>Feature sequence1 299 1018 gene locus_tag LOCUS_00010 299 1018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979631.1 protein_id gnl|my_center|LOCUS_00010 999 2408 gene locus_tag LOCUS_00020 999 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2456 3040 gene locus_tag LOCUS_00030 2456 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4668 3037 gene locus_tag LOCUS_00040 4668 3037 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980485.1 protein_id gnl|my_center|LOCUS_00040 5761 4736 gene locus_tag LOCUS_00050 5761 4736 CDS product PTO1314 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980496.1 protein_id gnl|my_center|LOCUS_00050 6749 5880 gene locus_tag LOCUS_00060 6749 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7022 9667 gene locus_tag LOCUS_00070 gene ppdK 7022 9667 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_00070 10271 9885 gene locus_tag LOCUS_00080 10271 9885 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_00080 10557 10486 gene locus_tag LOCUS_t00010 10557 10486 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12039 10738 gene locus_tag LOCUS_00090 gene gdhA 12039 10738 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_00090 12413 13186 gene locus_tag LOCUS_00100 12413 13186 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_00100 13536 13460 gene locus_tag LOCUS_t00020 13536 13460 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13620 14099 gene locus_tag LOCUS_00110 13620 14099 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_00110 14096 14806 gene locus_tag LOCUS_00120 gene queC 14096 14806 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_00120 15784 14810 gene locus_tag LOCUS_00130 gene mdh 15784 14810 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528846.1 protein_id gnl|my_center|LOCUS_00130 15897 16787 gene locus_tag LOCUS_00140 15897 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16780 18225 gene locus_tag LOCUS_00150 16780 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18500 18210 gene locus_tag LOCUS_00160 18500 18210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18555 19535 gene locus_tag LOCUS_00170 gene hemB 18555 19535 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 protein_id gnl|my_center|LOCUS_00170 19610 19948 gene locus_tag LOCUS_00180 19610 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20013 20300 gene locus_tag LOCUS_00190 20013 20300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20302 21129 gene locus_tag LOCUS_00200 gene tatC 20302 21129 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_00200 21819 21100 gene locus_tag LOCUS_00210 21819 21100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22075 21821 gene locus_tag LOCUS_00220 22075 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22431 22072 gene locus_tag LOCUS_00230 22431 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23892 22435 gene locus_tag LOCUS_00240 gene fpoN 23892 22435 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_00240 25451 23889 gene locus_tag LOCUS_00250 gene fpoM 25451 23889 CDS product F(420)H(2) dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_00250 27390 25453 gene locus_tag LOCUS_00260 gene fpoL 27390 25453 CDS product F420H2 dehydrogenase subunit FpoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021518.1 protein_id gnl|my_center|LOCUS_00260 27694 27395 gene locus_tag LOCUS_00270 gene fpoK 27694 27395 CDS product F420H2 dehydrogenase subunit FpoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589525.1 protein_id gnl|my_center|LOCUS_00270 27912 27694 gene locus_tag LOCUS_00280 27912 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28153 27905 gene locus_tag LOCUS_00290 28153 27905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 28584 28150 gene locus_tag LOCUS_00300 28584 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29621 28581 gene locus_tag LOCUS_00310 gene nuoH 29621 28581 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328865.1 protein_id gnl|my_center|LOCUS_00310 30745 29618 gene locus_tag LOCUS_00320 30745 29618 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257853.1 protein_id gnl|my_center|LOCUS_00320 31203 30748 gene locus_tag LOCUS_00330 31203 30748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31676 31209 gene locus_tag LOCUS_00340 gene nuoB 31676 31209 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 protein_id gnl|my_center|LOCUS_00340 32110 31673 gene locus_tag LOCUS_00350 32110 31673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 34041 32227 gene locus_tag LOCUS_00360 gene gatE 34041 32227 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979281.1 protein_id gnl|my_center|LOCUS_00360 35249 34038 gene locus_tag LOCUS_00370 gene gatD 35249 34038 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876345.1 protein_id gnl|my_center|LOCUS_00370 36061 35261 gene locus_tag LOCUS_00380 36061 35261 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880910.1 protein_id gnl|my_center|LOCUS_00380 37203 36061 gene locus_tag LOCUS_00390 37203 36061 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_00390 37835 37251 gene locus_tag LOCUS_00400 37835 37251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 38254 37832 gene locus_tag LOCUS_00410 38254 37832 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_00410 39461 38319 gene locus_tag LOCUS_00420 gene priS 39461 38319 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_00420 39548 42886 gene locus_tag LOCUS_00430 39548 42886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 43918 42887 gene locus_tag LOCUS_00440 43918 42887 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868029.1 protein_id gnl|my_center|LOCUS_00440 44809 43919 gene locus_tag LOCUS_00450 44809 43919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 45596 44811 gene locus_tag LOCUS_00460 45596 44811 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941524.1 protein_id gnl|my_center|LOCUS_00460 47203 45668 gene locus_tag LOCUS_00470 47203 45668 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_00470 48945 47335 gene locus_tag LOCUS_00480 48945 47335 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977995.1 protein_id gnl|my_center|LOCUS_00480 50046 49039 gene locus_tag LOCUS_00490 gene amrS 50046 49039 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_00490 50948 50139 gene locus_tag LOCUS_00500 gene amrB 50948 50139 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_00500 51021 51584 gene locus_tag LOCUS_00510 51021 51584 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_00510 51734 52942 gene locus_tag LOCUS_00520 51734 52942 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979148.1 protein_id gnl|my_center|LOCUS_00520 52949 53728 gene locus_tag LOCUS_00530 gene thiE 52949 53728 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086979.1 protein_id gnl|my_center|LOCUS_00530 53730 54404 gene locus_tag LOCUS_00540 gene thiE 53730 54404 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368782.1 protein_id gnl|my_center|LOCUS_00540 54350 54547 gene locus_tag LOCUS_00550 54350 54547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 54748 54820 gene locus_tag LOCUS_t00030 54748 54820 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 55272 55466 gene locus_tag LOCUS_00560 55272 55466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 56968 55922 gene locus_tag LOCUS_00570 gene tcuB 56968 55922 CDS product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 protein_id gnl|my_center|LOCUS_00570 58313 56961 gene locus_tag LOCUS_00580 gene tcuA 58313 56961 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813511.1 protein_id gnl|my_center|LOCUS_00580 59898 58762 gene locus_tag LOCUS_00590 59898 58762 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390958.1 protein_id gnl|my_center|LOCUS_00590 60615 60699 gene locus_tag LOCUS_t00040 60615 60699 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60902 61141 gene locus_tag LOCUS_00600 60902 61141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 61248 61640 gene locus_tag LOCUS_00610 61248 61640 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_00610 61736 62005 gene locus_tag LOCUS_00620 gene albA 61736 62005 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_00620 62119 63111 gene locus_tag LOCUS_00630 62119 63111 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_00630 63117 64277 gene locus_tag LOCUS_00640 63117 64277 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_00640 64280 64483 gene locus_tag LOCUS_00650 64280 64483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 64822 64490 gene locus_tag LOCUS_00660 64822 64490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 65304 64819 gene locus_tag LOCUS_00670 65304 64819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 65561 66283 gene locus_tag LOCUS_00680 65561 66283 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_00680 66280 67326 gene locus_tag LOCUS_00690 gene fni 66280 67326 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_00690 67323 67853 gene locus_tag LOCUS_00700 67323 67853 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978535.1 protein_id gnl|my_center|LOCUS_00700 68056 68286 gene locus_tag LOCUS_00710 68056 68286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 68293 68859 gene locus_tag LOCUS_00720 68293 68859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 68860 69921 gene locus_tag LOCUS_00730 68860 69921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 69924 70253 gene locus_tag LOCUS_00740 69924 70253 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 protein_id gnl|my_center|LOCUS_00740 70261 72015 gene locus_tag LOCUS_00750 70261 72015 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_00750 72017 73399 gene locus_tag LOCUS_00760 72017 73399 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_00760 73405 74052 gene locus_tag LOCUS_00770 73405 74052 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 protein_id gnl|my_center|LOCUS_00770 74036 74215 gene locus_tag LOCUS_00780 74036 74215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 74217 74540 gene locus_tag LOCUS_00790 74217 74540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 74546 76561 gene locus_tag LOCUS_00800 74546 76561 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_00800 77125 76571 gene locus_tag LOCUS_00810 77125 76571 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_00810 77927 77253 gene locus_tag LOCUS_00820 77927 77253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 77937 79760 gene locus_tag LOCUS_00830 77937 79760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 80704 79763 gene locus_tag LOCUS_00840 80704 79763 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250659.1 protein_id gnl|my_center|LOCUS_00840 80814 81965 gene locus_tag LOCUS_00850 80814 81965 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000501370.1 protein_id gnl|my_center|LOCUS_00850 81962 82891 gene locus_tag LOCUS_00860 81962 82891 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967072.1 protein_id gnl|my_center|LOCUS_00860 83549 82893 gene locus_tag LOCUS_00870 83549 82893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 83618 84430 gene locus_tag LOCUS_00880 83618 84430 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007467.1 protein_id gnl|my_center|LOCUS_00880 84788 85390 gene locus_tag LOCUS_00890 84788 85390 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978815.1 protein_id gnl|my_center|LOCUS_00890 85476 86048 gene locus_tag LOCUS_00900 85476 86048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 86292 86050 gene locus_tag LOCUS_00910 86292 86050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 86588 87658 gene locus_tag LOCUS_00920 86588 87658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 87633 89099 gene locus_tag LOCUS_00930 87633 89099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 89066 90427 gene locus_tag LOCUS_00940 89066 90427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 91028 94030 gene locus_tag LOCUS_00950 91028 94030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 94132 94878 gene locus_tag LOCUS_00960 94132 94878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 94969 95910 gene locus_tag LOCUS_00970 94969 95910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 95956 97008 gene locus_tag LOCUS_00980 gene gmd 95956 97008 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880676.1 protein_id gnl|my_center|LOCUS_00980 97286 97963 gene locus_tag LOCUS_00990 97286 97963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 98020 98310 gene locus_tag LOCUS_01000 98020 98310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 99416 98586 gene locus_tag