOCUS_70010 6940 6086 gene locus_tag LOCUS_70020 6940 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 7674 6937 gene locus_tag LOCUS_70030 7674 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 8085 9311 gene locus_tag LOCUS_70040 8085 9311 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_70040 10678 10478 gene locus_tag LOCUS_70050 10678 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70050 10848 10675 gene locus_tag LOCUS_70060 10848 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70060 11886 12032 gene locus_tag LOCUS_70070 11886 12032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70070 12635 12090 gene locus_tag LOCUS_70080 12635 12090 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971687.1 protein_id gnl|my_center|LOCUS_70080 13614 12820 gene locus_tag LOCUS_70090 gene mutM 13614 12820 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_70090 13943 14302 gene locus_tag LOCUS_70100 13943 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70100 14465 14752 gene locus_tag LOCUS_70110 14465 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70110 14871 15212 gene locus_tag LOCUS_70120 14871 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70120 15314 15685 gene locus_tag LOCUS_70130 15314 15685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70130 16076 15807 gene locus_tag LOCUS_70140 16076 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70140 16827 16291 gene locus_tag LOCUS_70150 16827 16291 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223770.1 protein_id gnl|my_center|LOCUS_70150 16903 17952 gene locus_tag LOCUS_70160 16903 17952 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223769.1 protein_id gnl|my_center|LOCUS_70160 17949 18668 gene locus_tag LOCUS_70170 17949 18668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70170 18680 19714 gene locus_tag LOCUS_70180 18680 19714 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_70180 19832 20353 gene locus_tag LOCUS_70190 19832 20353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 20867 20562 gene locus_tag LOCUS_70200 20867 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70200 20806 21000 gene locus_tag LOCUS_70210 20806 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 21037 21861 gene locus_tag LOCUS_70220 21037 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 22287 22706 gene locus_tag LOCUS_70230 22287 22706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 23096 22893 gene locus_tag LOCUS_70240 23096 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 23289 23050 gene locus_tag LOCUS_70250 23289 23050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 23522 23277 gene locus_tag LOCUS_70260 23522 23277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70260 23836 23543 gene locus_tag LOCUS_70270 23836 23543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 23997 24347 gene locus_tag LOCUS_70280 23997 24347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70280 24514 25071 gene locus_tag LOCUS_70290 24514 25071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 26007 26996 gene locus_tag LOCUS_70300 26007 26996 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_70300 27264 27025 gene locus_tag LOCUS_70310 27264 27025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70310 27283 27519 gene locus_tag LOCUS_70320 27283 27519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 27662 28633 gene locus_tag LOCUS_70330 27662 28633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70330 28669 29031 gene locus_tag LOCUS_70340 28669 29031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70340 29062 30237 gene locus_tag LOCUS_70350 29062 30237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 30350 30529 gene locus_tag LOCUS_70360 30350 30529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 31464 30562 gene locus_tag LOCUS_70370 31464 30562 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086604761.1 protein_id gnl|my_center|LOCUS_70370 31702 31424 gene locus_tag LOCUS_70380 31702 31424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70380 31616 32155 gene locus_tag LOCUS_70390 31616 32155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125537386.1 protein_id gnl|my_center|LOCUS_70390 32152 33414 gene locus_tag LOCUS_70400 32152 33414 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031229.1 protein_id gnl|my_center|LOCUS_70400 33468 34523 gene locus_tag LOCUS_70410 33468 34523 CDS product DnaB-like helicase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031228.1 protein_id gnl|my_center|LOCUS_70410 34553 35920 gene locus_tag LOCUS_70420 34553 35920 CDS product DUF317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031227.1 protein_id gnl|my_center|LOCUS_70420 36015 37091 gene locus_tag LOCUS_70430 36015 37091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70430 37783 37223 gene locus_tag LOCUS_70440 37783 37223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 37968 38519 gene locus_tag LOCUS_70450 37968 38519 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109619.1 protein_id gnl|my_center|LOCUS_70450 39059 39214 gene locus_tag LOCUS_70460 39059 39214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70460 41061 40324 gene locus_tag LOCUS_70470 41061 40324 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_70470 42004 42744 gene locus_tag LOCUS_70480 42004 42744 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730773.1 protein_id gnl|my_center|LOCUS_70480 42812 43444 gene locus_tag LOCUS_70490 42812 43444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 43525 44316 gene locus_tag LOCUS_70500 43525 44316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390557.1 protein_id gnl|my_center|LOCUS_70500 45049 45888 gene locus_tag LOCUS_70510 45049 45888 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_70510 46018 46722 gene locus_tag LOCUS_70520 46018 46722 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026996.1 protein_id gnl|my_center|LOCUS_70520 47478 47759 gene locus_tag LOCUS_70530 47478 47759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 48293 47928 gene locus_tag LOCUS_70540 48293 47928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 48431 48682 gene locus_tag LOCUS_70550 48431 48682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 49229 48981 gene locus_tag LOCUS_70560 49229 48981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_70560 51025 50090 gene locus_tag LOCUS_70570 51025 50090 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222870.1 protein_id gnl|my_center|LOCUS_70570 51177 51938 gene locus_tag LOCUS_70580 51177 51938 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730620.1 protein_id gnl|my_center|LOCUS_70580 52372 52067 gene locus_tag LOCUS_70590 52372 52067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70590 52402 52629 gene locus_tag LOCUS_70600 52402 52629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70600 53159 52830 gene locus_tag LOCUS_70610 53159 52830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 54112 53177 gene locus_tag LOCUS_70620 54112 53177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 55062 54607 gene locus_tag LOCUS_70630 55062 54607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70630 56710 55361 gene locus_tag LOCUS_70640 56710 55361 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225363.1 protein_id gnl|my_center|LOCUS_70640 57635 56775 gene locus_tag LOCUS_70650 57635 56775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_70650 58319 58717 gene