>Feature sequence01 2284 320 gene locus_tag LOCUS_00010 2284 320 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_00010 2690 3289 gene locus_tag LOCUS_00020 2690 3289 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963332.1 protein_id gnl|my_center|LOCUS_00020 3402 5906 gene locus_tag LOCUS_00030 3402 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5964 7013 gene locus_tag LOCUS_00040 5964 7013 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_00040 7087 9084 gene locus_tag LOCUS_00050 gene pulA 7087 9084 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_00050 9181 9510 gene locus_tag LOCUS_00060 9181 9510 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_00060 9532 10425 gene locus_tag LOCUS_00070 9532 10425 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_00070 10448 11059 gene locus_tag LOCUS_00080 10448 11059 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_00080 11066 12106 gene locus_tag LOCUS_00090 gene arsB 11066 12106 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_00090 12806 12096 gene locus_tag LOCUS_00100 gene lipB 12806 12096 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_00100 13137 14828 gene locus_tag LOCUS_00110 gene lysS 13137 14828 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963334.1 protein_id gnl|my_center|LOCUS_00110 15167 16384 gene locus_tag LOCUS_00120 15167 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16494 16970 gene locus_tag LOCUS_00130 16494 16970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 18332 17046 gene locus_tag LOCUS_00140 gene hemL 18332 17046 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_00140 19454 18354 gene locus_tag LOCUS_00150 19454 18354 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_00150 20367 19456 gene locus_tag LOCUS_00160 20367 19456 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_00160 20785 22770 gene locus_tag LOCUS_00170 20785 22770 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_00170 22789 23337 gene locus_tag LOCUS_00180 22789 23337 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_00180 25667 23604 gene locus_tag LOCUS_00190 25667 23604 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_00190 26731 25679 gene locus_tag LOCUS_00200 26731 25679 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_00200 28062 26758 gene locus_tag LOCUS_00210 28062 26758 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_00210 28870 28121 gene locus_tag LOCUS_00220 28870 28121 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_00220 31371 28873 gene locus_tag LOCUS_00230 gene paaZ 31371 28873 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_00230 32579 31374 gene locus_tag LOCUS_00240 gene pcaF 32579 31374 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402686.1 protein_id gnl|my_center|LOCUS_00240 33122 32694 gene locus_tag LOCUS_00250 gene paaI 33122 32694 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535436.1 protein_id gnl|my_center|LOCUS_00250 34355 33174 gene locus_tag LOCUS_00260 34355 33174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 35165 34365 gene locus_tag LOCUS_00270 35165 34365 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_00270 36091 35312 gene locus_tag LOCUS_00280 gene paaG 36091 35312 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 protein_id gnl|my_center|LOCUS_00280 36598 36098 gene locus_tag LOCUS_00290 gene paaJ 36598 36098 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_00290 37357 36602 gene locus_tag LOCUS_00300 gene paaC 37357 36602 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705612.1 protein_id gnl|my_center|LOCUS_00300 37641 37357 gene locus_tag LOCUS_00310 gene paaB 37641 37357 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_00310 38608 37643 gene locus_tag LOCUS_00320 gene paaA 38608 37643 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_00320 39709 38636 gene locus_tag LOCUS_00330 gene paaK 39709 38636 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 protein_id gnl|my_center|LOCUS_00330 40380 39802 gene locus_tag LOCUS_00340 40380 39802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 40467 40772 gene locus_tag LOCUS_00350 40467 40772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41556 40912 gene locus_tag LOCUS_00360 41556 40912 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_00360 43438 41564 gene locus_tag LOCUS_00370 43438 41564 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_00370 45891 44035 gene locus_tag LOCUS_00380 45891 44035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47010 47543 gene locus_tag LOCUS_00390 47010 47543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48505 47540 gene locus_tag LOCUS_00400 48505 47540 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_00400 49068 48547 gene locus_tag LOCUS_00410 49068 48547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51689 49080 gene locus_tag LOCUS_00420 gene alaS 51689 49080 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964045.1 protein_id gnl|my_center|LOCUS_00420 51896 52867 gene locus_tag LOCUS_00430 51896 52867 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_00430 52867 53196 gene locus_tag LOCUS_00440 52867 53196 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_00440 53270 53872 gene locus_tag LOCUS_00450 53270 53872 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_00450 53875 54312 gene locus_tag LOCUS_00460 53875 54312 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_00460 54320 55153 gene locus_tag LOCUS_00470 54320 55153 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964050.1 protein_id gnl|my_center|LOCUS_00470 57954 55177 gene locus_tag LOCUS_00480 57954 55177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_00480 59378 58068 gene locus_tag LOCUS_00490 gene der 59378 58068 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_00490 59544 60071 gene locus_tag LOCUS_00500 59544 60071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 61100 60219 gene locus_tag LOCUS_00510 gene era 61100 60219 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_00510 61297 64512 gene locus_tag LOCUS_00520 61297 64512 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_00520 65405 64578 gene locus_tag LOCUS_00530 65405 64578 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_00530 67780 65723 gene locus_tag LOCUS_00540 67780 65723 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_00540 68239 67907 gene locus_tag LOCUS_00550 68239 67907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 68238 68945 gene locus_tag LOCUS_00560 68238 68945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 69050 70396 gene locus_tag LOCUS_00570 69050 70396 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_00570 70407 71444 gene locus_tag LOCUS_00580 gene cydB 70407 71444 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_00580 71753 73957 gene locus_tag LOCUS_00590 71753 73957 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_00590 74032 76473 gene locus_tag LOCUS_00600 gene galB 74032 76473 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_00600 76650 77963 gene locus_tag LOCUS_00610 76650 77963 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963918.1 protein_id gnl|my_center|LOCUS_00610 77971 79044 gene locus_tag LOCUS_00620 77971 79044 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963917.1 protein_id gnl|my_center|LOCUS_00620 79149 82379 gene locus_tag LOCUS_00630 79149 82379 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963916.1 protein_id gnl|my_center|LOCUS_00630 82384 82689 gene locus_tag LOCUS_00640 82384 82689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 84454 83000 gene locus_tag LOCUS_00650 84454 83000 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_00650 85664 84609 gene locus_tag LOCUS_00660 85664 84609 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965860.1 protein_id gnl|my_center|LOCUS_00660 85966 88443 gene locus_tag LOCUS_00670 85966 88443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 88478 89521 gene locus_tag LOCUS_00680 88478 89521 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_00680 90274 89531 gene locus_tag LOCUS_00690 90274 89531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 92256 90277 gene locus_tag LOCUS_00700 92256 90277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 92786 92346 gene locus_tag LOCUS_00710 92786 92346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 93710 92880 gene locus_tag LOCUS_00720 93710 92880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 94091 97303 gene locus_tag LOCUS_00730 94091 97303 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_00730 97322 99109 gene locus_tag LOCUS_00740 97322 99109 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_00740 99145 100692 gene locus_tag LOCUS_00750 99145 100692 CDS product DUF5123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109106.1 protein_id gnl|my_center|LOCUS_00750 100874 102151 gene locus_tag LOCUS_00760 100874 102151 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_00760 102204 103631 gene locus_tag LOCUS_00770 gene pelB 102204 103631 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_00770 103653 104669 gene locus_tag LOCUS_00780 103653 104669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 104677 105918 gene locus_tag LOCUS_00790 104677 105918 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_00790 105930 107555 gene locus_tag LOCUS_00800 105930 107555 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109159.1 protein_id gnl|my_center|LOCUS_00800 107557 108528 gene locus_tag LOCUS_00810 107557 108528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 108808 115521 gene locus_tag LOCUS_00820 108808 115521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 115525 117381 gene locus_tag LOCUS_00830 115525 117381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 117601 118632 gene locus_tag LOCUS_00840 117601 118632 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_00840 120282 118672 gene locus_tag LOCUS_00850 gene uxaA 120282 118672 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199352.1 protein_id gnl|my_center|LOCUS_00850 121748 120276 gene locus_tag LOCUS_00860 121748 120276 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212691688.1 protein_id gnl|my_center|LOCUS_00860 123072 121774 gene locus_tag LOCUS_00870 123072 121774 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_00870 123808 123137 gene locus_tag LOCUS_00880 123808 123137 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_00880 124995 123949 gene locus_tag LOCUS_00890 124995 123949 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_00890 126426 125026 gene locus_tag LOCUS_00900 gene uxaC 126426 125026 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_00900 127233 126442 gene locus_tag LOCUS_00910 127233 126442 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_00910 128080 127241 gene locus_tag LOCUS_00920 gene kduI 128080 127241 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_00920 128678 130489 gene locus_tag LOCUS_00930 128678 130489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 130657 131895 gene locus_tag LOCUS_00940 130657 131895 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139375234.1 protein_id gnl|my_center|LOCUS_00940 132045 132680 gene locus_tag LOCUS_00950 132045 132680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 132719 134143 gene locus_tag LOCUS_00960 132719 134143 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_00960 134163 134528 gene locus_tag LOCUS_00970 134163 134528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 134467 134988 gene locus_tag LOCUS_00980 134467 134988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 134985 135623 gene locus_tag LOCUS_00990 134985 135623 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459533.1 protein_id gnl|my_center|LOCUS_00990 137206 136004 gene locus_tag LOCUS_01000 137206 136004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 138559 137219 gene locus_tag LOCUS_01010 138559 137219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 138978 138667 gene locus_tag LOCUS_01020 138978 138667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 140078 139230 gene locus_tag LOCUS_01030 140078 139230 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665981.1 protein_id gnl|my_center|LOCUS_01030 141598 140135 gene locus_tag LOCUS_01040 141598 140135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 143047 141689 gene locus_tag LOCUS_01050 143047 141689 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767199.1 protein_id gnl|my_center|LOCUS_01050 144850 143171 gene locus_tag LOCUS_01060 144850 143171 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028668529.1 protein_id gnl|my_center|LOCUS_01060 145507 144875 gene locus_tag LOCUS_01070 145507 144875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 146431 145589 gene locus_tag LOCUS_01080 146431 145589 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_01080 147868 146444 gene locus_tag LOCUS_01090 147868 146444 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_01090 148983 147868 gene locus_tag LOCUS_01100 148983 147868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 150509 148983 gene locus_tag LOCUS_01110 150509 148983 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_01110 152189 150609 gene locus_tag LOCUS_01120 152189 150609 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073366.1 protein_id gnl|my_center|LOCUS_01120 153828 152197 gene locus_tag LOCUS_01130 153828 152197 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_01130 156149 153831 gene locus_tag LOCUS_01140 156149 153831 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920890.1 protein_id gnl|my_center|LOCUS_01140 157867 156194 gene locus_tag LOCUS_01150 157867 156194 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992183.1 protein_id gnl|my_center|LOCUS_01150 161045 157878 gene locus_tag LOCUS_01160 161045 157878 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_01160 165059 161241 gene locus_tag LOCUS_01170 165059 161241 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107547.1 protein_id gnl|my_center|LOCUS_01170 165555 166490 gene locus_tag LOCUS_01180 165555 166490 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_01180 167889 166564 gene locus_tag LOCUS_01190 167889 166564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 169418 167925 gene locus_tag LOCUS_01200 169418 167925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 169663 171024 gene locus_tag LOCUS_01210 169663 171024 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963629.1 protein_id gnl|my_center|LOCUS_01210 171037 172203 gene locus_tag LOCUS_01220 171037 172203 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_01220 172672 174003 gene locus_tag LOCUS_01230 172672 174003 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403845.1 protein_id gnl|my_center|LOCUS_01230 174554 176056 gene locus_tag LOCUS_01240 174554 176056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 176075 176290 gene locus_tag LOCUS_01250 176075 176290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 178334 177042 gene locus_tag LOCUS_01260 178334 177042 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_01260 180568 178373 gene locus_tag LOCUS_01270 180568 178373 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_01270 181624 180596 gene locus_tag LOCUS_01280 181624 180596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 182966 181821 gene locus_tag LOCUS_01290 182966 181821 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089761628.1 protein_id gnl|my_center|LOCUS_01290 184558 183503 gene locus_tag LOCUS_01300 184558 183503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 186510 184906 gene locus_tag LOCUS_01310 186510 184906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 187302 186625 gene locus_tag LOCUS_01320 187302 186625 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 protein_id gnl|my_center|LOCUS_01320 187982 187626 gene locus_tag LOCUS_01330 187982 187626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 188368 187997 gene locus_tag LOCUS_01340 188368 187997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 188791 188429 gene locus_tag LOCUS_01350 188791 188429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 189804 190112 gene locus_tag LOCUS_01360 189804 190112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 190067 190076 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 191463 190312 gene locus_tag LOCUS_01370 191463 190312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 192942 191917 gene locus_tag LOCUS_01380 192942 191917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 193520 192945 gene locus_tag LOCUS_01390 193520 192945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 194191 193994 gene locus_tag LOCUS_01400 194191 193994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 194657 194208 gene locus_tag LOCUS_01410 194657 194208 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_01410 194893 194738 gene locus_tag LOCUS_01420 194893 194738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01420 195098 194862 gene locus_tag LOCUS_01430 195098 194862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01430 195828 199169 gene locus_tag LOCUS_01440 195828 199169 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291481.1 protein_id gnl|my_center|LOCUS_01440 199424 199351 gene locus_tag LOCUS_t00010 199424 199351 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 199666 199484 gene locus_tag LOCUS_01450 199666 199484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 200568 199744 gene locus_tag LOCUS_01460 200568 199744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 202575 200665 gene locus_tag LOCUS_01470 202575 200665 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_01470 202660 203043 gene locus_tag LOCUS_01480 202660 203043 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_01480 204101 203061 gene locus_tag LOCUS_01490 204101 203061 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_01490 205078 204188 gene locus_tag LOCUS_01500 gene gldN 205078 204188 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_01500 206697 205186 gene locus_tag LOCUS_01510 gene gldM 206697 205186 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_01510 207433 206792 gene locus_tag LOCUS_01520 gene gldL 207433 206792 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_01520 208870 207497 gene locus_tag LOCUS_01530 gene gldK 208870 207497 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_01530 210195 209029 gene locus_tag LOCUS_01540 210195 209029 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_01540 212777 210288 gene locus_tag LOCUS_01550 gene topA 212777 210288 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_01550 213699 212932 gene locus_tag LOCUS_01560 213699 212932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 213853 215298 gene locus_tag LOCUS_01570 gene miaB 213853 215298 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_01570 215370 216635 gene locus_tag LOCUS_01580 215370 216635 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_01580 216672 217178 gene locus_tag LOCUS_01590 216672 217178 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_01590 217182 218123 gene locus_tag LOCUS_01600 217182 218123 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_01600 218123 218473 gene locus_tag LOCUS_01610 gene secG 218123 218473 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964085.1 protein_id gnl|my_center|LOCUS_01610 218625 218900 gene locus_tag LOCUS_01620 218625 218900 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_01620 218948 220612 gene locus_tag LOCUS_01630 gene groL 218948 220612 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_01630 221124 220732 gene locus_tag LOCUS_01640 221124 220732 CDS product DUF1398 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886004.1 protein_id gnl|my_center|LOCUS_01640 223476 221251 gene locus_tag LOCUS_01650 223476 221251 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_01650 225992 223587 gene locus_tag LOCUS_01660 225992 223587 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946759.1 protein_id gnl|my_center|LOCUS_01660 226669 226097 gene locus_tag LOCUS_01670 226669 226097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 227924 226701 gene locus_tag LOCUS_01680 227924 226701 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_01680 228341 227934 gene locus_tag LOCUS_01690 228341 227934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 229669 228371 gene locus_tag LOCUS_01700 229669 228371 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203354.1 protein_id gnl|my_center|LOCUS_01700 230947 229682 gene locus_tag LOCUS_01710 230947 229682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 234779 230940 gene locus_tag LOCUS_01720 234779 230940 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_01720 235214 234879 gene locus_tag LOCUS_01730 235214 234879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 235784 235356 gene locus_tag LOCUS_01740 235784 235356 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_01740 236328 235777 gene locus_tag LOCUS_01750 gene xrtF 236328 235777 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_01750 236411 236866 gene locus_tag LOCUS_01760 236411 236866 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_01760 238126 236876 gene locus_tag LOCUS_01770 238126 236876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_01770 238373 239905 gene locus_tag LOCUS_01780 gene purH 238373 239905 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_01780 240004 241032 gene locus_tag LOCUS_01790 240004 241032 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_01790 241183 241875 gene locus_tag LOCUS_01800 gene mreC 241183 241875 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_01800 241868 242374 gene locus_tag LOCUS_01810 241868 242374 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_01810 242371 244302 gene locus_tag LOCUS_01820 gene mrdA 242371 244302 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_01820 244302 245579 gene locus_tag LOCUS_01830 gene rodA 244302 245579 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_01830 245610 246242 gene locus_tag LOCUS_01840 245610 246242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 246576 246244 gene locus_tag LOCUS_01850 gene gldC 246576 246244 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_01850 247538 246576 gene locus_tag LOCUS_01860 gene gldB 247538 246576 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_01860 247632 248429 gene locus_tag LOCUS_01870 gene nadE 247632 248429 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964169.1 protein_id gnl|my_center|LOCUS_01870 248530 249168 gene locus_tag LOCUS_01880 248530 249168 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_01880 251106 249151 gene locus_tag LOCUS_01890 gene dnaG 251106 249151 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964171.1 protein_id gnl|my_center|LOCUS_01890 251253 253571 gene locus_tag LOCUS_01900 251253 253571 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_01900 254662 253583 gene locus_tag LOCUS_01910 254662 253583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 255487 254714 gene locus_tag LOCUS_01920 255487 254714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 256049 255474 gene locus_tag LOCUS_01930 256049 255474 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_01930 256375 257817 gene locus_tag LOCUS_01940 256375 257817 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_01940 257834 258760 gene locus_tag LOCUS_01950 257834 258760 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919475.1 protein_id gnl|my_center|LOCUS_01950 258769 259722 gene locus_tag LOCUS_01960 258769 259722 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_01960 260712 259735 gene locus_tag LOCUS_01970 260712 259735 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_01970 261824 260784 gene locus_tag LOCUS_01980 gene rlmN 261824 260784 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_01980 263002 261953 gene locus_tag LOCUS_01990 gene queA 263002 261953 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_01990 264305 263082 gene locus_tag LOCUS_02000 264305 263082 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962416.1 protein_id gnl|my_center|LOCUS_02000 264683 264357 gene locus_tag LOCUS_02010 264683 264357 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_02010 266686 264680 gene locus_tag LOCUS_02020 266686 264680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 268598 266691 gene locus_tag LOCUS_02030 268598 266691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 269193 268675 gene locus_tag LOCUS_02040 269193 268675 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208541.1 protein_id gnl|my_center|LOCUS_02040 269645 269193 gene locus_tag LOCUS_02050 gene dtd 269645 269193 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_02050 270685 269735 gene locus_tag LOCUS_02060 gene rsgA 270685 269735 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_02060 270774 271226 gene locus_tag LOCUS_02070 270774 271226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 272355 271273 gene locus_tag LOCUS_02080 272355 271273 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_02080 273218 272367 gene locus_tag LOCUS_02090 273218 272367 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_02090 274360 273215 gene locus_tag LOCUS_02100 274360 273215 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_02100 275184 274357 gene locus_tag LOCUS_02110 275184 274357 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_02110 275468 276364 gene locus_tag LOCUS_02120 gene gldA 275468 276364 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_02120 277110 276361 gene locus_tag LOCUS_02130 277110 276361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 278207 277107 gene locus_tag LOCUS_02140 278207 277107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 279198 278242 gene locus_tag LOCUS_02150 gene metF 279198 278242 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_02150 279717 279481 gene locus_tag LOCUS_02160 279717 279481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112513.1 protein_id gnl|my_center|LOCUS_02160 282404 279729 gene locus_tag LOCUS_02170 282404 279729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02170 283427 282414 gene locus_tag LOCUS_02180 283427 282414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02180 284565 283675 gene locus_tag LOCUS_02190 gene cysM 284565 283675 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279365.1 protein_id gnl|my_center|LOCUS_02190 285286 284552 gene locus_tag LOCUS_02200 285286 284552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 286384 285332 gene locus_tag LOCUS_02210 286384 285332 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_02210 286970 286386 gene locus_tag LOCUS_02220 286970 286386 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_02220 287753 286977 gene locus_tag LOCUS_02230 gene cobA 287753 286977 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_02230 289878 287737 gene locus_tag LOCUS_02240 289878 287737 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_02240 291170 289923 gene locus_tag LOCUS_02250 291170 289923 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_02250 292203 291301 gene locus_tag LOCUS_02260 gene cysD 292203 291301 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_02260 292846 292226 gene locus_tag LOCUS_02270 292846 292226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 293114 292851 gene locus_tag LOCUS_02280 293114 292851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 293696 293280 gene locus_tag LOCUS_02290 293696 293280 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_02290 294520 293729 gene locus_tag LOCUS_02300 294520 293729 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_02300 295698 294523 gene locus_tag LOCUS_02310 295698 294523 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_02310 299222 295821 gene locus_tag LOCUS_02320 299222 295821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 300513 299239 gene locus_tag LOCUS_02330 300513 299239 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_02330 302376 300826 gene locus_tag LOCUS_02340 302376 300826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_02340 302525 303700 gene locus_tag LOCUS_02350 302525 303700 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_02350 303714 304832 gene locus_tag LOCUS_02360 gene leuB 303714 304832 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_02360 306016 304934 gene locus_tag LOCUS_02370 306016 304934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 306503 306060 gene locus_tag LOCUS_02380 306503 306060 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803505.1 protein_id gnl|my_center|LOCUS_02380 307502 306585 gene locus_tag LOCUS_02390 307502 306585 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_02390 308792 307518 gene locus_tag LOCUS_02400 gene argH 308792 307518 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_02400 309978 308905 gene locus_tag LOCUS_02410 309978 308905 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_02410 310756 309980 gene locus_tag LOCUS_02420 gene argB 310756 309980 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_02420 311796 310849 gene locus_tag LOCUS_02430 311796 310849 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_02430 312564 311803 gene locus_tag LOCUS_02440 312564 311803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 313764 312568 gene locus_tag LOCUS_02450 313764 312568 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_02450 314914 313790 gene locus_tag LOCUS_02460 314914 313790 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_02460 315710 314916 gene locus_tag LOCUS_02470 gene proC 315710 314916 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_02470 316737 315760 gene locus_tag LOCUS_02480 gene argC 316737 315760 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_02480 317924 316740 gene locus_tag LOCUS_02490 317924 316740 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_02490 318535 317921 gene locus_tag LOCUS_02500 318535 317921 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_02500 319444 318977 gene locus_tag LOCUS_02510 gene azu 319444 318977 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706751.1 protein_id gnl|my_center|LOCUS_02510 321122 319530 gene locus_tag LOCUS_02520 321122 319530 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941484.1 protein_id gnl|my_center|LOCUS_02520 322572 321310 gene locus_tag LOCUS_02530 gene ilvA 322572 321310 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_02530 324081 322579 gene locus_tag LOCUS_02540 gene ilvC 324081 322579 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 protein_id gnl|my_center|LOCUS_02540 324628 324095 gene locus_tag LOCUS_02550 gene ilvN 324628 324095 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_02550 326379 324646 gene locus_tag LOCUS_02560 gene ilvB 326379 324646 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_02560 328068 326389 gene locus_tag LOCUS_02570 gene ilvD 328068 326389 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_02570 328648 329901 gene locus_tag LOCUS_02580 gene metK 328648 329901 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_02580 330931 329903 gene locus_tag LOCUS_02590 330931 329903 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_02590 331810 330941 gene locus_tag LOCUS_02600 331810 330941 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_02600 332047 332826 gene locus_tag LOCUS_02610 332047 332826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 332831 333445 gene locus_tag LOCUS_02620 332831 333445 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_02620 335154 333442 gene locus_tag LOCUS_02630 335154 333442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_02630 336302 335196 gene locus_tag LOCUS_02640 336302 335196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 339112 336383 gene locus_tag LOCUS_02650 339112 336383 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_02650 339793 339161 gene locus_tag LOCUS_02660 339793 339161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 342542 340164 gene locus_tag LOCUS_02670 342542 340164 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_02670 343200 342673 gene locus_tag LOCUS_02680 343200 342673 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_02680 343454 345103 gene locus_tag LOCUS_02690 gene sulP 343454 345103 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_02690 345195 345381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 345409 345768 gene locus_tag LOCUS_02700 345409 345768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 348486 345877 gene locus_tag LOCUS_02710 348486 345877 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_02710 349499 348522 gene locus_tag LOCUS_02720 349499 348522 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_02720 349713 350459 gene locus_tag LOCUS_02730 349713 350459 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_02730 350549 351508 gene locus_tag LOCUS_02740 350549 351508 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_02740 351626 352240 gene locus_tag LOCUS_02750 351626 352240 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_02750 352259 353515 gene locus_tag LOCUS_02760 352259 353515 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963821.1 protein_id gnl|my_center|LOCUS_02760 353615 354439 gene locus_tag LOCUS_02770 353615 354439 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962504.1 protein_id gnl|my_center|LOCUS_02770 354788 354492 gene locus_tag LOCUS_02780 354788 354492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 355093 356007 gene locus_tag LOCUS_02790 355093 356007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 356151 358820 gene locus_tag LOCUS_02800 356151 358820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 358864 360420 gene locus_tag LOCUS_02810 358864 360420 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_02810 360442 361353 gene locus_tag LOCUS_02820 gene fabD 360442 361353 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_02820 361357 361854 gene locus_tag LOCUS_02830 gene lspA 361357 361854 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965414.1 protein_id gnl|my_center|LOCUS_02830 362439 361930 gene locus_tag LOCUS_02840 362439 361930 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_02840 363098 362463 gene locus_tag LOCUS_02850 363098 362463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 364563 363118 gene locus_tag LOCUS_02860 364563 363118 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_02860 367787 364581 gene locus_tag LOCUS_02870 367787 364581 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_02870 369524 368028 gene locus_tag LOCUS_02880 369524 368028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 370811 369786 gene locus_tag LOCUS_02890 gene galE 370811 369786 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_02890 371958 370804 gene locus_tag LOCUS_02900 371958 370804 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_02900 372148 373353 gene locus_tag LOCUS_02910 372148 373353 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_02910 373418 374416 gene locus_tag LOCUS_02920 373418 374416 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_02920 376149 374497 gene locus_tag LOCUS_02930 376149 374497 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_02930 376372 377268 gene locus_tag LOCUS_02940 376372 377268 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846458.1 protein_id gnl|my_center|LOCUS_02940 377290 378438 gene locus_tag LOCUS_02950 gene galK 377290 378438 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_02950 378462 379481 gene locus_tag LOCUS_02960 gene galT 378462 379481 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191497.1 protein_id gnl|my_center|LOCUS_02960 380590 379511 gene locus_tag LOCUS_02970 380590 379511 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_02970 383838 380656 gene locus_tag LOCUS_02980 383838 380656 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202201.1 protein_id gnl|my_center|LOCUS_02980 386353 383882 gene locus_tag LOCUS_02990 gene galB 386353 383882 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_02990 387960 386365 gene locus_tag LOCUS_03000 387960 386365 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 protein_id gnl|my_center|LOCUS_03000 389394 387967 gene locus_tag LOCUS_03010 389394 387967 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769340.1 protein_id gnl|my_center|LOCUS_03010 390050 389391 gene locus_tag LOCUS_03020 390050 389391 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121534.1 protein_id gnl|my_center|LOCUS_03020 391621 390065 gene locus_tag LOCUS_03030 391621 390065 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555683.1 protein_id gnl|my_center|LOCUS_03030 393008 391632 gene locus_tag LOCUS_03040 393008 391632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 393363 397367 gene locus_tag LOCUS_03050 393363 397367 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_03050 397506 400586 gene locus_tag LOCUS_03060 397506 400586 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_03060 400591 402138 gene locus_tag LOCUS_03070 400591 402138 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_03070 402155 403516 gene locus_tag LOCUS_03080 402155 403516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 403595 404419 gene locus_tag LOCUS_03090 403595 404419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 404546 405991 gene locus_tag LOCUS_03100 404546 405991 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921292.1 protein_id gnl|my_center|LOCUS_03100 406010 407542 gene locus_tag LOCUS_03110 406010 407542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 407554 409200 gene locus_tag LOCUS_03120 407554 409200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 409214 410791 gene locus_tag LOCUS_03130 409214 410791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 410925 411155 gene locus_tag LOCUS_03140 410925 411155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 414033 411358 gene locus_tag LOCUS_03150 414033 411358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 415054 414170 gene locus_tag LOCUS_03160 415054 414170 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_03160 416878 415136 gene locus_tag LOCUS_03170 416878 415136 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_03170 420044 416889 gene locus_tag LOCUS_03180 420044 416889 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016266957.1 protein_id gnl|my_center|LOCUS_03180 421489 420059 gene locus_tag LOCUS_03190 421489 420059 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026811032.1 protein_id gnl|my_center|LOCUS_03190 422959 421640 gene locus_tag LOCUS_03200 422959 421640 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_03200 425911 423308 gene locus_tag LOCUS_03210 425911 423308 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_03210 428021 426417 gene locus_tag LOCUS_03220 428021 426417 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_03220 429329 428148 gene locus_tag LOCUS_03230 429329 428148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 430544 429447 gene locus_tag LOCUS_03240 430544 429447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 432407 430557 gene locus_tag LOCUS_03250 432407 430557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 434229 432538 gene locus_tag LOCUS_03260 434229 432538 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_03260 437569 434285 gene locus_tag LOCUS_03270 437569 434285 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_03270 438940 437768 gene locus_tag LOCUS_03280 438940 437768 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_03280 439075 439671 gene locus_tag LOCUS_03290 439075 439671 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_03290 440111 440026 gene locus_tag LOCUS_t00020 440111 440026 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 440211 440139 gene locus_tag LOCUS_t00030 440211 440139 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 442887 440308 gene locus_tag LOCUS_03300 gene mutS 442887 440308 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_03300 443095 443532 gene locus_tag LOCUS_03310 443095 443532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 443613 444149 gene locus_tag LOCUS_03320 443613 444149 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_03320 444537 444791 gene locus_tag LOCUS_03330 444537 444791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 446208 444913 gene locus_tag LOCUS_03340 446208 444913 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_03340 447526 446399 gene locus_tag LOCUS_03350 gene folK 447526 446399 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_03350 447599 448303 gene locus_tag LOCUS_03360 447599 448303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 448386 451022 gene locus_tag LOCUS_03370 448386 451022 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_03370 451127 451990 gene locus_tag LOCUS_03380 451127 451990 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_03380 452022 452216 gene locus_tag LOCUS_03390 gene rpsU 452022 452216 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_03390 453065 452271 gene locus_tag LOCUS_03400 453065 452271 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_03400 453107 454621 gene locus_tag LOCUS_03410 453107 454621 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_03410 456088 454856 gene locus_tag LOCUS_03420 gene clpX 456088 454856 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_03420 456837 456163 gene locus_tag LOCUS_03430 gene clpP 456837 456163 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_03430 458298 456970 gene locus_tag LOCUS_03440 458298 456970 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_03440 458781 458434 gene locus_tag LOCUS_03450 458781 458434 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931277.1 protein_id gnl|my_center|LOCUS_03450 459905 458793 gene locus_tag LOCUS_03460 459905 458793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 460743 459973 gene locus_tag LOCUS_03470 460743 459973 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_03470 461456 460743 gene locus_tag LOCUS_03480 461456 460743 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_03480 461546 462205 gene locus_tag LOCUS_03490 461546 462205 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_03490 462209 463093 gene locus_tag LOCUS_03500 462209 463093 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_03500 463194 463880 gene locus_tag LOCUS_03510 463194 463880 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_03510 463884 464624 gene locus_tag LOCUS_03520 463884 464624 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_03520 464560 467211 gene locus_tag LOCUS_03530 gene bamA 464560 467211 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_03530 467380 468498 gene locus_tag LOCUS_03540 467380 468498 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_03540 468528 469034 gene locus_tag LOCUS_03550 468528 469034 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_03550 469104 469883 gene locus_tag LOCUS_03560 gene murI 469104 469883 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_03560 470984 469896 gene locus_tag LOCUS_03570 470984 469896 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_03570 471489 470977 gene locus_tag LOCUS_03580 471489 470977 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_03580 472501 471494 gene locus_tag LOCUS_03590 472501 471494 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_03590 472671 473573 gene locus_tag LOCUS_03600 472671 473573 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_03600 473725 475761 gene locus_tag LOCUS_03610 473725 475761 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_03610 475827 476114 gene locus_tag LOCUS_03620 475827 476114 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257550.1 protein_id gnl|my_center|LOCUS_03620 476204 477013 gene locus_tag LOCUS_03630 476204 477013 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_03630 477684 477010 gene locus_tag LOCUS_03640 gene tsaB 477684 477010 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_03640 478973 477696 gene locus_tag LOCUS_03650 478973 477696 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_03650 480311 478980 gene locus_tag LOCUS_03660 480311 478980 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_03660 481576 480413 gene locus_tag LOCUS_03670 481576 480413 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_03670 482858 481599 gene locus_tag LOCUS_03680 482858 481599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_03680 484104 482860 gene locus_tag LOCUS_03690 484104 482860 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_03690 484798 484097 gene locus_tag LOCUS_03700 484798 484097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_03700 485159 484932 gene locus_tag LOCUS_03710 485159 484932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 protein_id gnl|my_center|LOCUS_03710 485697 485152 gene locus_tag LOCUS_03720 485697 485152 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_03720 486437 485697 gene locus_tag LOCUS_03730 486437 485697 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_03730 487146 486424 gene locus_tag LOCUS_03740 487146 486424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_03740 487632 487252 gene locus_tag LOCUS_03750 487632 487252 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_03750 488633 487653 gene locus_tag LOCUS_03760 488633 487653 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_03760 489294 488713 gene locus_tag LOCUS_03770 489294 488713 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_03770 490192 489302 gene locus_tag LOCUS_03780 gene cyoE 490192 489302 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_03780 490341 491204 gene locus_tag LOCUS_03790 490341 491204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 491548 491207 gene locus_tag LOCUS_03800 491548 491207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 493694 491595 gene locus_tag LOCUS_03810 493694 491595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_03810 494551 493805 gene locus_tag LOCUS_03820 494551 493805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 495453 494731 gene locus_tag LOCUS_03830 495453 494731 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838193.1 protein_id gnl|my_center|LOCUS_03830 495892 495512 gene locus_tag LOCUS_03840 495892 495512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 496265 495885 gene locus_tag LOCUS_03850 gene gcvH 496265 495885 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_03850 503610 496330 gene locus_tag LOCUS_03860 gene sprA 503610 496330 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100614127.1 protein_id gnl|my_center|LOCUS_03860 504192 503611 gene locus_tag LOCUS_03870 gene ruvA 504192 503611 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_03870 506545 504245 gene locus_tag LOCUS_03880 506545 504245 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_03880 507527 506604 gene locus_tag LOCUS_03890 gene queG 507527 506604 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_03890 508589 507567 gene locus_tag LOCUS_03900 gene ruvB 508589 507567 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_03900 510497 508659 gene locus_tag LOCUS_03910 510497 508659 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_03910 511520 510564 gene locus_tag LOCUS_03920 511520 510564 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_03920 516237 511549 gene locus_tag LOCUS_03930 516237 511549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 518239 516449 gene locus_tag LOCUS_03940 518239 516449 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_03940 519336 518269 gene locus_tag LOCUS_03950 519336 518269 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_03950 520737 519367 gene locus_tag LOCUS_03960 520737 519367 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_03960 521434 520859 gene locus_tag LOCUS_03970 521434 520859 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_03970 521967 521434 gene locus_tag LOCUS_03980 521967 521434 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_03980 523699 521972 gene locus_tag LOCUS_03990 gene nrfD 523699 521972 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_03990 526813 523730 gene locus_tag LOCUS_04000 526813 523730 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_04000 528130 526841 gene locus_tag LOCUS_04010 528130 526841 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_04010 528342 528734 gene locus_tag LOCUS_04020 528342 528734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 531552 528808 gene locus_tag LOCUS_04030 gene infB 531552 528808 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962639.1 protein_id gnl|my_center|LOCUS_04030 532833 531601 gene locus_tag LOCUS_04040 gene nusA 532833 531601 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962638.1 protein_id gnl|my_center|LOCUS_04040 533308 532847 gene locus_tag LOCUS_04050 gene rimP 533308 532847 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962637.1 protein_id gnl|my_center|LOCUS_04050 533443 534270 gene locus_tag LOCUS_04060 533443 534270 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_04060 534410 534337 gene locus_tag