LOCUS_01010 99416 98586 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_01010 99652 99579 gene locus_tag LOCUS_t00050 99652 99579 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 99983 101416 gene locus_tag LOCUS_01020 99983 101416 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892504.1 protein_id gnl|my_center|LOCUS_01020 101633 102940 gene locus_tag LOCUS_01030 101633 102940 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978029.1 protein_id gnl|my_center|LOCUS_01030 102998 103222 gene locus_tag LOCUS_01040 102998 103222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 103906 103235 gene locus_tag LOCUS_01050 103906 103235 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980647.1 protein_id gnl|my_center|LOCUS_01050 105152 104019 gene locus_tag LOCUS_01060 105152 104019 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547446.1 protein_id gnl|my_center|LOCUS_01060 105290 105652 gene locus_tag LOCUS_01070 105290 105652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 106014 105658 gene locus_tag LOCUS_01080 106014 105658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 107050 106124 gene locus_tag LOCUS_01090 107050 106124 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_01090 107307 108647 gene locus_tag LOCUS_01100 107307 108647 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978029.1 protein_id gnl|my_center|LOCUS_01100 108975 109823 gene locus_tag LOCUS_01110 108975 109823 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867466.1 protein_id gnl|my_center|LOCUS_01110 109813 111270 gene locus_tag LOCUS_01120 109813 111270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 111479 111267 gene locus_tag LOCUS_01130 111479 111267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 111857 111480 gene locus_tag LOCUS_01140 111857 111480 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_01140 113110 111854 gene locus_tag LOCUS_01150 113110 111854 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_01150 114332 113103 gene locus_tag LOCUS_01160 114332 113103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 115778 114336 gene locus_tag LOCUS_01170 gene sufB 115778 114336 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356769.1 protein_id gnl|my_center|LOCUS_01170 116522 115779 gene locus_tag LOCUS_01180 gene sufC 116522 115779 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_01180 116625 117293 gene locus_tag LOCUS_01190 116625 117293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 117910 117302 gene locus_tag LOCUS_01200 117910 117302 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_01200 118024 119223 gene locus_tag LOCUS_01210 gene agl3 118024 119223 CDS product UDP-sulfoquinovose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846779.1 protein_id gnl|my_center|LOCUS_01210 119927 119193 gene locus_tag LOCUS_01220 gene rfbA 119927 119193 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842260.1 protein_id gnl|my_center|LOCUS_01220 120082 121329 gene locus_tag LOCUS_01230 120082 121329 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_01230 121332 121739 gene locus_tag LOCUS_01240 121332 121739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 121742 122629 gene locus_tag LOCUS_01250 gene ftsY 121742 122629 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249604.1 protein_id gnl|my_center|LOCUS_01250 123292 122618 gene locus_tag LOCUS_01260 123292 122618 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_01260 124598 123396 gene locus_tag LOCUS_01270 124598 123396 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_01270 125449 124595 gene locus_tag LOCUS_01280 125449 124595 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_01280 126219 125509 gene locus_tag LOCUS_01290 126219 125509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 126455 126868 gene locus_tag LOCUS_01300 126455 126868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 126855 128051 gene locus_tag LOCUS_01310 126855 128051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 128048 128794 gene locus_tag LOCUS_01320 128048 128794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 129483 128773 gene locus_tag LOCUS_01330 129483 128773 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_01330 129629 131059 gene locus_tag LOCUS_01340 129629 131059 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_01340 131063 131929 gene locus_tag LOCUS_01350 gene ubiA 131063 131929 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930826.1 protein_id gnl|my_center|LOCUS_01350 132988 131906 gene locus_tag LOCUS_01360 132988 131906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799743.1 protein_id gnl|my_center|LOCUS_01360 133469 133158 gene locus_tag LOCUS_01370 133469 133158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 134010 133462 gene locus_tag LOCUS_01380 134010 133462 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_01380 134171 135376 gene locus_tag LOCUS_01390 134171 135376 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146541.1 protein_id gnl|my_center|LOCUS_01390 135860 135399 gene locus_tag LOCUS_01400 gene rimI 135860 135399 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240337.1 protein_id gnl|my_center|LOCUS_01400 136386 136562 gene locus_tag LOCUS_01410 136386 136562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 138396 136594 gene locus_tag LOCUS_01420 138396 136594 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980495.1 protein_id gnl|my_center|LOCUS_01420 140634 138772 gene locus_tag LOCUS_01430 140634 138772 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249735.1 protein_id gnl|my_center|LOCUS_01430 141392 140640 gene locus_tag LOCUS_01440 141392 140640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 142813 141449 gene locus_tag LOCUS_01450 142813 141449 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867854.1 protein_id gnl|my_center|LOCUS_01450 142970 143956 gene locus_tag LOCUS_01460 142970 143956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 143953 144519 gene locus_tag LOCUS_01470 143953 144519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 144540 145118 gene locus_tag LOCUS_01480 144540 145118 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978770.1 protein_id gnl|my_center|LOCUS_01480 145155 145610 gene locus_tag LOCUS_01490 145155 145610 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_01490 145621 145968 gene locus_tag LOCUS_01500 145621 145968 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870196.1 protein_id gnl|my_center|LOCUS_01500 145968 146123 gene locus_tag LOCUS_01510 145968 146123 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250270.1 protein_id gnl|my_center|LOCUS_01510 146134 146406 gene locus_tag LOCUS_01520 146134 146406 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_01520 146403 147062 gene locus_tag LOCUS_01530 146403 147062 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879557.1 protein_id gnl|my_center|LOCUS_01530 147110 147604 gene locus_tag LOCUS_01540 147110 147604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 148114 147578 gene locus_tag LOCUS_01550 gene pyrE 148114 147578 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_01550 148300 149565 gene locus_tag LOCUS_01560 148300 149565 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978353.1 protein_id gnl|my_center|LOCUS_01560 149891 149559 gene locus_tag LOCUS_01570 149891 149559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 150173 151501 gene locus_tag LOCUS_01580 gene hisS 150173 151501 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_01580 151532 151765 gene locus_tag LOCUS_01590 151532 151765 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_01590 151779 152096 gene locus_tag LOCUS_01600 151779 152096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 152146 153081 gene locus_tag LOCUS_01610 gene guaA 152146 153081 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_01610 153171 153782 gene locus_tag LOCUS_01620 gene rpsB 153171 153782 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_01620 154813 153911 gene locus_tag LOCUS_01630 154813 153911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 155336 154806 gene locus_tag LOCUS_01640 155336 154806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 155433 156638 gene locus_tag LOCUS_01650 155433 156638 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_01650 156640 157626 gene locus_tag LOCUS_01660 156640 157626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 158297 157650 gene locus_tag LOCUS_01670 158297 157650 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_01670 158457 158972 gene locus_tag LOCUS_01680 158457 158972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 159019 159324 gene locus_tag LOCUS_01690 159019 159324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 159705 160259 gene locus_tag LOCUS_01700 159705 160259 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_01700 161437 160256 gene locus_tag LOCUS_01710 gene truD 161437 160256 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251252.1 protein_id gnl|my_center|LOCUS_01710 162594 161500 gene locus_tag LOCUS_01720 gene mqnC 162594 161500 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763062.1 protein_id gnl|my_center|LOCUS_01720 162695 163810 gene locus_tag LOCUS_01730 162695 163810 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240397.1 protein_id gnl|my_center|LOCUS_01730 164549 163794 gene locus_tag LOCUS_01740 164549 163794 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980351.1 protein_id gnl|my_center|LOCUS_01740 164985 164536 gene locus_tag LOCUS_01750 164985 164536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 166625 164973 gene locus_tag LOCUS_01760 166625 164973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 167796 166618 gene locus_tag LOCUS_01770 167796 166618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 168285 167800 gene locus_tag LOCUS_01780 168285 167800 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117134.1 protein_id gnl|my_center|LOCUS_01780 168718 168269 gene locus_tag LOCUS_01790 gene moaC 168718 168269 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_01790 168968 168723 gene locus_tag LOCUS_01800 168968 168723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 170608 169016 gene locus_tag LOCUS_01810 170608 169016 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_01810 170667 171242 gene locus_tag LOCUS_01820 170667 171242 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_01820 171606 171974 gene locus_tag LOCUS_01830 171606 171974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 172800 171976 gene locus_tag LOCUS_01840 gene speE 172800 171976 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_01840 173154 173423 gene locus_tag LOCUS_01850 173154 173423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 173721 173431 gene locus_tag LOCUS_01860 173721 173431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 174747 173725 gene locus_tag LOCUS_01870 174747 173725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 175190 176554 gene locus_tag LOCUS_01880 gene dnaG 175190 176554 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_01880 176536 178035 gene locus_tag LOCUS_01890 176536 178035 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_01890 178081 179856 gene locus_tag LOCUS_01900 178081 179856 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_01900 179986 180579 gene locus_tag LOCUS_01910 179986 180579 CDS product regulator of amino acid metabolism, contains ACT domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147148.1 protein_id gnl|my_center|LOCUS_01910 180713 181570 gene locus_tag LOCUS_01920 180713 181570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 181575 182204 gene locus_tag LOCUS_01930 181575 182204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 182780 182175 gene locus_tag LOCUS_01940 182780 182175 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958173.1 protein_id gnl|my_center|LOCUS_01940 183160 182777 gene locus_tag LOCUS_01950 gene gcvH 183160 182777 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_01950 183412 183921 gene locus_tag LOCUS_01960 gene thpR 183412 183921 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 protein_id gnl|my_center|LOCUS_01960 184235 183909 gene locus_tag LOCUS_01970 184235 183909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 184359 185066 gene locus_tag LOCUS_01980 184359 185066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 185674 185039 gene locus_tag LOCUS_01990 185674 185039 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_01990 185974 186705 gene locus_tag LOCUS_02000 185974 186705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 