locus_tag LOCUS_70660 58319 58717 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 protein_id gnl|my_center|LOCUS_70660 58714 58977 gene locus_tag LOCUS_70670 58714 58977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 59313 59146 gene locus_tag LOCUS_70680 59313 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 60022 59537 gene locus_tag LOCUS_70690 60022 59537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 60284 60045 gene locus_tag LOCUS_70700 60284 60045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70700 60489 60914 gene locus_tag LOCUS_70710 60489 60914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70710 60911 61276 gene locus_tag LOCUS_70720 60911 61276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 >Feature sequence37 147 824 gene locus_tag LOCUS_70730 147 824 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977695.1 protein_id gnl|my_center|LOCUS_70730 1135 2175 gene locus_tag LOCUS_70740 gene cbcC 1135 2175 CDS product carbohydrate-binding protein CbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027945.1 protein_id gnl|my_center|LOCUS_70740 3157 2240 gene locus_tag LOCUS_70750 3157 2240 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_70750 4175 3333 gene locus_tag LOCUS_70760 4175 3333 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226033.1 protein_id gnl|my_center|LOCUS_70760 5266 4259 gene locus_tag LOCUS_70770 5266 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027947.1 protein_id gnl|my_center|LOCUS_70770 8715 5263 gene locus_tag LOCUS_70780 gene dnaE 8715 5263 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_70780 10232 9177 gene locus_tag LOCUS_70790 10232 9177 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 protein_id gnl|my_center|LOCUS_70790 11551 10652 gene locus_tag LOCUS_70800 11551 10652 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_70800 12680 11862 gene locus_tag LOCUS_70810 12680 11862 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027953.1 protein_id gnl|my_center|LOCUS_70810 13876 12704 gene locus_tag LOCUS_70820 13876 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 14214 14648 gene locus_tag LOCUS_70830 14214 14648 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977077.1 protein_id gnl|my_center|LOCUS_70830 15920 14676 gene locus_tag LOCUS_70840 15920 14676 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_70840 17698 15965 gene locus_tag LOCUS_70850 17698 15965 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_70850 18136 19122 gene locus_tag LOCUS_70860 18136 19122 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027956.1 protein_id gnl|my_center|LOCUS_70860 19416 19201 gene locus_tag LOCUS_70870 19416 19201 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977071.1 protein_id gnl|my_center|LOCUS_70870 20645 19839 gene locus_tag LOCUS_70880 20645 19839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027957.1 protein_id gnl|my_center|LOCUS_70880 21925 20642 gene locus_tag LOCUS_70890 21925 20642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 22259 22567 gene locus_tag LOCUS_70900 22259 22567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70900 22646 23428 gene locus_tag LOCUS_70910 22646 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977068.1 protein_id gnl|my_center|LOCUS_70910 23425 24003 gene locus_tag LOCUS_70920 23425 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70920 25595 24126 gene locus_tag LOCUS_70930 gene der 25595 24126 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_70930 26339 25647 gene locus_tag LOCUS_70940 26339 25647 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_70940 27049 26336 gene locus_tag LOCUS_70950 gene cmk 27049 26336 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_70950 28331 27246 gene locus_tag LOCUS_70960 28331 27246 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_70960 28885 28328 gene locus_tag LOCUS_70970 28885 28328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70970 28854 29540 gene locus_tag LOCUS_70980 28854 29540 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027961.1 protein_id gnl|my_center|LOCUS_70980 30479 29634 gene locus_tag LOCUS_70990 30479 29634 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977059.1 protein_id gnl|my_center|LOCUS_70990 31505 30483 gene locus_tag LOCUS_71000 31505 30483 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_71000 32272 31502 gene locus_tag LOCUS_71010 32272 31502 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027962.1 protein_id gnl|my_center|LOCUS_71010 33351 32269 gene locus_tag LOCUS_71020 33351 32269 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_71020 34001 33348 gene locus_tag LOCUS_71030 gene pnuC 34001 33348 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_71030 35329 34127 gene locus_tag LOCUS_71040 35329 34127 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027963.1 protein_id gnl|my_center|LOCUS_71040 35964 35329 gene locus_tag LOCUS_71050 gene scpB 35964 35329 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_71050 37286 35961 gene locus_tag LOCUS_71060 37286 35961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71060 37934 37335 gene locus_tag LOCUS_71070 37934 37335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495132.1 protein_id gnl|my_center|LOCUS_71070 39046 37931 gene locus_tag LOCUS_71080 39046 37931 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_71080 40540 39425 gene locus_tag LOCUS_71090 gene ald 40540 39425 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_71090 43056 40681 gene locus_tag LOCUS_71100 43056 40681 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868162.1 protein_id gnl|my_center|LOCUS_71100 43864 43238 gene locus_tag LOCUS_71110 43864 43238 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_71110 45627 43969 gene locus_tag LOCUS_71120 45627 43969 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_71120 46344 48146 gene locus_tag LOCUS_71130 46344 48146 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_71130 49196 48195 gene locus_tag LOCUS_71140 49196 48195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71140 49514 51121 gene locus_tag LOCUS_71150 49514 51121 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_71150 52271 51165 gene locus_tag LOCUS_71160 52271 51165 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_71160 >Feature sequence38 147 584 gene locus_tag LOCUS_71170 147 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71170 762 619 gene locus_tag LOCUS_71180 762 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71180 851 1108 gene locus_tag LOCUS_71190 851 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71190 1724 1524 gene locus_tag LOCUS_71200 1724 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 2437 1721 gene locus_tag LOCUS_71210 2437 1721 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 protein_id gnl|my_center|LOCUS_71210 3782 2553 gene locus_tag LOCUS_71220 3782 2553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766116.1 protein_id gnl|my_center|LOCUS_71220 4257 5345 gene locus_tag LOCUS_71230 4257 5345 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_71230 5386 6180 gene locus_tag LOCUS_71240 5386 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71240 6524 6150 gene locus_tag LOCUS_71250 6524 6150 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043782036.1 protein_id gnl|my_center|LOCUS_71250 7955 7083 gene locus_tag LOCUS_71260 7955 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71260 8067 8219 gene locus_tag LOCUS_71270 