LOCUS_t00040 534410 534337 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 534649 537969 gene locus_tag LOCUS_04070 534649 537969 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_04070 538006 538668 gene locus_tag LOCUS_04080 538006 538668 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_04080 538961 538665 gene locus_tag LOCUS_04090 538961 538665 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_04090 540342 539107 gene locus_tag LOCUS_04100 540342 539107 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_04100 540570 543425 gene locus_tag LOCUS_04110 gene polA 540570 543425 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_04110 543626 544375 gene locus_tag LOCUS_04120 543626 544375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 544867 545514 gene locus_tag LOCUS_04130 544867 545514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 545675 546031 gene locus_tag LOCUS_04140 545675 546031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 546184 546951 gene locus_tag LOCUS_04150 546184 546951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 547111 547662 gene locus_tag LOCUS_04160 547111 547662 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530731.1 protein_id gnl|my_center|LOCUS_04160 547659 548144 gene locus_tag LOCUS_04170 547659 548144 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_04170 548306 549046 gene locus_tag LOCUS_04180 548306 549046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 549284 549658 gene locus_tag LOCUS_04190 549284 549658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 550382 549822 gene locus_tag LOCUS_04200 550382 549822 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770279.1 protein_id gnl|my_center|LOCUS_04200 550714 551169 gene locus_tag LOCUS_04210 gene rplM 550714 551169 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_04210 551170 551556 gene locus_tag LOCUS_04220 gene rpsI 551170 551556 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962624.1 protein_id gnl|my_center|LOCUS_04220 551732 552523 gene locus_tag LOCUS_04230 gene rpsB 551732 552523 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_04230 552607 553440 gene locus_tag LOCUS_04240 gene tsf 552607 553440 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_04240 553549 554256 gene locus_tag LOCUS_04250 gene pyrH 553549 554256 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_04250 554298 554855 gene locus_tag LOCUS_04260 gene frr 554298 554855 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_04260 554910 556181 gene locus_tag LOCUS_04270 554910 556181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 556242 558638 gene locus_tag LOCUS_04280 556242 558638 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_04280 558729 560630 gene locus_tag LOCUS_04290 558729 560630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 560740 562200 gene locus_tag LOCUS_04300 gene rpoN 560740 562200 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_04300 563492 562800 gene locus_tag LOCUS_04310 563492 562800 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_04310 564141 563668 gene locus_tag LOCUS_04320 564141 563668 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_04320 564756 564169 gene locus_tag LOCUS_04330 564756 564169 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_04330 565204 564761 gene locus_tag LOCUS_04340 565204 564761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 565996 565226 gene locus_tag LOCUS_04350 565996 565226 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_04350 566157 566069 gene locus_tag LOCUS_t00050 566157 566069 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 567265 566234 gene locus_tag LOCUS_04360 567265 566234 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_04360 568045 567269 gene locus_tag LOCUS_04370 568045 567269 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_04370 568121 568561 gene locus_tag LOCUS_04380 568121 568561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 568610 569233 gene locus_tag LOCUS_04390 gene nreC 568610 569233 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_04390 570802 569585 gene locus_tag LOCUS_04400 gene odhB 570802 569585 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_04400 573602 570861 gene locus_tag LOCUS_04410 573602 570861 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_04410 573803 574300 gene locus_tag LOCUS_04420 573803 574300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 574748 574317 gene locus_tag LOCUS_04430 574748 574317 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930578.1 protein_id gnl|my_center|LOCUS_04430 574900 575394 gene locus_tag LOCUS_04440 574900 575394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 575412 577373 gene locus_tag LOCUS_04450 gene nosZ 575412 577373 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_04450 577477 578070 gene locus_tag LOCUS_04460 577477 578070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 578067 578504 gene locus_tag LOCUS_04470 578067 578504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 578509 579747 gene locus_tag LOCUS_04480 578509 579747 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_04480 579741 580448 gene locus_tag LOCUS_04490 579741 580448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460087.1 protein_id gnl|my_center|LOCUS_04490 580441 581223 gene locus_tag LOCUS_04500 580441 581223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 581714 581253 gene locus_tag LOCUS_04510 581714 581253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 583735 583004 gene locus_tag LOCUS_04520 gene ric 583735 583004 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_04520 584218 583784 gene locus_tag LOCUS_04530 584218 583784 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_04530 584634 584287 gene locus_tag LOCUS_04540 584634 584287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_04540 585608 584634 gene locus_tag LOCUS_04550 585608 584634 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_04550 585732 586334 gene locus_tag LOCUS_04560 585732 586334 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_04560 586338 587681 gene locus_tag LOCUS_04570 586338 587681 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_04570 587698 588876 gene locus_tag LOCUS_04580 587698 588876 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_04580 588900 592394 gene locus_tag LOCUS_04590 588900 592394 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_04590 595331 592452 gene locus_tag LOCUS_04600 595331 592452 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_04600 595605 597359 gene locus_tag LOCUS_04610 gene aspS 595605 597359 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_04610 597406 599193 gene locus_tag LOCUS_04620 597406 599193 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_04620 599334 601124 gene locus_tag LOCUS_04630 599334 601124 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_04630 601121 601354 gene locus_tag LOCUS_04640 601121 601354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 601651 601890 gene locus_tag LOCUS_04650 601651 601890 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_04650 602604 602152 gene locus_tag LOCUS_04660 602604 602152 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_04660 602752 604422 gene locus_tag LOCUS_04670 602752 604422 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962453.1 protein_id gnl|my_center|LOCUS_04670 604712 605098 gene locus_tag LOCUS_04680 gene mutT 604712 605098 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_04680 605095 608235 gene locus_tag LOCUS_04690 605095 608235 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 protein_id gnl|my_center|LOCUS_04690 610359 609010 gene locus_tag LOCUS_04700 610359 609010 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_04700 610511 610909 gene locus_tag LOCUS_04710 610511 610909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 611136 613985 gene locus_tag LOCUS_04720 611136 613985 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_04720 614022 615212 gene locus_tag LOCUS_04730 614022 615212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 615633 615283 gene locus_tag LOCUS_04740 615633 615283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_04740 615922 618207 gene locus_tag LOCUS_04750 615922 618207 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_04750 618339 619187 gene locus_tag LOCUS_04760 618339 619187 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_04760 621761 619287 gene locus_tag LOCUS_04770 621761 619287 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_04770 622924 621956 gene locus_tag LOCUS_04780 622924 621956 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_04780 623819 623253 gene locus_tag LOCUS_04790 623819 623253 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_04790 623924 624505 gene locus_tag LOCUS_04800 623924 624505 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_04800 624508 624711 gene locus_tag LOCUS_04810 624508 624711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 624711 625313 gene locus_tag LOCUS_04820 624711 625313 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 protein_id gnl|my_center|LOCUS_04820 625982 625317 gene locus_tag LOCUS_04830 625982 625317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 626111 626571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 627525 627743 gene locus_tag LOCUS_04840 627525 627743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 630339 628744 gene locus_tag LOCUS_04850 630339 628744 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_04850 630770 630339 gene locus_tag LOCUS_04860 630770 630339 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_04860 631576 630989 gene locus_tag LOCUS_04870 631576 630989 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_04870 632583 631612 gene locus_tag LOCUS_04880 632583 631612 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_04880 632771 633256 gene locus_tag LOCUS_04890 632771 633256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 634030 633317 gene locus_tag LOCUS_04900 634030 633317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 634279 634749 gene locus_tag LOCUS_04910 634279 634749 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377741.1 protein_id gnl|my_center|LOCUS_04910 635100 634753 gene locus_tag LOCUS_04920 635100 634753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_04920 635632 635192 gene locus_tag LOCUS_04930 635632 635192 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257161.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04930 635815 636147 gene locus_tag LOCUS_04940 gene ssb 635815 636147 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_04940 637764 636202 gene locus_tag LOCUS_04950 gene nadB 637764 636202 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_04950 638690 637764 gene locus_tag LOCUS_04960 gene nadA 638690 637764 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_04960 638811 639266 gene locus_tag LOCUS_04970 638811 639266 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_04970 641047 639263 gene locus_tag LOCUS_04980 641047 639263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 643103 641232 gene locus_tag LOCUS_04990 gene nrdD 643103 641232 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_04990 643560 643111 gene locus_tag LOCUS_05000 643560 643111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 644035 646548 gene locus_tag LOCUS_05010 gene ppc 644035 646548 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 protein_id gnl|my_center|LOCUS_05010 647801 646617 gene locus_tag LOCUS_05020 gene amt 647801 646617 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_05020 648219 647881 gene locus_tag LOCUS_05030 648219 647881 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_05030 649620 648379 gene locus_tag LOCUS_05040 649620 648379 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_05040 649981 649643 gene locus_tag LOCUS_05050 649981 649643 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_05050 650990 650010 gene locus_tag LOCUS_05060 650990 650010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 651474 655955 gene locus_tag LOCUS_05070 gene gltB 651474 655955 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_05070 655960 657426 gene locus_tag LOCUS_05080 655960 657426 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_05080 657548 657832 gene locus_tag LOCUS_05090 657548 657832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 657914 659506 gene locus_tag LOCUS_05100 657914 659506 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444186.1 protein_id gnl|my_center|LOCUS_05100 659514 660143 gene locus_tag LOCUS_05110 659514 660143 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_05110 661220 660213 gene locus_tag LOCUS_05120 gene fbp 661220 660213 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962470.1 protein_id gnl|my_center|LOCUS_05120 661342 661821 gene locus_tag LOCUS_05130 661342 661821 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_05130 661784 663073 gene locus_tag LOCUS_05140 661784 663073 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_05140 663158 665008 gene locus_tag LOCUS_05150 663158 665008 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_05150 665430 665062 gene locus_tag LOCUS_05160 665430 665062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 666251 665487 gene locus_tag LOCUS_05170 666251 665487 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_05170 666671 666303 gene locus_tag LOCUS_05180 666671 666303 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_05180 667058 666687 gene locus_tag LOCUS_05190 667058 666687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 667539 667084 gene locus_tag LOCUS_05200 667539 667084 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_05200 668499 667564 gene locus_tag LOCUS_05210 668499 667564 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_05210 668865 668500 gene locus_tag LOCUS_05220 668865 668500 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_05220 670343 668970 gene locus_tag LOCUS_05230 gene mgtE 670343 668970 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962248.1 protein_id gnl|my_center|LOCUS_05230 671138 670365 gene locus_tag LOCUS_05240 gene rsmA 671138 670365 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_05240 671477 671160 gene locus_tag LOCUS_05250 671477 671160 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_05250 672006 671488 gene locus_tag LOCUS_05260 672006 671488 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_05260 673764 672013 gene locus_tag LOCUS_05270 673764 672013 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_05270 675517 674246 gene locus_tag LOCUS_05280 gene serS 675517 674246 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_05280 676526 675591 gene locus_tag LOCUS_05290 676526 675591 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_05290 676605 679436 gene locus_tag LOCUS_05300 676605 679436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 680076 679450 gene locus_tag LOCUS_05310 gene pth 680076 679450 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_05310 680797 680153 gene locus_tag LOCUS_05320 680797 680153 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_05320 681765 680824 gene locus_tag LOCUS_05330 681765 680824 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_05330 681914 681996 gene locus_tag LOCUS_t00060 681914 681996 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 682739 682155 gene locus_tag LOCUS_05340 682739 682155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 684236 682863 gene locus_tag LOCUS_05350 684236 682863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 684873 684274 gene locus_tag LOCUS_05360 684873 684274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 685919 685338 gene locus_tag LOCUS_05370 685919 685338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 686292 687137 gene locus_tag LOCUS_05380 686292 687137 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_05380 687185 687775 gene locus_tag LOCUS_05390 gene gmk 687185 687775 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_05390 687785 688363 gene locus_tag LOCUS_05400 gene nadD 687785 688363 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_05400 688449 689312 gene locus_tag LOCUS_05410 gene mmsB 688449 689312 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208097.1 protein_id gnl|my_center|LOCUS_05410 690331 689390 gene locus_tag LOCUS_05420 690331 689390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 690461 691462 gene locus_tag LOCUS_05430 690461 691462 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962320.1 protein_id gnl|my_center|LOCUS_05430 691859 691464 gene locus_tag LOCUS_05440 691859 691464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 693310 691895 gene locus_tag LOCUS_05450 693310 691895 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_05450 696453 693316 gene locus_tag LOCUS_05460 696453 693316 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_05460 697599 696466 gene locus_tag LOCUS_05470 697599 696466 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_05470 698109 697609 gene locus_tag LOCUS_05480 698109 697609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 699252 698233 gene locus_tag LOCUS_05490 gene pheS 699252 698233 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_05490 699754 699398 gene locus_tag LOCUS_05500 699754 699398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_05500 699824 700354 gene locus_tag LOCUS_05510 699824 700354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 700988 700362 gene locus_tag LOCUS_05520 gene can 700988 700362 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_05520 701777 701028 gene locus_tag LOCUS_05530 701777 701028 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_05530 703551 701779 gene locus_tag LOCUS_05540 703551 701779 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_05540 703948 703571 gene locus_tag LOCUS_05550 703948 703571 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_05550 704870 703995 gene locus_tag LOCUS_05560 704870 703995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 706005 704968 gene locus_tag LOCUS_05570 706005 704968 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_05570 707112 706105 gene locus_tag LOCUS_05580 707112 706105 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_05580 708773 707112 gene locus_tag LOCUS_05590 708773 707112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_05590 709647 708781 gene locus_tag LOCUS_05600 709647 708781 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_05600 710739 709738 gene locus_tag LOCUS_05610 710739 709738 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_05610 711962 710925 gene locus_tag LOCUS_05620 711962 710925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 712297 713049 gene locus_tag LOCUS_05630 712297 713049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 713084 714217 gene locus_tag LOCUS_05640 713084 714217 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038509176.1 protein_id gnl|my_center|LOCUS_05640 715991 714366 gene locus_tag LOCUS_05650 715991 714366 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_05650 716093 717100 gene locus_tag LOCUS_05660 716093 717100 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_05660 717093 717410 gene locus_tag LOCUS_05670 717093 717410 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_05670 718248 717418 gene locus_tag LOCUS_05680 718248 717418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 718781 718293 gene locus_tag LOCUS_05690 718781 718293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 719344 718877 gene locus_tag LOCUS_05700 719344 718877 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_05700 720003 719341 gene locus_tag LOCUS_05710 720003 719341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 720046 721158 gene locus_tag LOCUS_05720 gene dinB 720046 721158 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 protein_id gnl|my_center|LOCUS_05720 722694 721258 gene locus_tag LOCUS_05730 gene pyk 722694 721258 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_05730 723179 722694 gene locus_tag LOCUS_05740 723179 722694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 723906 723304 gene locus_tag LOCUS_05750 gene rnc 723906 723304 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962378.1 protein_id gnl|my_center|LOCUS_05750 725296 724046 gene locus_tag LOCUS_05760 gene fabF 725296 724046 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_05760 725542 725309 gene locus_tag LOCUS_05770 725542 725309 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007137004.1 protein_id gnl|my_center|LOCUS_05770 725733 726305 gene locus_tag LOCUS_05780 725733 726305 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_05780 726298 726939 gene locus_tag LOCUS_05790 726298 726939 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_05790 728916 726958 gene locus_tag LOCUS_05800 728916 726958 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_05800 729037 728870 gene locus_tag LOCUS_05810 729037 728870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 729149 730084 gene locus_tag LOCUS_05820 729149 730084 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_05820 730239 732137 gene locus_tag LOCUS_05830 730239 732137 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_05830 733245 732637 gene locus_tag LOCUS_05840 733245 732637 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_05840 733381 736515 gene locus_tag LOCUS_05850 733381 736515 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_05850 736539 737732 gene locus_tag LOCUS_05860 gene kbl 736539 737732 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_05860 737886 739214 gene locus_tag LOCUS_05870 737886 739214 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_05870 739281 742046 gene locus_tag LOCUS_05880 739281 742046 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_05880 742050 742889 gene locus_tag LOCUS_05890 742050 742889 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_05890 745248 742897 gene locus_tag LOCUS_05900 745248 742897 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091172195.1 protein_id gnl|my_center|LOCUS_05900 745473 745399 gene locus_tag LOCUS_t00070 745473 745399 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 746332 745481 gene locus_tag LOCUS_05910 746332 745481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 746509 747834 gene locus_tag LOCUS_05920 746509 747834 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_05920 747870 748046 gene locus_tag LOCUS_05930 747870 748046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 748170 748622 gene locus_tag LOCUS_05940 748170 748622 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_05940 748615 749385 gene locus_tag LOCUS_05950 748615 749385 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_05950 750650 749382 gene locus_tag LOCUS_05960 gene nreB 750650 749382 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_05960 752352 750643 gene locus_tag LOCUS_05970 gene recJ 752352 750643 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_05970 752797 752375 gene locus_tag LOCUS_05980 752797 752375 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811690.1 protein_id gnl|my_center|LOCUS_05980 752862 753452 gene locus_tag LOCUS_05990 752862 753452 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_05990 753588 754247 gene locus_tag LOCUS_06000 753588 754247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 754821 754252 gene locus_tag LOCUS_06010 754821 754252 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529221.1 protein_id gnl|my_center|LOCUS_06010 755497 754823 gene locus_tag LOCUS_06020 gene rsmI 755497 754823 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_06020 756204 755494 gene locus_tag LOCUS_06030 756204 755494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_06030 756338 756985 gene locus_tag LOCUS_06040 756338 756985 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_06040 756978 758084 gene locus_tag LOCUS_06050 756978 758084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 758148 758549 gene locus_tag LOCUS_06060 gene mscL 758148 758549 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547170.1 protein_id gnl|my_center|LOCUS_06060 758684 759673 gene locus_tag LOCUS_06070 758684 759673 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_06070 759692 760132 gene locus_tag LOCUS_06080 759692 760132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 761118 760195 gene locus_tag LOCUS_06090 761118 760195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 761267 763414 gene locus_tag LOCUS_06100 761267 763414 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_06100 763449 764363 gene locus_tag LOCUS_06110 763449 764363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_06110 764817 764356 gene locus_tag LOCUS_06120 764817 764356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_06120 765395 764814 gene locus_tag LOCUS_06130 gene mtgA 765395 764814 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964436.1 protein_id gnl|my_center|LOCUS_06130 766623 765508 gene locus_tag LOCUS_06140 766623 765508 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_06140 768150 766798 gene locus_tag LOCUS_06150 gene accC 768150 766798 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_06150 768725 768234 gene locus_tag LOCUS_06160 gene accB 768725 768234 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_06160 769741 768737 gene locus_tag LOCUS_06170 769741 768737 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_06170 769719 769913 gene locus_tag LOCUS_06180 769719 769913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 770122 769919 gene locus_tag LOCUS_06190 gene rpmF 770122 769919 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_06190 770671 770132 gene locus_tag LOCUS_06200 770671 770132 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_06200 771792 770746 gene locus_tag LOCUS_06210 gene pdxA 771792 770746 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_06210 771858 772457 gene locus_tag LOCUS_06220 771858 772457 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_06220 777752 772989 gene locus_tag LOCUS_06230 777752 772989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 779409 777871 gene locus_tag LOCUS_06240 779409 777871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 780710 779772 gene locus_tag LOCUS_06250 780710 779772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 781612 780728 gene locus_tag LOCUS_06260 781612 780728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 783059 781602 gene locus_tag LOCUS_06270 783059 781602 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_06270 784356 783091 gene locus_tag LOCUS_06280 784356 783091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 786132 784372 gene locus_tag LOCUS_06290 786132 784372 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_06290 789651 786196 gene locus_tag LOCUS_06300 789651 786196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 791045 789726 gene locus_tag LOCUS_06310 791045 789726 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_06310 792624 791059 gene locus_tag LOCUS_06320 792624 791059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 794209 792605 gene locus_tag LOCUS_06330 794209 792605 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_06330 794921 794223 gene locus_tag LOCUS_06340 794921 794223 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256962.1 protein_id gnl|my_center|LOCUS_06340 796985 795120 gene locus_tag LOCUS_06350 796985 795120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 800149 797000 gene locus_tag LOCUS_06360 800149 797000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 801315 800434 gene locus_tag LOCUS_06370 801315 800434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 803423 801330 gene locus_tag LOCUS_06380 803423 801330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 804933 803443 gene locus_tag LOCUS_06390 804933 803443 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_06390 807976 804947 gene locus_tag LOCUS_06400 807976 804947 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_06400 810997 808196 gene locus_tag LOCUS_06410 810997 808196 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_06410 812702 811206 gene locus_tag LOCUS_06420 812702 811206 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_06420 814726 812747 gene locus_tag LOCUS_06430 814726 812747 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_06430 817565 814746 gene locus_tag LOCUS_06440 817565 814746 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_06440 818982 817873 gene locus_tag LOCUS_06450 818982 817873 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_06450 <819817 819022 gene locus_tag LOCUS_06460 <819817 819022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase >Feature sequence02 11 93 gene locus_tag LOCUS_r00010 11 93 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 69 percent of the 5S ribosomal RNA 214 714 gene locus_tag LOCUS_06470 214 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 947 711 gene locus_tag LOCUS_06480 947 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1755 934 gene locus_tag LOCUS_06490 gene murQ 1755 934 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_06490 2609 1794 gene locus_tag LOCUS_06500 2609 1794 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_06500 4935 2611 gene locus_tag LOCUS_06510 4935 2611 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_06510 7279 5060 gene locus_tag LOCUS_06520 7279 5060 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142855.1 protein_id gnl|my_center|LOCUS_06520 8495 8145 gene locus_tag LOCUS_06530 gene rplS 8495 8145 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963978.1 protein_id gnl|my_center|LOCUS_06530 9382 8705 gene locus_tag LOCUS_06540 gene trmD 9382 8705 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_06540 11186 9489 gene locus_tag LOCUS_06550 11186 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 11972 11412 gene locus_tag LOCUS_06560 11972 11412 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528771.1 protein_id gnl|my_center|LOCUS_06560 12846 12208 gene locus_tag LOCUS_06570 12846 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 14437 12989 gene locus_tag LOCUS_06580 14437 12989 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_06580 15987 14578 gene locus_tag LOCUS_06590 15987 14578 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_06590 16144 16917 gene locus_tag LOCUS_06600 gene dapF 16144 16917 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_06600 16914 17438 gene locus_tag LOCUS_06610 16914 17438 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_06610 17439 18482 gene locus_tag LOCUS_06620 gene mltG 17439 18482 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_06620 18485 19393 gene locus_tag LOCUS_06630 18485 19393 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_06630 19504 20166 gene locus_tag LOCUS_06640 19504 20166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 20891 20175 gene locus_tag LOCUS_06650 20891 20175 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_06650 21405 20953 gene locus_tag LOCUS_06660 21405 20953 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_06660 22844 21417 gene locus_tag LOCUS_06670 gene dnaA 22844 21417 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_06670 23028 23426 gene locus_tag LOCUS_06680 23028 23426 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_06680 24036 23428 gene locus_tag LOCUS_06690 24036 23428 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_06690 24653 24042 gene locus_tag LOCUS_06700 24653 24042 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_06700 25566 24646 gene locus_tag LOCUS_06710 gene ribD 25566 24646 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_06710 25667 26158 gene locus_tag LOCUS_06720 25667 26158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_06720 26155 27024 gene locus_tag LOCUS_06730 gene prmC 26155 27024 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_06730 27021 29018 gene locus_tag LOCUS_06740 gene ligA 27021 29018 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963952.1 protein_id gnl|my_center|LOCUS_06740 29097 29807 gene locus_tag LOCUS_06750 29097 29807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 30252 29812 gene locus_tag LOCUS_06760 30252 29812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 30911 30732 gene locus_tag LOCUS_06770 30911 30732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 30925 31128 gene locus_tag LOCUS_06780 30925 31128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 31391 31921 gene locus_tag LOCUS_06790 31391 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 31911 32789 gene locus_tag LOCUS_06800 gene dapA 31911 32789 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_06800 32791 33714 gene locus_tag LOCUS_06810 32791 33714 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_06810 33823 34629 gene locus_tag LOCUS_06820 gene bamD 33823 34629 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_06820 34629 34964 gene locus_tag LOCUS_06830 34629 34964 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_06830 34972 36183 gene locus_tag LOCUS_06840 gene coaBC 34972 36183 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_06840 36176 37063 gene locus_tag LOCUS_06850 36176 37063 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_06850 37126 38778 gene locus_tag LOCUS_06860 gene recN 37126 38778 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_06860 38834 39649 gene locus_tag LOCUS_06870 38834 39649 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_06870 39858 40862 gene locus_tag LOCUS_06880 39858 40862 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_06880 40940 41827 gene locus_tag LOCUS_06890 40940 41827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 41824 42411 gene locus_tag LOCUS_06900 gene coaE 41824 42411 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_06900 42525 44060 gene locus_tag LOCUS_06910 42525 44060 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_06910 44063 44767 gene locus_tag LOCUS_06920 44063 44767 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_06920 46626 44878 gene locus_tag LOCUS_06930 46626 44878 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789735.1 protein_id gnl|my_center|LOCUS_06930 47086 46895 gene locus_tag LOCUS_06940 47086 46895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 47782 47123 gene locus_tag LOCUS_06950 47782 47123 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_06950 48115 47783 gene locus_tag LOCUS_06960 48115 47783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 49374 48121 gene locus_tag LOCUS_06970 49374 48121 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_06970 51290 49371 gene locus_tag LOCUS_06980 51290 49371 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_06980 51534 53426 gene locus_tag LOCUS_06990 51534 53426 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_06990 54963 53479 gene locus_tag LOCUS_07000 54963 53479 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_07000 55771 55007 gene locus_tag LOCUS_07010 55771 55007 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_07010 55876 57165 gene locus_tag LOCUS_07020 55876 57165 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767135.1 protein_id gnl|my_center|LOCUS_07020 57830 57168 gene locus_tag LOCUS_07030 57830 57168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_07030 60316 57881 gene locus_tag LOCUS_07040 60316 57881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 60488 61039 gene locus_tag LOCUS_07050 gene msrA 60488 61039 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_07050 61041 61628 gene locus_tag LOCUS_07060 gene folE 61041 61628 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_07060 61666 61929 gene locus_tag LOCUS_07070 61666 61929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_07070 64149 61972 gene locus_tag LOCUS_07080 64149 61972 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_07080 65510 65070 gene locus_tag LOCUS_07090 65510 65070 CDS product DUF6146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_07090 66275 65637 gene locus_tag LOCUS_07100 66275 65637 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_07100 66960 66376 gene locus_tag LOCUS_07110 66960 66376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07110 67327 66950 gene locus_tag LOCUS_07120 67327 66950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07120 68555 67491 gene locus_tag LOCUS_07130 gene serC 68555 67491 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_07130 69691 68633 gene locus_tag LOCUS_07140 69691 68633 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_07140 69705 70112 gene locus_tag LOCUS_07150 69705 70112 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_07150 70183 71139 gene locus_tag LOCUS_07160 70183 71139 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_07160 71412 71245 gene locus_tag LOCUS_07170 71412 71245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 71383 72150 gene locus_tag LOCUS_07180 71383 72150 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782748.1 protein_id gnl|my_center|LOCUS_07180 72301 72624 gene locus_tag LOCUS_07190 72301 72624 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_07190 72621 73496 gene locus_tag LOCUS_07200 72621 73496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 73508 74005 gene locus_tag LOCUS_07210 73508 74005 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_07210 74010 74516 gene locus_tag LOCUS_07220 74010 74516 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974220.1 protein_id gnl|my_center|LOCUS_07220 74699 75799 gene locus_tag LOCUS_07230 74699 75799 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_07230 76061 76696 gene locus_tag LOCUS_07240 76061 76696 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397610.1 protein_id gnl|my_center|LOCUS_07240 76887 78059 gene locus_tag LOCUS_07250 76887 78059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 79541 78096 gene locus_tag LOCUS_07260 79541 78096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 79701 80795 gene locus_tag LOCUS_07270 gene ychF 79701 80795 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962805.1 protein_id gnl|my_center|LOCUS_07270 81506 81273 gene locus_tag LOCUS_07280 81506 81273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 81892 81554 gene locus_tag LOCUS_07290 81892 81554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 81939 83795 gene locus_tag LOCUS_07300 81939 83795 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_07300 83807 83935 gene locus_tag LOCUS_07310 83807 83935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 83939 86599 gene locus_tag LOCUS_07320 83939 86599 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_07320 87919 86618 gene locus_tag LOCUS_07330 87919 86618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 90317 87912 gene locus_tag LOCUS_07340 90317 87912 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_07340 91030 90335 gene locus_tag LOCUS_07350 91030 90335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_07350 92305 91043 gene locus_tag LOCUS_07360 92305 91043 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_07360 93695 92904 gene locus_tag LOCUS_07370 93695 92904 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_07370 94678 93767 gene locus_tag LOCUS_07380 gene miaA 94678 93767 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_07380 95522 94671 gene locus_tag LOCUS_07390 95522 94671 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_07390 96924 95551 gene locus_tag LOCUS_07400 96924 95551 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_07400 97704 97021 gene locus_tag LOCUS_07410 97704 97021 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_07410 98938 97694 gene locus_tag LOCUS_07420 98938 97694 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_07420 99930 99043 gene locus_tag LOCUS_07430 99930 99043 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_07430 100904 99933 gene locus_tag LOCUS_07440 100904 99933 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_07440 101061 101702 gene locus_tag LOCUS_07450 101061 101702 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_07450 102064 101699 gene locus_tag LOCUS_07460 102064 101699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 104227 102149 gene locus_tag LOCUS_07470 104227 102149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 104713 104255 gene locus_tag LOCUS_07480 gene smpB 104713 104255 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963988.1 protein_id gnl|my_center|LOCUS_07480 104879 106279 gene locus_tag LOCUS_07490 gene lpdA 104879 106279 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_07490 106539 108062 gene locus_tag LOCUS_07500 106539 108062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 108825 108109 gene locus_tag LOCUS_07510 108825 108109 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_07510 109727 108822 gene locus_tag LOCUS_07520 109727 108822 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_07520 110064 110486 gene locus_tag LOCUS_07530 110064 110486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 111346 110567 gene locus_tag LOCUS_07540 111346 110567 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_07540 111903 111415 gene locus_tag LOCUS_07550 111903 111415 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788377.1 protein_id gnl|my_center|LOCUS_07550 112672 111905 gene locus_tag LOCUS_07560 112672 111905 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788374.1 protein_id gnl|my_center|LOCUS_07560 113008 113601 gene locus_tag LOCUS_07570 113008 113601 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_07570 113627 114016 gene locus_tag LOCUS_07580 113627 114016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 114038 115009 gene locus_tag LOCUS_07590 114038 115009 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546076.1 protein_id gnl|my_center|LOCUS_07590 115067 115354 gene locus_tag LOCUS_07600 115067 115354 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_07600 115368 115805 gene locus_tag LOCUS_07610 115368 115805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 117302 115962 gene locus_tag LOCUS_07620 117302 115962 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_07620 118238 117345 gene locus_tag LOCUS_07630 118238 117345 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_07630 118316 119608 gene locus_tag LOCUS_07640 118316 119608 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_07640 120297 119605 gene locus_tag LOCUS_07650 120297 119605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 120422 121735 gene locus_tag LOCUS_07660 gene tilS 120422 121735 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_07660 121774 123393 gene locus_tag LOCUS_07670 gene ade 121774 123393 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_07670 123398 124357 gene locus_tag LOCUS_07680 123398 124357 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_07680 124408 125946 gene locus_tag LOCUS_07690 124408 125946 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_07690 126444 127676 gene locus_tag LOCUS_07700 126444 127676 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_07700 127676 128416 gene locus_tag LOCUS_07710 127676 128416 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851457.1 protein_id gnl|my_center|LOCUS_07710 128420 129151 gene locus_tag LOCUS_07720 gene pxpB 128420 129151 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_07720 129144 129989 gene locus_tag LOCUS_07730 129144 129989 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382245.1 protein_id gnl|my_center|LOCUS_07730 130684 129986 gene locus_tag LOCUS_07740 gene deoD 130684 129986 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898215.1 protein_id gnl|my_center|LOCUS_07740 131369 130704 gene locus_tag LOCUS_07750 gene deoC 131369 130704 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448021.1 protein_id gnl|my_center|LOCUS_07750 132159 131497 gene locus_tag LOCUS_07760 gene deoC 132159 131497 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_07760 135075 132466 gene locus_tag LOCUS_07770 gene clpB 135075 132466 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_07770 135232 135621 gene locus_tag LOCUS_07780 gene ytxJ 135232 135621 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_07780 135729 136358 gene locus_tag LOCUS_07790 135729 136358 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457314.1 protein_id gnl|my_center|LOCUS_07790 137591 136416 gene locus_tag LOCUS_07800 137591 136416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_07800 138981 137698 gene locus_tag LOCUS_07810 gene fahA 138981 137698 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_07810 139185 140456 gene locus_tag LOCUS_07820 139185 140456 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_07820 140898 140731 gene locus_tag LOCUS_07830 140898 140731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 141592 140900 gene locus_tag LOCUS_07840 141592 140900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 143326 141764 gene locus_tag LOCUS_07850 143326 141764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_07850 143761 143378 gene locus_tag LOCUS_07860 143761 143378 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_07860 144028 146217 gene locus_tag LOCUS_07870 144028 146217 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063035.1 protein_id gnl|my_center|LOCUS_07870 146493 147794 gene locus_tag LOCUS_07880 146493 147794 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362019.1 protein_id gnl|my_center|LOCUS_07880 147890 148654 gene locus_tag LOCUS_07890 147890 148654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 148672 149568 gene locus_tag LOCUS_07900 148672 149568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 149650 149946 gene locus_tag LOCUS_07910 149650 149946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 149949 150239 gene locus_tag LOCUS_07920 149949 150239 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964270.1 protein_id gnl|my_center|LOCUS_07920 150250 150975 gene locus_tag LOCUS_07930 150250 150975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 151268 155503 gene locus_tag LOCUS_07940 151268 155503 CDS product DUF6079 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392173.1 protein_id gnl|my_center|LOCUS_07940 155507 157999 gene locus_tag LOCUS_07950 155507 157999 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052729532.1 protein_id gnl|my_center|LOCUS_07950 157999 159438 gene locus_tag LOCUS_07960 157999 159438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 159435 160142 gene locus_tag LOCUS_07970 159435 160142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392177.1 protein_id gnl|my_center|LOCUS_07970 160187 160711 gene locus_tag LOCUS_07980 160187 160711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 160711 161535 gene locus_tag LOCUS_07990 160711 161535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 161597 162568 gene locus_tag LOCUS_08000 161597 162568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 163618 163911 gene locus_tag LOCUS_08010 163618 163911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 164165 164578 gene locus_tag LOCUS_08020 164165 164578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964407.1 protein_id gnl|my_center|LOCUS_08020 164735 165376 gene locus_tag LOCUS_08030 164735 165376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 165617 165532 gene locus_tag LOCUS_t00080 165617 165532 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 165721 166476 gene locus_tag LOCUS_08040 165721 166476 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_08040 166489 167124 gene locus_tag LOCUS_08050 166489 167124 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_08050 167136 168332 gene locus_tag LOCUS_08060 167136 168332 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072442.1 protein_id gnl|my_center|LOCUS_08060 168448 169542 gene locus_tag LOCUS_08070 168448 169542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 170699 169539 gene locus_tag LOCUS_08080 gene ribB 170699 169539 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_08080 172641 170716 gene locus_tag LOCUS_08090 172641 170716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 173353 172718 gene locus_tag LOCUS_08100 173353 172718 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_08100 175648 173372 gene locus_tag LOCUS_08110 175648 173372 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_08110 176250 175876 gene locus_tag LOCUS_08120 176250 175876 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_08120 176770 176270 gene locus_tag LOCUS_08130 gene tpx 176770 176270 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963706.1 protein_id gnl|my_center|LOCUS_08130 177093 179258 gene locus_tag LOCUS_08140 gene katG 177093 179258 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400805.1 protein_id gnl|my_center|LOCUS_08140 179596 179339 gene locus_tag LOCUS_08150 179596 179339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_08150 179891 179577 gene locus_tag LOCUS_08160 179891 179577 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_08160 180541 179897 gene locus_tag LOCUS_08170 