186729 187634 gene locus_tag LOCUS_02010 186729 187634 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062386917.1 protein_id gnl|my_center|LOCUS_02010 187694 187948 gene locus_tag LOCUS_02020 187694 187948 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902484.1 protein_id gnl|my_center|LOCUS_02020 188128 188739 gene locus_tag LOCUS_02030 188128 188739 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978562.1 protein_id gnl|my_center|LOCUS_02030 188741 189076 gene locus_tag LOCUS_02040 188741 189076 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_02040 190356 189085 gene locus_tag LOCUS_02050 gene hemL 190356 189085 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_02050 191449 190310 gene locus_tag LOCUS_02060 gene hemA 191449 190310 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869638.1 protein_id gnl|my_center|LOCUS_02060 191895 191512 gene locus_tag LOCUS_02070 191895 191512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 192162 192401 gene locus_tag LOCUS_02080 192162 192401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 193076 192402 gene locus_tag LOCUS_02090 193076 192402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 193822 193073 gene locus_tag LOCUS_02100 193822 193073 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_02100 193934 194953 gene locus_tag LOCUS_02110 gene adhP 193934 194953 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978667.1 protein_id gnl|my_center|LOCUS_02110 195032 196714 gene locus_tag LOCUS_02120 195032 196714 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_02120 196722 197831 gene locus_tag LOCUS_02130 196722 197831 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_02130 199779 197803 gene locus_tag LOCUS_02140 199779 197803 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 protein_id gnl|my_center|LOCUS_02140 200014 199757 gene locus_tag LOCUS_02150 200014 199757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 200417 200007 gene locus_tag LOCUS_02160 200417 200007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 204679 200639 gene locus_tag LOCUS_02170 204679 200639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 205822 204740 gene locus_tag LOCUS_02180 205822 204740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 208614 206065 gene locus_tag LOCUS_02190 208614 206065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 208701 208774 gene locus_tag LOCUS_t00060 208701 208774 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 209262 211385 gene locus_tag LOCUS_02200 209262 211385 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980626.1 protein_id gnl|my_center|LOCUS_02200 212340 211924 gene locus_tag LOCUS_02210 212340 211924 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980631.1 protein_id gnl|my_center|LOCUS_02210 213280 212318 gene locus_tag LOCUS_02220 213280 212318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980630.1 protein_id gnl|my_center|LOCUS_02220 214238 213273 gene locus_tag LOCUS_02230 214238 213273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846816.1 protein_id gnl|my_center|LOCUS_02230 215198 214251 gene locus_tag LOCUS_02240 215198 214251 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980628.1 protein_id gnl|my_center|LOCUS_02240 216223 215195 gene locus_tag LOCUS_02250 216223 215195 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846815.1 protein_id gnl|my_center|LOCUS_02250 216685 217392 gene locus_tag LOCUS_02260 216685 217392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 218154 217471 gene locus_tag LOCUS_02270 218154 217471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 218331 219431 gene locus_tag LOCUS_02280 218331 219431 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_02280 219428 220252 gene locus_tag LOCUS_02290 219428 220252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 221064 220249 gene locus_tag LOCUS_02300 221064 220249 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_02300 221123 222214 gene locus_tag LOCUS_02310 gene menC 221123 222214 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_02310 222216 223319 gene locus_tag LOCUS_02320 222216 223319 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926069.1 protein_id gnl|my_center|LOCUS_02320 224726 223308 gene locus_tag LOCUS_02330 gene gcvPB 224726 223308 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_02330 226034 224727 gene locus_tag LOCUS_02340 gene gcvPA 226034 224727 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_02340 226126 227100 gene locus_tag LOCUS_02350 226126 227100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 227893 227084 gene locus_tag LOCUS_02360 227893 227084 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879287.1 protein_id gnl|my_center|LOCUS_02360 227972 229441 gene locus_tag LOCUS_02370 gene purH 227972 229441 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_02370 230284 229442 gene locus_tag LOCUS_02380 230284 229442 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_02380 232589 230295 gene locus_tag LOCUS_02390 232589 230295 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010916276.1 protein_id gnl|my_center|LOCUS_02390 232739 233305 gene locus_tag LOCUS_02400 232739 233305 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_02400 233292 234380 gene locus_tag LOCUS_02410 233292 234380 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_02410 234380 234655 gene locus_tag LOCUS_02420 234380 234655 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_02420 235873 234650 gene locus_tag LOCUS_02430 gene ilvA 235873 234650 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_02430 237200 235890 gene locus_tag LOCUS_02440 237200 235890 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931407.1 protein_id gnl|my_center|LOCUS_02440 237860 237249 gene locus_tag LOCUS_02450 237860 237249 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_02450 238762 237866 gene locus_tag LOCUS_02460 gene ftcD 238762 237866 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080786.1 protein_id gnl|my_center|LOCUS_02460 239095 241731 gene locus_tag LOCUS_02470 239095 241731 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047928.1 protein_id gnl|my_center|LOCUS_02470 241733 242797 gene locus_tag LOCUS_02480 241733 242797 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987087.1 protein_id gnl|my_center|LOCUS_02480 242829 243974 gene locus_tag LOCUS_02490 242829 243974 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256874.1 protein_id gnl|my_center|LOCUS_02490 243921 244006 gene locus_tag LOCUS_t00070 243921 244006 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 247144 244142 gene locus_tag LOCUS_02500 247144 244142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 247445 247233 gene locus_tag LOCUS_02510 247445 247233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 247446 248459 gene locus_tag LOCUS_02520 247446 248459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 249054 248446 gene locus_tag LOCUS_02530 gene purN 249054 248446 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436064.1 protein_id gnl|my_center|LOCUS_02530 249129 250103 gene locus_tag LOCUS_02540 249129 250103 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 protein_id gnl|my_center|LOCUS_02540 251637 250096 gene locus_tag LOCUS_02550 251637 250096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 252640 251672 gene locus_tag LOCUS_02560 252640 251672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 252752 253363 gene locus_tag LOCUS_02570 252752 253363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 254220 253336 gene locus_tag LOCUS_02580 254220 253336 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_02580 254294 256399 gene locus_tag LOCUS_02590 gene metG 254294 256399 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868104.1 protein_id gnl|my_center|LOCUS_02590 257906 256392 gene locus_tag LOCUS_02600 gene lysS 257906 256392 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_02600 258518 257916 gene locus_tag LOCUS_02610 258518 257916 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022488.1 protein_id gnl|my_center|LOCUS_02610 259281 258808 gene locus_tag LOCUS_02620 259281 258808 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_02620 259416 259976 gene locus_tag LOCUS_02630 259416 259976 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_02630 260013 260936 gene locus_tag LOCUS_02640 260013 260936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 261138 260941 gene locus_tag LOCUS_02650 261138 260941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 261311 261135 gene locus_tag LOCUS_02660 261311 261135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 262173 261322 gene locus_tag LOCUS_02670 262173 261322 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_02670 263930 262173 gene locus_tag LOCUS_02680 263930 262173 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_02680 264147 265520 gene locus_tag LOCUS_02690 264147 265520 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_02690 266235 265702 gene locus_tag LOCUS_02700 266235 265702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 266303 267529 gene locus_tag LOCUS_02710 266303 267529 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_02710 268043 267522 gene locus_tag LOCUS_02720 268043 267522 CDS product TRASH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249785.1 protein_id gnl|my_center|LOCUS_02720 268120 268266 gene locus_tag LOCUS_02730 268120 268266 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_02730 268270 270306 gene locus_tag LOCUS_02740 268270 270306 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404341.1 protein_id gnl|my_center|LOCUS_02740 271307 270300 gene locus_tag LOCUS_02750 gene dph2 271307 270300 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_02750 272597 271347 gene locus_tag LOCUS_02760 gene hutI 272597 271347 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869661.1 protein_id gnl|my_center|LOCUS_02760 273786 272638 gene locus_tag LOCUS_02770 273786 272638 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727600.1 protein_id gnl|my_center|LOCUS_02770 274693 273974 gene locus_tag LOCUS_02780 274693 273974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 275635 274757 gene locus_tag LOCUS_02790 275635 274757 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879952.1 protein_id gnl|my_center|LOCUS_02790 276427 275663 gene locus_tag LOCUS_02800 276427 275663 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_02800 276528 277325 gene locus_tag LOCUS_02810 276528 277325 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651040.1 protein_id gnl|my_center|LOCUS_02810 277594 277665 gene locus_tag LOCUS_t00080 277594 277665 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 277936 279006 gene locus_tag LOCUS_02820 277936 279006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 279011 279640 gene locus_tag LOCUS_02830 279011 279640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 279674 279856 gene locus_tag LOCUS_02840 279674 279856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 279843 280184 gene locus_tag LOCUS_02850 279843 280184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 280188 282761 gene locus_tag LOCUS_02860 280188 282761 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_02860 283790 283251 gene locus_tag LOCUS_02870 283790 283251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 284208 283969 gene locus_tag LOCUS_02880 284208 283969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 284885 285379 gene locus_tag LOCUS_02890 284885 285379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 288472 285374 gene locus_tag LOCUS_02900 288472 285374 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979182.1 protein_id gnl|my_center|LOCUS_02900 288719 288531 gene locus_tag LOCUS_02910 288719 288531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 289314 289054 gene locus_tag LOCUS_02920 289314 289054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 290036 289701 gene locus_tag LOCUS_02930 290036 289701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 290967 290683 gene locus_tag LOCUS_02940 290967 290683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 291304 291555 gene locus_tag LOCUS_02950 291304 291555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 291799 291614 gene locus_tag LOCUS_02960 291799 291614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 292286 292699 gene locus_tag LOCUS_02970 292286 292699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 292696 293049 gene locus_tag LOCUS_02980 292696 293049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 293050 293898 gene locus_tag