8067 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71270 8363 8593 gene locus_tag LOCUS_71280 8363 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_71280 9009 8743 gene locus_tag LOCUS_71290 9009 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71290 9008 9673 gene locus_tag LOCUS_71300 9008 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71300 9649 9846 gene locus_tag LOCUS_71310 9649 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71310 9858 10094 gene locus_tag LOCUS_71320 9858 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71320 10046 10612 gene locus_tag LOCUS_71330 10046 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71330 10857 11714 gene locus_tag LOCUS_71340 10857 11714 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 protein_id gnl|my_center|LOCUS_71340 13142 11937 gene locus_tag LOCUS_71350 13142 11937 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 protein_id gnl|my_center|LOCUS_71350 13396 13139 gene locus_tag LOCUS_71360 13396 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71360 14307 13393 gene locus_tag LOCUS_71370 14307 13393 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111553.1 protein_id gnl|my_center|LOCUS_71370 14978 14514 gene locus_tag LOCUS_71380 14978 14514 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093742.1 protein_id gnl|my_center|LOCUS_71380 15157 15741 gene locus_tag LOCUS_71390 15157 15741 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081838.1 protein_id gnl|my_center|LOCUS_71390 17050 18612 gene locus_tag LOCUS_71400 17050 18612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71400 19867 18956 gene locus_tag LOCUS_71410 19867 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71410 19848 20621 gene locus_tag LOCUS_71420 19848 20621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_71420 20837 21145 gene locus_tag LOCUS_71430 gene wblA 20837 21145 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_71430 21303 22043 gene locus_tag LOCUS_71440 21303 22043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71440 22140 22328 gene locus_tag LOCUS_71450 22140 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71450 23446 22556 gene locus_tag LOCUS_71460 23446 22556 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162624885.1 protein_id gnl|my_center|LOCUS_71460 25735 23906 gene locus_tag LOCUS_71470 25735 23906 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_71470 25900 26691 gene locus_tag LOCUS_71480 25900 26691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71480 28114 29340 gene locus_tag LOCUS_71490 28114 29340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71490 29506 30660 gene locus_tag LOCUS_71500 29506 30660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71500 30702 30944 gene locus_tag LOCUS_71510 30702 30944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71510 31074 30862 gene locus_tag LOCUS_71520 31074 30862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71520 31058 31207 gene locus_tag LOCUS_71530 31058 31207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 31268 31531 gene locus_tag LOCUS_71540 31268 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 31827 31510 gene locus_tag LOCUS_71550 31827 31510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71550 32318 31959 gene locus_tag LOCUS_71560 32318 31959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71560 32424 32690 gene locus_tag LOCUS_71570 32424 32690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71570 32906 32685 gene locus_tag LOCUS_71580 32906 32685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71580 36050 33243 gene locus_tag LOCUS_71590 36050 33243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 36546 36250 gene locus_tag LOCUS_71600 36546 36250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 36976 36722 gene locus_tag LOCUS_71610 36976 36722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71610 37127 36939 gene locus_tag LOCUS_71620 37127 36939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71620 37491 37270 gene locus_tag LOCUS_71630 37491 37270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71630 37626 40358 gene locus_tag LOCUS_71640 37626 40358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71640 40962 40777 gene locus_tag LOCUS_71650 40962 40777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71650 41102 41248 gene locus_tag LOCUS_71660 41102 41248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 44188 41708 gene locus_tag LOCUS_71670 44188 41708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71670 44625 45044 gene locus_tag LOCUS_71680 44625 45044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_71680 45057 45293 gene locus_tag LOCUS_71690 45057 45293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_71690 46482 45241 gene locus_tag LOCUS_71700 46482 45241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71700 47192 47485 gene locus_tag LOCUS_71710 47192 47485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71710 47737 48039 gene locus_tag LOCUS_71720 47737 48039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 48460 49545 gene locus_tag LOCUS_71730 gene recA 48460 49545 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_71730 50358 49708 gene locus_tag LOCUS_71740 50358 49708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_71740 50651 51502 gene locus_tag LOCUS_71750 50651 51502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71750 52282 52458 gene locus_tag LOCUS_71760 52282 52458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71760 >Feature sequence39 145 753 gene locus_tag LOCUS_71770 145 753 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_71770 973 3360 gene locus_tag LOCUS_71780 973 3360 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_71780 3518 4387 gene locus_tag LOCUS_71790 3518 4387 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_71790 4384 4716 gene locus_tag LOCUS_71800 4384 4716 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_71800 4722 5528 gene locus_tag LOCUS_71810 4722 5528 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_71810 6125 5973 gene locus_tag LOCUS_71820 6125 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71820 6070 6528 gene locus_tag LOCUS_71830 6070 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71830 6546 7298 gene locus_tag LOCUS_71840 6546 7298 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066949941.1 protein_id gnl|my_center|LOCUS_71840 7352 7825 gene locus_tag LOCUS_71850 7352 7825 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_71850 8011 8577 gene locus_tag LOCUS_71860 8011 8577 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_71860 8636 10039 gene locus_tag LOCUS_71870 8636 10039 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_71870 10553 10143 gene locus_tag LOCUS_71880 10553 10143 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668708.1 protein_id gnl|my_center|LOCUS_71880 10942 13827 gene locus_tag LOCUS_71890 gene gcvP 10942 13827 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_71890 14173 13967 gene locus_tag LOCUS_71900 14173 13967 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_71900 15166 14540 gene locus_tag LOCUS_71910 15166 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325749.1 protein_id gnl|my_center|LOCUS_71910 15670 17202 gene locus_tag LOCUS_71920 15670 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 protein_id gnl|my_center|LOCUS_71920 19001 17241 gene locus_tag LOCUS_71930 19001 17241 