180541 179897 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_08170 182172 180682 gene locus_tag LOCUS_08180 182172 180682 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_08180 183481 182276 gene locus_tag LOCUS_08190 183481 182276 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_08190 183617 184099 gene locus_tag LOCUS_08200 183617 184099 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_08200 184101 184727 gene locus_tag LOCUS_08210 184101 184727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 184783 185289 gene locus_tag LOCUS_08220 184783 185289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 185255 186016 gene locus_tag LOCUS_08230 185255 186016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 185992 186798 gene locus_tag LOCUS_08240 185992 186798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 188165 186795 gene locus_tag LOCUS_08250 188165 186795 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963044.1 protein_id gnl|my_center|LOCUS_08250 188895 188200 gene locus_tag LOCUS_08260 188895 188200 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_08260 189713 188895 gene locus_tag LOCUS_08270 gene panB 189713 188895 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_08270 189836 190297 gene locus_tag LOCUS_08280 189836 190297 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840149.1 protein_id gnl|my_center|LOCUS_08280 191747 190326 gene locus_tag LOCUS_08290 191747 190326 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_08290 191962 193872 gene locus_tag LOCUS_08300 gene dnaK 191962 193872 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_08300 194036 194983 gene locus_tag LOCUS_08310 194036 194983 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983101.1 protein_id gnl|my_center|LOCUS_08310 197047 194987 gene locus_tag LOCUS_08320 197047 194987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 197327 198769 gene locus_tag LOCUS_08330 197327 198769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 198901 199551 gene locus_tag LOCUS_08340 198901 199551 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_08340 200126 199563 gene locus_tag LOCUS_08350 200126 199563 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_08350 200770 200123 gene locus_tag LOCUS_08360 200770 200123 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_08360 200824 201249 gene locus_tag LOCUS_08370 200824 201249 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_08370 201267 202370 gene locus_tag LOCUS_08380 201267 202370 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_08380 202421 204181 gene locus_tag LOCUS_08390 gene menD 202421 204181 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_08390 204268 204606 gene locus_tag LOCUS_08400 204268 204606 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_08400 204692 205522 gene locus_tag LOCUS_08410 204692 205522 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_08410 205578 206966 gene locus_tag LOCUS_08420 gene mnmE 205578 206966 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_08420 207128 208288 gene locus_tag LOCUS_08430 207128 208288 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_08430 209286 208489 gene locus_tag LOCUS_08440 209286 208489 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464673.1 protein_id gnl|my_center|LOCUS_08440 210183 209557 gene locus_tag LOCUS_08450 210183 209557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 210838 211128 gene locus_tag LOCUS_08460 210838 211128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 211186 212391 gene locus_tag LOCUS_08470 211186 212391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 212869 213711 gene locus_tag LOCUS_08480 212869 213711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 213224 213233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 213689 214069 gene locus_tag LOCUS_08490 213689 214069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 213932 213941 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 214047 214562 gene locus_tag LOCUS_08500 214047 214562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 214559 215422 gene locus_tag LOCUS_08510 214559 215422 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962653.1 protein_id gnl|my_center|LOCUS_08510 215439 215762 gene locus_tag LOCUS_08520 215439 215762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 216737 215793 gene locus_tag LOCUS_08530 216737 215793 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_08530 217518 218006 gene locus_tag LOCUS_08540 217518 218006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 218602 218096 gene locus_tag LOCUS_08550 218602 218096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 220380 220024 gene locus_tag LOCUS_08560 220380 220024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 221621 220944 gene locus_tag LOCUS_08570 221621 220944 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083605.1 protein_id gnl|my_center|LOCUS_08570 222558 221614 gene locus_tag LOCUS_08580 222558 221614 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070474.1 protein_id gnl|my_center|LOCUS_08580 223132 222815 gene locus_tag LOCUS_08590 223132 222815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 223502 223152 gene locus_tag LOCUS_08600 223502 223152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 224667 223486 gene locus_tag LOCUS_08610 224667 223486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 224805 225047 gene locus_tag LOCUS_08620 224805 225047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 225139 226248 gene locus_tag LOCUS_08630 225139 226248 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_08630 226591 230937 gene locus_tag LOCUS_08640 gene cas9 226591 230937 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_08640 230950 231855 gene locus_tag LOCUS_08650 gene cas1 230950 231855 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_08650 231803 232216 gene locus_tag LOCUS_08660 gene cas2 231803 232216 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_08660 232370 235736 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctgtgaattctccataaatttaaagaactgaaag 236982 235771 gene locus_tag LOCUS_08670 236982 235771 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203295.1 protein_id gnl|my_center|LOCUS_08670 238066 237317 gene locus_tag LOCUS_08680 238066 237317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 238902 238237 gene locus_tag LOCUS_08690 238902 238237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 240560 238905 gene locus_tag LOCUS_08700 240560 238905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 241139 241438 gene locus_tag LOCUS_08710 241139 241438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 241572 241757 gene locus_tag LOCUS_08720 241572 241757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 242108 243154 gene locus_tag LOCUS_08730 242108 243154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 243447 243208 gene locus_tag LOCUS_08740 243447 243208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 243753 246947 gene locus_tag LOCUS_08750 243753 246947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 247122 253238 gene locus_tag LOCUS_08760 247122 253238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 253403 258826 gene locus_tag LOCUS_08770 253403 258826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 260542 258875 gene locus_tag LOCUS_08780 260542 258875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 260670 261911 gene locus_tag LOCUS_08790 260670 261911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_08790 262382 261915 gene locus_tag LOCUS_08800 262382 261915 CDS product DUF6495 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_08800 262946 262485 gene locus_tag LOCUS_08810 gene rplI 262946 262485 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963954.1 protein_id gnl|my_center|LOCUS_08810 263256 262960 gene locus_tag LOCUS_08820 gene rpsR 263256 262960 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963955.1 protein_id gnl|my_center|LOCUS_08820 263597 263259 gene locus_tag LOCUS_08830 gene rpsF 263597 263259 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963956.1 protein_id gnl|my_center|LOCUS_08830 263793 264488 gene locus_tag LOCUS_08840 263793 264488 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_08840 266951 264498 gene locus_tag LOCUS_08850 gene priA 266951 264498 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_08850 267896 266955 gene locus_tag LOCUS_08860 267896 266955 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_08860 268851 267991 gene locus_tag LOCUS_08870 gene nadC 268851 267991 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_08870 268977 269450 gene locus_tag LOCUS_08880 gene rlmH 268977 269450 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_08880 271520 269451 gene locus_tag LOCUS_08890 gene prlC 271520 269451 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065284.1 protein_id gnl|my_center|LOCUS_08890 272122 271568 gene locus_tag LOCUS_08900 272122 271568 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436558.1 protein_id gnl|my_center|LOCUS_08900 273760 272150 gene locus_tag LOCUS_08910 273760 272150 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070720.1 protein_id gnl|my_center|LOCUS_08910 276063 273847 gene locus_tag LOCUS_08920 276063 273847 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_08920 276176 276748 gene locus_tag LOCUS_08930 276176 276748 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_08930 276818 279037 gene locus_tag LOCUS_08940 276818 279037 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_08940 279062 279514 gene locus_tag LOCUS_08950 279062 279514 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_08950 279528 280805 gene locus_tag LOCUS_08960 279528 280805 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_08960 280980 283061 gene locus_tag LOCUS_08970 280980 283061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 283072 284256 gene locus_tag LOCUS_08980 283072 284256 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_08980 284413 285801 gene locus_tag LOCUS_08990 284413 285801 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_08990 285857 286777 gene locus_tag LOCUS_09000 285857 286777 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_09000 286777 287796 gene locus_tag LOCUS_09010 286777 287796 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_09010 287789 288529 gene locus_tag LOCUS_09020 287789 288529 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_09020 288634 290739 gene locus_tag LOCUS_09030 288634 290739 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_09030 291036 291839 gene locus_tag LOCUS_09040 gene sppA 291036 291839 CDS product fructose-phosphate phosphohydrolase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_09040 295151 291840 gene locus_tag LOCUS_09050 295151 291840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 296082 295309 gene locus_tag LOCUS_09060 gene mazG 296082 295309 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_09060 298452 296188 gene locus_tag LOCUS_09070 298452 296188 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_09070 299605 298652 gene locus_tag LOCUS_09080 299605 298652 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_09080 301096 299609 gene locus_tag LOCUS_09090 301096 299609 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_09090 301913 301059 gene locus_tag LOCUS_09100 301913 301059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 303872 301914 gene locus_tag LOCUS_09110 303872 301914 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_09110 304000 304242 gene locus_tag LOCUS_09120 304000 304242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_09120 304304 306082 gene locus_tag LOCUS_09130 304304 306082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 306075 306797 gene locus_tag LOCUS_09140 306075 306797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 307114 307788 gene locus_tag LOCUS_09150 307114 307788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 307844 308713 gene locus_tag LOCUS_09160 307844 308713 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_09160 310248 308776 gene locus_tag LOCUS_09170 gene guaB 310248 308776 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_09170 310990 310316 gene locus_tag LOCUS_09180 310990 310316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 311546 311052 gene locus_tag LOCUS_09190 311546 311052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 312074 311547 gene locus_tag LOCUS_09200 312074 311547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 313348 312203 gene locus_tag LOCUS_09210 313348 312203 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_09210 314353 313490 gene locus_tag LOCUS_09220 314353 313490 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_09220 314663 315712 gene locus_tag LOCUS_09230 314663 315712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 316750 315716 gene locus_tag LOCUS_09240 316750 315716 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_09240 316888 318126 gene locus_tag LOCUS_09250 gene pepT 316888 318126 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964023.1 protein_id gnl|my_center|LOCUS_09250 318236 318703 gene locus_tag LOCUS_09260 318236 318703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 318858 319451 gene locus_tag LOCUS_09270 318858 319451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 319796 319506 gene locus_tag LOCUS_09280 gene yajC 319796 319506 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_09280 320279 319806 gene locus_tag LOCUS_09290 320279 319806 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_09290 321306 320362 gene locus_tag LOCUS_09300 gene nusB 321306 320362 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_09300 321545 323311 gene locus_tag LOCUS_09310 321545 323311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_09310 323443 323856 gene locus_tag LOCUS_09320 323443 323856 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_09320 324241 323906 gene locus_tag LOCUS_09330 324241 323906 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_09330 324289 324846 gene locus_tag LOCUS_09340 324289 324846 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_09340 325329 324847 gene locus_tag LOCUS_09350 325329 324847 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586895.1 protein_id gnl|my_center|LOCUS_09350 325876 325331 gene locus_tag LOCUS_09360 gene bstA 325876 325331 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_09360 326869 325937 gene locus_tag LOCUS_09370 326869 325937 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964012.1 protein_id gnl|my_center|LOCUS_09370 329149 326945 gene locus_tag LOCUS_09380 gene recQ 329149 326945 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_09380 329402 330319 gene locus_tag LOCUS_09390 329402 330319 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_09390 330319 331146 gene locus_tag LOCUS_09400 gene tatC 330319 331146 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_09400 331139 331486 gene locus_tag LOCUS_09410 331139 331486 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_09410 331557 332297 gene locus_tag LOCUS_09420 gene lptB 331557 332297 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_09420 333065 332313 gene locus_tag LOCUS_09430 333065 332313 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_09430 333328 334425 gene locus_tag LOCUS_09440 333328 334425 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_09440 334440 335642 gene locus_tag LOCUS_09450 334440 335642 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_09450 337001 335610 gene locus_tag LOCUS_09460 337001 335610 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_09460 338071 337061 gene locus_tag LOCUS_09470 338071 337061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 339254 338031 gene locus_tag LOCUS_09480 339254 338031 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_09480 340456 339380 gene locus_tag LOCUS_09490 340456 339380 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_09490 341574 340459 gene locus_tag LOCUS_09500 341574 340459 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_09500 342572 341571 gene locus_tag LOCUS_09510 342572 341571 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 protein_id gnl|my_center|LOCUS_09510 343605 342565 gene locus_tag LOCUS_09520 343605 342565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 345145 343598 gene locus_tag LOCUS_09530 345145 343598 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 protein_id gnl|my_center|LOCUS_09530 346287 345142 gene locus_tag LOCUS_09540 346287 345142 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_09540 347681 346287 gene locus_tag LOCUS_09550 347681 346287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 protein_id gnl|my_center|LOCUS_09550 348508 347687 gene locus_tag LOCUS_09560 348508 347687 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383884.1 protein_id gnl|my_center|LOCUS_09560 349386 348511 gene locus_tag LOCUS_09570 349386 348511 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 protein_id gnl|my_center|LOCUS_09570 350560 349403 gene locus_tag LOCUS_09580 350560 349403 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023668.1 protein_id gnl|my_center|LOCUS_09580 351540 350629 gene locus_tag LOCUS_09590 351540 350629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 352746 351544 gene locus_tag LOCUS_09600 352746 351544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 353910 352759 gene locus_tag LOCUS_09610 353910 352759 CDS product lipid galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557046.1 protein_id gnl|my_center|LOCUS_09610 354974 353907 gene locus_tag LOCUS_09620 354974 353907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 356043 354982 gene locus_tag LOCUS_09630 356043 354982 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194788.1 protein_id gnl|my_center|LOCUS_09630 356838 356059 gene locus_tag LOCUS_09640 356838 356059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 357692 356838 gene locus_tag LOCUS_09650 357692 356838 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282880.1 protein_id gnl|my_center|LOCUS_09650 358475 357693 gene locus_tag LOCUS_09660 358475 357693 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_09660 360038 358506 gene locus_tag LOCUS_09670 360038 358506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 360994 360062 gene locus_tag LOCUS_09680 360994 360062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 361881 360991 gene locus_tag LOCUS_09690 361881 360991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 363116 361878 gene locus_tag LOCUS_09700 363116 361878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_09700 363907 363119 gene locus_tag LOCUS_09710 363907 363119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_09710 366789 364306 gene locus_tag LOCUS_09720 366789 364306 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_09720 367595 366798 gene locus_tag LOCUS_09730 367595 366798 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_09730 367699 369561 gene locus_tag LOCUS_09740 367699 369561 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_09740 369945 370475 gene locus_tag LOCUS_09750 369945 370475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 370519 371205 gene locus_tag LOCUS_09760 370519 371205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_09760 371316 371888 gene locus_tag LOCUS_09770 371316 371888 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_09770 372016 372237 gene locus_tag LOCUS_09780 372016 372237 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_09780 372400 375753 gene locus_tag LOCUS_09790 gene secA 372400 375753 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_09790 375842 376672 gene locus_tag LOCUS_09800 375842 376672 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 protein_id gnl|my_center|LOCUS_09800 376784 377371 gene locus_tag LOCUS_09810 gene satP 376784 377371 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 protein_id gnl|my_center|LOCUS_09810 377414 378106 gene locus_tag LOCUS_09820 377414 378106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_09820 378806 378126 gene locus_tag LOCUS_09830 378806 378126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 379714 378809 gene locus_tag LOCUS_09840 379714 378809 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_09840 380526 379849 gene locus_tag LOCUS_09850 gene mnmD 380526 379849 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_09850 380611 381678 gene locus_tag LOCUS_09860 380611 381678 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963851.1 protein_id gnl|my_center|LOCUS_09860 382169 381783 gene locus_tag LOCUS_09870 382169 381783 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_09870 384734 382740 gene locus_tag LOCUS_09880 384734 382740 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_09880 384688 384849 gene locus_tag LOCUS_09890 384688 384849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 384973 385995 gene locus_tag LOCUS_09900 384973 385995 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463734.1 protein_id gnl|my_center|LOCUS_09900 386061 386432 gene locus_tag LOCUS_09910 gene crcB 386061 386432 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_09910 386935 386429 gene locus_tag LOCUS_09920 386935 386429 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_09920 387287 388492 gene locus_tag LOCUS_09930 387287 388492 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_09930 388506 389471 gene locus_tag LOCUS_09940 388506 389471 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_09940 389486 389863 gene locus_tag LOCUS_09950 389486 389863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 391218 389866 gene locus_tag LOCUS_09960 391218 389866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 391796 391353 gene locus_tag LOCUS_09970 391796 391353 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_09970 391912 392307 gene locus_tag LOCUS_09980 391912 392307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 393170 392685 gene locus_tag LOCUS_09990 393170 392685 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_09990 393160 393318 gene locus_tag LOCUS_10000 393160 393318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 396813 393376 gene locus_tag LOCUS_10010 396813 393376 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964044.1 protein_id gnl|my_center|LOCUS_10010 396959 397813 gene locus_tag LOCUS_10020 gene purU 396959 397813 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_10020 397858 398565 gene locus_tag LOCUS_10030 397858 398565 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_10030 398744 398941 gene locus_tag LOCUS_10040 398744 398941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 400129 400905 gene locus_tag LOCUS_10050 400129 400905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 400898 401314 gene locus_tag LOCUS_10060 400898 401314 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_10060 402113 401298 gene locus_tag LOCUS_10070 gene pyrF 402113 401298 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_10070 403226 402150 gene locus_tag LOCUS_10080 gene prfA 403226 402150 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_10080 403632 404297 gene locus_tag LOCUS_10090 403632 404297 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_10090 406896 404338 gene locus_tag LOCUS_10100 406896 404338 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_10100 408033 407071 gene locus_tag LOCUS_10110 408033 407071 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_10110 409287 408109 gene locus_tag LOCUS_10120 409287 408109 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_10120 411612 409426 gene locus_tag LOCUS_10130 411612 409426 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_10130 411874 412896 gene locus_tag LOCUS_10140 411874 412896 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_10140 413912 412968 gene locus_tag LOCUS_10150 413912 412968 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_10150 414067 414930 gene locus_tag LOCUS_10160 414067 414930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 415192 415551 gene locus_tag LOCUS_10170 415192 415551 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_10170 415554 417344 gene locus_tag LOCUS_10180 415554 417344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 419353 417404 gene locus_tag LOCUS_10190 419353 417404 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_10190 421648 420209 gene locus_tag LOCUS_10200 421648 420209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 422115 421672 gene locus_tag LOCUS_10210 422115 421672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 422717 422190 gene locus_tag LOCUS_10220 422717 422190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 423269 422838 gene locus_tag LOCUS_10230 423269 422838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 424661 423270 gene locus_tag LOCUS_10240 424661 423270 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_10240 425491 424649 gene locus_tag LOCUS_10250 425491 424649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 425970 425545 gene locus_tag LOCUS_10260 425970 425545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 426837 425983 gene locus_tag LOCUS_10270 426837 425983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 427719 426889 gene locus_tag LOCUS_10280 427719 426889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 428574 427732 gene locus_tag LOCUS_10290 428574 427732 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_10290 429453 428593 gene locus_tag LOCUS_10300 429453 428593 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_10300 431240 429522 gene locus_tag LOCUS_10310 431240 429522 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143956636.1 protein_id gnl|my_center|LOCUS_10310 431358 431804 gene locus_tag LOCUS_10320 431358 431804 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_10320 433972 433124 gene locus_tag LOCUS_10330 433972 433124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 435157 434102 gene locus_tag LOCUS_10340 435157 434102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 437219 435243 gene locus_tag LOCUS_10350 437219 435243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 437284 437694 gene locus_tag LOCUS_10360 437284 437694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 437697 438095 gene locus_tag LOCUS_10370 437697 438095 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_10370 438085 438384 gene locus_tag LOCUS_10380 gene trxA 438085 438384 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963919.1 protein_id gnl|my_center|LOCUS_10380 438468 439088 gene locus_tag LOCUS_10390 438468 439088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 439055 440182 gene locus_tag LOCUS_10400 439055 440182 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403786.1 protein_id gnl|my_center|LOCUS_10400 440382 441272 gene locus_tag LOCUS_10410 440382 441272 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_10410 441272 441568 gene locus_tag LOCUS_10420 441272 441568 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_10420 442171 442863 gene locus_tag LOCUS_10430 442171 442863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 442931 443878 gene locus_tag LOCUS_10440 442931 443878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 443936 444568 gene locus_tag LOCUS_10450 443936 444568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 444894 444655 gene locus_tag LOCUS_10460 444894 444655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 444929 445807 gene locus_tag LOCUS_10470 444929 445807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 446082 448883 gene locus_tag LOCUS_10480 446082 448883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 449214 449882 gene locus_tag LOCUS_10490 449214 449882 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833887.1 protein_id gnl|my_center|LOCUS_10490 450326 450009 gene locus_tag LOCUS_10500 450326 450009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 451384 450392 gene locus_tag LOCUS_10510 451384 450392 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_10510 452180 451395 gene locus_tag LOCUS_10520 452180 451395 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_10520 452914 452177 gene locus_tag LOCUS_10530 452914 452177 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_10530 453093 453695 gene locus_tag LOCUS_10540 453093 453695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 455456 453753 gene locus_tag LOCUS_10550 455456 453753 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_10550 455829 455461 gene locus_tag LOCUS_10560 455829 455461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 455985 456365 gene locus_tag LOCUS_10570 455985 456365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 456474 457253 gene locus_tag LOCUS_10580 456474 457253 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_10580 457312 457575 gene locus_tag LOCUS_10590 457312 457575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 457582 458298 gene locus_tag LOCUS_10600 457582 458298 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_10600 458298 459269 gene locus_tag LOCUS_10610 458298 459269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 460314 459292 gene locus_tag LOCUS_10620 gene ldhA 460314 459292 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762218.1 protein_id gnl|my_center|LOCUS_10620 460931 460317 gene locus_tag LOCUS_10630 460931 460317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 461980 461141 gene locus_tag LOCUS_10640 461980 461141 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_10640 463230 462133 gene locus_tag LOCUS_10650 463230 462133 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_10650 464974 463232 gene locus_tag LOCUS_10660 464974 463232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 466423 465002 gene locus_tag LOCUS_10670 466423 465002 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_10670 467936 466503 gene locus_tag LOCUS_10680 467936 466503 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036277.1 protein_id gnl|my_center|LOCUS_10680 469019 468126 gene locus_tag LOCUS_10690 469019 468126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 470543 469032 gene locus_tag LOCUS_10700 470543 469032 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_10700 473676 470554 gene locus_tag LOCUS_10710 473676 470554 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_10710 474059 476872 gene locus_tag LOCUS_10720 474059 476872 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_10720 476927 477154 gene locus_tag LOCUS_10730 476927 477154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 478245 477634 gene locus_tag LOCUS_10740 478245 477634 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963710.1 protein_id gnl|my_center|LOCUS_10740 478611 478267 gene locus_tag LOCUS_10750 478611 478267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 481007 478833 gene locus_tag LOCUS_10760 481007 478833 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_10760 483171 481237 gene locus_tag LOCUS_10770 483171 481237 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_10770 484304 483888 gene locus_tag LOCUS_10780 484304 483888 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_10780 484647 484309 gene locus_tag LOCUS_10790 484647 484309 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325418.1 protein_id gnl|my_center|LOCUS_10790 485951 484749 gene locus_tag LOCUS_10800 485951 484749 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_10800 490407 486004 gene locus_tag LOCUS_10810 490407 486004 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_10810 490817 490506 gene locus_tag LOCUS_10820 490817 490506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 491813 491235 gene locus_tag LOCUS_10830 491813 491235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 493212 491944 gene locus_tag LOCUS_10840 493212 491944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 493848 493267 gene locus_tag LOCUS_10850 493848 493267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 494836 494051 gene locus_tag LOCUS_10860 494836 494051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 494865 495068 gene locus_tag LOCUS_10870 494865 495068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 495489 495073 gene locus_tag LOCUS_10880 495489 495073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 498375 495610 gene locus_tag LOCUS_10890 498375 495610 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_10890 499475 499272 gene locus_tag LOCUS_10900 499475 499272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 500021 499590 gene locus_tag LOCUS_10910 500021 499590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 500633 500130 gene locus_tag LOCUS_10920 500633 500130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 501939 500731 gene locus_tag LOCUS_10930 501939 500731 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_10930 502475 502020 gene locus_tag LOCUS_10940 502475 502020 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_10940 503144 502476 gene locus_tag LOCUS_10950 503144 502476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 503587 503201 gene locus_tag LOCUS_10960 503587 503201 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_10960 503781 503593 gene locus_tag LOCUS_10970 503781 503593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 505092 503794 gene locus_tag LOCUS_10980 505092 503794 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065084.1 protein_id gnl|my_center|LOCUS_10980 507464 505095 gene locus_tag LOCUS_10990 507464 505095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 507938 507504 gene locus_tag LOCUS_11000 507938 507504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 508375 508061 gene locus_tag LOCUS_11010 508375 508061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 508997 508449 gene locus_tag LOCUS_11020 508997 508449 CDS product DUF3347 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073122886.1 protein_id gnl|my_center|LOCUS_11020 510917 509022 gene locus_tag LOCUS_11030 510917 509022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 512173 510926 gene locus_tag LOCUS_11040 512173 510926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 516023 512184 gene locus_tag LOCUS_11050 516023 512184 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_11050 516460 516131 gene locus_tag LOCUS_11060 516460 516131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 516909 517220 gene locus_tag LOCUS_11070 516909 517220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 517397 517978 gene locus_tag LOCUS_11080 517397 517978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 518050 518658 gene locus_tag LOCUS_11090 518050 518658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 518816 519280 gene locus_tag LOCUS_11100 518816 519280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 519621 519887 gene locus_tag LOCUS_11110 519621 519887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 519910 520128 gene locus_tag LOCUS_11120 519910 520128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 520146 520421 gene locus_tag LOCUS_11130 520146 520421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 520576 521106 gene locus_tag LOCUS_11140 520576 521106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11140 521099 521239 gene locus_tag LOCUS_11150 521099 521239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 521355 521948 gene locus_tag LOCUS_11160 521355 521948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 521957 522433 gene locus_tag LOCUS_11170 521957 522433 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942971.1 protein_id gnl|my_center|LOCUS_11170 522507 523877 gene locus_tag LOCUS_11180 522507 523877 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_11180 523885 524898 gene locus_tag LOCUS_11190 523885 524898 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_11190 524909 525526 gene locus_tag LOCUS_11200 524909 525526 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391567.1 protein_id gnl|my_center|LOCUS_11200 525556 526617 gene locus_tag LOCUS_11210 525556 526617 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_11210 526634 527464 gene locus_tag LOCUS_11220 526634 527464 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_11220 527467 528309 gene locus_tag LOCUS_11230 527467 528309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 528365 528619 gene locus_tag LOCUS_11240 528365 528619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 528623 530107 gene locus_tag LOCUS_11250 528623 530107 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444159.1 protein_id gnl|my_center|LOCUS_11250 530209 531639 gene locus_tag LOCUS_11260 530209 531639 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444662.1 protein_id gnl|my_center|LOCUS_11260 531650 532543 gene locus_tag LOCUS_11270 531650 532543 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_11270 532540 533190 gene locus_tag LOCUS_11280 532540 533190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 533198 533491 gene locus_tag LOCUS_11290 533198 533491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 533510 535579 gene locus_tag LOCUS_11300 533510 535579 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093407568.1 protein_id gnl|my_center|LOCUS_11300 535907 536314 gene locus_tag LOCUS_11310 535907 536314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 536412 537248 gene locus_tag LOCUS_11320 536412 537248 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962948.1 protein_id gnl|my_center|LOCUS_11320 538024 538359 gene locus_tag LOCUS_11330 gene ssb 538024 538359 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_11330 538438 538890 gene locus_tag LOCUS_11340 538438 538890 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_11340 538907 539104 gene locus_tag LOCUS_11350 538907 539104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 539508 540080 gene locus_tag LOCUS_11360 539508 540080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 540049 541083 gene locus_tag LOCUS_11370 540049 541083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 541080 542525 gene locus_tag LOCUS_11380 541080 542525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 544412 542724 gene locus_tag LOCUS_11390 544412 542724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 544744 544463 gene locus_tag LOCUS_11400 544744 544463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 545495 544794 gene locus_tag LOCUS_11410 545495 544794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 546565 545822 gene locus_tag LOCUS_11420 546565 545822 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_11420 546797 546555 gene locus_tag LOCUS_11430 546797 546555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 547541 547281 gene locus_tag LOCUS_11440 547541 547281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 548576 551560 gene locus_tag LOCUS_11450 548576 551560 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_11450 551572 552966 gene locus_tag LOCUS_11460 551572 552966 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_11460 553028 554428 gene locus_tag LOCUS_11470 553028 554428 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186755677.1 protein_id gnl|my_center|LOCUS_11470 554751 554500 gene locus_tag LOCUS_11480 554751 554500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 555575 554838 gene locus_tag LOCUS_11490 555575 554838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 557479 556523 gene locus_tag LOCUS_11500 557479 556523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 558045 557674 gene locus_tag LOCUS_11510 558045 557674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 558288 560714 gene locus_tag LOCUS_11520 558288 560714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 560802 561656 gene locus_tag LOCUS_11530 560802 561656 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004326095.1 protein_id gnl|my_center|LOCUS_11530 561959 562237 gene locus_tag LOCUS_11540 561959 562237 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_11540 562527 562931 gene locus_tag LOCUS_11550 562527 562931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 562928 563590 gene locus_tag LOCUS_11560 562928 563590 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_11560 563593 563901 gene locus_tag LOCUS_11570 563593 563901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 564242 566323 gene locus_tag LOCUS_11580 564242 566323 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963675.1 protein_id gnl|my_center|LOCUS_11580 566311 568215 gene locus_tag LOCUS_11590 566311 568215 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963674.1 protein_id gnl|my_center|LOCUS_11590 568228 569547 gene locus_tag LOCUS_11600 568228 569547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963643.1 protein_id gnl|my_center|LOCUS_11600 569520 570200 gene locus_tag LOCUS_11610 569520 570200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963642.1 protein_id gnl|my_center|LOCUS_11610 570190 573486 gene locus_tag LOCUS_11620 570190 573486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963641.1 protein_id gnl|my_center|LOCUS_11620 573479 574426 gene locus_tag LOCUS_11630 573479 574426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963640.1 protein_id gnl|my_center|LOCUS_11630 574423 578457 gene locus_tag LOCUS_11640 574423 578457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 579259 578666 gene locus_tag LOCUS_11650 579259 578666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 579780 579505 gene locus_tag LOCUS_11660 579780 579505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 580095 580382 gene locus_tag LOCUS_11670 580095 580382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 580655 583057 gene locus_tag LOCUS_11680 580655 583057 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_11680 583068 583649 gene locus_tag LOCUS_11690 583068 583649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 583649 584488 gene locus_tag LOCUS_11700 583649 584488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 584525 585154 gene locus_tag LOCUS_11710 584525 585154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 585242 586126 gene locus_tag LOCUS_11720 585242 586126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 586123 586911 gene locus_tag LOCUS_11730 586123 586911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 588344 587088 gene locus_tag LOCUS_11740 588344 587088 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362024.1 protein_id gnl|my_center|LOCUS_11740 588652 588578 gene locus_tag LOCUS_t00090 588652 588578 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 588738 589373 gene locus_tag LOCUS_11750 588738 589373 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_11750 589464 589961 gene locus_tag LOCUS_11760 589464 589961 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_11760 589958 590371 gene locus_tag LOCUS_11770 589958 590371 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_11770 590372 591172 gene locus_tag LOCUS_11780 590372 591172 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_11780 591235 592650 gene locus_tag LOCUS_11790 591235 592650 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_11790 592668 592871 gene locus_tag LOCUS_11800 592668 592871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 593178 592903 gene locus_tag LOCUS_11810 593178 592903 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_11810 594031 593195 gene locus_tag LOCUS_11820 gene prmA 594031 593195 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_11820 594970 594221 gene locus_tag LOCUS_11830 gene tpiA 594970 594221 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963550.1 protein_id gnl|my_center|LOCUS_11830 595455 594970 gene locus_tag LOCUS_11840 595455 594970 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_11840 596524 595484 gene locus_tag LOCUS_11850 596524 595484 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_11850 597882 596557 gene locus_tag LOCUS_11860 597882 596557 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_11860 598436 597897 gene locus_tag LOCUS_11870 598436 597897 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_11870 598593 599426 gene locus_tag LOCUS_11880 gene folP 598593 599426 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_11880 599462 600109 gene locus_tag LOCUS_11890 599462 600109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 600145 600930 gene locus_tag LOCUS_11900 gene cdaA 600145 600930 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_11900 600940 601785 gene locus_tag LOCUS_11910 600940 601785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 603503 601737 gene locus_tag LOCUS_11920 603503 601737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_11920 604247 603504 gene locus_tag LOCUS_11930 gene truA 604247 603504 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_11930 604323 604820 gene locus_tag LOCUS_11940 604323 604820 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_11940 605290 604880 gene locus_tag LOCUS_11950 605290 604880 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_11950 605490 607160 gene locus_tag LOCUS_11960 gene rho 605490 607160 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_11960 607264 608061 gene locus_tag LOCUS_11970 607264 608061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 608494 608243 gene locus_tag LOCUS_11980 gene rpsT 608494 608243 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_11980 608589 608517 gene locus_tag LOCUS_t00100 608589 608517 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 610217 608739 gene locus_tag LOCUS_11990 gene proS 610217 608739 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_11990 610684 611049 gene locus_tag LOCUS_12000 610684 611049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 611140 611499 gene locus_tag LOCUS_12010 611140 611499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 611420 612949 gene locus_tag LOCUS_12020 611420 612949 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_12020 613120 613797 gene locus_tag LOCUS_12030 gene folE 613120 613797 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_12030 613821 615302 gene locus_tag LOCUS_12040 gene cysS 613821 615302 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_12040 615398 615619 gene locus_tag LOCUS_12050 gene yidD 615398 615619 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962760.1 protein_id gnl|my_center|LOCUS_12050 615775 616743 gene locus_tag LOCUS_12060 615775 616743 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705115.1 protein_id gnl|my_center|LOCUS_12060 617011 617505 gene locus_tag LOCUS_12070 617011 617505 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788990.1 protein_id gnl|my_center|LOCUS_12070 617489 618130 gene locus_tag LOCUS_12080 617489 618130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 618185 618637 gene locus_tag LOCUS_12090 618185 618637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 620157 618697 gene locus_tag LOCUS_12100 620157 618697 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130286390.1 protein_id gnl|my_center|LOCUS_12100 620373 621296 gene locus_tag LOCUS_12110 620373 621296 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_12110 621333 622130 gene locus_tag LOCUS_12120 621333 622130 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_12120 622241 623473 gene locus_tag LOCUS_12130 622241 623473 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_12130 624341 623790 gene locus_tag LOCUS_12140 624341 623790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 624925 626769 gene locus_tag LOCUS_12150 624925 626769 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_12150 626926 627657 gene locus_tag LOCUS_12160 626926 627657 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_12160 628163 627672 gene locus_tag LOCUS_12170 628163 627672 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045629.1 protein_id gnl|my_center|LOCUS_12170 628358 629035 gene locus_tag LOCUS_12180 628358 629035 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_12180 629272 629072 gene locus_tag LOCUS_12190 629272 629072 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_12190 629721 629272 gene locus_tag LOCUS_12200 629721 629272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 630450 629842 gene locus_tag LOCUS_12210 630450 629842 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044977646.1 protein_id gnl|my_center|LOCUS_12210 632117 630552 gene locus_tag LOCUS_12220 632117 630552 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 protein_id gnl|my_center|LOCUS_12220 632580 632149 gene locus_tag LOCUS_12230 632580 632149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 633984 632743 gene locus_tag LOCUS_12240 633984 632743 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_12240 634503 634030 gene locus_tag LOCUS_12250 634503 634030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 634541 635110 gene locus_tag LOCUS_12260 634541 635110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_12260 636047 635112 gene locus_tag LOCUS_12270 636047 635112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 636272 637615 gene locus_tag LOCUS_12280 gene purB 636272 637615 