LOCUS_02990 293050 293898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 293955 294386 gene locus_tag LOCUS_03000 293955 294386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 294897 295096 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 295193 295630 gene locus_tag LOCUS_03010 295193 295630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 295864 295700 gene locus_tag LOCUS_03020 295864 295700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 296317 296658 gene locus_tag LOCUS_03030 296317 296658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 298064 296655 gene locus_tag LOCUS_03040 298064 296655 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_03040 298158 299054 gene locus_tag LOCUS_03050 298158 299054 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015265.1 protein_id gnl|my_center|LOCUS_03050 299379 299963 gene locus_tag LOCUS_03060 gene udg 299379 299963 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_03060 299998 301089 gene locus_tag LOCUS_03070 299998 301089 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485746.1 protein_id gnl|my_center|LOCUS_03070 301079 302608 gene locus_tag LOCUS_03080 301079 302608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 302605 303849 gene locus_tag LOCUS_03090 302605 303849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03090 303846 306320 gene locus_tag LOCUS_03100 303846 306320 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_03100 306678 308462 gene locus_tag LOCUS_03110 306678 308462 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980561.1 protein_id gnl|my_center|LOCUS_03110 309871 308444 gene locus_tag LOCUS_03120 309871 308444 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429707.1 protein_id gnl|my_center|LOCUS_03120 311185 310028 gene locus_tag LOCUS_03130 311185 310028 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_03130 311275 312360 gene locus_tag LOCUS_03140 311275 312360 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650945.1 protein_id gnl|my_center|LOCUS_03140 312981 312340 gene locus_tag LOCUS_03150 312981 312340 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940263.1 protein_id gnl|my_center|LOCUS_03150 313210 313070 gene locus_tag LOCUS_03160 313210 313070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 314011 313211 gene locus_tag LOCUS_03170 314011 313211 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846813.1 protein_id gnl|my_center|LOCUS_03170 314262 315377 gene locus_tag LOCUS_03180 314262 315377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 315715 317037 gene locus_tag LOCUS_03190 315715 317037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 317874 317044 gene locus_tag LOCUS_03200 317874 317044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 317855 318067 gene locus_tag LOCUS_03210 317855 318067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 318503 319804 gene locus_tag LOCUS_03220 318503 319804 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980448.1 protein_id gnl|my_center|LOCUS_03220 320319 321494 gene locus_tag LOCUS_03230 320319 321494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 321868 321796 gene locus_tag LOCUS_t00090 321868 321796 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 322870 321968 gene locus_tag LOCUS_03240 322870 321968 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978840.1 protein_id gnl|my_center|LOCUS_03240 323784 322882 gene locus_tag LOCUS_03250 323784 322882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 323992 323786 gene locus_tag LOCUS_03260 323992 323786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 324173 325564 gene locus_tag LOCUS_03270 324173 325564 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817128.1 protein_id gnl|my_center|LOCUS_03270 325561 326784 gene locus_tag LOCUS_03280 325561 326784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 328762 326771 gene locus_tag LOCUS_03290 328762 326771 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319808.1 protein_id gnl|my_center|LOCUS_03290 329098 328763 gene locus_tag LOCUS_03300 329098 328763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 330069 329155 gene locus_tag LOCUS_03310 330069 329155 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_03310 330779 330123 gene locus_tag LOCUS_03320 330779 330123 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_03320 330893 331612 gene locus_tag LOCUS_03330 330893 331612 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205380.1 protein_id gnl|my_center|LOCUS_03330 331696 332430 gene locus_tag LOCUS_03340 331696 332430 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286674.1 protein_id gnl|my_center|LOCUS_03340 332731 332432 gene locus_tag LOCUS_03350 332731 332432 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226382.1 protein_id gnl|my_center|LOCUS_03350 332847 333743 gene locus_tag LOCUS_03360 332847 333743 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979713.1 protein_id gnl|my_center|LOCUS_03360 333740 334882 gene locus_tag LOCUS_03370 333740 334882 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979714.1 protein_id gnl|my_center|LOCUS_03370 334875 335864 gene locus_tag LOCUS_03380 334875 335864 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_03380 335867 336751 gene locus_tag LOCUS_03390 335867 336751 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979765.1 protein_id gnl|my_center|LOCUS_03390 337628 336738 gene locus_tag LOCUS_03400 337628 336738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 337736 338422 gene locus_tag LOCUS_03410 337736 338422 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429736.1 protein_id gnl|my_center|LOCUS_03410 338468 339604 gene locus_tag LOCUS_03420 338468 339604 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_03420 339591 340352 gene locus_tag LOCUS_03430 339591 340352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 341974 340589 gene locus_tag LOCUS_03440 341974 340589 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728727.1 protein_id gnl|my_center|LOCUS_03440 343688 342267 gene locus_tag LOCUS_03450 343688 342267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980448.1 protein_id gnl|my_center|LOCUS_03450 343801 344394 gene locus_tag LOCUS_03460 343801 344394 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979504.1 protein_id gnl|my_center|LOCUS_03460 345043 344375 gene locus_tag LOCUS_03470 345043 344375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 346331 345009 gene locus_tag LOCUS_03480 gene lpdA 346331 345009 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382270.1 protein_id gnl|my_center|LOCUS_03480 347488 346331 gene locus_tag LOCUS_03490 gene pdhC 347488 346331 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863427.1 protein_id gnl|my_center|LOCUS_03490 348458 347493 gene locus_tag LOCUS_03500 348458 347493 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_03500 349468 348455 gene locus_tag LOCUS_03510 349468 348455 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480247.1 protein_id gnl|my_center|LOCUS_03510 350316 349471 gene locus_tag LOCUS_03520 gene lipA 350316 349471 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_03520 351596 350502 gene locus_tag LOCUS_03530 351596 350502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 351793 353046 gene locus_tag LOCUS_03540 351793 353046 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763075.1 protein_id gnl|my_center|LOCUS_03540 353027 353860 gene locus_tag LOCUS_03550 353027 353860 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240504.1 protein_id gnl|my_center|LOCUS_03550 354106 356082 gene locus_tag LOCUS_03560 354106 356082 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_03560 356539 356057 gene locus_tag LOCUS_03570 356539 356057 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251060.1 protein_id gnl|my_center|LOCUS_03570 356647 357600 gene locus_tag LOCUS_03580 356647 357600 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762509.1 protein_id gnl|my_center|LOCUS_03580 358303 357689 gene locus_tag LOCUS_03590 358303 357689 CDS product DUF981 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979588.1 protein_id gnl|my_center|LOCUS_03590 362799 358579 gene locus_tag LOCUS_03600 362799 358579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 363145 364032 gene locus_tag LOCUS_03610 363145 364032 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879523.1 protein_id gnl|my_center|LOCUS_03610 364068 364487 gene locus_tag LOCUS_03620 364068 364487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 365552 364452 gene locus_tag LOCUS_03630 365552 364452 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485794.1 protein_id gnl|my_center|LOCUS_03630 365637 366842 gene locus_tag LOCUS_03640 365637 366842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 368543 366876 gene locus_tag LOCUS_03650 gene hutU 368543 366876 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_03650 369605 368637 gene locus_tag LOCUS_03660 369605 368637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847040.1 protein_id gnl|my_center|LOCUS_03660 371557 369830 gene locus_tag LOCUS_03670 371557 369830 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979843.1 protein_id gnl|my_center|LOCUS_03670 371896 371576 gene locus_tag LOCUS_03680 371896 371576 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980363.1 protein_id gnl|my_center|LOCUS_03680 372102 372431 gene locus_tag LOCUS_03690 gene tnpA 372102 372431 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979175.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03690 372760 372993 gene locus_tag LOCUS_03700 372760 372993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03700 374642 373758 gene locus_tag LOCUS_03710 374642 373758 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846989.1 protein_id gnl|my_center|LOCUS_03710 375385 374639 gene locus_tag LOCUS_03720 375385 374639 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979861.1 protein_id gnl|my_center|LOCUS_03720 375516 376715 gene locus_tag LOCUS_03730 375516 376715 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761790.1 protein_id gnl|my_center|LOCUS_03730 376726 377835 gene locus_tag LOCUS_03740 376726 377835 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878637.1 protein_id gnl|my_center|LOCUS_03740 377825 378826 gene locus_tag LOCUS_03750 377825 378826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 378876 380750 gene locus_tag LOCUS_03760 378876 380750 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_03760 380747 381529 gene locus_tag LOCUS_03770 380747 381529 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_03770 382506 381532 gene locus_tag LOCUS_03780 382506 381532 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_03780 383310 382546 gene locus_tag LOCUS_03790 383310 382546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 383451 384029 gene locus_tag LOCUS_03800 383451 384029 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902616.1 protein_id gnl|my_center|LOCUS_03800 384022 384585 gene locus_tag LOCUS_03810 384022 384585 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_03810 384579 384938 gene locus_tag LOCUS_03820 gene pth2 384579 384938 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_03820 386110 384935 gene locus_tag LOCUS_03830 gene megL 386110 384935 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_03830 386196 386816 gene locus_tag LOCUS_03840 gene tmk 386196 386816 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080341.1 protein_id gnl|my_center|LOCUS_03840 387656 386784 gene locus_tag LOCUS_03850 gene map 387656 386784 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_03850 389344 387737 gene locus_tag LOCUS_03860 gene pyrG 389344 387737 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_03860 389385 389888 gene locus_tag LOCUS_03870 389385 389888 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289427.1 protein_id gnl|my_center|LOCUS_03870 391299 389881 gene locus_tag LOCUS_03880 391299 389881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 392343 391309 gene locus_tag LOCUS_03890 392343 391309 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_03890 393305 392328 gene locus_tag LOCUS_03900 gene thrC 393305 392328 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_03900 393760 394584 gene locus_tag LOCUS_03910 393760 394584 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980694.1 protein_id gnl|my_center|LOCUS_03910 394574 394867 gene locus_tag LOCUS_03920 394574 394867 CDS product TA0938 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980695.1 protein_id gnl|my_center|LOCUS_03920 395979 394891 gene locus_tag LOCUS_03930 gene gcvT 395979 