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742065.1 protein_id gnl|my_center|LOCUS_71930 19164 19964 gene locus_tag LOCUS_71940 19164 19964 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_71940 20811 19990 gene locus_tag LOCUS_71950 20811 19990 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_71950 20997 21746 gene locus_tag LOCUS_71960 20997 21746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71960 21743 23818 gene locus_tag LOCUS_71970 21743 23818 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079184950.1 protein_id gnl|my_center|LOCUS_71970 23815 24834 gene locus_tag LOCUS_71980 23815 24834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104311.1 protein_id gnl|my_center|LOCUS_71980 26582 26199 gene locus_tag LOCUS_71990 26582 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71990 27095 27481 gene locus_tag LOCUS_72000 27095 27481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 27828 28379 gene locus_tag LOCUS_72010 27828 28379 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977462.1 protein_id gnl|my_center|LOCUS_72010 28464 29492 gene locus_tag LOCUS_72020 28464 29492 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_72020 29654 30679 gene locus_tag LOCUS_72030 29654 30679 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027747.1 protein_id gnl|my_center|LOCUS_72030 31409 30729 gene locus_tag LOCUS_72040 31409 30729 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_72040 31445 32776 gene locus_tag LOCUS_72050 31445 32776 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_72050 33855 32767 gene locus_tag LOCUS_72060 33855 32767 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222702.1 protein_id gnl|my_center|LOCUS_72060 33929 34858 gene locus_tag LOCUS_72070 33929 34858 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_72070 35372 34875 gene locus_tag LOCUS_72080 35372 34875 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_72080 35591 36217 gene locus_tag LOCUS_72090 35591 36217 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_72090 36214 37302 gene locus_tag LOCUS_72100 36214 37302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72100 38418 37360 gene locus_tag LOCUS_72110 38418 37360 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031381.1 protein_id gnl|my_center|LOCUS_72110 39672 38476 gene locus_tag LOCUS_72120 39672 38476 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978298.1 protein_id gnl|my_center|LOCUS_72120 40806 39754 gene locus_tag LOCUS_72130 40806 39754 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978297.1 protein_id gnl|my_center|LOCUS_72130 41224 40799 gene locus_tag LOCUS_72140 41224 40799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72140 41414 42082 gene locus_tag LOCUS_72150 41414 42082 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768246.1 protein_id gnl|my_center|LOCUS_72150 44428 42251 gene locus_tag LOCUS_72160 44428 42251 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226456.1 protein_id gnl|my_center|LOCUS_72160 44987 45433 gene locus_tag LOCUS_72170 44987 45433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72170 45481 46920 gene locus_tag LOCUS_72180 45481 46920 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_72180 47057 49291 gene locus_tag LOCUS_72190 47057 49291 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_72190 50899 49343 gene locus_tag LOCUS_72200 50899 49343 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_72200 51126 51308 gene locus_tag LOCUS_72210 51126 51308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72210 >Feature sequence40 <1 829 gene locus_tag LOCUS_72220 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968094.1:non-ribosomal peptide synthetase DhbF 907 1089 gene locus_tag LOCUS_72230 907 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72230 1126 1911 gene locus_tag LOCUS_72240 1126 1911 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_72240 2133 2285 gene locus_tag LOCUS_72250 2133 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72250 2441 2689 gene locus_tag LOCUS_72260 2441 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72260 2738 2989 gene locus_tag LOCUS_72270 2738 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72270 2982 4193 gene locus_tag LOCUS_72280 2982 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72280 4420 4253 gene locus_tag LOCUS_72290 4420 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72290 4868 5875 gene locus_tag LOCUS_72300 4868 5875 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226606.1 protein_id gnl|my_center|LOCUS_72300 5905 6744 gene locus_tag LOCUS_72310 5905 6744 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_72310 6741 7634 gene locus_tag LOCUS_72320 6741 7634 CDS product acetylating acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749472.1 protein_id gnl|my_center|LOCUS_72320 7631 8653 gene locus_tag LOCUS_72330 gene dmpG 7631 8653 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749470.1 protein_id gnl|my_center|LOCUS_72330 8646 9740 gene locus_tag LOCUS_72340 gene hisC 8646 9740 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_72340 9725 10726 gene locus_tag LOCUS_72350 9725 10726 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078864641.1 protein_id gnl|my_center|LOCUS_72350 13813 10967 gene locus_tag LOCUS_72360 13813 10967 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_72360 14862 15830 gene locus_tag LOCUS_72370 14862 15830 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_72370 16141 16344 gene locus_tag LOCUS_72380 16141 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72380 17224 16565 gene locus_tag LOCUS_72390 17224 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72390 17546 17172 gene locus_tag LOCUS_72400 17546 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72400 17919 17461 gene locus_tag LOCUS_72410 17919 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72410 18669 17974 gene locus_tag LOCUS_72420 18669 17974 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_72420 18783 19226 gene locus_tag LOCUS_72430 18783 19226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72430 20072 19635 gene locus_tag LOCUS_72440 20072 19635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72440 20780 20097 gene locus_tag LOCUS_72450 20780 20097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72450 22425 21172 gene locus_tag LOCUS_72460 22425 21172 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031048.1 protein_id gnl|my_center|LOCUS_72460 23080 22748 gene locus_tag LOCUS_72470 23080 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 24047 23328 gene locus_tag LOCUS_72480 24047 23328 CDS product transposase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190010786.1 protein_id gnl|my_center|LOCUS_72480 24377 24195 gene locus_tag LOCUS_72490 24377 24195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72490 24703 24512 gene locus_tag LOCUS_72500 24703 24512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72500 25716 25036 gene locus_tag LOCUS_72510 25716 25036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72510 26139 25777 gene locus_tag LOCUS_72520 26139 25777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 26384 26935 gene locus_tag LOCUS_72530 26384 26935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72530 27005 27367 gene locus_tag LOCUS_72540 27005 27367 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 protein_id gnl|my_center|LOCUS_72540 27651 27962 gene locus_tag LOCUS_72550 27651 