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_12280 637617 637796 gene locus_tag LOCUS_12290 637617 637796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 638407 637862 gene locus_tag LOCUS_12300 638407 637862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 638937 638434 gene locus_tag LOCUS_12310 638937 638434 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_12310 639522 639046 gene locus_tag LOCUS_12320 639522 639046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 640018 639509 gene locus_tag LOCUS_12330 640018 639509 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_12330 640166 641632 gene locus_tag LOCUS_12340 640166 641632 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108185.1 protein_id gnl|my_center|LOCUS_12340 643628 641694 gene locus_tag LOCUS_12350 gene btuB 643628 641694 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228170.1 protein_id gnl|my_center|LOCUS_12350 644355 644741 gene locus_tag LOCUS_12360 644355 644741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 644841 646151 gene locus_tag LOCUS_12370 644841 646151 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_12370 646162 646698 gene locus_tag LOCUS_12380 646162 646698 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_12380 649591 646739 gene locus_tag LOCUS_12390 gene carB 649591 646739 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_12390 650158 650733 gene locus_tag LOCUS_12400 650158 650733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_12400 651670 650741 gene locus_tag LOCUS_12410 651670 650741 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_12410 652370 651705 gene locus_tag LOCUS_12420 652370 651705 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_12420 652487 652783 gene locus_tag LOCUS_12430 652487 652783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 654169 652838 gene locus_tag LOCUS_12440 gene mtaB 654169 652838 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_12440 654287 655843 gene locus_tag LOCUS_12450 654287 655843 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_12450 656399 655830 gene locus_tag LOCUS_12460 656399 655830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 657584 656667 gene locus_tag LOCUS_12470 657584 656667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 658798 657623 gene locus_tag LOCUS_12480 658798 657623 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_12480 659196 658945 gene locus_tag LOCUS_12490 659196 658945 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_12490 659355 659873 gene locus_tag LOCUS_12500 659355 659873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 659928 660875 gene locus_tag LOCUS_12510 659928 660875 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_12510 660928 662658 gene locus_tag LOCUS_12520 660928 662658 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_12520 662747 664573 gene locus_tag LOCUS_12530 662747 664573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_12530 664883 665425 gene locus_tag LOCUS_12540 664883 665425 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_12540 665459 665959 gene locus_tag LOCUS_12550 665459 665959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 665978 666418 gene locus_tag LOCUS_12560 665978 666418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 667425 666448 gene locus_tag LOCUS_12570 667425 666448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_12570 667598 668812 gene locus_tag LOCUS_12580 667598 668812 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_12580 668823 669929 gene locus_tag LOCUS_12590 668823 669929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 669994 670854 gene locus_tag LOCUS_12600 669994 670854 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644479.1 protein_id gnl|my_center|LOCUS_12600 670915 674631 gene locus_tag LOCUS_12610 gene purL 670915 674631 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962854.1 protein_id gnl|my_center|LOCUS_12610 677440 674711 gene locus_tag LOCUS_12620 gene ppdK 677440 674711 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_12620 677675 679447 gene locus_tag LOCUS_12630 677675 679447 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_12630 679592 679984 gene locus_tag LOCUS_12640 679592 679984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 680119 680559 gene locus_tag LOCUS_12650 680119 680559 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_12650 680580 682973 gene locus_tag LOCUS_12660 680580 682973 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_12660 682978 684168 gene locus_tag LOCUS_12670 682978 684168 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_12670 684185 685993 gene locus_tag LOCUS_12680 684185 685993 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_12680 686075 687406 gene locus_tag LOCUS_12690 686075 687406 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_12690 687410 689056 gene locus_tag LOCUS_12700 687410 689056 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_12700 689247 691712 gene locus_tag LOCUS_12710 689247 691712 CDS product Plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658068.1 protein_id gnl|my_center|LOCUS_12710 691760 692335 gene locus_tag LOCUS_12720 691760 692335 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_12720 693654 692386 gene locus_tag LOCUS_12730 693654 692386 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313130.1 protein_id gnl|my_center|LOCUS_12730 695762 693675 gene locus_tag LOCUS_12740 695762 693675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 697493 695991 gene locus_tag LOCUS_12750 697493 695991 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_12750 698589 697459 gene locus_tag LOCUS_12760 698589 697459 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_12760 699357 698680 gene locus_tag LOCUS_12770 699357 698680 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_12770 699493 701889 gene locus_tag LOCUS_12780 699493 701889 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_12780 701960 702145 gene locus_tag LOCUS_12790 gene ccoS 701960 702145 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 protein_id gnl|my_center|LOCUS_12790 702157 704343 gene locus_tag LOCUS_12800 gene ccoN 702157 704343 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_12800 704362 704553 gene locus_tag LOCUS_12810 704362 704553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 704550 705506 gene locus_tag LOCUS_12820 704550 705506 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_12820 705577 707001 gene locus_tag LOCUS_12830 gene ccoG 705577 707001 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_12830 707015 707461 gene locus_tag LOCUS_12840 707015 707461 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_12840 707463 708164 gene locus_tag LOCUS_12850 707463 708164 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_12850 708275 708688 gene locus_tag LOCUS_12860 708275 708688 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_12860 709610 708783 gene locus_tag LOCUS_12870 709610 708783 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_12870 711008 709644 gene locus_tag LOCUS_12880 gene hemN 711008 709644 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_12880 711141 711722 gene locus_tag LOCUS_12890 711141 711722 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963846.1 protein_id gnl|my_center|LOCUS_12890 711811 712341 gene locus_tag LOCUS_12900 711811 712341 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_12900 712343 713149 gene locus_tag LOCUS_12910 712343 713149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 713384 713965 gene locus_tag LOCUS_12920 713384 713965 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_12920 716302 714119 gene locus_tag LOCUS_12930 716302 714119 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_12930 717660 716368 gene locus_tag LOCUS_12940 717660 716368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 718291 717737 gene locus_tag LOCUS_12950 718291 717737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 718965 718312 gene locus_tag LOCUS_12960 718965 718312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 719112 720275 gene locus_tag LOCUS_12970 gene argE 719112 720275 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338096.1 protein_id gnl|my_center|LOCUS_12970 720333 721505 gene locus_tag LOCUS_12980 720333 721505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 721585 722577 gene locus_tag LOCUS_12990 gene lpxD 721585 722577 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963712.1 protein_id gnl|my_center|LOCUS_12990 722792 722592 gene locus_tag LOCUS_13000 722792 722592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 723146 722796 gene locus_tag LOCUS_13010 723146 722796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 723481 723146 gene locus_tag LOCUS_13020 723481 723146 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964581.1 protein_id gnl|my_center|LOCUS_13020 724166 723738 gene locus_tag LOCUS_13030 724166 723738 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_13030 724421 725233 gene locus_tag LOCUS_13040 724421 725233 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265531.1 protein_id gnl|my_center|LOCUS_13040 725416 726039 gene locus_tag LOCUS_13050 725416 726039 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_13050 726044 726808 gene locus_tag LOCUS_13060 726044 726808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 727624 726863 gene locus_tag LOCUS_13070 727624 726863 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_13070 727956 727615 gene locus_tag LOCUS_13080 727956 727615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 728280 727975 gene locus_tag LOCUS_13090 728280 727975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 729639 728293 gene locus_tag LOCUS_13100 729639 728293 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_13100 730286 729663 gene locus_tag LOCUS_13110 730286 729663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 protein_id gnl|my_center|LOCUS_13110 731232 730507 gene locus_tag LOCUS_13120 731232 730507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 733540 731387 gene locus_tag LOCUS_13130 733540 731387 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_13130 734064 734558 gene locus_tag LOCUS_13140 734064 734558 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_13140 734563 735198 gene locus_tag LOCUS_13150 734563 735198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_13150 735783 735187 gene locus_tag LOCUS_13160 735783 735187 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 protein_id gnl|my_center|LOCUS_13160 738061 735770 gene locus_tag LOCUS_13170 738061 735770 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_13170 738292 739362 gene locus_tag LOCUS_13180 738292 739362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 739875 739516 gene locus_tag LOCUS_13190 739875 739516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 740705 739908 gene locus_tag LOCUS_13200 740705 739908 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_13200 741397 740756 gene locus_tag LOCUS_13210 741397 740756 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_13210 741419 742108 gene locus_tag LOCUS_13220 741419 742108 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295798.1 protein_id gnl|my_center|LOCUS_13220 742710 742105 gene locus_tag LOCUS_13230 742710 742105 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_13230 743303 742824 gene locus_tag LOCUS_13240 743303 742824 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_13240 743409 744347 gene locus_tag LOCUS_13250 743409 744347 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_13250 744595 744398 gene locus_tag LOCUS_13260 744595 744398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_13260 745530 744730 gene locus_tag LOCUS_13270 745530 744730 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_13270 745997 745767 gene locus_tag LOCUS_13280 745997 745767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 746521 746129 gene locus_tag LOCUS_13290 746521 746129 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_13290 746729 747175 gene locus_tag LOCUS_13300 746729 747175 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 protein_id gnl|my_center|LOCUS_13300 747256 747600 gene locus_tag LOCUS_13310 747256 747600 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_13310 747593 749410 gene locus_tag LOCUS_13320 747593 749410 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_13320 749511 750236 gene locus_tag LOCUS_13330 749511 750236 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_13330 752089 750575 gene locus_tag LOCUS_13340 752089 750575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093039140.1 protein_id gnl|my_center|LOCUS_13340 753506 752082 gene locus_tag LOCUS_13350 753506 752082 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941221.1 protein_id gnl|my_center|LOCUS_13350 754355 753675 gene locus_tag LOCUS_13360 754355 753675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 754742 754512 gene locus_tag LOCUS_13370 754742 754512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 755232 754750 gene locus_tag LOCUS_13380 755232 754750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573601.1 protein_id gnl|my_center|LOCUS_13380 755690 755376 gene locus_tag LOCUS_13390 755690 755376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 756369 755695 gene locus_tag LOCUS_13400 756369 755695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 757909 756506 gene locus_tag LOCUS_13410 757909 756506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 758769 758422 gene locus_tag LOCUS_13420 758769 758422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 759197 758784 gene locus_tag LOCUS_13430 759197 758784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 759576 759214 gene locus_tag LOCUS_13440 759576 759214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 760661 759582 gene locus_tag LOCUS_13450 760661 759582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 760789 761211 gene locus_tag LOCUS_13460 760789 761211 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535380.1 protein_id gnl|my_center|LOCUS_13460 762627 761296 gene locus_tag LOCUS_13470 762627 761296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 762667 762873 gene locus_tag LOCUS_13480 762667 762873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 763926 762901 gene locus_tag LOCUS_13490 763926 762901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 764390 763929 gene locus_tag LOCUS_13500 764390 763929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 765165 764968 gene locus_tag LOCUS_13510 765165 764968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 765631 765182 gene locus_tag LOCUS_13520 765631 765182 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_13520 766076 765717 gene locus_tag LOCUS_13530 gene ssb 766076 765717 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_13530 766636 767166 gene locus_tag LOCUS_13540 766636 767166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_13540 767159 767848 gene locus_tag LOCUS_13550 767159 767848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 768198 768875 gene locus_tag LOCUS_13560 768198 768875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 768805 769008 gene locus_tag LOCUS_13570 768805 769008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 769282 769052 gene locus_tag LOCUS_13580 769282 769052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13580 769882 769349 gene locus_tag LOCUS_13590 769882 769349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13590 772728 770407 gene locus_tag LOCUS_13600 772728 770407 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107900.1 protein_id gnl|my_center|LOCUS_13600 775877 772734 gene locus_tag LOCUS_13610 775877 772734 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_13610 776900 775884 gene locus_tag LOCUS_13620 776900 775884 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_13620 <777786 776941 gene locus_tag LOCUS_13630 <777786 776941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202616.1:sugar-binding protein >Feature sequence03 121 732 gene locus_tag LOCUS_13640 121 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1508 1434 gene locus_tag LOCUS_t00110 1508 1434 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1990 1541 gene locus_tag LOCUS_13650 1990 1541 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_13650 4188 2137 gene locus_tag LOCUS_13660 gene ftsZ 4188 2137 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964152.1 protein_id gnl|my_center|LOCUS_13660 5485 4178 gene locus_tag LOCUS_13670 gene ftsA 5485 4178 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_13670 6181 5489 gene locus_tag LOCUS_13680 6181 5489 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_13680 7550 6198 gene locus_tag LOCUS_13690 gene murC 7550 6198 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_13690 8667 7552 gene locus_tag LOCUS_13700 gene murG 8667 7552 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_13700 9022 8669 gene locus_tag LOCUS_13710 9022 8669 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_13710 10248 9055 gene locus_tag LOCUS_13720 10248 9055 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_13720 11604 10273 gene locus_tag LOCUS_13730 gene murD 11604 10273 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_13730 12846 11605 gene locus_tag LOCUS_13740 gene mraY 12846 11605 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_13740 14310 12847 gene locus_tag LOCUS_13750 14310 12847 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_13750 16262 14307 gene locus_tag LOCUS_13760 16262 14307 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_13760 16643 16323 gene locus_tag LOCUS_13770 16643 16323 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_13770 17554 16646 gene locus_tag LOCUS_13780 gene rsmH 17554 16646 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_13780 17999 17529 gene locus_tag LOCUS_13790 gene mraZ 17999 17529 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_13790 18298 19059 gene locus_tag LOCUS_13800 18298 19059 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_13800 19075 19680 gene locus_tag LOCUS_13810 gene yihA 19075 19680 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_13810 19735 20631 gene locus_tag LOCUS_13820 19735 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 21772 20684 gene locus_tag LOCUS_13830 21772 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 23929 21782 gene locus_tag LOCUS_13840 23929 21782 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_13840 24128 24916 gene locus_tag LOCUS_13850 gene surE 24128 24916 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_13850 24917 25198 gene locus_tag LOCUS_13860 24917 25198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964420.1 protein_id gnl|my_center|LOCUS_13860 25211 26323 gene locus_tag LOCUS_13870 gene lpxB 25211 26323 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_13870 26379 26909 gene locus_tag LOCUS_13880 26379 26909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 27005 29071 gene locus_tag LOCUS_13890 27005 29071 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_13890 29489 29064 gene locus_tag LOCUS_13900 29489 29064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 31401 29623 gene locus_tag LOCUS_13910 31401 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 32814 31450 gene locus_tag LOCUS_13920 32814 31450 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_13920 33219 34541 gene locus_tag LOCUS_13930 33219 34541 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_13930 34538 35452 gene locus_tag LOCUS_13940 34538 35452 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_13940 37643 35514 gene locus_tag LOCUS_13950 37643 35514 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964518.1 protein_id gnl|my_center|LOCUS_13950 39106 37817 gene locus_tag LOCUS_13960 39106 37817 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_13960 39295 39107 gene locus_tag LOCUS_13970 39295 39107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 40004 39450 gene locus_tag LOCUS_13980 gene lptC 40004 39450 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_13980 41411 40005 gene locus_tag LOCUS_13990 41411 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 42717 41404 gene locus_tag LOCUS_14000 42717 41404 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_14000 43448 42714 gene locus_tag LOCUS_14010 43448 42714 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964522.1 protein_id gnl|my_center|LOCUS_14010 43632 43705 gene locus_tag LOCUS_t00120 43632 43705 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 44047 44619 gene locus_tag LOCUS_14020 44047 44619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 45444 44611 gene locus_tag LOCUS_14030 45444 44611 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_14030 47282 45441 gene locus_tag LOCUS_14040 47282 45441 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_14040 48856 47279 gene locus_tag LOCUS_14050 48856 47279 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555796.1 protein_id gnl|my_center|LOCUS_14050 51339 49018 gene locus_tag LOCUS_14060 gene bglX 51339 49018 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_14060 52148 51342 gene locus_tag LOCUS_14070 52148 51342 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203675.1 protein_id gnl|my_center|LOCUS_14070 53520 52159 gene locus_tag LOCUS_14080 53520 52159 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_14080 54895 53531 gene locus_tag LOCUS_14090 54895 53531 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_14090 57371 55032 gene locus_tag LOCUS_14100 57371 55032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 58951 57428 gene locus_tag LOCUS_14110 58951 57428 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769526.1 protein_id gnl|my_center|LOCUS_14110 61992 58963 gene locus_tag LOCUS_14120 61992 58963 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_14120 65014 62216 gene locus_tag LOCUS_14130 65014 62216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_14130 65234 65662 gene locus_tag LOCUS_14140 65234 65662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 65708 66097 gene locus_tag LOCUS_14150 65708 66097 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_14150 66158 67213 gene locus_tag LOCUS_14160 gene arsS 66158 67213 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_14160 67217 67708 gene locus_tag LOCUS_14170 67217 67708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 67710 68387 gene locus_tag LOCUS_14180 67710 68387 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_14180 68380 69192 gene locus_tag LOCUS_14190 68380 69192 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_14190 69259 70143 gene locus_tag LOCUS_14200 69259 70143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 70140 70844 gene locus_tag LOCUS_14210 70140 70844 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_14210 70837 71529 gene locus_tag LOCUS_14220 70837 71529 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045801381.1 protein_id gnl|my_center|LOCUS_14220 72260 71526 gene locus_tag LOCUS_14230 72260 71526 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_14230 73272 72358 gene locus_tag LOCUS_14240 73272 72358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_14240 73468 73899 gene locus_tag LOCUS_14250 73468 73899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403019.1 protein_id gnl|my_center|LOCUS_14250 74016 74708 gene locus_tag LOCUS_14260 74016 74708 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_14260 74705 76210 gene locus_tag LOCUS_14270 74705 76210 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_14270 77358 76207 gene locus_tag LOCUS_14280 77358 76207 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_14280 77523 78635 gene locus_tag LOCUS_14290 77523 78635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 78938 79996 gene locus_tag LOCUS_14300 78938 79996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 80296 80018 gene locus_tag LOCUS_14310 80296 80018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 80950 80537 gene locus_tag LOCUS_14320 80950 80537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 81190 80960 gene locus_tag LOCUS_14330 81190 80960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 81531 81202 gene locus_tag LOCUS_14340 81531 81202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963820.1 protein_id gnl|my_center|LOCUS_14340 82511 81534 gene locus_tag LOCUS_14350 82511 81534 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_14350 83424 82498 gene locus_tag LOCUS_14360 gene speB 83424 82498 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_14360 84814 83414 gene locus_tag LOCUS_14370 84814 83414 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_14370 86020 85148 gene locus_tag LOCUS_14380 86020 85148 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_14380 86954 86094 gene locus_tag LOCUS_14390 86954 86094 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_14390 87980 87051 gene locus_tag LOCUS_14400 87980 87051 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_14400 89087 88008 gene locus_tag LOCUS_14410 gene mvaD 89087 88008 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_14410 89627 89088 gene locus_tag LOCUS_14420 89627 89088 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_14420 90839 89628 gene locus_tag LOCUS_14430 90839 89628 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_14430 91513 90836 gene locus_tag LOCUS_14440 91513 90836 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_14440 92384 91518 gene locus_tag LOCUS_14450 gene tesB 92384 91518 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 protein_id gnl|my_center|LOCUS_14450 93883 92453 gene locus_tag LOCUS_14460 93883 92453 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_14460 96274 93887 gene locus_tag LOCUS_14470 96274 93887 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 protein_id gnl|my_center|LOCUS_14470 97250 96276 gene locus_tag LOCUS_14480 97250 96276 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925938.1 protein_id gnl|my_center|LOCUS_14480 99180 97252 gene locus_tag LOCUS_14490 99180 97252 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767002.1 protein_id gnl|my_center|LOCUS_14490 101505 99199 gene locus_tag LOCUS_14500 101505 99199 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_14500 102296 101601 gene locus_tag LOCUS_14510 gene pgmB 102296 101601 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_14510 103595 102300 gene locus_tag LOCUS_14520 103595 102300 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_14520 104865 103792 gene locus_tag LOCUS_14530 104865 103792 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_14530 105143 108052 gene locus_tag LOCUS_14540 105143 108052 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_14540 108064 109665 gene locus_tag LOCUS_14550 108064 109665 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_14550 109672 110808 gene locus_tag LOCUS_14560 109672 110808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 110827 112503 gene locus_tag LOCUS_14570 110827 112503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 112571 115333 gene locus_tag LOCUS_14580 112571 115333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 115506 115424 gene locus_tag LOCUS_t00130 115506 115424 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 115605 116993 gene locus_tag LOCUS_14590 115605 116993 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_14590 117141 118034 gene locus_tag LOCUS_14600 117141 118034 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023411.1 protein_id gnl|my_center|LOCUS_14600 118109 118474 gene locus_tag LOCUS_14610 118109 118474 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_14610 118477 119850 gene locus_tag LOCUS_14620 118477 119850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 119990 121090 gene locus_tag LOCUS_14630 119990 121090 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_14630 121455 121096 gene locus_tag LOCUS_14640 121455 121096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 121611 122045 gene locus_tag LOCUS_14650 121611 122045 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_14650 122055 123029 gene locus_tag LOCUS_14660 122055 123029 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_14660 124273 123026 gene locus_tag LOCUS_14670 124273 123026 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712480.1 protein_id gnl|my_center|LOCUS_14670 125285 124275 gene locus_tag LOCUS_14680 125285 124275 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_14680 126871 125285 gene locus_tag LOCUS_14690 126871 125285 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206391.1 protein_id gnl|my_center|LOCUS_14690 127894 126971 gene locus_tag LOCUS_14700 127894 126971 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_14700 128155 129006 gene locus_tag LOCUS_14710 128155 129006 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194105476.1 protein_id gnl|my_center|LOCUS_14710 129726 129148 gene locus_tag LOCUS_14720 129726 129148 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_14720 130598 129846 gene locus_tag LOCUS_14730 130598 129846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 131167 130805 gene locus_tag LOCUS_14740 131167 130805 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_14740 131565 131221 gene locus_tag LOCUS_14750 131565 131221 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_14750 132311 131562 gene locus_tag LOCUS_14760 132311 131562 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_14760 133336 132308 gene locus_tag LOCUS_14770 gene hemW 133336 132308 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_14770 134044 133490 gene locus_tag LOCUS_14780 gene ruvC 134044 133490 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_14780 134681 134037 gene locus_tag LOCUS_14790 134681 134037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 135079 134816 gene locus_tag LOCUS_14800 135079 134816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 135144 135695 gene locus_tag LOCUS_14810 135144 135695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 135692 136816 gene locus_tag LOCUS_14820 135692 136816 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_14820 136871 137731 gene locus_tag LOCUS_14830 136871 137731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 138177 137734 gene locus_tag LOCUS_14840 138177 137734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 139954 138323 gene locus_tag LOCUS_14850 139954 138323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 140316 139951 gene locus_tag LOCUS_14860 140316 139951 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_14860 141612 140338 gene locus_tag LOCUS_14870 141612 140338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 141912 142280 gene locus_tag LOCUS_14880 141912 142280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 143169 142492 gene locus_tag LOCUS_14890 gene nreC 143169 142492 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_14890 145198 143180 gene locus_tag LOCUS_14900 145198 143180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 145457 145305 gene locus_tag LOCUS_14910 145457 145305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 146804 145797 gene locus_tag LOCUS_14920 146804 145797 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_14920 151731 147082 gene locus_tag LOCUS_14930 151731 147082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 152342 152199 gene locus_tag LOCUS_14940 152342 152199 CDS product DUF5679 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_14940 154159 152546 gene locus_tag LOCUS_14950 154159 152546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 154762 155406 gene locus_tag LOCUS_14960 154762 155406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_14960 155635 157479 gene locus_tag LOCUS_14970 155635 157479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 157507 157911 gene locus_tag LOCUS_14980 157507 157911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 158148 158816 gene locus_tag LOCUS_14990 158148 158816 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_14990 158823 160490 gene locus_tag LOCUS_15000 158823 160490 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_15000 160494 161066 gene locus_tag LOCUS_15010 160494 161066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 161039 161048 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 161069 161965 gene locus_tag LOCUS_15020 161069 161965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 161962 163359 gene locus_tag LOCUS_15030 161962 163359 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_15030 165871 163475 gene locus_tag LOCUS_15040 165871 163475 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404785.1 protein_id gnl|my_center|LOCUS_15040 167339 165879 gene locus_tag LOCUS_15050 167339 165879 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404786.1 protein_id gnl|my_center|LOCUS_15050 167571 167317 gene locus_tag LOCUS_15060 167571 167317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 167891 167583 gene locus_tag LOCUS_15070 167891 167583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 167983 168906 gene locus_tag LOCUS_15080 167983 168906 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_15080 170483 169782 gene locus_tag LOCUS_15090 170483 169782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 171552 170602 gene locus_tag LOCUS_15100 171552 170602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 172061 171564 gene locus_tag LOCUS_15110 172061 171564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 173045 172218 gene locus_tag LOCUS_15120 173045 172218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 173629 173048 gene locus_tag LOCUS_15130 173629 173048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 176077 173651 gene locus_tag LOCUS_15140 176077 173651 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112378231.1 protein_id gnl|my_center|LOCUS_15140 176637 176350 gene locus_tag LOCUS_15150 176637 176350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 177092 177310 gene locus_tag LOCUS_15160 177092 177310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 177297 177632 gene locus_tag LOCUS_15170 177297 177632 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681615.1 protein_id gnl|my_center|LOCUS_15170 177622 178560 gene locus_tag LOCUS_15180 177622 178560 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681613.1 protein_id gnl|my_center|LOCUS_15180 179270 178608 gene locus_tag LOCUS_15190 179270 178608 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_15190 179524 179267 gene locus_tag LOCUS_15200 179524 179267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 180092 179814 gene locus_tag LOCUS_15210 180092 179814 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 protein_id gnl|my_center|LOCUS_15210 181161 180373 gene locus_tag LOCUS_15220 181161 180373 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_15220 182056 181811 gene locus_tag LOCUS_15230 182056 181811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 182764 184629 gene locus_tag LOCUS_15240 182764 184629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 184626 185291 gene locus_tag LOCUS_15250 184626 185291 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_15250 185977 186228 gene locus_tag LOCUS_15260 185977 186228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 188578 186299 gene locus_tag LOCUS_15270 188578 186299 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_15270 190058 188640 gene locus_tag LOCUS_15280 190058 188640 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_15280 193071 190069 gene locus_tag LOCUS_15290 193071 190069 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_15290 193421 193672 gene locus_tag LOCUS_15300 193421 193672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 193962 194195 gene locus_tag LOCUS_15310 193962 194195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 195175 194252 gene locus_tag LOCUS_15320 195175 194252 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_15320 196058 195627 gene locus_tag LOCUS_15330 196058 195627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 197236 196097 gene locus_tag LOCUS_15340 197236 196097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 200335 197237 gene locus_tag LOCUS_15350 200335 197237 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_15350 200641 200336 gene locus_tag LOCUS_15360 200641 200336 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962894.1 protein_id gnl|my_center|LOCUS_15360 201530 200934 gene locus_tag LOCUS_15370 201530 200934 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_15370 201979 201521 gene locus_tag LOCUS_15380 201979 201521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 203571 202198 gene locus_tag LOCUS_15390 203571 202198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 204671 203637 gene locus_tag LOCUS_15400 204671 203637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 205098 204634 gene locus_tag LOCUS_15410 205098 204634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 205951 205721 gene locus_tag LOCUS_15420 205951 205721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 206384 205935 gene locus_tag LOCUS_15430 206384 205935 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_15430 206799 206461 gene locus_tag LOCUS_15440 gene ssb 206799 206461 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_15440 208171 207335 gene locus_tag LOCUS_15450 208171 207335 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962948.1 protein_id gnl|my_center|LOCUS_15450 208836 209261 gene locus_tag LOCUS_15460 208836 209261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 209347 210333 gene locus_tag LOCUS_15470 209347 210333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 210311 212275 gene locus_tag LOCUS_15480 210311 212275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 212635 213594 gene locus_tag LOCUS_15490 212635 213594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 213614 213820 gene locus_tag LOCUS_15500 213614 213820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 214027 215112 gene locus_tag LOCUS_15510 214027 215112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 215112 216482 gene locus_tag LOCUS_15520 215112 216482 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_15520 216509 217888 gene locus_tag LOCUS_15530 216509 217888 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_15530 218017 220185 gene locus_tag LOCUS_15540 gene bglX 218017 220185 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_15540 220197 221726 gene locus_tag LOCUS_15550 220197 221726 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_15550 221752 222567 gene locus_tag LOCUS_15560 221752 222567 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038982.1 protein_id gnl|my_center|LOCUS_15560 223266 222994 gene locus_tag LOCUS_15570 223266 222994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 224014 223286 gene locus_tag LOCUS_15580 224014 223286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 224158 224030 gene locus_tag LOCUS_15590 224158 224030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 224789 224460 gene locus_tag LOCUS_15600 224789 224460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 226274 224955 gene locus_tag LOCUS_15610 226274 224955 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_15610 227829 226282 gene locus_tag LOCUS_15620 227829 226282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 229014 227833 gene locus_tag LOCUS_15630 229014 227833 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_15630 230189 229014 gene locus_tag LOCUS_15640 230189 229014 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_15640 232050 230212 gene locus_tag LOCUS_15650 232050 230212 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_15650 233239 232058 gene locus_tag LOCUS_15660 233239 232058 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_15660 233389 234267 gene locus_tag LOCUS_15670 233389 234267 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_15670 234564 237746 gene locus_tag LOCUS_15680 234564 237746 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_15680 237752 239350 gene locus_tag LOCUS_15690 237752 239350 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_15690 239361 240401 gene locus_tag LOCUS_15700 239361 240401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 240478 241683 gene locus_tag LOCUS_15710 240478 241683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 243983 242877 gene locus_tag LOCUS_15720 243983 242877 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_15720 244446 244372 gene locus_tag LOCUS_t00140 244446 244372 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 245460 244525 gene locus_tag LOCUS_15730 245460 244525 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_15730 247979 245451 gene locus_tag LOCUS_15740 247979 245451 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_15740 248648 248106 gene locus_tag LOCUS_15750 gene clpP 248648 248106 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_15750 249043 248726 gene locus_tag LOCUS_15760 gene trxA 249043 248726 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_15760 250136 249267 gene locus_tag LOCUS_15770 250136 249267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 254628 250240 gene locus_tag LOCUS_15780 gene dnaE 254628 250240 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_15780 254849 255949 gene locus_tag LOCUS_15790 254849 255949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 256080 256448 gene locus_tag LOCUS_15800 256080 256448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 256465 257322 gene locus_tag LOCUS_15810 256465 257322 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_15810 257338 257604 gene locus_tag LOCUS_15820 257338 257604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 257630 258613 gene locus_tag LOCUS_15830 257630 258613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 258610 259926 gene locus_tag LOCUS_15840 gene nrfD 258610 259926 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_15840 259923 260798 gene locus_tag LOCUS_15850 259923 260798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 260785 261183 gene locus_tag LOCUS_15860 260785 261183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 261413 262396 gene locus_tag LOCUS_15870 261413 262396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 262415 263752 gene locus_tag LOCUS_15880 gene nrfD 262415 263752 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_15880 263757 264638 gene locus_tag LOCUS_15890 263757 264638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 264669 265067 gene locus_tag LOCUS_15900 264669 265067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 266322 265126 gene locus_tag LOCUS_15910 gene nrfD 266322 265126 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_15910 267106 266327 gene locus_tag LOCUS_15920 267106 266327 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_15920 267540 267088 gene locus_tag LOCUS_15930 267540 267088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 267958 269175 gene locus_tag LOCUS_15940 gene hemA 267958 269175 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_15940 269312 270310 gene locus_tag LOCUS_15950 269312 270310 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_15950 270428 271000 gene locus_tag LOCUS_15960 270428 271000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 271205 271729 gene locus_tag LOCUS_15970 gene rimM 271205 271729 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_15970 272215 271793 gene locus_tag LOCUS_15980 272215 271793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 272440 273099 gene locus_tag LOCUS_15990 272440 273099 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_15990 274347 273100 gene locus_tag LOCUS_16000 274347 273100 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_16000 274250 274438 gene locus_tag LOCUS_16010 274250 274438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 274482 275570 gene locus_tag LOCUS_16020 274482 275570 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_16020 275702 276880 gene locus_tag LOCUS_16030 275702 276880 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_16030 276995 277723 gene locus_tag LOCUS_16040 276995 277723 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_16040 277796 278695 gene locus_tag LOCUS_16050 277796 278695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 279021 278692 gene locus_tag LOCUS_16060 279021 278692 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_16060 279560 279231 gene locus_tag LOCUS_16070 279560 279231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 280970 279567 gene locus_tag LOCUS_16080 280970 279567 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_16080 282505 281015 gene locus_tag LOCUS_16090 282505 281015 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_16090 284431 282512 gene locus_tag LOCUS_16100 gene nuoL 284431 282512 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_16100 284760 284443 gene locus_tag LOCUS_16110 gene nuoK 284760 284443 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_16110 285206 284757 gene locus_tag LOCUS_16120 285206 284757 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_16120 285762 285286 gene locus_tag LOCUS_16130 285762 285286 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_16130 286830 285766 gene locus_tag LOCUS_16140 gene nuoH 286830 285766 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_16140 287962 286841 gene locus_tag LOCUS_16150 287962 286841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16150 288426 287965 gene locus_tag LOCUS_16160 288426 287965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 288998 288438 gene locus_tag LOCUS_16170 288998 288438 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_16170 289339 288989 gene locus_tag LOCUS_16180 289339 288989 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_16180 290453 289440 gene locus_tag LOCUS_16190 290453 289440 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_16190 292312 290456 gene locus_tag LOCUS_16200 292312 290456 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_16200 292478 292828 gene locus_tag LOCUS_16210 292478 292828 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_16210 293125 296658 gene locus_tag LOCUS_16220 gene nifJ 293125 296658 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_16220 296790 297164 gene locus_tag LOCUS_16230 296790 297164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 297467 297228 gene locus_tag LOCUS_16240 297467 297228 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_16240 298607 297471 gene locus_tag LOCUS_16250 298607 297471 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963780.1 protein_id gnl|my_center|LOCUS_16250 298902 300218 gene locus_tag LOCUS_16260 298902 300218 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065247.1 protein_id gnl|my_center|LOCUS_16260 300400 301239 gene locus_tag LOCUS_16270 300400 301239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 301579 301250 gene locus_tag LOCUS_16280 301579 301250 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_16280 302212 301583 gene locus_tag LOCUS_16290 302212 301583 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_16290 302889 302215 gene locus_tag LOCUS_16300 gene trmB 302889 302215 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_16300 303204 304013 gene locus_tag LOCUS_16310 303204 304013 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_16310 305039 303996 gene locus_tag LOCUS_16320 305039 303996 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_16320 305719 305039 gene locus_tag LOCUS_16330 305719 305039 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_16330 305923 306264 gene locus_tag LOCUS_16340 305923 306264 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962299.1 protein_id gnl|my_center|LOCUS_16340 306372 308147 gene locus_tag LOCUS_16350 306372 308147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 308283 309263 gene locus_tag LOCUS_16360 308283 309263 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_16360 310687 309392 gene locus_tag LOCUS_16370 gene tyrS 310687 309392 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962338.1 protein_id gnl|my_center|LOCUS_16370 310775 311785 gene locus_tag LOCUS_16380 310775 311785 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_16380 312179 311745 gene locus_tag LOCUS_16390 312179 311745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 313630 312284 gene locus_tag LOCUS_16400 313630 312284 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_16400 314361 313639 gene locus_tag LOCUS_16410 314361 313639 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_16410 314527 315174 gene locus_tag LOCUS_16420 314527 315174 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_16420 315197 315946 gene locus_tag LOCUS_16430 315197 315946 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_16430 317623 316007 gene locus_tag LOCUS_16440 gene pckA 317623 316007 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813680.1 protein_id gnl|my_center|LOCUS_16440 318124 317690 gene locus_tag LOCUS_16450 318124 317690 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_16450 