394891 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082884.1 protein_id gnl|my_center|LOCUS_03930 396587 395976 gene locus_tag LOCUS_03940 gene pdxT 396587 395976 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_03940 396723 397766 gene locus_tag LOCUS_03950 396723 397766 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512886.1 protein_id gnl|my_center|LOCUS_03950 397830 399488 gene locus_tag LOCUS_03960 397830 399488 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467257.1 protein_id gnl|my_center|LOCUS_03960 399526 400488 gene locus_tag LOCUS_03970 399526 400488 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_03970 400813 400466 gene locus_tag LOCUS_03980 400813 400466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 402398 400908 gene locus_tag LOCUS_03990 402398 400908 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978751.1 protein_id gnl|my_center|LOCUS_03990 402607 402395 gene locus_tag LOCUS_04000 402607 402395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 403863 402955 gene locus_tag LOCUS_04010 403863 402955 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763057.1 protein_id gnl|my_center|LOCUS_04010 404477 403866 gene locus_tag LOCUS_04020 404477 403866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 404988 404536 gene locus_tag LOCUS_04030 404988 404536 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979029.1 protein_id gnl|my_center|LOCUS_04030 405157 406617 gene locus_tag LOCUS_04040 405157 406617 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847046.1 protein_id gnl|my_center|LOCUS_04040 406628 407986 gene locus_tag LOCUS_04050 406628 407986 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_04050 407986 409023 gene locus_tag LOCUS_04060 407986 409023 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_04060 408945 409256 gene locus_tag LOCUS_04070 408945 409256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 410990 409158 gene locus_tag LOCUS_04080 gene malA 410990 409158 CDS product alpha-glucosidase MalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980614.1 protein_id gnl|my_center|LOCUS_04080 411809 411036 gene locus_tag LOCUS_04090 411809 411036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763735.1 protein_id gnl|my_center|LOCUS_04090 412815 411814 gene locus_tag LOCUS_04100 412815 411814 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763736.1 protein_id gnl|my_center|LOCUS_04100 413209 412979 gene locus_tag LOCUS_04110 413209 412979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 413346 414230 gene locus_tag LOCUS_04120 413346 414230 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980466.1 protein_id gnl|my_center|LOCUS_04120 414626 414790 gene locus_tag LOCUS_04130 414626 414790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 414790 415029 gene locus_tag LOCUS_04140 414790 415029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 415026 416021 gene locus_tag LOCUS_04150 415026 416021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 419796 416686 gene locus_tag LOCUS_04160 419796 416686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 422857 419789 gene locus_tag LOCUS_04170 422857 419789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 423262 423549 gene locus_tag LOCUS_04180 423262 423549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 423551 424492 gene locus_tag LOCUS_04190 423551 424492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 424546 424474 gene locus_tag LOCUS_t00100 424546 424474 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 426043 424715 gene locus_tag LOCUS_04200 gene glnA 426043 424715 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173386.1 protein_id gnl|my_center|LOCUS_04200 427609 426329 gene locus_tag LOCUS_04210 427609 426329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 430351 427658 gene locus_tag LOCUS_04220 gene acnA 430351 427658 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_04220 430446 431657 gene locus_tag LOCUS_04230 430446 431657 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980657.1 protein_id gnl|my_center|LOCUS_04230 431767 432501 gene locus_tag LOCUS_04240 431767 432501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 432675 432845 gene locus_tag LOCUS_04250 432675 432845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 432842 433729 gene locus_tag LOCUS_04260 gene puuE 432842 433729 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267253.1 protein_id gnl|my_center|LOCUS_04260 435396 433750 gene locus_tag LOCUS_04270 435396 433750 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704301.1 protein_id gnl|my_center|LOCUS_04270 437903 435516 gene locus_tag LOCUS_04280 437903 435516 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599517.1 protein_id gnl|my_center|LOCUS_04280 438025 438453 gene locus_tag LOCUS_04290 438025 438453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 438450 439253 gene locus_tag LOCUS_04300 438450 439253 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_04300 439449 440222 gene locus_tag LOCUS_04310 439449 440222 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_04310 441518 440211 gene locus_tag LOCUS_04320 441518 440211 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_04320 441782 441537 gene locus_tag LOCUS_04330 441782 441537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 442260 441742 gene locus_tag LOCUS_04340 442260 441742 CDS product magnesium-dependent phosphatase-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251186.1 protein_id gnl|my_center|LOCUS_04340 442392 443588 gene locus_tag LOCUS_04350 442392 443588 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762777.1 protein_id gnl|my_center|LOCUS_04350 444012 443575 gene locus_tag LOCUS_04360 444012 443575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 443945 444160 gene locus_tag LOCUS_04370 443945 444160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 444227 444553 gene locus_tag LOCUS_04380 444227 444553 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_04380 445081 444575 gene locus_tag LOCUS_04390 445081 444575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 445683 445075 gene locus_tag LOCUS_04400 445683 445075 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_04400 445682 445903 gene locus_tag LOCUS_04410 445682 445903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 447197 445893 gene locus_tag LOCUS_04420 447197 445893 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980708.1 protein_id gnl|my_center|LOCUS_04420 448515 447559 gene locus_tag LOCUS_04430 gene coaA 448515 447559 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776319.1 protein_id gnl|my_center|LOCUS_04430 450199 448664 gene locus_tag LOCUS_04440 gene mdlC 450199 448664 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727769.1 protein_id gnl|my_center|LOCUS_04440 451111 450200 gene locus_tag LOCUS_04450 451111 450200 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_04450 451226 452890 gene locus_tag LOCUS_04460 451226 452890 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978028.1 protein_id gnl|my_center|LOCUS_04460 452963 453898 gene locus_tag LOCUS_04470 452963 453898 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_04470 454836 454096 gene locus_tag LOCUS_04480 454836 454096 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_04480 455698 454811 gene locus_tag LOCUS_04490 455698 454811 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251185.1 protein_id gnl|my_center|LOCUS_04490 457495 455786 gene locus_tag LOCUS_04500 gene ilvD 457495 455786 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980252.1 protein_id gnl|my_center|LOCUS_04500 457553 458617 gene locus_tag LOCUS_04510 457553 458617 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533145.1 protein_id gnl|my_center|LOCUS_04510 458653 459306 gene locus_tag LOCUS_04520 gene rpe 458653 459306 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_04520 460267 459290 gene locus_tag LOCUS_04530 460267 459290 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846753.1 protein_id gnl|my_center|LOCUS_04530 460574 461416 gene locus_tag LOCUS_04540 gene xerA 460574 461416 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_04540 461484 462017 gene locus_tag LOCUS_04550 461484 462017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 462081 463802 gene locus_tag LOCUS_04560 462081 463802 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_04560 463771 464220 gene locus_tag LOCUS_04570 463771 464220 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_04570 464221 465183 gene locus_tag LOCUS_04580 gene meaB 464221 465183 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_04580 465233 465622 gene locus_tag LOCUS_04590 465233 465622 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979712.1 protein_id gnl|my_center|LOCUS_04590 467191 465626 gene locus_tag LOCUS_04600 467191 465626 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979711.1 protein_id gnl|my_center|LOCUS_04600 468042 467242 gene locus_tag LOCUS_04610 468042 467242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 468238 468047 gene locus_tag LOCUS_04620 468238 468047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 468826 470517 gene locus_tag LOCUS_04630 468826 470517 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_04630 470565 472271 gene locus_tag LOCUS_04640 470565 472271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 473376 472699 gene locus_tag LOCUS_04650 473376 472699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 474244 473414 gene locus_tag LOCUS_04660 474244 473414 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250562.1 protein_id gnl|my_center|LOCUS_04660 474359 475069 gene locus_tag LOCUS_04670 gene psmA 474359 475069 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_04670 475582 475079 gene locus_tag LOCUS_04680 475582 475079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 475683 476396 gene locus_tag LOCUS_04690 475683 476396 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_04690 476504 477193 gene locus_tag LOCUS_04700 gene rrp4 476504 477193 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_04700 477177 477911 gene locus_tag LOCUS_04710 gene rrp41 477177 477911 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_04710 477911 478693 gene locus_tag LOCUS_04720 gene rrp42 477911 478693 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_04720 478700 478954 gene locus_tag LOCUS_04730 gene rpl37A 478700 478954 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877571.1 protein_id gnl|my_center|LOCUS_04730 478947 479078 gene locus_tag LOCUS_04740 478947 479078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 479083 480252 gene locus_tag LOCUS_04750 479083 480252 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249854.1 protein_id gnl|my_center|LOCUS_04750 480255 480551 gene locus_tag LOCUS_04760 480255 480551 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249853.1 protein_id gnl|my_center|LOCUS_04760 480548 480853 gene locus_tag LOCUS_04770 480548 480853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 480866 481414 gene locus_tag LOCUS_04780 480866 481414 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_04780 481411 482163 gene locus_tag LOCUS_04790 gene rsmA 481411 482163 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_04790 482941 482132 gene locus_tag LOCUS_04800 482941 482132 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_04800 483590 483024 gene locus_tag LOCUS_04810 483590 483024 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266683.1 protein_id gnl|my_center|LOCUS_04810 483682 484323 gene locus_tag LOCUS_04820 483682 484323 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867371.1 protein_id gnl|my_center|LOCUS_04820 485257 484325 gene locus_tag LOCUS_04830 gene arcC 485257 484325 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_04830 485404 486219 gene locus_tag LOCUS_04840 485404 486219 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_04840 486240 487475 gene locus_tag LOCUS_04850 486240 487475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 488693 487479 gene locus_tag LOCUS_04860 488693 487479 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980246.1 protein_id gnl|my_center|LOCUS_04860 488874 490184 gene locus_tag LOCUS_04870 488874 490184 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972411.1 protein_id gnl|my_center|LOCUS_04870 490919 490317 gene locus_tag LOCUS_04880 490919 490317 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_04880 491527 491045 gene locus_tag LOCUS_04890 491527 491045 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_04890 494884 491531 gene locus_tag LOCUS_04900 494884 