27962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72550 28425 28264 gene locus_tag LOCUS_72560 28425 28264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72560 28571 29017 gene locus_tag LOCUS_72570 28571 29017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72570 29267 30169 gene locus_tag LOCUS_72580 29267 30169 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877762.1 protein_id gnl|my_center|LOCUS_72580 31628 30390 gene locus_tag LOCUS_72590 31628 30390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72590 31873 32025 gene locus_tag LOCUS_72600 31873 32025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72600 33241 32861 gene locus_tag LOCUS_72610 33241 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72610 33890 34498 gene locus_tag LOCUS_72620 33890 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72620 35275 36165 gene locus_tag LOCUS_72630 35275 36165 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111517.1 protein_id gnl|my_center|LOCUS_72630 36874 36392 gene locus_tag LOCUS_72640 36874 36392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72640 37825 37178 gene locus_tag LOCUS_72650 37825 37178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72650 38771 38397 gene locus_tag LOCUS_72660 38771 38397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72660 39112 39480 gene locus_tag LOCUS_72670 39112 39480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 40041 39811 gene locus_tag LOCUS_72680 40041 39811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 40220 41587 gene locus_tag LOCUS_72690 40220 41587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72690 41521 41832 gene locus_tag LOCUS_72700 41521 41832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_72700 41887 42324 gene locus_tag LOCUS_72710 41887 42324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72710 42886 43404 gene locus_tag LOCUS_72720 42886 43404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 43765 44034 gene locus_tag LOCUS_72730 43765 44034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 44042 44371 gene locus_tag LOCUS_72740 44042 44371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72740 45292 44774 gene locus_tag LOCUS_72750 45292 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72750 >Feature sequence41 676 1287 gene locus_tag LOCUS_72760 676 1287 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030034.1 protein_id gnl|my_center|LOCUS_72760 2254 1304 gene locus_tag LOCUS_72770 2254 1304 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 protein_id gnl|my_center|LOCUS_72770 3861 2422 gene locus_tag LOCUS_72780 3861 2422 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_72780 3935 4534 gene locus_tag LOCUS_72790 3935 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72790 4682 5512 gene locus_tag LOCUS_72800 4682 5512 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_72800 5663 7312 gene locus_tag LOCUS_72810 5663 7312 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_72810 8310 7675 gene locus_tag LOCUS_72820 8310 7675 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029946.1 protein_id gnl|my_center|LOCUS_72820 8309 9445 gene locus_tag LOCUS_72830 gene deoC 8309 9445 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_72830 9452 10882 gene locus_tag LOCUS_72840 9452 10882 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_72840 10875 11765 gene locus_tag LOCUS_72850 10875 11765 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_72850 12265 11849 gene locus_tag LOCUS_72860 12265 11849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72860 12394 13068 gene locus_tag LOCUS_72870 12394 13068 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_72870 13894 13259 gene locus_tag LOCUS_72880 13894 13259 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327117.1 protein_id gnl|my_center|LOCUS_72880 14232 14909 gene locus_tag LOCUS_72890 gene afsQ1 14232 14909 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_72890 14906 16546 gene locus_tag LOCUS_72900 gene afsQ2 14906 16546 CDS product two-component system sensor histidine kinase AfsQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974067.1 protein_id gnl|my_center|LOCUS_72900 16543 17163 gene locus_tag LOCUS_72910 16543 17163 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974068.1 protein_id gnl|my_center|LOCUS_72910 17299 17889 gene locus_tag LOCUS_72920 17299 17889 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029938.1 protein_id gnl|my_center|LOCUS_72920 17980 18183 gene locus_tag LOCUS_72930 17980 18183 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_72930 18786 18454 gene locus_tag LOCUS_72940 18786 18454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72940 20070 18925 gene locus_tag LOCUS_72950 20070 18925 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_72950 20381 20992 gene locus_tag LOCUS_72960 20381 20992 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029936.1 protein_id gnl|my_center|LOCUS_72960 22009 21008 gene locus_tag LOCUS_72970 22009 21008 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_72970 22072 23376 gene locus_tag LOCUS_72980 22072 23376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029933.1 protein_id gnl|my_center|LOCUS_72980 23557 24558 gene locus_tag LOCUS_72990 23557 24558 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_72990 24644 24943 gene locus_tag LOCUS_73000 24644 24943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73000 26369 25092 gene locus_tag LOCUS_73010 26369 25092 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_73010 26810 26400 gene locus_tag LOCUS_73020 26810 26400 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_73020 28072 26807 gene locus_tag LOCUS_73030 28072 26807 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_73030 29211 28069 gene locus_tag LOCUS_73040 29211 28069 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029927.1 protein_id gnl|my_center|LOCUS_73040 30662 29208 gene locus_tag LOCUS_73050 30662 29208 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_73050 32020 30965 gene locus_tag LOCUS_73060 32020 30965 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974087.1 protein_id gnl|my_center|LOCUS_73060 33420 32179 gene locus_tag LOCUS_73070 33420 32179 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_73070 34737 33667 gene locus_tag LOCUS_73080 34737 33667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_73080 35672 34743 gene locus_tag LOCUS_73090 35672 34743 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 protein_id gnl|my_center|LOCUS_73090 37099 35684 gene locus_tag LOCUS_73100 37099 35684 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_73100 38385 37096 gene locus_tag LOCUS_73110 38385 37096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 protein_id gnl|my_center|LOCUS_73110 38564 39589 gene locus_tag LOCUS_73120 38564 39589 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_73120 39589 40947 gene locus_tag LOCUS_73130 39589 40947 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_73130 >Feature sequence42 65 427 gene locus_tag LOCUS_73140 65 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73140 895 437 gene locus_tag LOCUS_73150 895 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 3272 903 gene locus_tag LOCUS_73160 3272 903 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728610.1 protein_id gnl|my_center|LOCUS_73160 4414 3338 gene locus_tag LOCUS_73170 4414 3338 CDS product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776255.1 protein_id gnl|my_center|LOCUS_73170 