318162 319526 gene locus_tag LOCUS_16460 318162 319526 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_16460 319715 320185 gene locus_tag LOCUS_16470 319715 320185 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_16470 320230 320760 gene locus_tag LOCUS_16480 320230 320760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 322385 320844 gene locus_tag LOCUS_16490 322385 320844 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_16490 322493 323173 gene locus_tag LOCUS_16500 322493 323173 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_16500 323228 324835 gene locus_tag LOCUS_16510 323228 324835 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_16510 325598 324822 gene locus_tag LOCUS_16520 325598 324822 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_16520 326743 325601 gene locus_tag LOCUS_16530 326743 325601 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_16530 327636 326923 gene locus_tag LOCUS_16540 327636 326923 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_16540 328432 327737 gene locus_tag LOCUS_16550 328432 327737 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_16550 328589 328437 gene locus_tag LOCUS_16560 328589 328437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 331700 328683 gene locus_tag LOCUS_16570 331700 328683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 331930 332706 gene locus_tag LOCUS_16580 331930 332706 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930865.1 protein_id gnl|my_center|LOCUS_16580 332826 333674 gene locus_tag LOCUS_16590 332826 333674 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_16590 334591 333671 gene locus_tag LOCUS_16600 334591 333671 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259194.1 protein_id gnl|my_center|LOCUS_16600 334659 335537 gene locus_tag LOCUS_16610 334659 335537 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_16610 335629 335883 gene locus_tag LOCUS_16620 335629 335883 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_16620 335883 336695 gene locus_tag LOCUS_16630 335883 336695 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_16630 336695 337396 gene locus_tag LOCUS_16640 gene truB 336695 337396 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_16640 337445 338176 gene locus_tag LOCUS_16650 337445 338176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 338774 338154 gene locus_tag LOCUS_16660 338774 338154 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_16660 338868 339431 gene locus_tag LOCUS_16670 338868 339431 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_16670 339851 339447 gene locus_tag LOCUS_16680 339851 339447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 341122 339938 gene locus_tag LOCUS_16690 341122 339938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 341733 341119 gene locus_tag LOCUS_16700 341733 341119 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_16700 342366 341737 gene locus_tag LOCUS_16710 gene aat 342366 341737 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_16710 342827 342450 gene locus_tag LOCUS_16720 342827 342450 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_16720 343732 342863 gene locus_tag LOCUS_16730 343732 342863 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_16730 343853 345001 gene locus_tag LOCUS_16740 343853 345001 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_16740 345002 345352 gene locus_tag LOCUS_16750 345002 345352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185787975.1 protein_id gnl|my_center|LOCUS_16750 345736 345347 gene locus_tag LOCUS_16760 345736 345347 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_16760 346268 345795 gene locus_tag LOCUS_16770 gene greA 346268 345795 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_16770 346445 346849 gene locus_tag LOCUS_16780 346445 346849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_16780 349141 346898 gene locus_tag LOCUS_16790 349141 346898 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_16790 349752 349345 gene locus_tag LOCUS_16800 gene arfB 349752 349345 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_16800 351305 349755 gene locus_tag LOCUS_16810 351305 349755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16810 351871 351302 gene locus_tag LOCUS_16820 351871 351302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 352464 351832 gene locus_tag LOCUS_16830 gene pnuC 352464 351832 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_16830 352708 352448 gene locus_tag LOCUS_16840 352708 352448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 353504 352761 gene locus_tag LOCUS_16850 353504 352761 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_16850 354131 353505 gene locus_tag LOCUS_16860 354131 353505 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_16860 354196 355512 gene locus_tag LOCUS_16870 gene ahcY 354196 355512 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_16870 355767 356231 gene locus_tag LOCUS_16880 355767 356231 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690774.1 protein_id gnl|my_center|LOCUS_16880 356574 356314 gene locus_tag LOCUS_16890 gene rpmA 356574 356314 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964306.1 protein_id gnl|my_center|LOCUS_16890 357124 356600 gene locus_tag LOCUS_16900 357124 356600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 357673 357221 gene locus_tag LOCUS_16910 357673 357221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 358755 357877 gene locus_tag LOCUS_16920 358755 357877 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_16920 358850 359410 gene locus_tag LOCUS_16930 358850 359410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 360038 359457 gene locus_tag LOCUS_16940 gene gldD 360038 359457 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_16940 361306 360035 gene locus_tag LOCUS_16950 361306 360035 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_16950 361815 361366 gene locus_tag LOCUS_16960 gene ssb 361815 361366 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963776.1 protein_id gnl|my_center|LOCUS_16960 362949 361909 gene locus_tag LOCUS_16970 gene mutY 362949 361909 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_16970 363089 363379 gene locus_tag LOCUS_16980 363089 363379 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_16980 363774 365321 gene locus_tag LOCUS_16990 363774 365321 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_16990 366366 365467 gene locus_tag LOCUS_17000 366366 365467 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_17000 367568 366528 gene locus_tag LOCUS_17010 367568 366528 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_17010 368713 367754 gene locus_tag LOCUS_17020 368713 367754 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_17020 369509 368745 gene locus_tag LOCUS_17030 369509 368745 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_17030 369630 373040 gene locus_tag LOCUS_17040 369630 373040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_17040 373972 373037 gene locus_tag LOCUS_17050 373972 373037 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_17050 374802 374059 gene locus_tag LOCUS_17060 374802 374059 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_17060 376821 374809 gene locus_tag LOCUS_17070 376821 374809 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_17070 377412 376834 gene locus_tag LOCUS_17080 377412 376834 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_17080 379473 377656 gene locus_tag LOCUS_17090 379473 377656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 379543 380856 gene locus_tag LOCUS_17100 379543 380856 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_17100 382241 380919 gene locus_tag LOCUS_17110 382241 380919 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_17110 382347 383003 gene locus_tag LOCUS_17120 382347 383003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 383027 383806 gene locus_tag LOCUS_17130 383027 383806 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_17130 383865 384131 gene locus_tag LOCUS_17140 383865 384131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 384212 384463 gene locus_tag LOCUS_17150 384212 384463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 385506 384460 gene locus_tag LOCUS_17160 gene thiL 385506 384460 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_17160 385834 386163 gene locus_tag LOCUS_17170 385834 386163 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_17170 386190 387638 gene locus_tag LOCUS_17180 gene sufB 386190 387638 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_17180 387653 388066 gene locus_tag LOCUS_17190 387653 388066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 388071 388823 gene locus_tag LOCUS_17200 gene sufC 388071 388823 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_17200 388834 390147 gene locus_tag LOCUS_17210 gene sufD 388834 390147 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_17210 390235 391449 gene locus_tag LOCUS_17220 390235 391449 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_17220 391620 392696 gene locus_tag LOCUS_17230 391620 392696 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963731.1 protein_id gnl|my_center|LOCUS_17230 392786 393202 gene locus_tag LOCUS_17240 392786 393202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 393235 393663 gene locus_tag LOCUS_17250 393235 393663 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_17250 393733 394059 gene locus_tag LOCUS_17260 393733 394059 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_17260 394075 394584 gene locus_tag LOCUS_17270 394075 394584 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_17270 394605 395534 gene locus_tag LOCUS_17280 394605 395534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 396800 395586 gene locus_tag LOCUS_17290 gene hflX 396800 395586 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_17290 396875 397849 gene locus_tag LOCUS_17300 396875 397849 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_17300 399343 397901 gene locus_tag LOCUS_17310 399343 397901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 402092 399324 gene locus_tag LOCUS_17320 402092 399324 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_17320 402230 403282 gene locus_tag LOCUS_17330 402230 403282 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_17330 403772 403332 gene locus_tag LOCUS_17340 403772 403332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_17340 405525 403885 gene locus_tag LOCUS_17350 405525 403885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 408023 405537 gene locus_tag LOCUS_17360 408023 405537 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_17360 409883 408264 gene locus_tag LOCUS_17370 gene pgi 409883 408264 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962324.1 protein_id gnl|my_center|LOCUS_17370 411178 409883 gene locus_tag LOCUS_17380 411178 409883 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_17380 412077 411160 gene locus_tag LOCUS_17390 412077 411160 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_17390 412827 412084 gene locus_tag LOCUS_17400 412827 412084 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_17400 414179 413019 gene locus_tag LOCUS_17410 gene hppD 414179 413019 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_17410 414583 414224 gene locus_tag LOCUS_17420 414583 414224 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_17420 415780 414623 gene locus_tag LOCUS_17430 415780 414623 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_17430 417008 415962 gene locus_tag LOCUS_17440 417008 415962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 419426 417192 gene locus_tag LOCUS_17450 419426 417192 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_17450 421216 419423 gene locus_tag LOCUS_17460 gene uvrC 421216 419423 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_17460 421304 421759 gene locus_tag LOCUS_17470 421304 421759 CDS product RimK/LysX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459284.1 protein_id gnl|my_center|LOCUS_17470 421759 422631 gene locus_tag LOCUS_17480 gene rimK 421759 422631 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459235.1 protein_id gnl|my_center|LOCUS_17480 422641 423615 gene locus_tag LOCUS_17490 422641 423615 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_17490 423621 424184 gene locus_tag LOCUS_17500 423621 424184 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_17500 424813 424187 gene locus_tag LOCUS_17510 424813 424187 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_17510 425303 424923 gene locus_tag LOCUS_17520 425303 424923 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_17520 428927 425310 gene locus_tag LOCUS_17530 gene ileS 428927 425310 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_17530 433532 429045 gene locus_tag LOCUS_17540 433532 429045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 438414 433867 gene locus_tag LOCUS_17550 438414 433867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 440227 438869 gene locus_tag LOCUS_17560 gene radA 440227 438869 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_17560 441409 440258 gene locus_tag LOCUS_17570 441409 440258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 442405 441497 gene locus_tag LOCUS_17580 442405 441497 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_17580 442820 442470 gene locus_tag LOCUS_17590 442820 442470 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_17590 443682 442834 gene locus_tag LOCUS_17600 gene panC 443682 442834 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962287.1 protein_id gnl|my_center|LOCUS_17600 443880 444689 gene locus_tag LOCUS_17610 443880 444689 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_17610 444714 446399 gene locus_tag LOCUS_17620 444714 446399 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_17620 446562 448409 gene locus_tag LOCUS_17630 gene glmS 446562 448409 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_17630 448650 451406 gene locus_tag LOCUS_17640 448650 451406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_17640 451417 453030 gene locus_tag LOCUS_17650 451417 453030 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_17650 453196 454704 gene locus_tag LOCUS_17660 gene atpD 453196 454704 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_17660 454759 455052 gene locus_tag LOCUS_17670 gene atpC 454759 455052 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_17670 456205 455123 gene locus_tag LOCUS_17680 456205 455123 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_17680 457550 456222 gene locus_tag LOCUS_17690 457550 456222 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_17690 459396 457759 gene locus_tag LOCUS_17700 459396 457759 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766147.1 protein_id gnl|my_center|LOCUS_17700 462570 459451 gene locus_tag LOCUS_17710 462570 459451 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_17710 463953 462814 gene locus_tag LOCUS_17720 463953 462814 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_17720 465426 463996 gene locus_tag LOCUS_17730 465426 463996 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794945.1 protein_id gnl|my_center|LOCUS_17730 466786 465581 gene locus_tag LOCUS_17740 466786 465581 CDS product PNGase F N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813194.1 protein_id gnl|my_center|LOCUS_17740 468946 466790 gene locus_tag LOCUS_17750 468946 466790 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_17750 471368 469035 gene locus_tag LOCUS_17760 471368 469035 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796237.1 protein_id gnl|my_center|LOCUS_17760 472643 471369 gene locus_tag LOCUS_17770 472643 471369 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_17770 475021 472700 gene locus_tag LOCUS_17780 475021 472700 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_17780 477005 475068 gene locus_tag LOCUS_17790 477005 475068 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785386.1 protein_id gnl|my_center|LOCUS_17790 478118 477102 gene locus_tag LOCUS_17800 478118 477102 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_17800 480372 478129 gene locus_tag LOCUS_17810 480372 478129 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_17810 481486 480383 gene locus_tag LOCUS_17820 481486 480383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 482567 481494 gene locus_tag LOCUS_17830 482567 481494 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_17830 483539 482574 gene locus_tag LOCUS_17840 483539 482574 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107586.1 protein_id gnl|my_center|LOCUS_17840 483975 483697 gene locus_tag LOCUS_17850 483975 483697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 483711 483720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 485056 483983 gene locus_tag LOCUS_17860 485056 483983 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_17860 485099 485273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 488178 486412 gene locus_tag LOCUS_17870 488178 486412 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_17870 486462 486471 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <488859 488182 gene locus_tag LOCUS_17880 <488859 488182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109053.1:GH92 family glycosyl hydrolase >Feature sequence04 368 2302 gene locus_tag LOCUS_17890 gene thrS 368 2302 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963051.1 protein_id gnl|my_center|LOCUS_17890 2425 2880 gene locus_tag LOCUS_17900 2425 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2947 3144 gene locus_tag LOCUS_17910 gene rpmI 2947 3144 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_17910 3238 3582 gene locus_tag LOCUS_17920 gene rplT 3238 3582 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_17920 3728 4543 gene locus_tag LOCUS_17930 3728 4543 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263941.1 protein_id gnl|my_center|LOCUS_17930 5052 4567 gene locus_tag LOCUS_17940 5052 4567 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_17940 5093 5524 gene locus_tag LOCUS_17950 5093 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5572 6042 gene locus_tag LOCUS_17960 5572 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 7232 6048 gene locus_tag LOCUS_17970 7232 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_17970 8930 7386 gene locus_tag LOCUS_17980 gene dnaB 8930 7386 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_17980 10053 9100 gene locus_tag LOCUS_17990 10053 9100 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_17990 11026 10130 gene locus_tag LOCUS_18000 11026 10130 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_18000 12035 11013 gene locus_tag LOCUS_18010 12035 11013 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_18010 13228 12092 gene locus_tag LOCUS_18020 gene tgt 13228 12092 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_18020 13398 14243 gene locus_tag LOCUS_18030 13398 14243 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_18030 14264 15217 gene locus_tag LOCUS_18040 14264 15217 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_18040 15243 15863 gene locus_tag LOCUS_18050 15243 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 16933 15932 gene locus_tag LOCUS_18060 16933 15932 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_18060 17015 17386 gene locus_tag LOCUS_18070 17015 17386 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_18070 17506 18009 gene locus_tag LOCUS_18080 17506 18009 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_18080 18522 18001 gene locus_tag LOCUS_18090 18522 18001 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963564.1 protein_id gnl|my_center|LOCUS_18090 18649 18722 gene locus_tag LOCUS_t00150 18649 18722 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18776 18861 gene locus_tag LOCUS_t00160 18776 18861 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18939 19853 gene locus_tag LOCUS_18100 18939 19853 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_18100 19896 21356 gene locus_tag LOCUS_18110 gene crtI 19896 21356 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_18110 21449 22288 gene locus_tag LOCUS_18120 21449 22288 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_18120 22346 22753 gene locus_tag LOCUS_18130 22346 22753 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_18130 22763 23914 gene locus_tag LOCUS_18140 22763 23914 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_18140 24466 23903 gene locus_tag LOCUS_18150 24466 23903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 25003 24575 gene locus_tag LOCUS_18160 25003 24575 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_18160 25648 25058 gene locus_tag LOCUS_18170 gene def 25648 25058 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_18170 26128 25718 gene locus_tag LOCUS_18180 gene ruvX 26128 25718 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_18180 26589 26221 gene locus_tag LOCUS_18190 26589 26221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 26843 27658 gene locus_tag LOCUS_18200 26843 27658 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_18200 27701 28822 gene locus_tag LOCUS_18210 27701 28822 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392042.1 protein_id gnl|my_center|LOCUS_18210 29638 28823 gene locus_tag LOCUS_18220 29638 28823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 29776 30534 gene locus_tag LOCUS_18230 29776 30534 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_18230 31294 30536 gene locus_tag LOCUS_18240 31294 30536 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_18240 31391 31963 gene locus_tag LOCUS_18250 31391 31963 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_18250 32039 33463 gene locus_tag LOCUS_18260 32039 33463 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_18260 33463 33909 gene locus_tag LOCUS_18270 33463 33909 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_18270 33914 34930 gene locus_tag LOCUS_18280 33914 34930 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_18280 34968 35480 gene locus_tag LOCUS_18290 34968 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_18290 36545 35484 gene locus_tag LOCUS_18300 36545 35484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 36668 37564 gene locus_tag LOCUS_18310 36668 37564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_18310 37566 38396 gene locus_tag LOCUS_18320 37566 38396 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_18320 38424 41135 gene locus_tag LOCUS_18330 38424 41135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 41325 46124 gene locus_tag LOCUS_18340 41325 46124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 46180 48501 gene locus_tag LOCUS_18350 46180 48501 CDS product choice-of-anchor L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_18350 48653 53788 gene locus_tag LOCUS_18360 48653 53788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 53816 55819 gene locus_tag LOCUS_18370 gene uvrB 53816 55819 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_18370 56287 55877 gene locus_tag LOCUS_18380 56287 55877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963055.1 protein_id gnl|my_center|LOCUS_18380 56648 57487 gene locus_tag LOCUS_18390 56648 57487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 57491 57826 gene locus_tag LOCUS_18400 57491 57826 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_18400 59069 57879 gene locus_tag LOCUS_18410 gene sucC 59069 57879 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_18410 59275 60510 gene locus_tag LOCUS_18420 gene lysA 59275 60510 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_18420 60811 61542 gene locus_tag LOCUS_18430 60811 61542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 61731 63650 gene locus_tag LOCUS_18440 61731 63650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 63651 64391 gene locus_tag LOCUS_18450 63651 64391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 64574 65074 gene locus_tag LOCUS_18460 64574 65074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 65097 66035 gene locus_tag LOCUS_18470 65097 66035 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_18470 66067 67392 gene locus_tag LOCUS_18480 gene ampG 66067 67392 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367956.1 protein_id gnl|my_center|LOCUS_18480 67433 68248 gene locus_tag LOCUS_18490 67433 68248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 68286 69146 gene locus_tag LOCUS_18500 68286 69146 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182306545.1 protein_id gnl|my_center|LOCUS_18500 69198 69665 gene locus_tag LOCUS_18510 69198 69665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 69697 70575 gene locus_tag LOCUS_18520 69697 70575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 70582 71388 gene locus_tag LOCUS_18530 70582 71388 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003105.1 protein_id gnl|my_center|LOCUS_18530 71473 72594 gene locus_tag LOCUS_18540 71473 72594 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 protein_id gnl|my_center|LOCUS_18540 72611 73657 gene locus_tag LOCUS_18550 72611 73657 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549454.1 protein_id gnl|my_center|LOCUS_18550 73696 74739 gene locus_tag LOCUS_18560 73696 74739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 74762 75799 gene locus_tag LOCUS_18570 74762 75799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 75802 77217 gene locus_tag LOCUS_18580 75802 77217 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002146066.1 protein_id gnl|my_center|LOCUS_18580 77233 78678 gene locus_tag LOCUS_18590 77233 78678 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839812.1 protein_id gnl|my_center|LOCUS_18590 78687 79868 gene locus_tag LOCUS_18600 78687 79868 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104094.1 protein_id gnl|my_center|LOCUS_18600 79884 80633 gene locus_tag LOCUS_18610 79884 80633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 80626 81354 gene locus_tag LOCUS_18620 80626 81354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 81359 82123 gene locus_tag LOCUS_18630 81359 82123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 82889 82143 gene locus_tag LOCUS_18640 82889 82143 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880557.1 protein_id gnl|my_center|LOCUS_18640 83539 83006 gene locus_tag LOCUS_18650 83539 83006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 84975 83593 gene locus_tag LOCUS_18660 84975 83593 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_18660 85920 85042 gene locus_tag LOCUS_18670 85920 85042 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_18670 86042 86800 gene locus_tag LOCUS_18680 86042 86800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 87964 86801 gene locus_tag LOCUS_18690 87964 86801 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_18690 88860 87970 gene locus_tag LOCUS_18700 88860 87970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 90178 88865 gene locus_tag LOCUS_18710 90178 88865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_18710 91107 90181 gene locus_tag LOCUS_18720 91107 90181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_18720 92542 91424 gene locus_tag LOCUS_18730 gene dnaJ 92542 91424 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962830.1 protein_id gnl|my_center|LOCUS_18730 93106 92552 gene locus_tag LOCUS_18740 93106 92552 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962831.1 protein_id gnl|my_center|LOCUS_18740 94847 93342 gene locus_tag LOCUS_18750 94847 93342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 95443 94859 gene locus_tag LOCUS_18760 95443 94859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 95978 95427 gene locus_tag LOCUS_18770 gene sigW 95978 95427 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_18770 96160 96729 gene locus_tag LOCUS_18780 96160 96729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 96751 97833 gene locus_tag LOCUS_18790 gene meaB 96751 97833 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503589.1 protein_id gnl|my_center|LOCUS_18790 97873 98613 gene locus_tag LOCUS_18800 97873 98613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 98650 100077 gene locus_tag LOCUS_18810 98650 100077 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_18810 100164 100838 gene locus_tag LOCUS_18820 100164 100838 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_18820 100847 102151 gene locus_tag LOCUS_18830 100847 102151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 102156 103067 gene locus_tag LOCUS_18840 102156 103067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 103067 106075 gene locus_tag LOCUS_18850 103067 106075 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_18850 106078 107331 gene locus_tag LOCUS_18860 106078 107331 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_18860 107412 107870 gene locus_tag LOCUS_18870 107412 107870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 108089 110065 gene locus_tag LOCUS_18880 108089 110065 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_18880 110068 110949 gene locus_tag LOCUS_18890 110068 110949 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_18890 111509 110946 gene locus_tag LOCUS_18900 111509 110946 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_18900 111736 111506 gene locus_tag LOCUS_18910 111736 111506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_18910 113127 111751 gene locus_tag LOCUS_18920 113127 111751 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_18920 113510 114406 gene locus_tag LOCUS_18930 113510 114406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 115356 114415 gene locus_tag LOCUS_18940 115356 114415 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_18940 116985 115357 gene locus_tag LOCUS_18950 116985 115357 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_18950 118198 117011 gene locus_tag LOCUS_18960 gene mnmA 118198 117011 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_18960 118379 119788 gene locus_tag LOCUS_18970 118379 119788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 120610 119912 gene locus_tag LOCUS_18980 120610 119912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_18980 122574 120676 gene locus_tag LOCUS_18990 gene yidC 122574 120676 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964004.1 protein_id gnl|my_center|LOCUS_18990 124342 122702 gene locus_tag LOCUS_19000 124342 122702 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_19000 124548 124907 gene locus_tag LOCUS_19010 124548 124907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 125201 124968 gene locus_tag LOCUS_19020 125201 124968 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_19020 127162 125207 gene locus_tag LOCUS_19030 127162 125207 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_19030 128904 127369 gene locus_tag LOCUS_19040 gene guaA 128904 127369 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963998.1 protein_id gnl|my_center|LOCUS_19040 130350 128965 gene locus_tag LOCUS_19050 130350 128965 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 protein_id gnl|my_center|LOCUS_19050 130544 132361 gene locus_tag LOCUS_19060 130544 132361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 132586 134826 gene locus_tag LOCUS_19070 132586 134826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 136482 134884 gene locus_tag LOCUS_19080 gene bshC 136482 134884 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_19080 136770 138059 gene locus_tag LOCUS_19090 136770 138059 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_19090 138279 138644 gene locus_tag LOCUS_19100 138279 138644 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_19100 138815 139945 gene locus_tag LOCUS_19110 138815 139945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 139974 140513 gene locus_tag LOCUS_19120 139974 140513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 141909 140605 gene locus_tag LOCUS_19130 gene rimO 141909 140605 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_19130 141977 143071 gene locus_tag LOCUS_19140 141977 143071 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_19140 144064 143111 gene locus_tag LOCUS_19150 gene ftsY 144064 143111 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_19150 144461 144309 gene locus_tag LOCUS_19160 144461 144309 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_19160 144681 144499 gene locus_tag LOCUS_19170 gene rpmG 144681 144499 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_19170 144943 144707 gene locus_tag LOCUS_19180 gene rpmB 144943 144707 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_19180 146276 145026 gene locus_tag LOCUS_19190 146276 145026 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_19190 146617 146276 gene locus_tag LOCUS_19200 146617 146276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 147229 146618 gene locus_tag LOCUS_19210 147229 146618 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_19210 148008 147232 gene locus_tag LOCUS_19220 148008 147232 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_19220 149370 148042 gene locus_tag LOCUS_19230 149370 148042 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_19230 150563 149457 gene locus_tag LOCUS_19240 150563 149457 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_19240 151194 150577 gene locus_tag LOCUS_19250 gene recR 151194 150577 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963432.1 protein_id gnl|my_center|LOCUS_19250 151650 151288 gene locus_tag LOCUS_19260 151650 151288 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_19260 151770 154253 gene locus_tag LOCUS_19270 151770 154253 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_19270 155757 154753 gene locus_tag LOCUS_19280 155757 154753 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_19280 155939 157849 gene locus_tag LOCUS_19290 gene htpG 155939 157849 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_19290 158098 160248 gene locus_tag LOCUS_19300 158098 160248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 160365 161279 gene locus_tag LOCUS_19310 160365 161279 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_19310 161391 162629 gene locus_tag LOCUS_19320 161391 162629 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_19320 163088 162660 gene locus_tag LOCUS_19330 163088 162660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 163659 163078 gene locus_tag LOCUS_19340 163659 163078 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_19340 163800 164147 gene locus_tag LOCUS_19350 163800 164147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 164831 164199 gene locus_tag LOCUS_19360 164831 164199 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 protein_id gnl|my_center|LOCUS_19360 164945 165535 gene locus_tag LOCUS_19370 164945 165535 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_19370 165958 166851 gene locus_tag LOCUS_19380 165958 166851 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_19380 167099 167794 gene locus_tag LOCUS_19390 167099 167794 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_19390 167904 170207 gene locus_tag LOCUS_19400 167904 170207 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_19400 170349 170275 gene locus_tag LOCUS_t00170 170349 170275 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 170680 170411 gene locus_tag LOCUS_19410 170680 170411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_19410 171209 170799 gene locus_tag LOCUS_19420 171209 170799 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_19420 171732 171193 gene locus_tag LOCUS_19430 gene idi 171732 171193 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_19430 171858 173444 gene locus_tag LOCUS_19440 171858 173444 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_19440 173573 173806 gene locus_tag LOCUS_19450 173573 173806 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_19450 174265 173948 gene locus_tag LOCUS_19460 174265 173948 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_19460 178617 174316 gene locus_tag LOCUS_19470 gene rpoC 178617 174316 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963311.1 protein_id gnl|my_center|LOCUS_19470 182495 178683 gene locus_tag LOCUS_19480 gene rpoB 182495 178683 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_19480 182995 182618 gene locus_tag LOCUS_19490 gene rplL 182995 182618 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963313.1 protein_id gnl|my_center|LOCUS_19490 183584 183063 gene locus_tag LOCUS_19500 gene rplJ 183584 183063 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963314.1 protein_id gnl|my_center|LOCUS_19500 184293 183604 gene locus_tag LOCUS_19510 gene rplA 184293 183604 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963315.1 protein_id gnl|my_center|LOCUS_19510 184751 184314 gene locus_tag LOCUS_19520 gene rplK 184751 184314 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_19520 185382 184828 gene locus_tag LOCUS_19530 gene nusG 185382 184828 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963317.1 protein_id gnl|my_center|LOCUS_19530 185595 185401 gene locus_tag LOCUS_19540 gene secE 185595 185401 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963318.1 protein_id gnl|my_center|LOCUS_19540 185782 185709 gene locus_tag LOCUS_t00180 185782 185709 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 187032 185845 gene locus_tag LOCUS_19550 gene tuf 187032 185845 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963319.1 protein_id gnl|my_center|LOCUS_19550 187165 187093 gene locus_tag LOCUS_t00190 187165 187093 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 187356 187283 gene locus_tag LOCUS_t00200 187356 187283 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 187469 187387 gene locus_tag LOCUS_t00210 187469 187387 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 187577 187503 gene locus_tag LOCUS_t00220 187577 187503 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 187992 187690 gene locus_tag LOCUS_19560 gene raiA 187992 187690 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_19560 188919 188029 gene locus_tag LOCUS_19570 188919 188029 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_19570 188904 189062 gene locus_tag LOCUS_19580 188904 189062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 189226 189032 gene locus_tag LOCUS_19590 gene rpsU 189226 189032 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_19590 190488 189322 gene locus_tag LOCUS_19600 190488 189322 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_19600 191224 190502 gene locus_tag LOCUS_19610 191224 190502 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_19610 191522 191379 gene locus_tag LOCUS_19620 191522 191379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 193189 191519 gene locus_tag LOCUS_19630 193189 191519 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_19630 195004 193340 gene locus_tag LOCUS_19640 195004 193340 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_19640 196151 195132 gene locus_tag LOCUS_19650 196151 195132 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_19650 196375 196148 gene locus_tag LOCUS_19660 196375 196148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_19660 197661 196384 gene locus_tag LOCUS_19670 197661 196384 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_19670 197754 198281 gene locus_tag LOCUS_19680 gene hemG 197754 198281 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073509.1 protein_id gnl|my_center|LOCUS_19680 198287 198682 gene locus_tag LOCUS_19690 198287 198682 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_19690 198849 199742 gene locus_tag LOCUS_19700 198849 199742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 199786 200268 gene locus_tag LOCUS_19710 199786 200268 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_19710 201542 200307 gene locus_tag LOCUS_19720 201542 200307 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_19720 201543 202760 gene locus_tag LOCUS_19730 201543 202760 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_19730 203610 202762 gene locus_tag LOCUS_19740 203610 202762 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_19740 204146 203655 gene locus_tag LOCUS_19750 204146 203655 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_19750 204217 204912 gene locus_tag LOCUS_19760 204217 204912 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_19760 206714 204993 gene locus_tag LOCUS_19770 206714 204993 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_19770 209778 206758 gene locus_tag LOCUS_19780 209778 206758 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_19780 210096 211421 gene locus_tag LOCUS_19790 210096 211421 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958472.1 protein_id gnl|my_center|LOCUS_19790 211436 212119 gene locus_tag LOCUS_19800 211436 212119 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_19800 212935 213273 gene locus_tag LOCUS_19810 212935 213273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 213344 214096 gene locus_tag LOCUS_19820 213344 214096 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_19820 214097 215035 gene locus_tag LOCUS_19830 214097 215035 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963967.1 protein_id gnl|my_center|LOCUS_19830 215434 215018 gene locus_tag LOCUS_19840 215434 215018 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_19840 216282 215437 gene locus_tag LOCUS_19850 216282 215437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 216396 217535 gene locus_tag LOCUS_19860 216396 217535 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_19860 217548 218033 gene locus_tag LOCUS_19870 217548 218033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 218785 218054 gene locus_tag LOCUS_19880 218785 218054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 220247 218799 gene locus_tag LOCUS_19890 220247 218799 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203395.1 protein_id gnl|my_center|LOCUS_19890 221389 220286 gene locus_tag LOCUS_19900 221389 220286 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_19900 222366 221386 gene locus_tag LOCUS_19910 222366 221386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_19910 223686 222382 gene locus_tag LOCUS_19920 223686 222382 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_19920 225879 224080 gene locus_tag LOCUS_19930 gene typA 225879 224080 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_19930 226398 227216 gene locus_tag LOCUS_19940 gene kdsA 226398 227216 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962665.1 protein_id gnl|my_center|LOCUS_19940 227227 228087 gene locus_tag LOCUS_19950 227227 228087 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_19950 228867 228088 gene locus_tag LOCUS_19960 228867 228088 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_19960 230114 228909 gene locus_tag LOCUS_19970 230114 228909 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_19970 230320 230712 gene locus_tag LOCUS_tm00010 230320 230712 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 231082 230801 gene locus_tag LOCUS_19980 231082 230801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 232628 231123 gene locus_tag LOCUS_19990 232628 231123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 233136 232927 gene locus_tag LOCUS_20000 233136 232927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 233652 236723 gene locus_tag LOCUS_20010 gene ccsA 233652 236723 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_20010 237584 236796 gene locus_tag LOCUS_20020 237584 236796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_20020 239209 237581 gene locus_tag LOCUS_20030 239209 237581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 242696 240849 gene locus_tag LOCUS_20040 242696 240849 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842747.1 protein_id gnl|my_center|LOCUS_20040 244042 242702 gene locus_tag LOCUS_20050 244042 242702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 244863 244042 gene locus_tag LOCUS_20060 244863 244042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 245728 245240 gene locus_tag LOCUS_20070 245728 245240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 246164 245880 gene locus_tag LOCUS_20080 246164 245880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 246856 246446 gene locus_tag LOCUS_20090 246856 246446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 247174 246866 gene locus_tag LOCUS_20100 247174 246866 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_20100 247873 247259 gene locus_tag LOCUS_20110 247873 247259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 248425 247877 gene locus_tag LOCUS_20120 248425 247877 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948056.1 protein_id gnl|my_center|LOCUS_20120 248683 250086 gene locus_tag LOCUS_20130 248683 250086 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_20130 250094 250660 gene locus_tag LOCUS_20140 250094 250660 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_20140 250664 251656 gene locus_tag LOCUS_20150 gene trpD 250664 251656 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_20150 251653 252438 gene locus_tag LOCUS_20160 gene trpC 251653 252438 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_20160 252435 253130 gene locus_tag LOCUS_20170 252435 253130 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962673.1 protein_id gnl|my_center|LOCUS_20170 253127 254308 gene locus_tag LOCUS_20180 gene trpB 253127 254308 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_20180 254319 255092 gene locus_tag LOCUS_20190 gene trpA 254319 255092 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_20190 255231 255374 gene locus_tag LOCUS_20200 255231 255374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 255519 256799 gene locus_tag LOCUS_20210 255519 256799 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_20210 256953 257573 gene locus_tag LOCUS_20220 256953 257573 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_20220 257563 258888 gene locus_tag LOCUS_20230 257563 258888 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_20230 258902 259984 gene locus_tag LOCUS_20240 258902 259984 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_20240 259988 261565 gene locus_tag LOCUS_20250 259988 261565 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_20250 261697 262428 gene locus_tag LOCUS_20260 261697 262428 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_20260 262604 264127 gene locus_tag LOCUS_20270 262604 264127 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_20270 264189 264530 gene locus_tag LOCUS_20280 264189 264530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 264628 265083 gene locus_tag LOCUS_20290 gene trmL 264628 265083 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_20290 265723 265088 gene locus_tag LOCUS_20300 265723 265088 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943590.1 protein_id gnl|my_center|LOCUS_20300 267564 265780 gene locus_tag LOCUS_20310 gene argS 267564 265780 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963616.1 protein_id gnl|my_center|LOCUS_20310 268015 270069 gene locus_tag LOCUS_20320 268015 270069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 271009 270071 gene locus_tag LOCUS_20330 271009 270071 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_20330 272046 271132 gene locus_tag LOCUS_20340 272046 271132 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_20340 273395 272109 gene locus_tag LOCUS_20350 273395 272109 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_20350 274863 273571 gene locus_tag LOCUS_20360 gene eno 274863 273571 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963441.1 protein_id gnl|my_center|LOCUS_20360 276121 275018 gene locus_tag LOCUS_20370 gene carA 276121 275018 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_20370 276688 276206 gene locus_tag LOCUS_20380 gene rplQ 276688 276206 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_20380 277740 276748 gene locus_tag LOCUS_20390 277740 276748 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_20390 278444 277839 gene locus_tag LOCUS_20400 gene rpsD 278444 277839 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_20400 278972 278589 gene locus_tag LOCUS_20410 gene rpsK 278972 278589 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_20410 279355 278981 gene locus_tag LOCUS_20420 gene rpsM 279355 278981 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_20420 279695 279513 gene locus_tag LOCUS_20430 279695 279513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 281053 279707 gene locus_tag LOCUS_20440 gene secY 281053 279707 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963450.1 protein_id gnl|my_center|LOCUS_20440 281519 281067 gene locus_tag LOCUS_20450 gene rplO 281519 281067 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963451.1 protein_id gnl|my_center|LOCUS_20450 281716 281534 gene locus_tag LOCUS_20460 gene rpmD 281716 281534 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963452.1 protein_id gnl|my_center|LOCUS_20460 282252 281728 gene locus_tag LOCUS_20470 gene rpsE 282252 281728 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_20470 282615 282259 gene locus_tag LOCUS_20480 