491531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 494838 495062 gene locus_tag LOCUS_04910 494838 495062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 495157 495999 gene locus_tag LOCUS_04920 495157 495999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980531.1 protein_id gnl|my_center|LOCUS_04920 495989 496711 gene locus_tag LOCUS_04930 495989 496711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651061.1 protein_id gnl|my_center|LOCUS_04930 498239 496713 gene locus_tag LOCUS_04940 498239 496713 CDS product FadD7 family fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909016.1 protein_id gnl|my_center|LOCUS_04940 499642 498236 gene locus_tag LOCUS_04950 499642 498236 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_04950 500340 499681 gene locus_tag LOCUS_04960 500340 499681 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_04960 501040 500423 gene locus_tag LOCUS_04970 501040 500423 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_04970 501658 501452 gene locus_tag LOCUS_04980 501658 501452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 502502 501723 gene locus_tag LOCUS_04990 502502 501723 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_04990 505765 502505 gene locus_tag LOCUS_05000 gene polC 505765 502505 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_05000 506346 506041 gene locus_tag LOCUS_05010 506346 506041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 506475 507041 gene locus_tag LOCUS_05020 506475 507041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 507113 507871 gene locus_tag LOCUS_05030 507113 507871 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980321.1 protein_id gnl|my_center|LOCUS_05030 508161 507868 gene locus_tag LOCUS_05040 508161 507868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 508250 509566 gene locus_tag LOCUS_05050 508250 509566 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877902.1 protein_id gnl|my_center|LOCUS_05050 509568 510743 gene locus_tag LOCUS_05060 509568 510743 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979702.1 protein_id gnl|my_center|LOCUS_05060 510759 511766 gene locus_tag LOCUS_05070 510759 511766 CDS product encapsulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978997.1 protein_id gnl|my_center|LOCUS_05070 513144 514280 gene locus_tag LOCUS_05080 gene thrC 513144 514280 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_05080 514304 514708 gene locus_tag LOCUS_05090 514304 514708 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651021.1 protein_id gnl|my_center|LOCUS_05090 514852 515376 gene locus_tag LOCUS_05100 514852 515376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 515667 516332 gene locus_tag LOCUS_05110 515667 516332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 516619 517167 gene locus_tag LOCUS_05120 516619 517167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 517160 517750 gene locus_tag LOCUS_05130 517160 517750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 517921 518703 gene locus_tag LOCUS_05140 517921 518703 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_05140 518928 519521 gene locus_tag LOCUS_05150 518928 519521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 520865 519855 gene locus_tag LOCUS_05160 520865 519855 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328850.1 protein_id gnl|my_center|LOCUS_05160 520955 522382 gene locus_tag LOCUS_05170 520955 522382 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249805.1 protein_id gnl|my_center|LOCUS_05170 522379 523326 gene locus_tag LOCUS_05180 gene cbiB 522379 523326 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870831.1 protein_id gnl|my_center|LOCUS_05180 524059 523295 gene locus_tag LOCUS_05190 524059 523295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 524740 524096 gene locus_tag LOCUS_05200 gene pyrF 524740 524096 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065013.1 protein_id gnl|my_center|LOCUS_05200 525902 524769 gene locus_tag LOCUS_05210 gene ftsZ 525902 524769 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_05210 526019 527074 gene locus_tag LOCUS_05220 526019 527074 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_05220 527160 527582 gene locus_tag LOCUS_05230 527160 527582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 528630 527563 gene locus_tag LOCUS_05240 528630 527563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 528863 529285 gene locus_tag LOCUS_05250 528863 529285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 529295 531064 gene locus_tag LOCUS_05260 529295 531064 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_05260 531175 533025 gene locus_tag LOCUS_05270 gene tgtA 531175 533025 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068322314.1 protein_id gnl|my_center|LOCUS_05270 533884 533012 gene locus_tag LOCUS_05280 533884 533012 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944018.1 protein_id gnl|my_center|LOCUS_05280 535026 533881 gene locus_tag LOCUS_05290 535026 533881 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_05290 537409 535028 gene locus_tag LOCUS_05300 537409 535028 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980151.1 protein_id gnl|my_center|LOCUS_05300 537613 538842 gene locus_tag LOCUS_05310 gene glyA 537613 538842 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_05310 538839 539948 gene locus_tag LOCUS_05320 538839 539948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 539952 541328 gene locus_tag LOCUS_05330 539952 541328 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868372.1 protein_id gnl|my_center|LOCUS_05330 541338 542636 gene locus_tag LOCUS_05340 541338 542636 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146938.1 protein_id gnl|my_center|LOCUS_05340 545007 542638 gene locus_tag LOCUS_05350 545007 542638 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_05350 547441 545057 gene locus_tag LOCUS_05360 547441 545057 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_05360 547570 548607 gene locus_tag LOCUS_05370 547570 548607 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762133.1 protein_id gnl|my_center|LOCUS_05370 548759 549253 gene locus_tag LOCUS_05380 gene purE 548759 549253 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978802.1 protein_id gnl|my_center|LOCUS_05380 549255 550346 gene locus_tag LOCUS_05390 549255 550346 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978803.1 protein_id gnl|my_center|LOCUS_05390 550361 551299 gene locus_tag LOCUS_05400 550361 551299 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979074.1 protein_id gnl|my_center|LOCUS_05400 551818 551294 gene locus_tag LOCUS_05410 551818 551294 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_05410 552783 551818 gene locus_tag LOCUS_05420 gene radA 552783 551818 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_05420 553795 552776 gene locus_tag LOCUS_05430 553795 552776 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867508.1 protein_id gnl|my_center|LOCUS_05430 553929 557405 gene locus_tag LOCUS_05440 553929 557405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 557441 558004 gene locus_tag LOCUS_05450 557441 558004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 558029 558598 gene locus_tag LOCUS_05460 558029 558598 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_05460 558576 559049 gene locus_tag LOCUS_05470 558576 559049 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545624.1 protein_id gnl|my_center|LOCUS_05470 559030 560076 gene locus_tag LOCUS_05480 559030 560076 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869669.1 protein_id gnl|my_center|LOCUS_05480 560846 560073 gene locus_tag LOCUS_05490 560846 560073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_05490 561784 560843 gene locus_tag LOCUS_05500 561784 560843 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_05500 562970 561852 gene locus_tag LOCUS_05510 562970 561852 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_05510 563213 564115 gene locus_tag LOCUS_05520 563213 564115 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396180.1 protein_id gnl|my_center|LOCUS_05520 564102 564914 gene locus_tag LOCUS_05530 564102 564914 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030645.1 protein_id gnl|my_center|LOCUS_05530 564911 565897 gene locus_tag LOCUS_05540 564911 565897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_05540 567291 565936 gene locus_tag LOCUS_05550 567291 565936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 569207 568698 gene locus_tag LOCUS_05560 569207 568698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 570408 569245 gene locus_tag LOCUS_05570 570408 569245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05570 570860 570717 gene locus_tag LOCUS_05580 570860 570717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 571239 571165 gene locus_tag LOCUS_t00110 571239 571165 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 571352 572452 gene locus_tag LOCUS_05590 571352 572452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 573211 572456 gene locus_tag LOCUS_05600 573211 572456 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244072.1 protein_id gnl|my_center|LOCUS_05600 574689 573208 gene locus_tag LOCUS_05610 574689 573208 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_05610 575974 574886 gene locus_tag LOCUS_05620 575974 574886 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979764.1 protein_id gnl|my_center|LOCUS_05620 576489 577148 gene locus_tag LOCUS_05630 576489 577148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 577377 577150 gene locus_tag LOCUS_05640 577377 577150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 577739 577425 gene locus_tag LOCUS_05650 577739 577425 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_05650 578780 577785 gene locus_tag LOCUS_05660 578780 577785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 579036 579893 gene locus_tag LOCUS_05670 579036 579893 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979238.1 protein_id gnl|my_center|LOCUS_05670 579890 581017 gene locus_tag LOCUS_05680 579890 581017 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979237.1 protein_id gnl|my_center|LOCUS_05680 581025 582242 gene locus_tag LOCUS_05690 581025 582242 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_05690 582288 582650 gene locus_tag LOCUS_05700 gene sepF 582288 582650 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_05700 583953 582634 gene locus_tag LOCUS_05710 583953 582634 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868492.1 protein_id gnl|my_center|LOCUS_05710 584057 585478 gene locus_tag LOCUS_05720 584057 585478 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847046.1 protein_id gnl|my_center|LOCUS_05720 585527 585745 gene locus_tag LOCUS_05730 585527 585745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 586095 585748 gene locus_tag LOCUS_05740 586095 585748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 586630 586127 gene locus_tag LOCUS_05750 586630 586127 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979029.1 protein_id gnl|my_center|LOCUS_05750 586969 588333 gene locus_tag LOCUS_05760 586969 588333 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979128.1 protein_id gnl|my_center|LOCUS_05760 588554 588748 gene locus_tag LOCUS_05770 588554 588748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 588681 590558 gene locus_tag LOCUS_05780 588681 590558 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980626.1 protein_id gnl|my_center|LOCUS_05780 590597 591592 gene locus_tag LOCUS_05790 590597 591592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846815.1 protein_id gnl|my_center|LOCUS_05790 591589 592536 gene locus_tag LOCUS_05800 591589 592536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_05800 592588 594084 gene locus_tag LOCUS_05810 592588 594084 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030374.1 protein_id gnl|my_center|LOCUS_05810 595457 594090 gene locus_tag LOCUS_05820 gene hemL 595457 594090 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460175.1 protein_id gnl|my_center|LOCUS_05820 595645 596796 gene locus_tag LOCUS_05830 595645 596796 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943175.1 protein_id gnl|my_center|LOCUS_05830 596815 597825 gene locus_tag LOCUS_05840 596815 597825 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846816.1 protein_id gnl|my_center|LOCUS_05840 597815 598774 gene locus_tag LOCUS_05850 597815 598774 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261419.1 protein_id gnl|my_center|LOCUS_05850 600651 598768 gene locus_tag LOCUS_05860 600651 598768 