6752 5379 gene locus_tag LOCUS_73180 6752 5379 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028961.1 protein_id gnl|my_center|LOCUS_73180 8239 6824 gene locus_tag LOCUS_73190 8239 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73190 9078 8422 gene locus_tag LOCUS_73200 9078 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73200 9234 9551 gene locus_tag LOCUS_73210 9234 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73210 9728 9567 gene locus_tag LOCUS_73220 9728 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 10799 10164 gene locus_tag LOCUS_73230 10799 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73230 12665 11031 gene locus_tag LOCUS_73240 12665 11031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_73240 12550 13422 gene locus_tag LOCUS_73250 12550 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73250 14601 13813 gene locus_tag LOCUS_73260 14601 13813 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_73260 16156 14780 gene locus_tag LOCUS_73270 16156 14780 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_73270 16744 16301 gene locus_tag LOCUS_73280 16744 16301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73280 17811 17047 gene locus_tag LOCUS_73290 17811 17047 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_73290 18824 17865 gene locus_tag LOCUS_73300 18824 17865 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729493.1 protein_id gnl|my_center|LOCUS_73300 18930 19331 gene locus_tag LOCUS_73310 18930 19331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_73310 19968 19507 gene locus_tag LOCUS_73320 19968 19507 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 protein_id gnl|my_center|LOCUS_73320 21046 20084 gene locus_tag LOCUS_73330 21046 20084 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729493.1 protein_id gnl|my_center|LOCUS_73330 21567 21193 gene locus_tag LOCUS_73340 21567 21193 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_73340 22134 21814 gene locus_tag LOCUS_73350 22134 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73350 22286 23530 gene locus_tag LOCUS_73360 22286 23530 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_73360 23630 25129 gene locus_tag LOCUS_73370 23630 25129 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 protein_id gnl|my_center|LOCUS_73370 27080 27262 gene locus_tag LOCUS_73380 27080 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73380 28536 27772 gene locus_tag LOCUS_73390 28536 27772 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976828.1 protein_id gnl|my_center|LOCUS_73390 29536 28553 gene locus_tag LOCUS_73400 29536 28553 CDS product IS481-like element IS1649 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027058.1 protein_id gnl|my_center|LOCUS_73400 29679 30125 gene locus_tag LOCUS_73410 29679 30125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73410 30217 30651 gene locus_tag LOCUS_73420 30217 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73420 31342 30671 gene locus_tag LOCUS_73430 31342 30671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73430 32430 34529 gene locus_tag LOCUS_73440 32430 34529 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_73440 >Feature sequence43 <1 2880 gene locus_tag LOCUS_73450 <1 2880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222548.1:type I polyketide synthase 2924 13051 gene locus_tag LOCUS_73460 2924 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 13059 19046 gene locus_tag LOCUS_73470 13059 19046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73470 19141 20076 gene locus_tag LOCUS_73480 19141 20076 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037942.1 protein_id gnl|my_center|LOCUS_73480 >Feature sequence44 450 202 gene locus_tag LOCUS_73490 450 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 682 365 gene locus_tag LOCUS_73500 682 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73500 855 715 gene locus_tag LOCUS_73510 855 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73510 1765 1022 gene locus_tag LOCUS_73520 1765 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73520 1933 2319 gene locus_tag LOCUS_73530 1933 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73530 2271 2873 gene locus_tag LOCUS_73540 2271 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73540 3415 2777 gene locus_tag LOCUS_73550 3415 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73550 4388 3924 gene locus_tag LOCUS_73560 4388 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73560 4602 5474 gene locus_tag LOCUS_73570 4602 5474 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192727398.1 protein_id gnl|my_center|LOCUS_73570 5840 5529 gene locus_tag LOCUS_73580 5840 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73580 6570 6866 gene locus_tag LOCUS_73590 6570 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73590 6867 7196 gene locus_tag LOCUS_73600 6867 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73600 8654 8190 gene locus_tag LOCUS_73610 8654 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73610 8607 8789 gene locus_tag LOCUS_73620 8607 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73620 8906 9745 gene locus_tag LOCUS_73630 8906 9745 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 protein_id gnl|my_center|LOCUS_73630 9864 10748 gene locus_tag LOCUS_73640 9864 10748 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728098.1 protein_id gnl|my_center|LOCUS_73640 11107 12462 gene locus_tag LOCUS_73650 11107 12462 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 protein_id gnl|my_center|LOCUS_73650 12795 13187 gene locus_tag LOCUS_73660 12795 13187 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975062.1 protein_id gnl|my_center|LOCUS_73660 13557 14177 gene locus_tag LOCUS_73670 13557 14177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73670 14257 15039 gene locus_tag LOCUS_73680 14257 15039 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879184.1 protein_id gnl|my_center|LOCUS_73680 15485 15066 gene locus_tag LOCUS_73690 15485 15066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 15830 16540 gene locus_tag LOCUS_73700 15830 16540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73700 17443 17093 gene locus_tag LOCUS_73710 17443 17093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73710 17684 17436 gene locus_tag LOCUS_73720 17684 17436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_73720 18075 17767 gene locus_tag LOCUS_73730 18075 17767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_73730 18494 18177 gene locus_tag LOCUS_73740 18494 18177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73740 19625 19200 gene locus_tag LOCUS_73750 19625 19200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73750 20699 21295 gene locus_tag LOCUS_73760 20699 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73760 24142 21626 gene locus_tag LOCUS_73770 24142 21626 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843320.1 protein_id gnl|my_center|LOCUS_73770 24418 24678 gene locus_tag LOCUS_73780 24418 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73780 >Feature sequence45 485 12 gene locus_tag LOCUS_73790 485 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 1423 656 gene locus_tag LOCUS_73800 1423 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73800 1744 1508 gene locus_tag LOCUS_73810 1744 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73810 2075 1908 gene locus_tag LOCUS_73820 2075 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73820 