gene rplR 282615 282259 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_20480 283168 282626 gene locus_tag LOCUS_20490 gene rplF 283168 282626 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_20490 283578 283180 gene locus_tag LOCUS_20500 gene rpsH 283578 283180 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_20500 283916 283647 gene locus_tag LOCUS_20510 gene rpsN 283916 283647 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_20510 284471 283920 gene locus_tag LOCUS_20520 gene rplE 284471 283920 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_20520 284797 284474 gene locus_tag LOCUS_20530 gene rplX 284797 284474 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963459.1 protein_id gnl|my_center|LOCUS_20530 285165 284797 gene locus_tag LOCUS_20540 gene rplN 285165 284797 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_20540 285425 285168 gene locus_tag LOCUS_20550 gene rpsQ 285425 285168 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_20550 285631 285440 gene locus_tag LOCUS_20560 gene rpmC 285631 285440 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963462.1 protein_id gnl|my_center|LOCUS_20560 286064 285645 gene locus_tag LOCUS_20570 gene rplP 286064 285645 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963463.1 protein_id gnl|my_center|LOCUS_20570 286811 286086 gene locus_tag LOCUS_20580 gene rpsC 286811 286086 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_20580 287228 286821 gene locus_tag LOCUS_20590 gene rplV 287228 286821 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_20590 287513 287235 gene locus_tag LOCUS_20600 gene rpsS 287513 287235 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007136562.1 protein_id gnl|my_center|LOCUS_20600 288341 287517 gene locus_tag LOCUS_20610 gene rplB 288341 287517 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_20610 288642 288352 gene locus_tag LOCUS_20620 gene rplW 288642 288352 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_20620 289279 288650 gene locus_tag LOCUS_20630 gene rplD 289279 288650 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_20630 289896 289279 gene locus_tag LOCUS_20640 gene rplC 289896 289279 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_20640 290343 290038 gene locus_tag LOCUS_20650 gene rpsJ 290343 290038 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_20650 292482 290356 gene locus_tag LOCUS_20660 gene fusA 292482 290356 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_20660 292965 292489 gene locus_tag LOCUS_20670 gene rpsG 292965 292489 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_20670 293362 292988 gene locus_tag LOCUS_20680 gene rpsL 293362 292988 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_20680 293755 295365 gene locus_tag LOCUS_20690 293755 295365 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_20690 295447 298731 gene locus_tag LOCUS_20700 295447 298731 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_20700 298743 300227 gene locus_tag LOCUS_20710 298743 300227 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_20710 300267 301109 gene locus_tag LOCUS_20720 300267 301109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 301425 304697 gene locus_tag LOCUS_20730 301425 304697 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_20730 304709 306148 gene locus_tag LOCUS_20740 304709 306148 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_20740 306215 306949 gene locus_tag LOCUS_20750 gene rlmB 306215 306949 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_20750 307738 307007 gene locus_tag LOCUS_20760 307738 307007 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_20760 307956 309233 gene locus_tag LOCUS_20770 307956 309233 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_20770 310095 309241 gene locus_tag LOCUS_20780 310095 309241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963480.1 protein_id gnl|my_center|LOCUS_20780 311497 310085 gene locus_tag LOCUS_20790 311497 310085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 312063 311506 gene locus_tag LOCUS_20800 312063 311506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 312789 312100 gene locus_tag LOCUS_20810 312789 312100 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_20810 314080 312782 gene locus_tag LOCUS_20820 314080 312782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 314778 314080 gene locus_tag LOCUS_20830 gene radC 314778 314080 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_20830 314887 315438 gene locus_tag LOCUS_20840 314887 315438 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807705.1 protein_id gnl|my_center|LOCUS_20840 315667 315440 gene locus_tag LOCUS_20850 315667 315440 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_20850 316939 315680 gene locus_tag LOCUS_20860 316939 315680 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073558.1 protein_id gnl|my_center|LOCUS_20860 317104 318546 gene locus_tag LOCUS_20870 317104 318546 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_20870 319194 318577 gene locus_tag LOCUS_20880 319194 318577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 319219 319428 gene locus_tag LOCUS_20890 319219 319428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 320172 319450 gene locus_tag LOCUS_20900 320172 319450 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558841.1 protein_id gnl|my_center|LOCUS_20900 320973 320215 gene locus_tag LOCUS_20910 gene yaaA 320973 320215 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962877.1 protein_id gnl|my_center|LOCUS_20910 321651 320998 gene locus_tag LOCUS_20920 321651 320998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 321888 322742 gene locus_tag LOCUS_20930 321888 322742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 323825 322779 gene locus_tag LOCUS_20940 323825 322779 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_20940 324385 323828 gene locus_tag LOCUS_20950 324385 323828 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_20950 324601 325584 gene locus_tag LOCUS_20960 324601 325584 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962814.1 protein_id gnl|my_center|LOCUS_20960 325594 326049 gene locus_tag LOCUS_20970 gene coaD 325594 326049 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_20970 327947 326325 gene locus_tag LOCUS_20980 327947 326325 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_20980 328677 328096 gene locus_tag LOCUS_20990 328677 328096 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_20990 328808 329452 gene locus_tag LOCUS_21000 gene pyrE 328808 329452 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_21000 329466 329861 gene locus_tag LOCUS_21010 329466 329861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_21010 330589 329858 gene locus_tag LOCUS_21020 330589 329858 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_21020 330688 331059 gene locus_tag LOCUS_21030 gene rsfS 330688 331059 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_21030 331066 333006 gene locus_tag LOCUS_21040 gene ftsH 331066 333006 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_21040 333123 333731 gene locus_tag LOCUS_21050 333123 333731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_21050 333824 334645 gene locus_tag LOCUS_21060 333824 334645 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_21060 334635 335291 gene locus_tag LOCUS_21070 334635 335291 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_21070 335284 335550 gene locus_tag LOCUS_21080 335284 335550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 338211 335581 gene locus_tag LOCUS_21090 338211 335581 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963808.1 protein_id gnl|my_center|LOCUS_21090 338367 338822 gene locus_tag LOCUS_21100 338367 338822 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_21100 340216 338879 gene locus_tag LOCUS_21110 340216 338879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 340345 341535 gene locus_tag LOCUS_21120 340345 341535 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_21120 341535 342548 gene locus_tag LOCUS_21130 gene murB 341535 342548 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_21130 342617 343162 gene locus_tag LOCUS_21140 342617 343162 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_21140 343159 343947 gene locus_tag LOCUS_21150 343159 343947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 344714 344028 gene locus_tag LOCUS_21160 gene aqpZ 344714 344028 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298299.1 protein_id gnl|my_center|LOCUS_21160 344867 345070 gene locus_tag LOCUS_21170 344867 345070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 345077 346189 gene locus_tag LOCUS_21180 345077 346189 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_21180 346180 346725 gene locus_tag LOCUS_21190 346180 346725 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_21190 346727 347623 gene locus_tag LOCUS_21200 346727 347623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 347613 348827 gene locus_tag LOCUS_21210 347613 348827 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 protein_id gnl|my_center|LOCUS_21210 348876 349754 gene locus_tag LOCUS_21220 gene lipA 348876 349754 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_21220 349757 350773 gene locus_tag LOCUS_21230 gene gap 349757 350773 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_21230 350856 353030 gene locus_tag LOCUS_21240 350856 353030 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_21240 353970 353020 gene locus_tag LOCUS_21250 gene lpxK 353970 353020 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963591.1 protein_id gnl|my_center|LOCUS_21250 354170 355264 gene locus_tag LOCUS_21260 354170 355264 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963351.1 protein_id gnl|my_center|LOCUS_21260 355268 356047 gene locus_tag LOCUS_21270 355268 356047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_21270 356177 356827 gene locus_tag LOCUS_21280 gene msrA 356177 356827 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013187310.1 protein_id gnl|my_center|LOCUS_21280 356890 357558 gene locus_tag LOCUS_21290 356890 357558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 358110 357691 gene locus_tag LOCUS_21300 358110 357691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 358226 359497 gene locus_tag LOCUS_21310 gene kynU 358226 359497 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964305.1 protein_id gnl|my_center|LOCUS_21310 359490 360902 gene locus_tag LOCUS_21320 359490 360902 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964302.1 protein_id gnl|my_center|LOCUS_21320 361090 361560 gene locus_tag LOCUS_21330 361090 361560 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_21330 361570 361989 gene locus_tag LOCUS_21340 361570 361989 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681082.1 protein_id gnl|my_center|LOCUS_21340 361990 363432 gene locus_tag LOCUS_21350 gene hpaE 361990 363432 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 protein_id gnl|my_center|LOCUS_21350 363487 364269 gene locus_tag LOCUS_21360 363487 364269 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_21360 364344 364916 gene locus_tag LOCUS_21370 364344 364916 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_21370 364922 366004 gene locus_tag LOCUS_21380 364922 366004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 366004 366648 gene locus_tag LOCUS_21390 366004 366648 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_21390 366863 366645 gene locus_tag LOCUS_21400 366863 366645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 369316 367010 gene locus_tag LOCUS_21410 369316 367010 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_21410 369885 369427 gene locus_tag LOCUS_21420 369885 369427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_21420 370773 370000 gene locus_tag LOCUS_21430 370773 370000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 371522 370773 gene locus_tag LOCUS_21440 371522 370773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 371674 372381 gene locus_tag LOCUS_21450 gene pepE 371674 372381 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_21450 372485 372412 gene locus_tag LOCUS_t00230 372485 372412 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 373072 372683 gene locus_tag LOCUS_21460 373072 372683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 373323 374840 gene locus_tag LOCUS_21470 gene gpmI 373323 374840 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_21470 374886 375299 gene locus_tag LOCUS_21480 374886 375299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_21480 376570 375305 gene locus_tag LOCUS_21490 376570 375305 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962593.1 protein_id gnl|my_center|LOCUS_21490 376693 377511 gene locus_tag LOCUS_21500 gene map 376693 377511 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_21500 377518 377829 gene locus_tag LOCUS_21510 377518 377829 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_21510 377927 378694 gene locus_tag LOCUS_21520 377927 378694 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_21520 379768 378788 gene locus_tag LOCUS_21530 379768 378788 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_21530 380153 379776 gene locus_tag LOCUS_21540 380153 379776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 380232 381284 gene locus_tag LOCUS_21550 380232 381284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 381277 381990 gene locus_tag LOCUS_21560 381277 381990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 382155 382616 gene locus_tag LOCUS_21570 382155 382616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 384005 382689 gene locus_tag LOCUS_21580 gene nqrF 384005 382689 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_21580 384813 383998 gene locus_tag LOCUS_21590 384813 383998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 385482 384835 gene locus_tag LOCUS_21600 385482 384835 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763479.1 protein_id gnl|my_center|LOCUS_21600 386238 385486 gene locus_tag LOCUS_21610 386238 385486 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_21610 387446 386238 gene locus_tag LOCUS_21620 387446 386238 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_21620 388835 387480 gene locus_tag LOCUS_21630 388835 387480 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_21630 389023 390240 gene locus_tag LOCUS_21640 389023 390240 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_21640 390324 390710 gene locus_tag LOCUS_21650 gene apaG 390324 390710 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_21650 391705 390707 gene locus_tag LOCUS_21660 391705 390707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 392423 391698 gene locus_tag LOCUS_21670 392423 391698 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_21670 392583 394211 gene locus_tag LOCUS_21680 gene pruA 392583 394211 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_21680 394361 395647 gene locus_tag LOCUS_21690 394361 395647 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_21690 395747 396697 gene locus_tag LOCUS_21700 395747 396697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 397342 396713 gene locus_tag LOCUS_21710 gene rsmG 397342 396713 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_21710 397486 398586 gene locus_tag LOCUS_21720 397486 398586 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_21720 398609 399793 gene locus_tag LOCUS_21730 398609 399793 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_21730 400113 399844 gene locus_tag LOCUS_21740 400113 399844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 400384 400118 gene locus_tag LOCUS_21750 400384 400118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 400947 400765 gene locus_tag LOCUS_21760 400947 400765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 401449 400973 gene locus_tag LOCUS_21770 401449 400973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 402168 401506 gene locus_tag LOCUS_21780 402168 401506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 402556 402248 gene locus_tag LOCUS_21790 402556 402248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 402733 402581 gene locus_tag LOCUS_21800 402733 402581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 403124 402762 gene locus_tag LOCUS_21810 403124 402762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 405094 403310 gene locus_tag LOCUS_21820 405094 403310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 405540 405094 gene locus_tag LOCUS_21830 405540 405094 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_21830 406122 405556 gene locus_tag LOCUS_21840 406122 405556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 406564 406358 gene locus_tag LOCUS_21850 406564 406358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 406761 407489 gene locus_tag LOCUS_21860 gene ubiE 406761 407489 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_21860 407491 408219 gene locus_tag LOCUS_21870 407491 408219 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_21870 408941 408222 gene locus_tag LOCUS_21880 408941 408222 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_21880 409277 411751 gene locus_tag LOCUS_21890 409277 411751 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_21890 411884 412951 gene locus_tag LOCUS_21900 gene fbaA 411884 412951 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_21900 413129 413986 gene locus_tag LOCUS_21910 gene accD 413129 413986 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_21910 414114 414383 gene locus_tag LOCUS_21920 gene rpsO 414114 414383 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_21920 414541 416805 gene locus_tag LOCUS_21930 414541 416805 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964146.1 protein_id gnl|my_center|LOCUS_21930 419154 416890 gene locus_tag LOCUS_21940 419154 416890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 419391 419765 gene locus_tag LOCUS_21950 419391 419765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 419847 420710 gene locus_tag LOCUS_21960 419847 420710 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_21960 421033 421437 gene locus_tag LOCUS_21970 421033 421437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 421491 422153 gene locus_tag LOCUS_21980 gene rpe 421491 422153 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_21980 422444 422653 gene locus_tag LOCUS_21990 422444 422653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 423523 422672 gene locus_tag LOCUS_22000 423523 422672 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_22000 425469 423973 gene locus_tag LOCUS_22010 425469 423973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 425851 425486 gene locus_tag LOCUS_22020 425851 425486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 426852 426004 gene locus_tag LOCUS_22030 426852 426004 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767365.1 protein_id gnl|my_center|LOCUS_22030 428221 426887 gene locus_tag LOCUS_22040 428221 426887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 430082 428253 gene locus_tag LOCUS_22050 430082 428253 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831876.1 protein_id gnl|my_center|LOCUS_22050 431692 430100 gene locus_tag LOCUS_22060 431692 430100 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992183.1 protein_id gnl|my_center|LOCUS_22060 434919 431704 gene locus_tag LOCUS_22070 434919 431704 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_22070 437368 434933 gene locus_tag LOCUS_22080 437368 434933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 438639 437395 gene locus_tag LOCUS_22090 438639 437395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 439939 438644 gene locus_tag LOCUS_22100 439939 438644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 443937 440113 gene locus_tag LOCUS_22110 443937 440113 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107956.1 protein_id gnl|my_center|LOCUS_22110 445499 444012 gene locus_tag LOCUS_22120 445499 444012 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_22120 447144 445513 gene locus_tag LOCUS_22130 447144 445513 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038682.1 protein_id gnl|my_center|LOCUS_22130 448180 447167 gene locus_tag LOCUS_22140 448180 447167 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_22140 448451 450025 gene locus_tag LOCUS_22150 448451 450025 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158257889.1 protein_id gnl|my_center|LOCUS_22150 450479 451750 gene locus_tag LOCUS_22160 450479 451750 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119323.1 protein_id gnl|my_center|LOCUS_22160 452484 451834 gene locus_tag LOCUS_22170 452484 451834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 453172 452561 gene locus_tag LOCUS_22180 453172 452561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 453948 453289 gene locus_tag LOCUS_22190 453948 453289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 454554 453964 gene locus_tag LOCUS_22200 454554 453964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 455106 454576 gene locus_tag LOCUS_22210 455106 454576 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_22210 456077 455118 gene locus_tag LOCUS_22220 gene nrfD 456077 455118 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074173.1 protein_id gnl|my_center|LOCUS_22220 456624 456091 gene locus_tag LOCUS_22230 456624 456091 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_22230 458864 456621 gene locus_tag LOCUS_22240 458864 456621 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_22240 459048 460937 gene locus_tag LOCUS_22250 gene extM 459048 460937 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_22250 461844 460939 gene locus_tag LOCUS_22260 gene moaA 461844 460939 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_22260 462858 461947 gene locus_tag LOCUS_22270 gene moaCB 462858 461947 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_22270 463305 462862 gene locus_tag LOCUS_22280 463305 462862 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_22280 464392 463298 gene locus_tag LOCUS_22290 gene moeB 464392 463298 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_22290 464640 464395 gene locus_tag LOCUS_22300 464640 464395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 465196 464612 gene locus_tag LOCUS_22310 465196 464612 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_22310 465939 465199 gene locus_tag LOCUS_22320 465939 465199 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_22320 466280 465942 gene locus_tag LOCUS_22330 466280 465942 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546328.1 protein_id gnl|my_center|LOCUS_22330 467467 466292 gene locus_tag LOCUS_22340 467467 466292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 467890 468420 gene locus_tag LOCUS_22350 467890 468420 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence05 268 762 gene locus_tag LOCUS_22360 268 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 953 1447 gene locus_tag LOCUS_22370 953 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1747 2121 gene locus_tag LOCUS_22380 1747 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2118 2717 gene locus_tag LOCUS_22390 2118 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 3182 3667 gene locus_tag LOCUS_22400 3182 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3671 4000 gene locus_tag LOCUS_22410 3671 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 4252 4509 gene locus_tag LOCUS_22420 4252 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 5269 6267 gene locus_tag LOCUS_22430 5269 6267 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_22430 7421 6609 gene locus_tag LOCUS_22440 7421 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 8073 7702 gene locus_tag LOCUS_22450 8073 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 8924 8085 gene locus_tag LOCUS_22460 8924 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 9415 8924 gene locus_tag LOCUS_22470 9415 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 10745 9408 gene locus_tag LOCUS_22480 10745 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 12182 10746 gene locus_tag LOCUS_22490 12182 10746 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_22490 14555 12183 gene locus_tag LOCUS_22500 14555 12183 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_22500 15355 14816 gene locus_tag LOCUS_22510 15355 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 16101 15358 gene locus_tag LOCUS_22520 16101 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 17188 16274 gene locus_tag LOCUS_22530 17188 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 17569 17844 gene locus_tag LOCUS_22540 17569 17844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 18225 18061 gene locus_tag LOCUS_22550 18225 18061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 18161 21004 gene locus_tag LOCUS_22560 18161 21004 CDS product triple tyrosine motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091372500.1 protein_id gnl|my_center|LOCUS_22560 21265 24468 gene locus_tag LOCUS_22570 21265 24468 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202338.1 protein_id gnl|my_center|LOCUS_22570 24480 26003 gene locus_tag LOCUS_22580 24480 26003 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_22580 26148 26945 gene locus_tag LOCUS_22590 26148 26945 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_22590 26974 28785 gene locus_tag LOCUS_22600 gene uidA 26974 28785 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966715.1 protein_id gnl|my_center|LOCUS_22600 28778 29605 gene locus_tag LOCUS_22610 28778 29605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 29605 30411 gene locus_tag LOCUS_22620 29605 30411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 30477 31241 gene locus_tag LOCUS_22630 30477 31241 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_22630 31251 33569 gene locus_tag LOCUS_22640 gene bglX 31251 33569 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_22640 33577 35361 gene locus_tag LOCUS_22650 33577 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 35385 36101 gene locus_tag LOCUS_22660 35385 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 36098 37510 gene locus_tag LOCUS_22670 36098 37510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 37522 39090 gene locus_tag LOCUS_22680 37522 39090 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_22680 39132 40625 gene locus_tag LOCUS_22690 gene glpK 39132 40625 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_22690 40647 41375 gene locus_tag LOCUS_22700 40647 41375 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_22700 41408 42364 gene locus_tag LOCUS_22710 41408 42364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 42430 43257 gene locus_tag LOCUS_22720 42430 43257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_22720 43277 44455 gene locus_tag LOCUS_22730 gene uxuA 43277 44455 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_22730 45351 45091 gene locus_tag LOCUS_22740 45351 45091 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_22740 46192 45362 gene locus_tag LOCUS_22750 gene hypB 46192 45362 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_22750 46552 46211 gene locus_tag LOCUS_22760 gene hypA 46552 46211 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_22760 46721 47848 gene locus_tag LOCUS_22770 46721 47848 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_22770 47860 49590 gene locus_tag LOCUS_22780 47860 49590 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012502532.1 protein_id gnl|my_center|LOCUS_22780 49926 50357 gene locus_tag LOCUS_22790 49926 50357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 50439 50990 gene locus_tag LOCUS_22800 50439 50990 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173947.1 protein_id gnl|my_center|LOCUS_22800 51006 53270 gene locus_tag LOCUS_22810 gene hypF 51006 53270 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582504.1 protein_id gnl|my_center|LOCUS_22810 53271 54368 gene locus_tag LOCUS_22820 gene hypD 53271 54368 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_22820 54368 55393 gene locus_tag LOCUS_22830 gene hypE 54368 55393 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545205.1 protein_id gnl|my_center|LOCUS_22830 56094 55390 gene locus_tag LOCUS_22840 56094 55390 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_22840 56386 56460 gene locus_tag LOCUS_t00240 56386 56460 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57409 56522 gene locus_tag LOCUS_22850 57409 56522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 57929 57474 gene locus_tag LOCUS_22860 57929 57474 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525374.1 protein_id gnl|my_center|LOCUS_22860 58202 59446 gene locus_tag LOCUS_22870 58202 59446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 59443 60498 gene locus_tag LOCUS_22880 59443 60498 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_22880 60600 61439 gene locus_tag LOCUS_22890 60600 61439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 61599 62042 gene locus_tag LOCUS_22900 61599 62042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 63227 62031 gene locus_tag LOCUS_22910 63227 62031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_22910 64323 63235 gene locus_tag LOCUS_22920 64323 63235 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_22920 64846 64346 gene locus_tag LOCUS_22930 64846 64346 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_22930 65523 64879 gene locus_tag LOCUS_22940 65523 64879 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_22940 66232 65525 gene locus_tag LOCUS_22950 66232 65525 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_22950 67256 66234 gene locus_tag LOCUS_22960 gene tsaD 67256 66234 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_22960 67440 71816 gene locus_tag LOCUS_22970 67440 71816 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_22970 71970 72956 gene locus_tag LOCUS_22980 gene pfkA 71970 72956 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_22980 72975 73976 gene locus_tag LOCUS_22990 gene gap 72975 73976 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963725.1 protein_id gnl|my_center|LOCUS_22990 74047 74928 gene locus_tag LOCUS_23000 74047 74928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_23000 76003 74999 gene locus_tag LOCUS_23010 76003 74999 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_23010 77106 76066 gene locus_tag LOCUS_23020 77106 76066 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095585.1 protein_id gnl|my_center|LOCUS_23020 77340 79262 gene locus_tag LOCUS_23030 77340 79262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 79643 79263 gene locus_tag LOCUS_23040 79643 79263 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_23040 82352 79674 gene locus_tag LOCUS_23050 82352 79674 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_23050 82548 83663 gene locus_tag LOCUS_23060 82548 83663 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_23060 83730 84683 gene locus_tag LOCUS_23070 83730 84683 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_23070 84695 85996 gene locus_tag LOCUS_23080 84695 85996 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_23080 86007 86798 gene locus_tag LOCUS_23090 86007 86798 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_23090 86818 87414 gene locus_tag LOCUS_23100 86818 87414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 87414 87899 gene locus_tag LOCUS_23110 87414 87899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_23110 87988 89211 gene locus_tag LOCUS_23120 gene serB 87988 89211 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010528670.1 protein_id gnl|my_center|LOCUS_23120 91517 89223 gene locus_tag LOCUS_23130 91517 89223 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_23130 92456 91521 gene locus_tag LOCUS_23140 92456 91521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 93022 92510 gene locus_tag LOCUS_23150 93022 92510 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992764.1 protein_id gnl|my_center|LOCUS_23150 93710 93994 gene locus_tag LOCUS_23160 93710 93994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 93991 94974 gene locus_tag LOCUS_23170 93991 94974 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_23170 94976 95182 gene locus_tag LOCUS_23180 94976 95182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 95230 96714 gene locus_tag LOCUS_23190 95230 96714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 96833 99757 gene locus_tag LOCUS_23200 96833 99757 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_23200 99773 100909 gene locus_tag LOCUS_23210 gene bshA 99773 100909 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_23210 100958 101302 gene locus_tag LOCUS_23220 100958 101302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 101846 101367 gene locus_tag LOCUS_23230 101846 101367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 102153 103217 gene locus_tag LOCUS_23240 gene aroC 102153 103217 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962924.1 protein_id gnl|my_center|LOCUS_23240 103367 104773 gene locus_tag LOCUS_23250 103367 104773 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_23250 104776 105606 gene locus_tag LOCUS_23260 104776 105606 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477173.1 protein_id gnl|my_center|LOCUS_23260 106025 105609 gene locus_tag LOCUS_23270 106025 105609 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_23270 108187 106022 gene locus_tag LOCUS_23280 108187 106022 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963184.1 protein_id gnl|my_center|LOCUS_23280 108748 108272 gene locus_tag LOCUS_23290 108748 108272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_23290 111218 108807 gene locus_tag LOCUS_23300 111218 108807 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_23300 114001 111395 gene locus_tag LOCUS_23310 114001 111395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_23310 115033 114344 gene locus_tag LOCUS_23320 115033 114344 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_23320 117887 115056 gene locus_tag LOCUS_23330 gene uvrA 117887 115056 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_23330 118381 118013 gene locus_tag LOCUS_23340 118381 118013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 118741 119265 gene locus_tag LOCUS_23350 118741 119265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 119988 119272 gene locus_tag LOCUS_23360 119988 119272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 121665 120076 gene locus_tag LOCUS_23370 gene ggt 121665 120076 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_23370 122381 121776 gene locus_tag LOCUS_23380 122381 121776 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_23380 122460 123848 gene locus_tag LOCUS_23390 gene glmM 122460 123848 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_23390 124802 123933 gene locus_tag LOCUS_23400 124802 123933 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_23400 124965 125615 gene locus_tag LOCUS_23410 124965 125615 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_23410 125771 128221 gene locus_tag LOCUS_23420 gene lon 125771 128221 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_23420 128318 129337 gene locus_tag LOCUS_23430 gene porQ 128318 129337 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_23430 129455 130144 gene locus_tag LOCUS_23440 gene cmk 129455 130144 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_23440 130613 130194 gene locus_tag LOCUS_23450 130613 130194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 130824 132692 gene locus_tag LOCUS_23460 gene rpsA 130824 132692 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_23460 132838 133377 gene locus_tag LOCUS_23470 gene pyrR 132838 133377 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_23470 133384 134313 gene locus_tag LOCUS_23480 133384 134313 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_23480 134317 134649 gene locus_tag LOCUS_23490 134317 134649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_23490 134651 135559 gene locus_tag LOCUS_23500 134651 135559 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_23500 135965 135552 gene locus_tag LOCUS_23510 135965 135552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 136049 136696 gene locus_tag LOCUS_23520 gene pdxH 136049 136696 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963814.1 protein_id gnl|my_center|LOCUS_23520 136862 137356 gene locus_tag LOCUS_23530 136862 137356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 138854 137457 gene locus_tag LOCUS_23540 gene fumC 138854 137457 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_23540 139028 139669 gene locus_tag LOCUS_23550 139028 139669 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_23550 142369 139754 gene locus_tag LOCUS_23560 142369 139754 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_23560 142630 142418 gene locus_tag LOCUS_23570 142630 142418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 142575 142757 gene locus_tag LOCUS_23580 142575 142757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_23580 145429 142838 gene locus_tag LOCUS_23590 145429 142838 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_23590 145858 145517 gene locus_tag LOCUS_23600 gene arsC 145858 145517 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_23600 146823 145873 gene locus_tag LOCUS_23610 gene prfB 146823 145873 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_23610 147073 148095 gene locus_tag LOCUS_23620 147073 148095 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_23620 148432 148109 gene locus_tag LOCUS_23630 148432 148109 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963031.1 protein_id gnl|my_center|LOCUS_23630 148516 150576 gene locus_tag LOCUS_23640 148516 150576 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_23640 150659 151699 gene locus_tag LOCUS_23650 150659 151699 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098105.1 protein_id gnl|my_center|LOCUS_23650 151940 153199 gene locus_tag LOCUS_23660 151940 153199 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_23660 154365 153247 gene locus_tag LOCUS_23670 154365 153247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_23670 155393 154389 gene locus_tag LOCUS_23680 155393 154389 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_23680 155551 155826 gene locus_tag LOCUS_23690 155551 155826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963907.1 protein_id gnl|my_center|LOCUS_23690 155978 158287 gene locus_tag LOCUS_23700 155978 158287 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_23700 158274 159557 gene locus_tag LOCUS_23710 158274 159557 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_23710 159668 161128 gene locus_tag LOCUS_23720 159668 161128 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_23720 162371 161199 gene locus_tag LOCUS_23730 162371 161199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 162876 163736 gene locus_tag LOCUS_23740 162876 163736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 164414 163797 gene locus_tag LOCUS_23750 164414 163797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 164603 165673 gene locus_tag LOCUS_23760 164603 165673 CDS product DUF3667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018972380.1 protein_id gnl|my_center|LOCUS_23760 168482 165693 gene locus_tag LOCUS_23770 gene uvrA 168482 165693 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_23770 168758 169348 gene locus_tag LOCUS_23780 168758 169348 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_23780 170238 169579 gene locus_tag LOCUS_23790 170238 169579 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_23790 170273 170731 gene locus_tag LOCUS_23800 gene bcp 170273 170731 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_23800 172185 170728 gene locus_tag LOCUS_23810 172185 170728 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_23810 173647 172295 gene locus_tag LOCUS_23820 173647 172295 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_23820 174084 173776 gene locus_tag LOCUS_23830 174084 173776 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_23830 175199 174087 gene locus_tag LOCUS_23840 175199 174087 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_23840 175395 176156 gene locus_tag LOCUS_23850 175395 176156 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_23850 176171 176674 gene locus_tag LOCUS_23860 176171 176674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_23860 177042 176671 gene locus_tag LOCUS_23870 177042 176671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_23870 177460 177080 gene locus_tag LOCUS_23880 177460 177080 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_23880 177762 178919 gene locus_tag LOCUS_23890 177762 178919 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_23890 178990 179469 gene locus_tag LOCUS_23900 178990 179469 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_23900 179655 181106 gene locus_tag LOCUS_23910 179655 181106 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_23910 181112 182071 gene locus_tag LOCUS_23920 181112 182071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 182134 183099 gene locus_tag LOCUS_23930 182134 183099 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462477.1 protein_id gnl|my_center|LOCUS_23930 183083 183775 gene locus_tag LOCUS_23940 183083 183775 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462476.1 protein_id gnl|my_center|LOCUS_23940 183772 184866 gene locus_tag LOCUS_23950 183772 184866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 186120 184879 gene locus_tag LOCUS_23960 186120 184879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 187381 186128 gene locus_tag LOCUS_23970 187381 186128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 188457 187426 gene locus_tag LOCUS_23980 188457 187426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 189693 188638 gene locus_tag LOCUS_23990 189693 188638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 190307 189696 gene locus_tag LOCUS_24000 190307 189696 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_24000 191517 190321 gene locus_tag LOCUS_24010 191517 190321 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 protein_id gnl|my_center|LOCUS_24010 192745 191996 gene locus_tag LOCUS_24020 192745 191996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964412.1 protein_id gnl|my_center|LOCUS_24020 193733 194026 gene locus_tag LOCUS_24030 193733 194026 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_24030 195950 194943 gene locus_tag LOCUS_24040 195950 194943 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905212.1 protein_id gnl|my_center|LOCUS_24040 196232 196032 gene locus_tag LOCUS_24050 196232 196032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 196424 198394 gene locus_tag LOCUS_24060 196424 198394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 198654 199505 gene locus_tag LOCUS_24070 198654 199505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 200235 199510 gene locus_tag LOCUS_24080 200235 199510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 201416 200331 gene locus_tag LOCUS_24090 201416 200331 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_24090 202294 201413 gene locus_tag LOCUS_24100 202294 201413 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905213.1 protein_id gnl|my_center|LOCUS_24100 203401 202304 gene locus_tag LOCUS_24110 203401 202304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 203990 203406 gene locus_tag LOCUS_24120 203990 203406 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107243.1 protein_id gnl|my_center|LOCUS_24120 205114 203996 gene locus_tag LOCUS_24130 205114 203996 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765277.1 protein_id gnl|my_center|LOCUS_24130 206231 205119 gene locus_tag LOCUS_24140 206231 205119 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_24140 207665 206280 gene locus_tag LOCUS_24150 207665 206280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 208776 207808 gene locus_tag LOCUS_24160 208776 207808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 210066 208783 gene locus_tag LOCUS_24170 210066 208783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 211599 210070 gene locus_tag LOCUS_24180 211599 210070 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202612.1 protein_id gnl|my_center|LOCUS_24180 212914 211628 gene locus_tag LOCUS_24190 212914 211628 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_24190 214131 213133 gene locus_tag LOCUS_24200 214131 213133 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_24200 215195 216325 gene locus_tag LOCUS_24210 215195 216325 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_24210 216322 218274 gene locus_tag LOCUS_24220 216322 218274 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_24220 218368 219090 gene locus_tag LOCUS_24230 218368 219090 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_24230 219100 221493 gene locus_tag LOCUS_24240 219100 221493 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_24240 222228 221482 gene locus_tag LOCUS_24250 222228 221482 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_24250 222651 222340 gene locus_tag LOCUS_24260 222651 222340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 223837 222917 gene locus_tag LOCUS_24270 gene aroB 223837 222917 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_24270 224077 225252 gene locus_tag LOCUS_24280 224077 225252 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_24280 226348 225269 gene locus_tag LOCUS_24290 226348 225269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 227048 226455 gene locus_tag LOCUS_24300 227048 226455 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_24300 227423 227052 gene locus_tag LOCUS_24310 227423 227052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 228661 227462 gene locus_tag LOCUS_24320 228661 227462 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_24320 228855 231287 gene locus_tag LOCUS_24330 228855 231287 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963986.1 protein_id gnl|my_center|LOCUS_24330 231780 231304 gene locus_tag LOCUS_24340 231780 231304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 231931 231788 gene locus_tag LOCUS_24350 231931 231788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 232530 232102 gene locus_tag LOCUS_24360 gene tsaE 232530 232102 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_24360 234180 232627 gene locus_tag LOCUS_24370 234180 232627 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_24370 234303 235523 gene locus_tag LOCUS_24380 234303 235523 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_24380 235576 236604 gene locus_tag LOCUS_24390 gene lpxD 235576 236604 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_24390 236591 237997 gene locus_tag LOCUS_24400 236591 237997 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_24400 238010 238795 gene locus_tag LOCUS_24410 gene lpxA 238010 238795 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_24410 238827 239393 gene locus_tag LOCUS_24420 gene efp 238827 239393 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_24420 239399 240337 gene locus_tag LOCUS_24430 239399 240337 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_24430 240407 241285 gene locus_tag LOCUS_24440 gene sucD 240407 241285 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_24440 241450 242196 gene locus_tag LOCUS_24450 gene fabG 241450 242196 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_24450 242200 244233 gene locus_tag LOCUS_24460 242200 244233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_24460 244245 245063 gene locus_tag LOCUS_24470 244245 245063 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_24470 245603 245115 gene locus_tag LOCUS_24480 245603 245115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 245942 246799 gene locus_tag LOCUS_24490 gene hisG 245942 246799 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_24490 246811 248094 gene locus_tag LOCUS_24500 gene hisD 246811 248094 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_24500 248172 249215 gene locus_tag LOCUS_24510 gene hisC 248172 249215 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_24510 249218 250351 gene locus_tag LOCUS_24520 gene hisB 249218 250351 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_24520 250416 250997 gene locus_tag LOCUS_24530 gene hisH 250416 250997 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963104.1 protein_id gnl|my_center|LOCUS_24530 251064 251798 gene locus_tag LOCUS_24540 gene hisA 251064 251798 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_24540 251813 252568 gene locus_tag LOCUS_24550 gene hisF 251813 252568 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_24550 252578 253171 gene locus_tag LOCUS_24560 gene hisIE 252578 253171 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_24560 253673 253236 gene locus_tag LOCUS_24570 253673 253236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_24570 253873 254556 gene locus_tag LOCUS_24580 gene truA 253873 254556 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_24580 254745 255299 gene locus_tag LOCUS_24590 254745 