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_05860 600813 601922 gene locus_tag LOCUS_05870 gene aroB 600813 601922 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980356.1 protein_id gnl|my_center|LOCUS_05870 601924 602706 gene locus_tag LOCUS_05880 gene aroE 601924 602706 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_05880 602699 603520 gene locus_tag LOCUS_05890 602699 603520 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249219.1 protein_id gnl|my_center|LOCUS_05890 603517 604776 gene locus_tag LOCUS_05900 gene aroA 603517 604776 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_05900 604796 606457 gene locus_tag LOCUS_05910 gene argS 604796 606457 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878394.1 protein_id gnl|my_center|LOCUS_05910 609551 606678 gene locus_tag LOCUS_05920 609551 606678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 610654 609650 gene locus_tag LOCUS_05930 610654 609650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 612093 610651 gene locus_tag LOCUS_05940 612093 610651 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_05940 612273 612497 gene locus_tag LOCUS_05950 612273 612497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 612611 612982 gene locus_tag LOCUS_05960 612611 612982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877792.1 protein_id gnl|my_center|LOCUS_05960 613025 613879 gene locus_tag LOCUS_05970 613025 613879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 613933 614796 gene locus_tag LOCUS_05980 gene cutB 613933 614796 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_05980 614801 615313 gene locus_tag LOCUS_05990 gene cutC 614801 615313 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_05990 615321 617330 gene locus_tag LOCUS_06000 615321 617330 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978728.1 protein_id gnl|my_center|LOCUS_06000 617327 617503 gene locus_tag LOCUS_06010 617327 617503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 618945 617491 gene locus_tag LOCUS_06020 gene ggt 618945 617491 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 protein_id gnl|my_center|LOCUS_06020 619022 619540 gene locus_tag LOCUS_06030 619022 619540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 620441 619578 gene locus_tag LOCUS_06040 620441 619578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 621493 620441 gene locus_tag LOCUS_06050 gene asd 621493 620441 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_06050 621777 622106 gene locus_tag LOCUS_06060 621777 622106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 622188 622751 gene locus_tag LOCUS_06070 gene rnhB 622188 622751 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_06070 623854 622739 gene locus_tag LOCUS_06080 623854 622739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 623930 624373 gene locus_tag LOCUS_06090 623930 624373 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761799.1 protein_id gnl|my_center|LOCUS_06090 624822 624391 gene locus_tag LOCUS_06100 624822 624391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 626585 624819 gene locus_tag LOCUS_06110 626585 624819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_06110 626704 627216 gene locus_tag LOCUS_06120 626704 627216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 627272 627922 gene locus_tag LOCUS_06130 gene tpiA 627272 627922 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064694.1 protein_id gnl|my_center|LOCUS_06130 627938 628603 gene locus_tag LOCUS_06140 627938 628603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 628640 628716 gene locus_tag LOCUS_t00120 628640 628716 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 629011 629721 gene locus_tag LOCUS_06150 629011 629721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 629769 631268 gene locus_tag LOCUS_06160 gene hutH 629769 631268 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925153.1 protein_id gnl|my_center|LOCUS_06160 631302 633314 gene locus_tag LOCUS_06170 gene thrS 631302 633314 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583388.1 protein_id gnl|my_center|LOCUS_06170 633635 633450 gene locus_tag LOCUS_06180 633635 633450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 633817 633545 gene locus_tag LOCUS_06190 633817 633545 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391609.1 protein_id gnl|my_center|LOCUS_06190 635121 633820 gene locus_tag LOCUS_06200 635121 633820 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278478.1 protein_id gnl|my_center|LOCUS_06200 635184 635864 gene locus_tag LOCUS_06210 635184 635864 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_06210 637075 635837 gene locus_tag LOCUS_06220 gene eif2g 637075 635837 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_06220 637466 637080 gene locus_tag LOCUS_06230 637466 637080 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_06230 637868 638389 gene locus_tag LOCUS_06240 637868 638389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 638448 639413 gene locus_tag LOCUS_06250 gene moaA 638448 639413 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_06250 640681 639392 gene locus_tag LOCUS_06260 640681 639392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 640733 641167 gene locus_tag LOCUS_06270 640733 641167 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438516.1 protein_id gnl|my_center|LOCUS_06270 641314 642471 gene locus_tag LOCUS_06280 641314 642471 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979064.1 protein_id gnl|my_center|LOCUS_06280 643118 642540 gene locus_tag LOCUS_06290 643118 642540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978012.1 protein_id gnl|my_center|LOCUS_06290 644000 643155 gene locus_tag LOCUS_06300 gene fdhD 644000 643155 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_06300 644443 643997 gene locus_tag LOCUS_06310 644443 643997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 647384 644448 gene locus_tag LOCUS_06320 gene fdhF 647384 644448 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245240.1 protein_id gnl|my_center|LOCUS_06320 647526 648251 gene locus_tag LOCUS_06330 647526 648251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 648374 649831 gene locus_tag LOCUS_06340 gene guaB 648374 649831 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868777.1 protein_id gnl|my_center|LOCUS_06340 649838 650695 gene locus_tag LOCUS_06350 649838 650695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 650733 651074 gene locus_tag LOCUS_06360 650733 651074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846147.1 protein_id gnl|my_center|LOCUS_06360 654415 651523 gene locus_tag LOCUS_r00010 654415 651523 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 654725 655921 gene locus_tag LOCUS_06370 654725 655921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 655977 656333 gene locus_tag LOCUS_06380 655977 656333 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_06380 656335 657636 gene locus_tag LOCUS_06390 gene cca 656335 657636 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_06390 657731 660721 gene locus_tag LOCUS_06400 657731 660721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 660844 661275 gene locus_tag LOCUS_06410 660844 661275 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979189.1 protein_id gnl|my_center|LOCUS_06410 661328 661400 gene locus_tag LOCUS_t00130 661328 661400 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 661404 661601 gene locus_tag LOCUS_06420 661404 661601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 662611 661595 gene locus_tag LOCUS_06430 gene purM 662611 661595 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868770.1 protein_id gnl|my_center|LOCUS_06430 662801 663151 gene locus_tag LOCUS_06440 662801 663151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978593.1 protein_id gnl|my_center|LOCUS_06440 663722 663153 gene locus_tag LOCUS_06450 663722 663153 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_06450 663779 664456 gene locus_tag LOCUS_06460 663779 664456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 664591 664959 gene locus_tag LOCUS_06470 664591 664959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 664952 665530 gene locus_tag LOCUS_06480 664952 665530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 665938 665525 gene locus_tag LOCUS_06490 665938 665525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 666056 667411 gene locus_tag LOCUS_06500 666056 667411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088030.1 protein_id gnl|my_center|LOCUS_06500 667484 668323 gene locus_tag LOCUS_06510 667484 668323 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086157.1 protein_id gnl|my_center|LOCUS_06510 668301 669359 gene locus_tag LOCUS_06520 668301 669359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 671682 669340 gene locus_tag LOCUS_06530 671682 669340 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_06530 672157 671687 gene locus_tag LOCUS_06540 gene cutC 672157 671687 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_06540 673018 672161 gene locus_tag LOCUS_06550 gene cutB 673018 672161 CDS product glyceraldehyde dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978541.1 protein_id gnl|my_center|LOCUS_06550 673130 673651 gene locus_tag LOCUS_06560 673130 673651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 674909 673641 gene locus_tag LOCUS_06570 674909 673641 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931723.1 protein_id gnl|my_center|LOCUS_06570 674988 675060 gene locus_tag LOCUS_t00140 674988 675060 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 675300 675139 gene locus_tag LOCUS_06580 675300 675139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 676174 677364 gene locus_tag LOCUS_06590 676174 677364 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978029.1 protein_id gnl|my_center|LOCUS_06590 678521 677373 gene locus_tag LOCUS_06600 678521 677373 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873437.1 protein_id gnl|my_center|LOCUS_06600 679207 678560 gene locus_tag LOCUS_06610 679207 678560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 679388 679594 gene locus_tag LOCUS_06620 679388 679594 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250449.1 protein_id gnl|my_center|LOCUS_06620 680124 681552 gene locus_tag LOCUS_r00020 680124 681552 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 681672 681887 gene locus_tag LOCUS_06630 681672 681887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 681897 682778 gene locus_tag LOCUS_06640 681897 682778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 682792 684183 gene locus_tag LOCUS_06650 682792 684183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 684183 684647 gene locus_tag LOCUS_06660 684183 684647 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_06660 684683 685138 gene locus_tag LOCUS_06670 gene bcp 684683 685138 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_06670 685446 685255 gene locus_tag LOCUS_06680 685446 685255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 685767 685453 gene locus_tag LOCUS_06690 gene rpl12p 685767 685453 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250366.1 protein_id gnl|my_center|LOCUS_06690 686730 685783 gene locus_tag LOCUS_06700 686730 685783 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870010.1 protein_id gnl|my_center|LOCUS_06700 687377 686727 gene locus_tag LOCUS_06710 687377 686727 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_06710 687891 687421 gene locus_tag LOCUS_06720 687891 687421 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250369.1 protein_id gnl|my_center|LOCUS_06720 688005 688655 gene locus_tag LOCUS_06730 688005 688655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 689526 688846 gene locus_tag LOCUS_06740 689526 688846 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 protein_id gnl|my_center|LOCUS_06740 690689 689529 gene locus_tag LOCUS_06750 690689 689529 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_06750 691037 690819 gene locus_tag LOCUS_06760 691037 690819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 691230 692132 gene locus_tag LOCUS_06770 691230 692132 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_06770 692193 693248 gene locus_tag LOCUS_06780 692193 693248 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_06780 693241 694401 gene locus_tag LOCUS_06790 693241 694401 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_06790 694398 694805 gene locus_tag LOCUS_06800 694398 694805 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_06800 694875 695258 gene locus_tag LOCUS_06810 694875 695258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 