4376 2088 gene locus_tag LOCUS_73830 4376 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73830 3019 3112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6433 4373 gene locus_tag LOCUS_73840 6433 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73840 7299 6430 gene locus_tag LOCUS_73850 7299 6430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73850 7747 8007 gene locus_tag LOCUS_73860 7747 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_73860 8878 8048 gene locus_tag LOCUS_73870 8878 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 9010 9249 gene locus_tag LOCUS_73880 9010 9249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73880 9231 9440 gene locus_tag LOCUS_73890 9231 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73890 11040 9997 gene locus_tag LOCUS_73900 11040 9997 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229442.1 protein_id gnl|my_center|LOCUS_73900 11146 12102 gene locus_tag LOCUS_73910 11146 12102 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_73910 12236 12607 gene locus_tag LOCUS_73920 12236 12607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73920 13226 12888 gene locus_tag LOCUS_73930 13226 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73930 14725 13307 gene locus_tag LOCUS_73940 14725 13307 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027167.1 protein_id gnl|my_center|LOCUS_73940 18169 14975 gene locus_tag LOCUS_73950 18169 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73950 19347 18508 gene locus_tag LOCUS_73960 19347 18508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 19660 20265 gene locus_tag LOCUS_73970 19660 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 20516 22168 gene locus_tag LOCUS_73980 20516 22168 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485194.1 protein_id gnl|my_center|LOCUS_73980 22387 23196 gene locus_tag LOCUS_73990 22387 23196 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031761.1 protein_id gnl|my_center|LOCUS_73990 >Feature sequence46 <1 1455 gene locus_tag LOCUS_74000 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727118.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 3388 1961 gene locus_tag LOCUS_74010 3388 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74010 3890 3666 gene locus_tag LOCUS_74020 3890 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74020 5106 4555 gene locus_tag LOCUS_74030 5106 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74030 5949 5455 gene locus_tag LOCUS_74040 5949 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74040 7262 5946 gene locus_tag LOCUS_74050 gene nhaA 7262 5946 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_74050 7409 8356 gene locus_tag LOCUS_74060 7409 8356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74060 9973 8438 gene locus_tag LOCUS_74070 9973 8438 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_74070 11089 10517 gene locus_tag LOCUS_74080 11089 10517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74080 11420 11632 gene locus_tag LOCUS_74090 11420 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74090 12164 11994 gene locus_tag LOCUS_74100 12164 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74100 12968 12360 gene locus_tag LOCUS_74110 12968 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74110 13564 12962 gene locus_tag LOCUS_74120 13564 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74120 14739 13561 gene locus_tag LOCUS_74130 14739 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74130 15311 14736 gene locus_tag LOCUS_74140 gene ndk 15311 14736 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804615.1 protein_id gnl|my_center|LOCUS_74140 16366 15344 gene locus_tag LOCUS_74150 16366 15344 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528318.1 protein_id gnl|my_center|LOCUS_74150 16579 16400 gene locus_tag LOCUS_74160 16579 16400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74160 17080 16835 gene locus_tag LOCUS_74170 17080 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74170 17538 17044 gene locus_tag LOCUS_74180 17538 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74180 17942 17493 gene locus_tag LOCUS_74190 17942 17493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74190 18397 18176 gene locus_tag LOCUS_74200 18397 18176 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_74200 18777 18415 gene locus_tag LOCUS_74210 18777 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74210 19250 18774 gene locus_tag LOCUS_74220 19250 18774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74220 19687 19247 gene locus_tag LOCUS_74230 19687 19247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74230 20153 19674 gene locus_tag LOCUS_74240 20153 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74240 20434 21783 gene locus_tag LOCUS_74250 20434 21783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74250 21797 22363 gene locus_tag LOCUS_74260 21797 22363 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390927.1 protein_id gnl|my_center|LOCUS_74260 22540 23118 gene locus_tag LOCUS_74270 22540 23118 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230366.1 protein_id gnl|my_center|LOCUS_74270 >Feature sequence47 85 276 gene locus_tag LOCUS_74280 85 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74280 2222 1287 gene locus_tag LOCUS_74290 2222 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74290 2877 2446 gene locus_tag LOCUS_74300 2877 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74300 3459 3088 gene locus_tag LOCUS_74310 3459 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74310 3566 4486 gene locus_tag LOCUS_74320 3566 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74320 5311 4871 gene locus_tag LOCUS_74330 5311 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74330 5997 5278 gene locus_tag LOCUS_74340 5997 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74340 6583 7032 gene locus_tag LOCUS_74350 6583 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74350 7755 7408 gene locus_tag LOCUS_74360 7755 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74360 8444 7752 gene locus_tag LOCUS_74370 8444 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74370 8705 9211 gene locus_tag LOCUS_74380 8705 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74380 10756 9242 gene locus_tag LOCUS_74390 10756 9242 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_74390 12596 10911 gene locus_tag LOCUS_74400 12596 10911 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032668525.1 protein_id gnl|my_center|LOCUS_74400 13212 12754 gene locus_tag LOCUS_74410 13212 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749457.1 protein_id gnl|my_center|LOCUS_74410 >Feature sequence48 362 18 gene locus_tag LOCUS_74420 362 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74420 503 1564 gene locus_tag LOCUS_74430 503 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74430 1746 2873 gene locus_tag LOCUS_74440 1746 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74440 3062 4867 gene locus_tag LOCUS_74450 3062 4867 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_74450 4906 6192 gene locus_tag LOCUS_74460 4906 6192 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230529.1 protein_id gnl|my_center|LOCUS_74460 6232 8001 gene locus_tag LOCUS_74470 6232 8001 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971902.1 protein_id gnl|my_center|LOCUS_74470 8941 8165 gene locus_tag LOCUS_74480 8941 