255299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 255385 256062 gene locus_tag LOCUS_24600 255385 256062 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_24600 256501 256055 gene locus_tag LOCUS_24610 256501 256055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 256925 256509 gene locus_tag LOCUS_24620 256925 256509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_24620 257069 257956 gene locus_tag LOCUS_24630 257069 257956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 257983 258366 gene locus_tag LOCUS_24640 257983 258366 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_24640 258603 259997 gene locus_tag LOCUS_24650 gene leuC 258603 259997 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_24650 260105 260701 gene locus_tag LOCUS_24660 gene leuD 260105 260701 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_24660 260705 262225 gene locus_tag LOCUS_24670 260705 262225 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_24670 262244 263302 gene locus_tag LOCUS_24680 gene leuB 262244 263302 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_24680 264605 263358 gene locus_tag LOCUS_24690 264605 263358 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_24690 264864 266978 gene locus_tag LOCUS_24700 264864 266978 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_24700 266991 267371 gene locus_tag LOCUS_24710 266991 267371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 267406 267636 gene locus_tag LOCUS_24720 267406 267636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 268459 267680 gene locus_tag LOCUS_24730 268459 267680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 269393 268566 gene locus_tag LOCUS_24740 269393 268566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 271046 269823 gene locus_tag LOCUS_24750 271046 269823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 272380 271322 gene locus_tag LOCUS_24760 272380 271322 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 protein_id gnl|my_center|LOCUS_24760 272811 272386 gene locus_tag LOCUS_24770 272811 272386 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_24770 273936 272830 gene locus_tag LOCUS_24780 273936 272830 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_24780 274613 274038 gene locus_tag LOCUS_24790 274613 274038 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704887.1 protein_id gnl|my_center|LOCUS_24790 275022 274753 gene locus_tag LOCUS_24800 275022 274753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 274931 275149 gene locus_tag LOCUS_24810 274931 275149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 275515 275273 gene locus_tag LOCUS_24820 275515 275273 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_24820 276647 275550 gene locus_tag LOCUS_24830 276647 275550 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_24830 277587 277039 gene locus_tag LOCUS_24840 277587 277039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 277961 277584 gene locus_tag LOCUS_24850 277961 277584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 279515 278163 gene locus_tag LOCUS_24860 279515 278163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 279933 279529 gene locus_tag LOCUS_24870 279933 279529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 280072 281070 gene locus_tag LOCUS_24880 280072 281070 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242607.1 protein_id gnl|my_center|LOCUS_24880 281714 281085 gene locus_tag LOCUS_24890 281714 281085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 282386 281841 gene locus_tag LOCUS_24900 282386 281841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 283570 282467 gene locus_tag LOCUS_24910 283570 282467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 284366 283683 gene locus_tag LOCUS_24920 284366 283683 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_24920 286143 284374 gene locus_tag LOCUS_24930 286143 284374 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_24930 286373 286984 gene locus_tag LOCUS_24940 286373 286984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 286989 288239 gene locus_tag LOCUS_24950 286989 288239 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_24950 288243 289136 gene locus_tag LOCUS_24960 288243 289136 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_24960 289167 289628 gene locus_tag LOCUS_24970 289167 289628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 289635 290537 gene locus_tag LOCUS_24980 289635 290537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 290542 291264 gene locus_tag LOCUS_24990 290542 291264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 291261 292367 gene locus_tag LOCUS_25000 291261 292367 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_25000 292367 293488 gene locus_tag LOCUS_25010 292367 293488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_25010 294204 293506 gene locus_tag LOCUS_25020 294204 293506 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963886.1 protein_id gnl|my_center|LOCUS_25020 294307 296037 gene locus_tag LOCUS_25030 294307 296037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 296874 296026 gene locus_tag LOCUS_25040 296874 296026 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532624.1 protein_id gnl|my_center|LOCUS_25040 297935 296907 gene locus_tag LOCUS_25050 297935 296907 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_25050 298822 297935 gene locus_tag LOCUS_25060 298822 297935 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_25060 299837 298923 gene locus_tag LOCUS_25070 gene yedA 299837 298923 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_25070 300640 299894 gene locus_tag LOCUS_25080 gene ppk2 300640 299894 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_25080 301123 300674 gene locus_tag LOCUS_25090 301123 300674 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_25090 302863 301313 gene locus_tag LOCUS_25100 302863 301313 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_25100 303022 304035 gene locus_tag LOCUS_25110 gene mgrA 303022 304035 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 protein_id gnl|my_center|LOCUS_25110 304718 304044 gene locus_tag LOCUS_25120 304718 304044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 306019 305603 gene locus_tag LOCUS_25130 306019 305603 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_25130 306620 306141 gene locus_tag LOCUS_25140 306620 306141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 308762 306759 gene locus_tag LOCUS_25150 308762 306759 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_25150 308895 309845 gene locus_tag LOCUS_25160 308895 309845 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_25160 309874 310200 gene locus_tag LOCUS_25170 309874 310200 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_25170 310204 311145 gene locus_tag LOCUS_25180 310204 311145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 311135 311998 gene locus_tag LOCUS_25190 311135 311998 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_25190 312017 312871 gene locus_tag LOCUS_25200 312017 312871 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_25200 314380 312872 gene locus_tag LOCUS_25210 gene hutH 314380 312872 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_25210 314506 315537 gene locus_tag LOCUS_25220 314506 315537 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 protein_id gnl|my_center|LOCUS_25220 317133 315580 gene locus_tag LOCUS_25230 317133 315580 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_25230 317477 319921 gene locus_tag LOCUS_25240 gene thrA 317477 319921 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_25240 320031 320960 gene locus_tag LOCUS_25250 320031 320960 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_25250 321072 322373 gene locus_tag LOCUS_25260 gene thrC 321072 322373 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_25260 322378 322902 gene locus_tag LOCUS_25270 322378 322902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 323216 323881 gene locus_tag LOCUS_25280 323216 323881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 325473 324037 gene locus_tag LOCUS_25290 gene pepP 325473 324037 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193684.1 protein_id gnl|my_center|LOCUS_25290 325729 326811 gene locus_tag LOCUS_25300 gene gcvT 325729 326811 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_25300 326845 327675 gene locus_tag LOCUS_25310 326845 327675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 327733 328026 gene locus_tag LOCUS_25320 327733 328026 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067278.1 protein_id gnl|my_center|LOCUS_25320 328175 328894 gene locus_tag LOCUS_25330 328175 328894 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_25330 329072 330649 gene locus_tag LOCUS_25340 329072 330649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 330726 332351 gene locus_tag LOCUS_25350 330726 332351 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_25350 332509 333954 gene locus_tag LOCUS_25360 332509 333954 CDS product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946128.1 protein_id gnl|my_center|LOCUS_25360 333956 335179 gene locus_tag LOCUS_25370 333956 335179 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_25370 335176 335859 gene locus_tag LOCUS_25380 335176 335859 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_25380 336587 335862 gene locus_tag LOCUS_25390 336587 335862 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_25390 336819 339353 gene locus_tag LOCUS_25400 336819 339353 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_25400 340064 339516 gene locus_tag LOCUS_25410 340064 339516 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 protein_id gnl|my_center|LOCUS_25410 341148 340066 gene locus_tag LOCUS_25420 341148 340066 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072443.1 protein_id gnl|my_center|LOCUS_25420 341980 341276 gene locus_tag LOCUS_25430 341980 341276 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_25430 342639 341971 gene locus_tag LOCUS_25440 gene kdsB 342639 341971 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963128.1 protein_id gnl|my_center|LOCUS_25440 344195 342771 gene locus_tag LOCUS_25450 344195 342771 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_25450 344511 344720 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 345152 345979 gene locus_tag LOCUS_25460 345152 345979 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_25460 345979 346518 gene locus_tag LOCUS_25470 gene rsmD 345979 346518 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_25470 346686 347603 gene locus_tag LOCUS_25480 346686 347603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 347630 348376 gene locus_tag LOCUS_25490 347630 348376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 349533 351257 gene locus_tag LOCUS_25500 349533 351257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 351268 351837 gene locus_tag LOCUS_25510 351268 351837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 351839 352420 gene locus_tag LOCUS_25520 351839 352420 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_25520 352944 352417 gene locus_tag LOCUS_25530 352944 352417 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_25530 353947 353042 gene locus_tag LOCUS_25540 353947 353042 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_25540 356012 353949 gene locus_tag LOCUS_25550 gene ppk1 356012 353949 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_25550 356632 356150 gene locus_tag LOCUS_25560 356632 356150 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_25560 357202 357651 gene locus_tag LOCUS_25570 357202 357651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence06 3050 126 gene locus_tag LOCUS_25580 3050 126 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_25580 4754 3069 gene locus_tag LOCUS_25590 4754 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 5572 4751 gene locus_tag LOCUS_25600 gene murQ 5572 4751 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_25600 7813 5585 gene locus_tag LOCUS_25610 7813 5585 CDS product DUF6259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108900.1 protein_id gnl|my_center|LOCUS_25610 9375 7894 gene locus_tag LOCUS_25620 9375 7894 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_25620 10643 9456 gene locus_tag LOCUS_25630 10643 9456 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_25630 12313 10808 gene locus_tag LOCUS_25640 12313 10808 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714626.1 protein_id gnl|my_center|LOCUS_25640 15477 12325 gene locus_tag LOCUS_25650 15477 12325 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121850300.1 protein_id gnl|my_center|LOCUS_25650 16055 16804 gene locus_tag LOCUS_25660 16055 16804 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096592.1 protein_id gnl|my_center|LOCUS_25660 16919 18136 gene locus_tag LOCUS_25670 16919 18136 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_25670 18140 19093 gene locus_tag LOCUS_25680 18140 19093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 19125 20378 gene locus_tag LOCUS_25690 19125 20378 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100706.1 protein_id gnl|my_center|LOCUS_25690 20534 22015 gene locus_tag LOCUS_25700 20534 22015 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635999.1 protein_id gnl|my_center|LOCUS_25700 22185 22111 gene locus_tag LOCUS_t00250 22185 22111 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22642 22241 gene locus_tag LOCUS_25710 gene mce 22642 22241 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_25710 22841 23236 gene locus_tag LOCUS_25720 gene rbfA 22841 23236 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962413.1 protein_id gnl|my_center|LOCUS_25720 23237 24442 gene locus_tag LOCUS_25730 23237 24442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_25730 25467 24454 gene locus_tag LOCUS_25740 gene dusB 25467 24454 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_25740 26640 25519 gene locus_tag LOCUS_25750 26640 25519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 26837 28633 gene locus_tag LOCUS_25760 gene lepA 26837 28633 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_25760 28941 30143 gene locus_tag LOCUS_25770 gene glgA 28941 30143 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258925.1 protein_id gnl|my_center|LOCUS_25770 30227 31492 gene locus_tag LOCUS_25780 30227 31492 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_25780 31536 33473 gene locus_tag LOCUS_25790 31536 33473 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_25790 33476 35110 gene locus_tag LOCUS_25800 33476 35110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 35114 37021 gene locus_tag LOCUS_25810 gene glgB 35114 37021 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_25810 37152 39548 gene locus_tag LOCUS_25820 37152 39548 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_25820 41394 39568 gene locus_tag LOCUS_25830 41394 39568 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_25830 41589 43508 gene locus_tag LOCUS_25840 41589 43508 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_25840 43563 44423 gene locus_tag LOCUS_25850 43563 44423 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_25850 44436 46043 gene locus_tag LOCUS_25860 44436 46043 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_25860 46105 47940 gene locus_tag LOCUS_25870 46105 47940 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_25870 48111 49508 gene locus_tag LOCUS_25880 48111 49508 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919894.1 protein_id gnl|my_center|LOCUS_25880 49671 50996 gene locus_tag LOCUS_25890 49671 50996 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905073.1 protein_id gnl|my_center|LOCUS_25890 51041 51418 gene locus_tag LOCUS_25900 gene rnpA 51041 51418 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_25900 51425 53068 gene locus_tag LOCUS_25910 51425 53068 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_25910 53159 53974 gene locus_tag LOCUS_25920 53159 53974 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962202.1 protein_id gnl|my_center|LOCUS_25920 54081 55412 gene locus_tag LOCUS_25930 54081 55412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 55859 55416 gene locus_tag LOCUS_25940 55859 55416 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_25940 56798 55887 gene locus_tag LOCUS_25950 56798 55887 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_25950 57233 56799 gene locus_tag LOCUS_25960 gene rpiB 57233 56799 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_25960 57860 60049 gene locus_tag LOCUS_25970 gene rnr 57860 60049 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964576.1 protein_id gnl|my_center|LOCUS_25970 60094 60768 gene locus_tag LOCUS_25980 60094 60768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 60891 61586 gene locus_tag LOCUS_25990 60891 61586 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_25990 61673 61602 gene locus_tag LOCUS_t00260 61673 61602 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 62086 61724 gene locus_tag LOCUS_26000 gene folB 62086 61724 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_26000 62185 64203 gene locus_tag LOCUS_26010 62185 64203 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_26010 64284 64763 gene locus_tag LOCUS_26020 64284 64763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 64928 65992 gene locus_tag LOCUS_26030 64928 65992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_26030 66039 66248 gene locus_tag LOCUS_26040 66039 66248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 67077 66292 gene locus_tag LOCUS_26050 67077 66292 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_26050 67285 67968 gene locus_tag LOCUS_26060 67285 67968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 69479 67965 gene locus_tag LOCUS_26070 gene gltX 69479 67965 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_26070 69628 72966 gene locus_tag LOCUS_26080 69628 72966 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_26080 72953 73366 gene locus_tag LOCUS_26090 gene ybeY 72953 73366 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_26090 73481 75352 gene locus_tag LOCUS_26100 gene mnmG 73481 75352 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_26100 75418 76272 gene locus_tag LOCUS_26110 75418 76272 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_26110 76470 77009 gene locus_tag LOCUS_26120 76470 77009 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_26120 78243 77089 gene locus_tag LOCUS_26130 78243 77089 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_26130 78463 79716 gene locus_tag LOCUS_26140 78463 79716 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_26140 79795 81348 gene locus_tag LOCUS_26150 79795 81348 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_26150 81454 82431 gene locus_tag LOCUS_26160 81454 82431 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_26160 82673 82491 gene locus_tag LOCUS_26170 82673 82491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 82792 83661 gene locus_tag LOCUS_26180 82792 83661 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_26180 83661 85163 gene locus_tag LOCUS_26190 83661 85163 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_26190 85191 86879 gene locus_tag LOCUS_26200 85191 86879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_26200 86895 87944 gene locus_tag LOCUS_26210 86895 87944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 87950 88954 gene locus_tag LOCUS_26220 gene rfbB 87950 88954 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_26220 88951 89808 gene locus_tag LOCUS_26230 gene rfbA 88951 89808 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_26230 89811 90359 gene locus_tag LOCUS_26240 gene rfbC 89811 90359 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_26240 90366 91184 gene locus_tag LOCUS_26250 gene rfbD 90366 91184 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_26250 91195 92313 gene locus_tag LOCUS_26260 gene gmd 91195 92313 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036868.1 protein_id gnl|my_center|LOCUS_26260 92364 93419 gene locus_tag LOCUS_26270 92364 93419 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_26270 93552 94868 gene locus_tag LOCUS_26280 93552 94868 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_26280 95931 96707 gene locus_tag LOCUS_26290 95931 96707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 96859 97254 gene locus_tag LOCUS_26300 96859 97254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 97258 98340 gene locus_tag LOCUS_26310 97258 98340 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107353.1 protein_id gnl|my_center|LOCUS_26310 98337 100049 gene locus_tag LOCUS_26320 98337 100049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 100046 100822 gene locus_tag LOCUS_26330 100046 100822 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_26330 101272 102036 gene locus_tag LOCUS_26340 101272 102036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26340 102105 103502 gene locus_tag LOCUS_26350 102105 103502 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_26350 103645 104631 gene locus_tag LOCUS_26360 103645 104631 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_26360 104635 106044 gene locus_tag LOCUS_26370 104635 106044 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_26370 107529 106168 gene locus_tag LOCUS_26380 107529 106168 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_26380 107568 108839 gene locus_tag LOCUS_26390 gene purD 107568 108839 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_26390 109059 108871 gene locus_tag LOCUS_26400 109059 108871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 110846 110187 gene locus_tag LOCUS_26410 gene upp 110846 110187 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_26410 110920 111525 gene locus_tag LOCUS_26420 110920 111525 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_26420 111620 112600 gene locus_tag LOCUS_26430 111620 112600 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043924886.1 protein_id gnl|my_center|LOCUS_26430 113652 112597 gene locus_tag LOCUS_26440 113652 112597 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_26440 113775 114182 gene locus_tag LOCUS_26450 113775 114182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 114244 115716 gene locus_tag LOCUS_26460 114244 115716 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079703094.1 protein_id gnl|my_center|LOCUS_26460 115745 116440 gene locus_tag LOCUS_26470 115745 116440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_26470 116698 119124 gene locus_tag LOCUS_26480 116698 119124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_26480 119137 119562 gene locus_tag LOCUS_26490 119137 119562 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_26490 119513 119752 gene locus_tag LOCUS_26500 119513 119752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 119752 120138 gene locus_tag LOCUS_26510 119752 120138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 120346 121449 gene locus_tag LOCUS_26520 gene atpB 120346 121449 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_26520 121486 121680 gene locus_tag LOCUS_26530 gene atpE 121486 121680 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964548.1 protein_id gnl|my_center|LOCUS_26530 121768 122268 gene locus_tag LOCUS_26540 121768 122268 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_26540 122277 122813 gene locus_tag LOCUS_26550 gene atpH 122277 122813 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_26550 122821 124401 gene locus_tag LOCUS_26560 gene atpA 122821 124401 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_26560 124470 125330 gene locus_tag LOCUS_26570 gene atpG 124470 125330 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_26570 125444 125911 gene locus_tag LOCUS_26580 125444 125911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 126073 127470 gene locus_tag LOCUS_26590 126073 127470 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_26590 127519 127953 gene locus_tag LOCUS_26600 gene dut 127519 127953 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_26600 128064 129065 gene locus_tag LOCUS_26610 128064 129065 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_26610 129156 130517 gene locus_tag LOCUS_26620 129156 130517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_26620 130528 131307 gene locus_tag LOCUS_26630 130528 131307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 131307 132533 gene locus_tag LOCUS_26640 131307 132533 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_26640 133043 132534 gene locus_tag LOCUS_26650 133043 132534 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_26650 134082 133144 gene locus_tag LOCUS_26660 134082 133144 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_26660 134178 135290 gene locus_tag LOCUS_26670 gene dprA 134178 135290 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_26670 136449 135451 gene locus_tag LOCUS_26680 gene trpS 136449 135451 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_26680 136709 137272 gene locus_tag LOCUS_26690 136709 137272 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_26690 138813 137353 gene locus_tag LOCUS_26700 138813 137353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 139364 138810 gene locus_tag LOCUS_26710 139364 138810 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_26710 139803 139384 gene locus_tag LOCUS_26720 139803 139384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150543285.1 protein_id gnl|my_center|LOCUS_26720 140908 139901 gene locus_tag LOCUS_26730 gene recA 140908 139901 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_26730 141195 142268 gene locus_tag LOCUS_26740 141195 142268 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962203.1 protein_id gnl|my_center|LOCUS_26740 142276 143523 gene locus_tag LOCUS_26750 142276 143523 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_26750 143523 143753 gene locus_tag LOCUS_26760 143523 143753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 143876 145048 gene locus_tag LOCUS_26770 gene ricT 143876 145048 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_26770 145038 145529 gene locus_tag LOCUS_26780 145038 145529 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_26780 145538 147874 gene locus_tag LOCUS_26790 145538 147874 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_26790 149835 147871 gene locus_tag LOCUS_26800 149835 147871 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_26800 151896 150217 gene locus_tag LOCUS_26810 151896 150217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_26810 152610 151897 gene locus_tag LOCUS_26820 152610 151897 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_26820 152984 152628 gene locus_tag LOCUS_26830 152984 152628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 155517 153073 gene locus_tag LOCUS_26840 155517 153073 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_26840 156096 155623 gene locus_tag LOCUS_26850 156096 155623 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962214.1 protein_id gnl|my_center|LOCUS_26850 157184 156096 gene locus_tag LOCUS_26860 157184 156096 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_26860 158512 157259 gene locus_tag LOCUS_26870 158512 157259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 159562 158573 gene locus_tag LOCUS_26880 gene hemB 159562 158573 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_26880 160528 159626 gene locus_tag LOCUS_26890 gene hemF 160528 159626 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_26890 161828 160539 gene locus_tag LOCUS_26900 gene nhaA 161828 160539 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_26900 162379 161843 gene locus_tag LOCUS_26910 162379 161843 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962220.1 protein_id gnl|my_center|LOCUS_26910 163523 162501 gene locus_tag LOCUS_26920 gene hemE 163523 162501 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_26920 165183 163606 gene locus_tag LOCUS_26930 165183 163606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 166435 165176 gene locus_tag LOCUS_26940 gene hemA 166435 165176 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_26940 166606 167526 gene locus_tag LOCUS_26950 166606 167526 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_26950 167539 167700 gene locus_tag LOCUS_26960 167539 167700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 167780 168793 gene locus_tag LOCUS_26970 gene hemH 167780 168793 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_26970 168806 170158 gene locus_tag LOCUS_26980 168806 170158 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_26980 170176 170724 gene locus_tag LOCUS_26990 170176 170724 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_26990 170978 172387 gene locus_tag LOCUS_27000 170978 172387 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_27000 172411 173196 gene locus_tag LOCUS_27010 172411 173196 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_27010 173766 173251 gene locus_tag LOCUS_27020 173766 173251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 173979 175055 gene locus_tag LOCUS_27030 173979 175055 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083628.1 protein_id gnl|my_center|LOCUS_27030 176269 175694 gene locus_tag LOCUS_27040 176269 175694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 177142 176552 gene locus_tag LOCUS_27050 177142 176552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 177341 178231 gene locus_tag LOCUS_27060 177341 178231 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_27060 178881 178228 gene locus_tag LOCUS_27070 178881 178228 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_27070 179939 178947 gene locus_tag LOCUS_27080 179939 178947 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_27080 180686 179949 gene locus_tag LOCUS_27090 180686 179949 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_27090 181102 180713 gene locus_tag LOCUS_27100 181102 180713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 181620 181210 gene locus_tag LOCUS_27110 181620 181210 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_27110 181740 182480 gene locus_tag LOCUS_27120 gene djlA 181740 182480 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_27120 183508 182477 gene locus_tag LOCUS_27130 183508 182477 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_27130 183565 185643 gene locus_tag LOCUS_27140 gene metG 183565 185643 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_27140 185666 186163 gene locus_tag LOCUS_27150 185666 186163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 186393 186830 gene locus_tag LOCUS_27160 186393 186830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 186836 187540 gene locus_tag LOCUS_27170 186836 187540 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_27170 187616 189742 gene locus_tag LOCUS_27180 187616 189742 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_27180 190234 189803 gene locus_tag LOCUS_27190 190234 189803 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_27190 190537 193890 gene locus_tag LOCUS_27200 gene mfd 190537 193890 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_27200 193921 195243 gene locus_tag LOCUS_27210 193921 195243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 195638 195279 gene locus_tag LOCUS_27220 195638 195279 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_27220 195770 196426 gene locus_tag LOCUS_27230 195770 196426 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_27230 196431 198311 gene locus_tag LOCUS_27240 196431 198311 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_27240 200589 198490 gene locus_tag LOCUS_27250 gene feoB 200589 198490 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_27250 200818 200582 gene locus_tag LOCUS_27260 200818 200582 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_27260 201565 200891 gene locus_tag LOCUS_27270 201565 200891 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_27270 201735 203081 gene locus_tag LOCUS_27280 gene rseP 201735 203081 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_27280 203158 203232 gene locus_tag LOCUS_t00270 203158 203232 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 203285 203357 gene locus_tag LOCUS_t00280 203285 203357 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 203574 204611 gene locus_tag LOCUS_27290 203574 204611 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_27290 204976 204620 gene locus_tag LOCUS_27300 204976 204620 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_27300 205047 205514 gene locus_tag LOCUS_27310 205047 205514 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_27310 206210 205488 gene locus_tag LOCUS_27320 206210 205488 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932758.1 protein_id gnl|my_center|LOCUS_27320 207230 206376 gene locus_tag LOCUS_27330 207230 206376 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_27330 207405 208748 gene locus_tag LOCUS_27340 gene gdhA 207405 208748 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_27340 208872 211220 gene locus_tag LOCUS_27350 208872 211220 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_27350 211220 211939 gene locus_tag LOCUS_27360 gene recO 211220 211939 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_27360 213878 211953 gene locus_tag LOCUS_27370 213878 211953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 213958 214431 gene locus_tag LOCUS_27380 213958 214431 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_27380 215155 214628 gene locus_tag LOCUS_27390 215155 214628 CDS product OmpA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962318.1 protein_id gnl|my_center|LOCUS_27390 216039 215164 gene locus_tag LOCUS_27400 216039 215164 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525382.1 protein_id gnl|my_center|LOCUS_27400 217322 216228 gene locus_tag LOCUS_27410 gene bioB 217322 216228 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_27410 218530 217373 gene locus_tag LOCUS_27420 218530 217373 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_27420 219818 218553 gene locus_tag LOCUS_27430 gene bioA 219818 218553 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_27430 220423 219815 gene locus_tag LOCUS_27440 gene bioD 220423 219815 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_27440 220800 220420 gene locus_tag LOCUS_27450 220800 220420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 221950 220793 gene locus_tag LOCUS_27460 221950 220793 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_27460 222086 223777 gene locus_tag LOCUS_27470 222086 223777 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_27470 223891 224346 gene locus_tag LOCUS_27480 223891 224346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 224350 224556 gene locus_tag LOCUS_27490 224350 224556 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_27490 224653 225024 gene locus_tag LOCUS_27500 224653 225024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 225078 226337 gene locus_tag LOCUS_27510 225078 226337 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_27510 226331 226771 gene locus_tag LOCUS_27520 gene umuD 226331 226771 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_27520 226945 228906 gene locus_tag LOCUS_27530 226945 228906 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_27530 229734 229021 gene locus_tag LOCUS_27540 229734 229021 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_27540 230605 229802 gene locus_tag LOCUS_27550 230605 229802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence07 1353 121 gene locus_tag LOCUS_27560 1353 121 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_27560 3148 1529 gene locus_tag LOCUS_27570 3148 1529 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_27570 4093 3176 gene locus_tag LOCUS_27580 4093 3176 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_27580 5358 4639 gene locus_tag LOCUS_27590 5358 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 6900 5485 gene locus_tag LOCUS_27600 6900 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 7365 7793 gene locus_tag LOCUS_27610 7365 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 7811 9439 gene locus_tag LOCUS_27620 7811 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 9482 10333 gene locus_tag LOCUS_27630 9482 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 11538 10441 gene locus_tag LOCUS_27640 11538 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 12292 11522 gene locus_tag LOCUS_27650 12292 11522 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 protein_id gnl|my_center|LOCUS_27650 12537 15803 gene locus_tag LOCUS_27660 12537 15803 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_27660 15809 17242 gene locus_tag LOCUS_27670 15809 17242 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_27670 17351 18154 gene locus_tag LOCUS_27680 17351 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 20909 18159 gene locus_tag LOCUS_27690 20909 18159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 21652 22185 gene locus_tag LOCUS_27700 21652 22185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 22423 23121 gene locus_tag LOCUS_27710 22423 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 23265 23705 gene locus_tag LOCUS_27720 23265 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 23947 24627 gene locus_tag LOCUS_27730 23947 24627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 24685 25242 gene locus_tag LOCUS_27740 24685 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 25252 25746 gene locus_tag LOCUS_27750 25252 25746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 25756 26199 gene locus_tag LOCUS_27760 25756 26199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 26203 26673 gene locus_tag LOCUS_27770 26203 26673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 26861 27307 gene locus_tag LOCUS_27780 26861 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962193.1 protein_id gnl|my_center|LOCUS_27780 27646 28959 gene locus_tag LOCUS_27790 27646 28959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962194.1 protein_id gnl|my_center|LOCUS_27790 29110 30549 gene locus_tag LOCUS_27800 29110 30549 CDS product gliding motility-associated C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962195.1 protein_id gnl|my_center|LOCUS_27800 30593 33004 gene locus_tag LOCUS_27810 30593 33004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 33078 41309 gene locus_tag LOCUS_27820 33078 41309 CDS product T9SS type B sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962197.1 protein_id gnl|my_center|LOCUS_27820 41376 42332 gene locus_tag LOCUS_27830 41376 42332 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962198.1 protein_id gnl|my_center|LOCUS_27830 42545 42736 gene locus_tag LOCUS_27840 42545 42736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 42821 43621 gene locus_tag LOCUS_27850 gene proC 42821 43621 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_27850 43623 44399 gene locus_tag LOCUS_27860 43623 44399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 44449 45597 gene locus_tag LOCUS_27870 44449 45597 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_27870 46628 45594 gene locus_tag LOCUS_27880 46628 45594 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_27880 46880 47683 gene locus_tag LOCUS_27890 46880 47683 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_27890 47789 48442 gene locus_tag LOCUS_27900 gene fsa 47789 48442 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_27900 49926 48511 gene locus_tag LOCUS_27910 49926 48511 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_27910 50121 51746 gene locus_tag LOCUS_27920 50121 51746 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_27920 51979 51743 gene locus_tag LOCUS_27930 51979 51743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 52115 52309 gene locus_tag LOCUS_27940 52115 52309 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_27940 53382 52375 gene locus_tag LOCUS_27950 53382 52375 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_27950 54451 53405 gene locus_tag LOCUS_27960 54451 53405 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_27960 54846 54505 gene locus_tag LOCUS_27970 54846 54505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 55588 54863 gene locus_tag LOCUS_27980 55588 54863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 55814 56662 gene locus_tag LOCUS_27990 55814 56662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 57151 56738 gene locus_tag LOCUS_28000 57151 56738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 57847 57173 gene locus_tag LOCUS_28010 57847 57173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 58814 57861 gene locus_tag LOCUS_28020 58814 57861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 58789 58992 gene locus_tag LOCUS_28030 58789 58992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 59095 59496 gene locus_tag LOCUS_28040 59095 59496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 60727 59609 gene locus_tag LOCUS_28050 gene dnaN 60727 59609 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_28050 62569 60902 gene locus_tag LOCUS_28060 gene gldG 62569 60902 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_28060 63047 62553 gene locus_tag LOCUS_28070 63047 62553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 63762 63052 gene locus_tag LOCUS_28080 gene gldF 63762 63052 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_28080 64091 63795 gene locus_tag LOCUS_28090 64091 63795 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_28090 64934 64098 gene locus_tag LOCUS_28100 64934 64098 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_28100 65183 66136 gene locus_tag LOCUS_28110 65183 66136 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_28110 66136 67086 gene locus_tag LOCUS_28120 66136 67086 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_28120 67806 67090 gene locus_tag LOCUS_28130 67806 67090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 68067 67888 gene locus_tag LOCUS_28140 68067 67888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 68702 68211 gene locus_tag LOCUS_28150 68702 68211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 69901 68858 gene locus_tag LOCUS_28160 69901 68858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 70106 72013 gene locus_tag LOCUS_28170 gene acs 70106 72013 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_28170 72624 72010 gene locus_tag LOCUS_28180 72624 72010 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764144.1 protein_id gnl|my_center|LOCUS_28180 72735 73766 gene locus_tag LOCUS_28190 gene ahr 72735 73766 CDS product NADPH-dependent aldehyde reductase Ahr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967417.1 protein_id gnl|my_center|LOCUS_28190 74051 75814 gene locus_tag LOCUS_28200 74051 75814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_28200 75818 76336 gene locus_tag LOCUS_28210 75818 76336 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_28210 76426 77007 gene locus_tag LOCUS_28220 76426 77007 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_28220 77137 77709 gene locus_tag LOCUS_28230 77137 77709 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_28230 77821 78432 gene locus_tag LOCUS_28240 77821 78432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 79979 78429 gene locus_tag LOCUS_28250 79979 78429 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719342.1 protein_id gnl|my_center|LOCUS_28250 81445 80003 gene locus_tag LOCUS_28260 gene accC 81445 80003 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_28260 81939 81460 gene locus_tag LOCUS_28270 81939 81460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 82726 82049 gene locus_tag LOCUS_28280 82726 82049 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_28280 83292 82738 gene locus_tag LOCUS_28290 83292 82738 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141374.1 protein_id gnl|my_center|LOCUS_28290 84399 83344 gene locus_tag LOCUS_28300 84399 83344 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_28300 84639 85523 gene locus_tag LOCUS_28310 84639 85523 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_28310 85805 85620 gene locus_tag LOCUS_28320 85805 85620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 85828 89214 gene locus_tag LOCUS_28330 85828 89214 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_28330 89356 89991 gene locus_tag LOCUS_28340 89356 89991 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_28340 90001 90624 gene locus_tag LOCUS_28350 90001 90624 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_28350 90650 91141 gene locus_tag LOCUS_28360 90650 91141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 91570 91142 gene locus_tag LOCUS_28370 91570 91142 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_28370 92241 91570 gene locus_tag LOCUS_28380 92241 91570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_28380 92979 92248 gene locus_tag LOCUS_28390 92979 92248 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_28390 93243 94400 gene locus_tag LOCUS_28400 93243 94400 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_28400 95481 94705 gene locus_tag LOCUS_28410 95481 94705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 95717 95896 gene locus_tag LOCUS_28420 95717 95896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 96490 95915 gene locus_tag LOCUS_28430 96490 95915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 97747 96539 gene locus_tag LOCUS_28440 97747 96539 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921540.1 protein_id gnl|my_center|LOCUS_28440 97917 98957 gene locus_tag LOCUS_28450 97917 98957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 99415 98984 gene locus_tag LOCUS_28460 99415 98984 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021476.1 protein_id gnl|my_center|LOCUS_28460 99953 99522 gene locus_tag LOCUS_28470 99953 99522 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_28470 100784 100095 gene locus_tag LOCUS_28480 100784 100095 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_28480 101334 100792 gene locus_tag LOCUS_28490 101334 100792 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_28490 102779 101355 gene locus_tag LOCUS_28500 gene rlmD 102779 101355 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_28500 103001 104290 gene locus_tag LOCUS_28510 gene rocD 103001 104290 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_28510 104685 104359 gene locus_tag LOCUS_28520 104685 104359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 104981 104691 gene locus_tag LOCUS_28530 104981 104691 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962900.1 protein_id gnl|my_center|LOCUS_28530 105121 105318 gene locus_tag LOCUS_28540 105121 105318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 105318 105878 gene locus_tag LOCUS_28550 105318 105878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_28550 106777 105875 gene locus_tag LOCUS_28560 106777 105875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 106878 108023 gene locus_tag LOCUS_28570 106878 108023 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_28570 109189 108020 gene locus_tag LOCUS_28580 109189 108020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 111695 109275 gene locus_tag LOCUS_28590 111695 109275 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_28590 113435 111750 gene locus_tag LOCUS_28600 113435 111750 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_28600 113659 113949 gene locus_tag LOCUS_28610 113659 113949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_28610 113965 114258 gene locus_tag LOCUS_28620 113965 114258 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_28620 114477 116051 gene locus_tag LOCUS_28630 gene rny 114477 116051 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_28630 116993 116097 gene locus_tag LOCUS_28640 gene xerD 116993 116097 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_28640 117142 117615 gene locus_tag LOCUS_28650 117142 117615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 117760 118308 gene locus_tag LOCUS_28660 117760 118308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 118488 119087 gene locus_tag LOCUS_28670 118488 119087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 119168 119584 gene locus_tag LOCUS_28680 gene aroQ 119168 119584 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_28680 119884 120183 gene locus_tag LOCUS_28690 119884 120183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 121628 120252 gene locus_tag LOCUS_28700 gene lpdA 121628 120252 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_28700 121744 123030 gene locus_tag LOCUS_28710 121744 123030 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_28710 123133 124062 gene locus_tag LOCUS_28720 123133 124062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 124676 124122 gene locus_tag LOCUS_28730 124676 124122 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_28730 125067 124669 gene locus_tag LOCUS_28740 gene msrB 125067 124669 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 protein_id gnl|my_center|LOCUS_28740 125540 125064 gene locus_tag LOCUS_28750 gene msrB 125540 125064 