8165 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030381.1 protein_id gnl|my_center|LOCUS_74480 9829 9071 gene locus_tag LOCUS_74490 9829 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74490 10818 10105 gene locus_tag LOCUS_74500 10818 10105 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091945.1 protein_id gnl|my_center|LOCUS_74500 10981 11565 gene locus_tag LOCUS_74510 10981 11565 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870827.1 protein_id gnl|my_center|LOCUS_74510 12135 11839 gene locus_tag LOCUS_74520 12135 11839 CDS product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978083.1 protein_id gnl|my_center|LOCUS_74520 >Feature sequence49 <1 9081 gene locus_tag LOCUS_74530 <1 9081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase note possible pseudo, frameshifted >Feature sequence50 177 812 gene locus_tag LOCUS_74540 177 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74540 823 1011 gene locus_tag LOCUS_74550 823 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74550 1210 1037 gene locus_tag LOCUS_74560 1210 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74560 4243 1424 gene locus_tag LOCUS_74570 4243 1424 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225477.1 protein_id gnl|my_center|LOCUS_74570 4587 5903 gene locus_tag LOCUS_74580 4587 5903 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228796.1 protein_id gnl|my_center|LOCUS_74580 5909 7819 gene locus_tag LOCUS_74590 5909 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74590 7838 9625 gene locus_tag LOCUS_74600 7838 9625 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225490.1 protein_id gnl|my_center|LOCUS_74600 >Feature sequence51 <1 8798 gene locus_tag LOCUS_74610 <1 8798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase >Feature sequence52 266 2527 gene locus_tag LOCUS_74620 266 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74620 3658 2618 gene locus_tag LOCUS_74630 3658 2618 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_74630 4015 5313 gene locus_tag LOCUS_74640 4015 5313 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031146.1 protein_id gnl|my_center|LOCUS_74640 5441 7177 gene locus_tag LOCUS_74650 5441 7177 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972257.1 protein_id gnl|my_center|LOCUS_74650 8193 7243 gene locus_tag LOCUS_74660 8193 7243 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_74660 8346 8861 gene locus_tag LOCUS_74670 8346 8861 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222738.1 protein_id gnl|my_center|LOCUS_74670 >Feature sequence53 1788 55 gene locus_tag LOCUS_74680 gene recN 1788 55 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_74680 2919 1987 gene locus_tag LOCUS_74690 2919 1987 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_74690 3731 2916 gene locus_tag LOCUS_74700 3731 2916 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_74700 4101 3739 gene locus_tag LOCUS_74710 4101 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977039.1 protein_id gnl|my_center|LOCUS_74710 4144 4491 gene locus_tag LOCUS_74720 4144 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_74720 5346 4531 gene locus_tag LOCUS_74730 5346 4531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_74730 6599 5484 gene locus_tag LOCUS_74740 6599 5484 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_74740 7654 6596 gene locus_tag LOCUS_74750 7654 6596 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_74750 >Feature sequence54 395 1222 gene locus_tag LOCUS_74760 395 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74760 3688 1301 gene locus_tag LOCUS_74770 3688 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74770 5223 3685 gene locus_tag LOCUS_74780 5223 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74780 5566 6969 gene locus_tag LOCUS_74790 5566 6969 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_74790 7061 7675 gene locus_tag LOCUS_74800 7061 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74800 >Feature sequence55 815 258 gene locus_tag LOCUS_74810 815 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74810 1558 998 gene locus_tag LOCUS_74820 1558 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74820 2080 1787 gene locus_tag LOCUS_74830 2080 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74830 2621 2220 gene locus_tag LOCUS_74840 2621 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_74840 3029 3352 gene locus_tag LOCUS_74850 3029 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74850 4107 3517 gene locus_tag LOCUS_74860 4107 3517 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228567.1 protein_id gnl|my_center|LOCUS_74860 4252 4986 gene locus_tag LOCUS_74870 4252 4986 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977890.1 protein_id gnl|my_center|LOCUS_74870 5020 5643 gene locus_tag LOCUS_74880 5020 5643 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228569.1 protein_id gnl|my_center|LOCUS_74880 7043 6345 gene locus_tag LOCUS_74890 7043 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74890 7342 7040 gene locus_tag LOCUS_74900 7342 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74900 >Feature sequence56 667 281 gene locus_tag LOCUS_74910 667 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74910 932 672 gene locus_tag LOCUS_74920 932 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74920 1588 929 gene locus_tag LOCUS_74930 1588 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74930 2107 1856 gene locus_tag LOCUS_74940 2107 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_74940 4252 2645 gene locus_tag LOCUS_74950 4252 2645 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918975.1 protein_id gnl|my_center|LOCUS_74950 4733 4413 gene locus_tag LOCUS_74960 4733 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74960 >Feature sequence57 1275 247 gene locus_tag LOCUS_74970 1275 247 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_74970 1361 2677 gene locus_tag LOCUS_74980 1361 2677 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_74980 3448 2759 gene locus_tag LOCUS_74990 3448 2759 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977032.1 protein_id gnl|my_center|LOCUS_74990 4693 4583 gene locus_tag LOCUS_r00040 4693 4583 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence58 >Feature sequence59 >Feature sequence60 <1 2186 gene locus_tag LOCUS_75000 <1 2186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase 514 581 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence61 >Feature sequence62 66 848 gene locus_tag LOCUS_75010 66 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75010 1301 900 gene locus_tag LOCUS_75020 1301 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_75020 >Feature sequence63 <1 1266 gene locus_tag LOCUS_75030 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267825.1:syringopeptin non-ribosomal peptide synthetase SypC >Feature sequence64 >Feature sequence65 >Feature sequence66 >Feature sequence67 <1 845 gene locus_tag LOCUS_75040 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031941.1:ISL3 family transposase >Feature sequence68 >Feature sequence69 >Feature sequence70 >Feature sequence71 >Feature sequence72 >Feature sequence73 >Feature sequence74 >Feature sequence75 >Feature sequence76 >Feature sequence77 >Feature sequence78 >Feature sequence79 >Feature sequence80 169 41 gene locus_tag LOCUS_75050 169 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_75050 >Feature sequence81 >Feature sequence82 >Feature sequence83