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967753.1 protein_id gnl|my_center|LOCUS_28750 125682 126503 gene locus_tag LOCUS_28760 125682 126503 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_28760 126564 127868 gene locus_tag LOCUS_28770 126564 127868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_28770 129040 127955 gene locus_tag LOCUS_28780 129040 127955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 129581 129018 gene locus_tag LOCUS_28790 129581 129018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 130150 129593 gene locus_tag LOCUS_28800 130150 129593 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765767.1 protein_id gnl|my_center|LOCUS_28800 132816 130267 gene locus_tag LOCUS_28810 132816 130267 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_28810 133057 132878 gene locus_tag LOCUS_28820 133057 132878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 133079 135631 gene locus_tag LOCUS_28830 gene gyrA 133079 135631 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_28830 135693 136910 gene locus_tag LOCUS_28840 135693 136910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_28840 137706 136957 gene locus_tag LOCUS_28850 137706 136957 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_28850 138895 137717 gene locus_tag LOCUS_28860 138895 137717 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_28860 139022 141076 gene locus_tag LOCUS_28870 139022 141076 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_28870 141169 141253 gene locus_tag LOCUS_t00290 141169 141253 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 141271 141346 gene locus_tag LOCUS_t00300 141271 141346 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 141672 141856 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 142538 142711 gene locus_tag LOCUS_28880 142538 142711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 143260 143042 gene locus_tag LOCUS_28890 143260 143042 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_28890 143494 143297 gene locus_tag LOCUS_28900 143494 143297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence08 1272 148 gene locus_tag LOCUS_28910 1272 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1327 1437 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2862 2506 gene locus_tag LOCUS_28920 2862 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3756 2878 gene locus_tag LOCUS_28930 3756 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 3912 4130 gene locus_tag LOCUS_28940 3912 4130 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_28940 4562 4218 gene locus_tag LOCUS_28950 4562 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 4572 4718 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5904 5829 gene locus_tag LOCUS_t00310 5904 5829 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6080 8371 gene locus_tag LOCUS_28960 6080 8371 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038090.1 protein_id gnl|my_center|LOCUS_28960 8399 9532 gene locus_tag LOCUS_28970 8399 9532 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_28970 9534 9935 gene locus_tag LOCUS_28980 9534 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 10000 10605 gene locus_tag LOCUS_28990 gene udk 10000 10605 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_28990 10606 10935 gene locus_tag LOCUS_29000 10606 10935 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_29000 10925 12301 gene locus_tag LOCUS_29010 10925 12301 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_29010 12304 12903 gene locus_tag LOCUS_29020 12304 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 12946 15069 gene locus_tag LOCUS_29030 gene scpA 12946 15069 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_29030 15177 15596 gene locus_tag LOCUS_29040 15177 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 15827 16378 gene locus_tag LOCUS_29050 15827 16378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 16579 17406 gene locus_tag LOCUS_29060 16579 17406 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963866.1 protein_id gnl|my_center|LOCUS_29060 17659 19107 gene locus_tag LOCUS_29070 17659 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 19314 20057 gene locus_tag LOCUS_29080 19314 20057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 20117 20695 gene locus_tag LOCUS_29090 20117 20695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 21460 20771 gene locus_tag LOCUS_29100 21460 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 22552 21488 gene locus_tag LOCUS_29110 22552 21488 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974520.1 protein_id gnl|my_center|LOCUS_29110 22912 22577 gene locus_tag LOCUS_29120 22912 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 23906 22974 gene locus_tag LOCUS_29130 23906 22974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 24279 23899 gene locus_tag LOCUS_29140 24279 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 24538 25059 gene locus_tag LOCUS_29150 24538 25059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921584.1 protein_id gnl|my_center|LOCUS_29150 25316 26080 gene locus_tag LOCUS_29160 25316 26080 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_29160 26084 26995 gene locus_tag LOCUS_29170 26084 26995 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_29170 27039 27560 gene locus_tag LOCUS_29180 27039 27560 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_29180 27564 28268 gene locus_tag LOCUS_29190 gene dapB 27564 28268 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_29190 28334 29890 gene locus_tag LOCUS_29200 gene lepB 28334 29890 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_29200 29960 30580 gene locus_tag LOCUS_29210 29960 30580 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_29210 31928 30897 gene locus_tag LOCUS_29220 31928 30897 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_29220 32806 31934 gene locus_tag LOCUS_29230 32806 31934 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_29230 33555 32806 gene locus_tag LOCUS_29240 33555 32806 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_29240 35402 33558 gene locus_tag LOCUS_29250 gene mutL 35402 33558 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_29250 35693 35403 gene locus_tag LOCUS_29260 35693 35403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 35941 35702 gene locus_tag LOCUS_29270 35941 35702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 36553 36068 gene locus_tag LOCUS_29280 gene ribH 36553 36068 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964104.1 protein_id gnl|my_center|LOCUS_29280 37328 36555 gene locus_tag LOCUS_29290 37328 36555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_29290 37461 38540 gene locus_tag LOCUS_29300 gene recF 37461 38540 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_29300 38521 38961 gene locus_tag LOCUS_29310 38521 38961 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_29310 38961 39257 gene locus_tag LOCUS_29320 38961 39257 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_29320 39306 39536 gene locus_tag LOCUS_29330 39306 39536 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_29330 40063 39668 gene locus_tag LOCUS_29340 40063 39668 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_29340 40178 41197 gene locus_tag LOCUS_29350 40178 41197 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_29350 41190 41729 gene locus_tag LOCUS_29360 gene gldI 41190 41729 CDS product gliding motility-associated peptidyl-prolyl isomerase GldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963996.1 protein_id gnl|my_center|LOCUS_29360 41742 42872 gene locus_tag LOCUS_29370 41742 42872 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_29370 42946 43875 gene locus_tag LOCUS_29380 gene lgt 42946 43875 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962761.1 protein_id gnl|my_center|LOCUS_29380 43877 44380 gene locus_tag LOCUS_29390 43877 44380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 47418 44440 gene locus_tag LOCUS_29400 gene secDF 47418 44440 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_29400 48214 47597 gene locus_tag LOCUS_29410 48214 47597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 49211 48285 gene locus_tag LOCUS_29420 49211 48285 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962692.1 protein_id gnl|my_center|LOCUS_29420 50385 49390 gene locus_tag LOCUS_29430 50385 49390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 50638 51408 gene locus_tag LOCUS_29440 50638 51408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 53433 51493 gene locus_tag LOCUS_29450 gene gyrB 53433 51493 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_29450 55473 53800 gene locus_tag LOCUS_29460 gene asnB 55473 53800 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_29460 55752 56288 gene locus_tag LOCUS_29470 55752 56288 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_29470 56963 56334 gene locus_tag LOCUS_29480 56963 56334 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_29480 57066 58610 gene locus_tag LOCUS_29490 57066 58610 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_29490 58662 59621 gene locus_tag LOCUS_29500 58662 59621 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549454.1 protein_id gnl|my_center|LOCUS_29500 59658 60218 gene locus_tag LOCUS_29510 59658 60218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 60230 61204 gene locus_tag LOCUS_29520 60230 61204 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_29520 61216 61578 gene locus_tag LOCUS_29530 61216 61578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 61578 62405 gene locus_tag LOCUS_29540 61578 62405 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_29540 62426 63196 gene locus_tag LOCUS_29550 gene rluF 62426 63196 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_29550 63200 63622 gene locus_tag LOCUS_29560 63200 63622 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_29560 63693 63923 gene locus_tag LOCUS_29570 63693 63923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 64826 63948 gene locus_tag LOCUS_29580 64826 63948 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_29580 66190 64862 gene locus_tag LOCUS_29590 gene ffh 66190 64862 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_29590 68069 66372 gene locus_tag LOCUS_29600 68069 66372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 68232 68747 gene locus_tag LOCUS_29610 68232 68747 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770321.1 protein_id gnl|my_center|LOCUS_29610 68875 69771 gene locus_tag LOCUS_29620 68875 69771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 69815 72082 gene locus_tag LOCUS_29630 69815 72082 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_29630 72139 73110 gene locus_tag LOCUS_29640 72139 73110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 74581 73274 gene locus_tag LOCUS_29650 74581 73274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 76278 74926 gene locus_tag LOCUS_29660 76278 74926 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_29660 77397 76444 gene locus_tag LOCUS_29670 77397 76444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 77539 83844 gene locus_tag LOCUS_29680 77539 83844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 83919 84389 gene locus_tag LOCUS_29690 83919 84389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 84392 85783 gene locus_tag LOCUS_29700 84392 85783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 86517 85792 gene locus_tag LOCUS_29710 86517 85792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_29710 87063 86602 gene locus_tag LOCUS_29720 87063 86602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 87310 87053 gene locus_tag LOCUS_29730 87310 87053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 88287 87289 gene locus_tag LOCUS_29740 gene obgE 88287 87289 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963487.1 protein_id gnl|my_center|LOCUS_29740 89448 88339 gene locus_tag LOCUS_29750 89448 88339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 89777 90955 gene locus_tag LOCUS_29760 89777 90955 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_29760 90963 91445 gene locus_tag LOCUS_29770 gene purE 90963 91445 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_29770 91570 93609 gene locus_tag LOCUS_29780 91570 93609 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_29780 93658 94212 gene locus_tag LOCUS_29790 gene sigX 93658 94212 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_29790 95013 94474 gene locus_tag LOCUS_29800 95013 94474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 95426 98275 gene locus_tag LOCUS_29810 gene gcvP 95426 98275 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_29810 98380 99438 gene locus_tag LOCUS_29820 98380 99438 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_29820 99484 100005 gene locus_tag LOCUS_29830 99484 100005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 100030 100881 gene locus_tag LOCUS_29840 100030 100881 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_29840 101735 100917 gene locus_tag LOCUS_29850 101735 100917 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_29850 103326 101728 gene locus_tag LOCUS_29860 103326 101728 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_29860 103540 104241 gene locus_tag LOCUS_29870 103540 104241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_29870 104241 105008 gene locus_tag LOCUS_29880 104241 105008 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_29880 105442 105026 gene locus_tag LOCUS_29890 105442 105026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 106013 105420 gene locus_tag LOCUS_29900 106013 105420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 106332 106003 gene locus_tag LOCUS_29910 106332 106003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 107981 106518 gene locus_tag LOCUS_29920 107981 106518 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_29920 109150 108071 gene locus_tag LOCUS_29930 109150 108071 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_29930 109842 109246 gene locus_tag LOCUS_29940 109842 109246 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_29940 110063 111163 gene locus_tag LOCUS_29950 110063 111163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 111908 111273 gene locus_tag LOCUS_29960 111908 111273 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 protein_id gnl|my_center|LOCUS_29960 112595 111912 gene locus_tag LOCUS_29970 112595 111912 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_29970 113484 112588 gene locus_tag LOCUS_29980 113484 112588 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_29980 113691 114785 gene locus_tag LOCUS_29990 113691 114785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 114895 115269 gene locus_tag LOCUS_30000 114895 115269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 115299 115571 gene locus_tag LOCUS_30010 115299 115571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 115609 116004 gene locus_tag LOCUS_30020 115609 116004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 117701 116085 gene locus_tag LOCUS_30030 117701 116085 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_30030 118703 117705 gene locus_tag LOCUS_30040 gene pdhA 118703 117705 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_30040 119384 118902 gene locus_tag LOCUS_30050 gene cdd 119384 118902 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_30050 120620 119484 gene locus_tag LOCUS_30060 gene porV 120620 119484 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_30060 124650 120766 gene locus_tag LOCUS_30070 gene porU 124650 120766 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_30070 124912 126609 gene locus_tag LOCUS_30080 gene gldJ 124912 126609 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_30080 126704 127987 gene locus_tag LOCUS_30090 126704 127987 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_30090 128307 129455 gene locus_tag LOCUS_30100 128307 129455 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_30100 129458 130426 gene locus_tag LOCUS_30110 129458 130426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 130401 131441 gene locus_tag LOCUS_30120 130401 131441 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_30120 132407 131634 gene locus_tag LOCUS_30130 132407 131634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 132630 132555 gene locus_tag LOCUS_t00320 132630 132555 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 132754 132679 gene locus_tag LOCUS_t00330 132754 132679 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 134035 132818 gene locus_tag LOCUS_30140 134035 132818 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_30140 134829 134038 gene locus_tag LOCUS_30150 134829 134038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_30150 135303 134908 gene locus_tag LOCUS_30160 135303 134908 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_30160 136006 135305 gene locus_tag LOCUS_30170 136006 135305 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_30170 137468 136062 gene locus_tag LOCUS_30180 gene nhaD 137468 136062 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_30180 138615 137584 gene locus_tag LOCUS_30190 138615 137584 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_30190 138743 139885 gene locus_tag LOCUS_30200 138743 139885 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_30200 140019 141287 gene locus_tag LOCUS_30210 140019 141287 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence09 859 1089 gene locus_tag LOCUS_30220 859 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 5135 1113 gene locus_tag LOCUS_30230 5135 1113 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_30230 5549 6694 gene locus_tag LOCUS_30240 5549 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 6699 9848 gene locus_tag LOCUS_30250 6699 9848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 protein_id gnl|my_center|LOCUS_30250 9867 11372 gene locus_tag LOCUS_30260 9867 11372 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766873.1 protein_id gnl|my_center|LOCUS_30260 11462 12586 gene locus_tag LOCUS_30270 11462 12586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 12721 14586 gene locus_tag LOCUS_30280 12721 14586 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_30280 14794 16071 gene locus_tag LOCUS_30290 14794 16071 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_30290 16074 17960 gene locus_tag LOCUS_30300 16074 17960 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_30300 18037 18957 gene locus_tag LOCUS_30310 18037 18957 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104808194.1 protein_id gnl|my_center|LOCUS_30310 18987 20774 gene locus_tag LOCUS_30320 gene uidA 18987 20774 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583888.1 protein_id gnl|my_center|LOCUS_30320 21018 21323 gene locus_tag LOCUS_30330 21018 21323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30330 21409 21726 gene locus_tag LOCUS_30340 21409 21726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30340 21742 22197 gene locus_tag LOCUS_30350 21742 22197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30350 22435 25419 gene locus_tag LOCUS_30360 22435 25419 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461657.1 protein_id gnl|my_center|LOCUS_30360 25483 26115 gene locus_tag LOCUS_30370 25483 26115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944228.1 protein_id gnl|my_center|LOCUS_30370 26250 27401 gene locus_tag LOCUS_30380 26250 27401 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037531.1 protein_id gnl|my_center|LOCUS_30380 27693 28268 gene locus_tag LOCUS_30390 27693 28268 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719850.1 protein_id gnl|my_center|LOCUS_30390 28370 29674 gene locus_tag LOCUS_30400 28370 29674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 29688 30497 gene locus_tag LOCUS_30410 29688 30497 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_30410 30525 31694 gene locus_tag LOCUS_30420 30525 31694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 31727 32422 gene locus_tag LOCUS_30430 31727 32422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 32436 33266 gene locus_tag LOCUS_30440 32436 33266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 33290 34381 gene locus_tag LOCUS_30450 33290 34381 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_30450 36360 35206 gene locus_tag LOCUS_30460 36360 35206 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_30460 40701 36373 gene locus_tag LOCUS_30470 40701 36373 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_30470 42498 41125 gene locus_tag LOCUS_30480 42498 41125 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_30480 43188 42520 gene locus_tag LOCUS_30490 43188 42520 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_30490 43913 43485 gene locus_tag LOCUS_30500 43913 43485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 44110 45090 gene locus_tag LOCUS_30510 gene trxB 44110 45090 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_30510 45191 45266 gene locus_tag LOCUS_t00340 45191 45266 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 45515 46774 gene locus_tag LOCUS_30520 45515 46774 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_30520 46967 47049 gene locus_tag LOCUS_t00350 46967 47049 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 47603 47271 gene locus_tag LOCUS_30530 47603 47271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 47890 50499 gene locus_tag LOCUS_30540 47890 50499 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_30540 52102 53010 gene locus_tag LOCUS_30550 52102 53010 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_30550 54028 53288 gene locus_tag LOCUS_30560 54028 53288 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_30560 54178 55329 gene locus_tag LOCUS_30570 54178 55329 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_30570 55368 57155 gene locus_tag LOCUS_30580 55368 57155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 57176 57343 gene locus_tag LOCUS_30590 57176 57343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 57464 59134 gene locus_tag LOCUS_30600 57464 59134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 59653 62880 gene locus_tag LOCUS_30610 59653 62880 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_30610 62893 64509 gene locus_tag LOCUS_30620 62893 64509 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_30620 64529 64939 gene locus_tag LOCUS_30630 64529 64939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 65122 66030 gene locus_tag LOCUS_30640 65122 66030 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_30640 66302 67195 gene locus_tag LOCUS_30650 66302 67195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 67206 68330 gene locus_tag LOCUS_30660 67206 68330 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088955.1 protein_id gnl|my_center|LOCUS_30660 68337 69146 gene locus_tag LOCUS_30670 68337 69146 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_30670 69152 70351 gene locus_tag LOCUS_30680 69152 70351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_30680 70396 71469 gene locus_tag LOCUS_30690 70396 71469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30690 71453 72100 gene locus_tag LOCUS_30700 71453 72100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30700 72211 74238 gene locus_tag LOCUS_30710 72211 74238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 72876 73049 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 74328 74633 gene locus_tag LOCUS_30720 74328 74633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 74648 75517 gene locus_tag LOCUS_30730 74648 75517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_30730 75586 77286 gene locus_tag LOCUS_30740 75586 77286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 78134 78370 gene locus_tag LOCUS_30750 78134 78370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 78926 79996 gene locus_tag LOCUS_30760 78926 79996 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence10 <1 796 gene locus_tag LOCUS_30770 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330748.1:glucosamine-6-phosphate deaminase 1371 1045 gene locus_tag LOCUS_30780 1371 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 2623 1394 gene locus_tag LOCUS_30790 2623 1394 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119270.1 protein_id gnl|my_center|LOCUS_30790 4880 2739 gene locus_tag LOCUS_30800 4880 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 6011 4914 gene locus_tag LOCUS_30810 6011 4914 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_30810 7193 6282 gene locus_tag LOCUS_30820 7193 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 8592 7225 gene locus_tag LOCUS_30830 8592 7225 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767298.1 protein_id gnl|my_center|LOCUS_30830 9993 8614 gene locus_tag LOCUS_30840 9993 8614 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_30840 11554 10076 gene locus_tag LOCUS_30850 11554 10076 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_30850 14815 11564 gene locus_tag LOCUS_30860 14815 11564 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_30860 16142 15042 gene locus_tag LOCUS_30870 16142 15042 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_30870 16357 17400 gene locus_tag LOCUS_30880 16357 17400 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_30880 18037 17402 gene locus_tag LOCUS_30890 18037 17402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 18384 18971 gene locus_tag LOCUS_30900 18384 18971 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_30900 19047 19667 gene locus_tag LOCUS_30910 19047 19667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 19679 20080 gene locus_tag LOCUS_30920 19679 20080 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097334.1 protein_id gnl|my_center|LOCUS_30920 20091 20540 gene locus_tag LOCUS_30930 20091 20540 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721609.1 protein_id gnl|my_center|LOCUS_30930 20547 21281 gene locus_tag LOCUS_30940 20547 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 21283 21912 gene locus_tag LOCUS_30950 21283 21912 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_30950 21982 23202 gene locus_tag LOCUS_30960 21982 23202 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097845.1 protein_id gnl|my_center|LOCUS_30960 23238 23813 gene locus_tag LOCUS_30970 23238 23813 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_30970 24748 23843 gene locus_tag LOCUS_30980 gene frlD 24748 23843 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853351.1 protein_id gnl|my_center|LOCUS_30980 25208 24855 gene locus_tag LOCUS_30990 25208 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 25927 25268 gene locus_tag LOCUS_31000 25927 25268 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947229.1 protein_id gnl|my_center|LOCUS_31000 27132 25924 gene locus_tag LOCUS_31010 27132 25924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 28408 27209 gene locus_tag LOCUS_31020 28408 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 28895 28410 gene locus_tag LOCUS_31030 28895 28410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 30028 28901 gene locus_tag LOCUS_31040 30028 28901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 33200 30030 gene locus_tag LOCUS_31050 33200 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 34075 33197 gene locus_tag LOCUS_31060 34075 33197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921395.1 protein_id gnl|my_center|LOCUS_31060 35217 34072 gene locus_tag LOCUS_31070 35217 34072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 35578 35234 gene locus_tag LOCUS_31080 35578 35234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 36684 35593 gene locus_tag LOCUS_31090 36684 35593 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_31090 37503 36811 gene locus_tag LOCUS_31100 37503 36811 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_31100 38519 37818 gene locus_tag LOCUS_31110 38519 37818 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463805.1 protein_id gnl|my_center|LOCUS_31110 43941 38512 gene locus_tag LOCUS_31120 43941 38512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 45516 43951 gene locus_tag LOCUS_31130 45516 43951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071655.1 protein_id gnl|my_center|LOCUS_31130 50006 45519 gene locus_tag LOCUS_31140 50006 45519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 51406 49991 gene locus_tag LOCUS_31150 51406 49991 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071653.1 protein_id gnl|my_center|LOCUS_31150 53451 51403 gene locus_tag LOCUS_31160 53451 51403 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_31160 54301 53459 gene locus_tag LOCUS_31170 54301 53459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 55283 54279 gene locus_tag LOCUS_31180 55283 54279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 55785 55567 gene locus_tag LOCUS_31190 55785 55567 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_31190 55938 57101 gene locus_tag LOCUS_31200 55938 57101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 57101 57466 gene locus_tag LOCUS_31210 57101 57466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 59571 57577 gene locus_tag LOCUS_31220 59571 57577 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679307.1 protein_id gnl|my_center|LOCUS_31220 61396 59552 gene locus_tag LOCUS_31230 61396 59552 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679308.1 protein_id gnl|my_center|LOCUS_31230 61920 61606 gene locus_tag LOCUS_31240 61920 61606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 62542 61937 gene locus_tag LOCUS_31250 62542 61937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 62717 62726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence11 <1 2592 gene locus_tag LOCUS_31260 <1 2592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein 2604 3530 gene locus_tag LOCUS_31270 2604 3530 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_31270 3594 5507 gene locus_tag LOCUS_31280 3594 5507 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_31280 5576 7495 gene locus_tag LOCUS_31290 5576 7495 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_31290 8230 7652 gene locus_tag LOCUS_31300 8230 7652 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765993.1 protein_id gnl|my_center|LOCUS_31300 9515 8322 gene locus_tag LOCUS_31310 gene ackA 9515 8322 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_31310 11610 9517 gene locus_tag LOCUS_31320 gene pta 11610 9517 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_31320 11817 13058 gene locus_tag LOCUS_31330 gene hutI 11817 13058 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_31330 14006 13122 gene locus_tag LOCUS_31340 14006 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 14127 15146 gene locus_tag LOCUS_31350 14127 15146 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_31350 15721 15143 gene locus_tag LOCUS_31360 gene nudK 15721 15143 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_31360 15906 16145 gene locus_tag LOCUS_31370 15906 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 17881 16190 gene locus_tag LOCUS_31380 gene ettA 17881 16190 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_31380 18063 17881 gene locus_tag LOCUS_31390 18063 17881 CDS product CAL67264 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_31390 19425 18262 gene locus_tag LOCUS_31400 19425 18262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 20320 19598 gene locus_tag LOCUS_31410 20320 19598 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_31410 20784 20347 gene locus_tag LOCUS_31420 20784 20347 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_31420 21075 20794 gene locus_tag LOCUS_31430 21075 20794 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529296.1 protein_id gnl|my_center|LOCUS_31430 21608 21078 gene locus_tag LOCUS_31440 21608 21078 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_31440 21759 23387 gene locus_tag LOCUS_31450 21759 23387 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_31450 24469 23384 gene locus_tag LOCUS_31460 24469 23384 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_31460 25438 24497 gene locus_tag LOCUS_31470 25438 24497 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_31470 26340 25441 gene locus_tag LOCUS_31480 26340 25441 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_31480 27216 26539 gene locus_tag LOCUS_31490 27216 26539 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_31490 28162 27260 gene locus_tag LOCUS_31500 gene menA 28162 27260 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_31500 29007 28162 gene locus_tag LOCUS_31510 29007 28162 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962642.1 protein_id gnl|my_center|LOCUS_31510 30167 29502 gene locus_tag LOCUS_31520 gene ung 30167 29502 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_31520 30232 31725 gene locus_tag LOCUS_31530 30232 31725 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949006.1 protein_id gnl|my_center|LOCUS_31530 32733 31729 gene locus_tag LOCUS_31540 gene holA 32733 31729 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_31540 32928 33284 gene locus_tag LOCUS_31550 32928 33284 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_31550 33281 34270 gene locus_tag LOCUS_31560 33281 34270 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_31560 34365 35204 gene locus_tag LOCUS_31570 34365 35204 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_31570 35894 35274 gene locus_tag LOCUS_31580 35894 35274 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_31580 36090 37016 gene locus_tag LOCUS_31590 36090 37016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 37013 37981 gene locus_tag LOCUS_31600 37013 37981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 40316 37986 gene locus_tag LOCUS_31610 40316 37986 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963024.1 protein_id gnl|my_center|LOCUS_31610 40455 42020 gene locus_tag LOCUS_31620 40455 42020 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_31620 42032 42553 gene locus_tag LOCUS_31630 42032 42553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_31630 43470 42556 gene locus_tag LOCUS_31640 43470 42556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 44375 43473 gene locus_tag LOCUS_31650 44375 43473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 46360 44372 gene locus_tag LOCUS_31660 46360 44372 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963153.1 protein_id gnl|my_center|LOCUS_31660 46437 48539 gene locus_tag LOCUS_31670 gene recG 46437 48539 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_31670 48668 48898 gene locus_tag LOCUS_31680 48668 48898 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_31680 48916 50040 gene locus_tag LOCUS_31690 48916 50040 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_31690 49994 50767 gene locus_tag LOCUS_31700 49994 50767 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_31700 50773 51342 gene locus_tag LOCUS_31710 50773 51342 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_31710 52465 51428 gene locus_tag LOCUS_31720 52465 51428 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_31720 52739 55168 gene locus_tag LOCUS_31730 gene pheT 52739 55168 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_31730 55310 55236 gene locus_tag LOCUS_t00360 55310 55236 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 56177 55455 gene locus_tag LOCUS_31740 gene bshB1 56177 55455 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_31740 56563 58191 gene locus_tag LOCUS_31750 gene pckA 56563 58191 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108804.1 protein_id gnl|my_center|LOCUS_31750 58325 58972 gene locus_tag LOCUS_31760 58325 58972 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964078.1 protein_id gnl|my_center|LOCUS_31760 59319 58969 gene locus_tag LOCUS_31770 59319 58969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence12 1012 335 gene locus_tag LOCUS_31780 1012 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1217 1384 gene locus_tag LOCUS_31790 1217 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 1892 1641 gene locus_tag LOCUS_31800 1892 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 4570 2345 gene locus_tag LOCUS_31810 4570 2345 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 protein_id gnl|my_center|LOCUS_31810 4933 4598 gene locus_tag LOCUS_31820 4933 4598 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852534.1 protein_id gnl|my_center|LOCUS_31820 5186 4947 gene locus_tag LOCUS_31830 5186 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 6176 7120 gene locus_tag LOCUS_31840 6176 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 7656 7582 gene locus_tag LOCUS_t00370 7656 7582 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7786 8178 gene locus_tag LOCUS_31850 7786 8178 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_31850 8250 9092 gene locus_tag LOCUS_31860 8250 9092 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_31860 9649 9089 gene locus_tag LOCUS_31870 9649 9089 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_31870 10042 9770 gene locus_tag LOCUS_31880 10042 9770 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_31880 11182 10235 gene locus_tag LOCUS_31890 gene fmt 11182 10235 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964109.1 protein_id gnl|my_center|LOCUS_31890 13086 11179 gene locus_tag LOCUS_31900 13086 11179 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_31900 13647 13093 gene locus_tag LOCUS_31910 13647 13093 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_31910 13683 14030 gene locus_tag LOCUS_31920 13683 14030 CDS product DUF493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_31920 14100 14747 gene locus_tag LOCUS_31930 14100 14747 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_31930 14757 16067 gene locus_tag LOCUS_31940 gene murA 14757 16067 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_31940 17135 16095 gene locus_tag LOCUS_31950 17135 16095 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946852.1 protein_id gnl|my_center|LOCUS_31950 18310 17234 gene locus_tag LOCUS_31960 18310 17234 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967105.1 protein_id gnl|my_center|LOCUS_31960 18932 18336 gene locus_tag LOCUS_31970 18932 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 19156 21231 gene locus_tag LOCUS_31980 19156 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 21555 21286 gene locus_tag LOCUS_31990 21555 21286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 22887 21583 gene locus_tag LOCUS_32000 22887 21583 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_32000 23350 22889 gene locus_tag LOCUS_32010 23350 22889 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_32010 23985 23812 gene locus_tag LOCUS_32020 23985 23812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 24533 23988 gene locus_tag LOCUS_32030 24533 23988 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230784.1 protein_id gnl|my_center|LOCUS_32030 25221 24538 gene locus_tag LOCUS_32040 25221 24538 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_32040 25930 25229 gene locus_tag LOCUS_32050 gene folE 25930 25229 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962795.1 protein_id gnl|my_center|LOCUS_32050 26258 25986 gene locus_tag LOCUS_32060 26258 25986 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_32060 26686 26258 gene locus_tag LOCUS_32070 26686 26258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 28288 26819 gene locus_tag LOCUS_32080 28288 26819 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_32080 29810 28278 gene locus_tag LOCUS_32090 29810 28278 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503887.1 protein_id gnl|my_center|LOCUS_32090 31056 29812 gene locus_tag LOCUS_32100 31056 29812 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_32100 32658 31234 gene locus_tag LOCUS_32110 32658 31234 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_32110 33326 32706 gene locus_tag LOCUS_32120 33326 32706 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_32120 34640 33330 gene locus_tag LOCUS_32130 34640 33330 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_32130 35264 34650 gene locus_tag LOCUS_32140 35264 34650 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_32140 35529 36377 gene locus_tag LOCUS_32150 35529 36377 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_32150 36669 36469 gene locus_tag LOCUS_32160 36669 36469 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_32160 37135 36659 gene locus_tag LOCUS_32170 37135 36659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 38240 37245 gene locus_tag LOCUS_32180 38240 37245 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_32180 39903 38209 gene locus_tag LOCUS_32190 39903 38209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 42545 40020 gene locus_tag LOCUS_32200 42545 40020 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_32200 43703 42633 gene locus_tag LOCUS_32210 gene corA 43703 42633 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965157.1 protein_id gnl|my_center|LOCUS_32210 44265 43735 gene locus_tag LOCUS_32220 44265 43735 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 protein_id gnl|my_center|LOCUS_32220 44896 44309 gene locus_tag LOCUS_32230 44896 44309 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_32230 45771 44896 gene locus_tag LOCUS_32240 45771 44896 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_32240 46696 46166 gene locus_tag LOCUS_32250 46696 46166 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_32250 47444 46677 gene locus_tag LOCUS_32260 47444 46677 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_32260 47505 47894 gene locus_tag LOCUS_32270 47505 47894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 48071 51184 gene locus_tag LOCUS_32280 gene ccsA 48071 51184 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_32280 51344 51718 gene locus_tag LOCUS_32290 51344 51718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 52451 51735 gene locus_tag LOCUS_32300 52451 51735 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922396.1 protein_id gnl|my_center|LOCUS_32300 53047 52445 gene locus_tag LOCUS_32310 53047 52445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 53293 53520 gene locus_tag LOCUS_32320 53293 53520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence13 228 422 gene locus_tag LOCUS_32330 228 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 621 836 gene locus_tag LOCUS_32340 621 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1636 1028 gene locus_tag LOCUS_32350 1636 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3890 2688 gene locus_tag LOCUS_32360 3890 2688 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628869.1 protein_id gnl|my_center|LOCUS_32360 4301 3930 gene locus_tag LOCUS_32370 4301 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 6469 4427 gene locus_tag LOCUS_32380 6469 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 7509 6871 gene locus_tag LOCUS_32390 7509 6871 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_32390 12056 7512 gene locus_tag LOCUS_32400 12056 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 16437 13861 gene locus_tag LOCUS_32410 16437 13861 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_32410 17338 16424 gene locus_tag LOCUS_32420 17338 16424 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791368.1 protein_id gnl|my_center|LOCUS_32420 17919 17398 gene locus_tag LOCUS_32430 17919 17398 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_32430 18155 19171 gene locus_tag LOCUS_32440 18155 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 19340 20122 gene locus_tag LOCUS_32450 19340 20122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 20162 20746 gene locus_tag LOCUS_32460 20162 20746 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_32460 20921 21388 gene locus_tag LOCUS_32470 20921 21388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 22632 21604 gene locus_tag LOCUS_32480 22632 21604 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362024.1 protein_id gnl|my_center|LOCUS_32480 23647 23390 gene locus_tag LOCUS_32490 23647 23390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 24518 23964 gene locus_tag LOCUS_32500 24518 23964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence14 163 507 gene locus_tag LOCUS_32510 163 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 665 1183 gene locus_tag LOCUS_32520 665 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 1345 1809 gene locus_tag LOCUS_32530 1345 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 1976 2722 gene locus_tag LOCUS_32540 1976 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 2892 3347 gene locus_tag LOCUS_32550 2892 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 3492 4475 gene locus_tag LOCUS_32560 3492 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 4633 5094 gene locus_tag LOCUS_32570 4633 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 5345 5674 gene locus_tag LOCUS_32580 5345 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 5833 6525 gene locus_tag LOCUS_32590 5833 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 8190 6613 gene locus_tag LOCUS_32600 8190 6613 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362017.1 protein_id gnl|my_center|LOCUS_32600 8409 9896 gene locus_tag LOCUS_32610 8409 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 9903 10238 gene locus_tag LOCUS_32620 9903 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 10402 10929 gene locus_tag LOCUS_32630 10402 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 >Feature sequence15 119 421 gene locus_tag LOCUS_32640 119 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 574 1494 gene locus_tag LOCUS_32650 574 1494 CDS product DUF2711 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242887.1 protein_id gnl|my_center|LOCUS_32650 1552 2076 gene locus_tag LOCUS_32660 1552 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 2238 2678 gene locus_tag LOCUS_32670 2238 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 2844 3623 gene locus_tag LOCUS_32680 2844 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 3774 4262 gene locus_tag LOCUS_32690 3774 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 4374 4946 gene locus_tag LOCUS_32700 4374 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 5106 5633 gene locus_tag LOCUS_32710 5106 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence16 411 1924 gene locus_tag LOCUS_r00020 411 1924 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2071 2145 gene locus_tag LOCUS_t00380 2071 2145 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2304 2378 gene locus_tag LOCUS_t00390 2304 2378 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2709 5519 gene locus_tag LOCUS_r00030 2709 5519 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5670 5772 gene locus_tag LOCUS_r00040 5670 5772 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence17 166 780 gene locus_tag LOCUS_32720 166 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 934 1437 gene locus_tag LOCUS_32730 934 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 1625 1990 gene locus_tag LOCUS_32740 1625 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 2158 2829 gene locus_tag LOCUS_32750 2158 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 2980 3366 gene locus_tag LOCUS_32760 2980 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 3540 4004 gene locus_tag LOCUS_32770 3540 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence18 701 225 gene locus_tag LOCUS_32780 701 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 1325 858 gene locus_tag LOCUS_32790 1325 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 1382 1504 gene locus_tag LOCUS_32800 1382 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 2685 1501 gene locus_tag LOCUS_32810 2685 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence19 1326 1414 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence20 118 786 gene locus_tag LOCUS_32820 118 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1020 1574 gene locus_tag LOCUS_32830 1020 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence21 452 213 gene locus_tag LOCUS_32840 452 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 1174 662 gene locus_tag LOCUS_32850 1174 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence22 >Feature sequence23 >Feature sequence24 214 702 gene locus_tag LOCUS_32860 214 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 789 929 gene locus_tag LOCUS_32870 789 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence25 >Feature sequence26 >Feature sequence27 37 645 gene locus_tag LOCUS_32880 37 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence28 >Feature sequence29 114 527 gene locus_tag LOCUS_32890 114 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence30 152 523 gene locus_tag LOCUS_32900 152 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence31 >Feature sequence32 >Feature sequence33 509 12 gene locus_tag LOCUS_32910 509 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence34 496 125 gene locus_tag LOCUS_32920 496 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920