696058 695261 gene locus_tag LOCUS_06820 gene proC 696058 695261 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869320.1 protein_id gnl|my_center|LOCUS_06820 696369 696232 gene locus_tag LOCUS_06830 696369 696232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 696635 697846 gene locus_tag LOCUS_06840 696635 697846 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461646.1 protein_id gnl|my_center|LOCUS_06840 699460 697841 gene locus_tag LOCUS_06850 699460 697841 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225668.1 protein_id gnl|my_center|LOCUS_06850 700429 699509 gene locus_tag LOCUS_06860 700429 699509 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980488.1 protein_id gnl|my_center|LOCUS_06860 701710 700508 gene locus_tag LOCUS_06870 701710 700508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 703139 701781 gene locus_tag LOCUS_06880 703139 701781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227373.1 protein_id gnl|my_center|LOCUS_06880 703873 703217 gene locus_tag LOCUS_06890 703873 703217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 704994 703900 gene locus_tag LOCUS_06900 704994 703900 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064552.1 protein_id gnl|my_center|LOCUS_06900 706027 704978 gene locus_tag LOCUS_06910 706027 704978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 706117 707271 gene locus_tag LOCUS_06920 706117 707271 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978035.1 protein_id gnl|my_center|LOCUS_06920 707268 707486 gene locus_tag LOCUS_06930 707268 707486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 707742 708875 gene locus_tag LOCUS_06940 707742 708875 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 protein_id gnl|my_center|LOCUS_06940 708872 710068 gene locus_tag LOCUS_06950 708872 710068 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978775.1 protein_id gnl|my_center|LOCUS_06950 710243 710097 gene locus_tag LOCUS_06960 710243 710097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 711571 710306 gene locus_tag LOCUS_06970 711571 710306 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240344.1 protein_id gnl|my_center|LOCUS_06970 712705 711743 gene locus_tag LOCUS_06980 712705 711743 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978410.1 protein_id gnl|my_center|LOCUS_06980 713143 712715 gene locus_tag LOCUS_06990 gene trxA 713143 712715 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_06990 713238 713618 gene locus_tag LOCUS_07000 713238 713618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 714582 713686 gene locus_tag LOCUS_07010 714582 713686 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015424.1 protein_id gnl|my_center|LOCUS_07010 714691 714984 gene locus_tag LOCUS_07020 714691 714984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 716122 715190 gene locus_tag LOCUS_07030 716122 715190 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_07030 716788 716225 gene locus_tag LOCUS_07040 gene rpsG 716788 716225 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_07040 717219 716791 gene locus_tag LOCUS_07050 717219 716791 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250029.1 protein_id gnl|my_center|LOCUS_07050 717673 718887 gene locus_tag LOCUS_07060 717673 718887 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869928.1 protein_id gnl|my_center|LOCUS_07060 718884 720212 gene locus_tag LOCUS_07070 gene argH 718884 720212 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082327.1 protein_id gnl|my_center|LOCUS_07070 720901 720416 gene locus_tag LOCUS_07080 720901 720416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 722101 720938 gene locus_tag LOCUS_07090 722101 720938 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_07090 722548 722108 gene locus_tag LOCUS_07100 722548 722108 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023592.1 protein_id gnl|my_center|LOCUS_07100 723619 722561 gene locus_tag LOCUS_07110 723619 722561 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023593.1 protein_id gnl|my_center|LOCUS_07110 723720 725705 gene locus_tag LOCUS_07120 723720 725705 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979927.1 protein_id gnl|my_center|LOCUS_07120 726590 725694 gene locus_tag LOCUS_07130 726590 725694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 727500 726637 gene locus_tag LOCUS_07140 727500 726637 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867336.1 protein_id gnl|my_center|LOCUS_07140 727736 727810 gene locus_tag LOCUS_t00150 727736 727810 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 728198 728428 gene locus_tag LOCUS_07150 728198 728428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 729813 730043 gene locus_tag LOCUS_07160 729813 730043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 730330 730524 gene locus_tag LOCUS_07170 730330 730524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 730461 730652 gene locus_tag LOCUS_07180 730461 730652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 730936 731295 gene locus_tag LOCUS_07190 730936 731295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 731870 731788 gene locus_tag LOCUS_t00160 731870 731788 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 732483 731887 gene locus_tag LOCUS_07200 732483 731887 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_07200 732847 733149 gene locus_tag LOCUS_07210 732847 733149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 734344 733091 gene locus_tag LOCUS_07220 734344 733091 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251169.1 protein_id gnl|my_center|LOCUS_07220 734679 734344 gene locus_tag LOCUS_07230 734679 734344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 734749 736248 gene locus_tag LOCUS_07240 734749 736248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 737441 736251 gene locus_tag LOCUS_07250 737441 736251 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_07250 738437 737481 gene locus_tag LOCUS_07260 gene twy1 738437 737481 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384983.1 protein_id gnl|my_center|LOCUS_07260 739430 738471 gene locus_tag LOCUS_07270 739430 738471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 741203 739560 gene locus_tag LOCUS_07280 gene thsB 741203 739560 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_07280 742405 741431 gene locus_tag LOCUS_07290 gene adhP 742405 741431 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_07290 742543 742833 gene locus_tag LOCUS_07300 742543 742833 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066065.1 protein_id gnl|my_center|LOCUS_07300 742830 743303 gene locus_tag LOCUS_07310 742830 743303 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761840.1 protein_id gnl|my_center|LOCUS_07310 744327 743335 gene locus_tag LOCUS_07320 744327 743335 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_07320 744407 744592 gene locus_tag LOCUS_07330 744407 744592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 744641 744715 gene locus_tag LOCUS_t00170 744641 744715 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 744937 745077 gene locus_tag LOCUS_07340 744937 745077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 745549 746661 gene locus_tag LOCUS_07350 745549 746661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 746919 746665 gene locus_tag LOCUS_07360 746919 746665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 748486 746912 gene locus_tag LOCUS_07370 748486 746912 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_07370 748724 748640 gene locus_tag LOCUS_t00180 748724 748640 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 748845 749069 gene locus_tag LOCUS_07380 748845 749069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 749071 750249 gene locus_tag LOCUS_07390 749071 750249 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_07390 751623 750244 gene locus_tag LOCUS_07400 751623 750244 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_07400 752094 751810 gene locus_tag LOCUS_07410 752094 751810 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_07410 752491 752916 gene locus_tag LOCUS_07420 752491 752916 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_07420 752945 753032 gene locus_tag LOCUS_t00190 752945 753032 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 753110 753544 gene locus_tag LOCUS_07430 753110 753544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 753569 755050 gene locus_tag LOCUS_07440 753569 755050 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_07440 755657 755031 gene locus_tag LOCUS_07450 gene nth 755657 755031 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083173.1 protein_id gnl|my_center|LOCUS_07450 758869 755654 gene locus_tag LOCUS_07460 gene carB 758869 755654 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_07460 759914 758862 gene locus_tag LOCUS_07470 759914 758862 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288877.1 protein_id gnl|my_center|LOCUS_07470 760410 760060 gene locus_tag LOCUS_07480 gene cutA 760410 760060 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879470.1 protein_id gnl|my_center|LOCUS_07480 761072 760404 gene locus_tag LOCUS_07490 gene sfsA 761072 760404 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_07490 761295 761867 gene locus_tag LOCUS_07500 761295 761867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 763106 761880 gene locus_tag LOCUS_07510 763106 761880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878039.1 protein_id gnl|my_center|LOCUS_07510 763886 763113 gene locus_tag LOCUS_07520 763886 763113 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_07520 764795 764031 gene locus_tag LOCUS_07530 764795 764031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 764905 766692 gene locus_tag LOCUS_07540 764905 766692 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146849.1 protein_id gnl|my_center|LOCUS_07540 766704 767645 gene locus_tag LOCUS_07550 766704 767645 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_07550 767722 767797 gene locus_tag LOCUS_t00200 767722 767797 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 768119 768045 gene locus_tag LOCUS_t00210 768119 768045 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 769229 768156 gene locus_tag LOCUS_07560 769229 768156 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_07560 770016 769222 gene locus_tag LOCUS_07570 gene etfB 770016 769222 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_07570 770420 771376 gene locus_tag LOCUS_07580 gene rpl3p 770420 771376 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_07580 771378 772136 gene locus_tag LOCUS_07590 gene rpl4p 771378 772136 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869672.1 protein_id gnl|my_center|LOCUS_07590 772137 772394 gene locus_tag LOCUS_07600 772137 772394 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_07600 772404 773090 gene locus_tag LOCUS_07610 772404 773090 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_07610 773093 773548 gene locus_tag LOCUS_07620 gene rpsS 773093 773548 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_07620 773554 774003 gene locus_tag LOCUS_07630 gene rplV 773554 774003 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_07630 774000 774644 gene locus_tag LOCUS_07640 774000 774644 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869961.1 protein_id gnl|my_center|LOCUS_07640 774625 774825 gene locus_tag LOCUS_07650 gene rpmC 774625 774825 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869962.1 protein_id gnl|my_center|LOCUS_07650 774822 775121 gene locus_tag LOCUS_07660 gene yciH 774822 775121 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_07660 775118 775423 gene locus_tag LOCUS_07670 775118 775423 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_07670 775413 775742 gene locus_tag LOCUS_07680 775413 775742 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_07680 775739 776137 gene locus_tag LOCUS_07690 775739 776137 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_07690 776147 776638 gene locus_tag LOCUS_07700 776147 776638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 776622 777338 gene locus_tag LOCUS_07710 776622 777338 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_07710 777335 777850 gene locus_tag LOCUS_07720 777335 777850 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_07720 777850 778011 gene locus_tag LOCUS_07730 777850 778011 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763587.1 protein_id gnl|my_center|LOCUS_07730 778021 778410 gene locus_tag LOCUS_07740 778021 778410 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_07740 778421 778960 gene locus_tag LOCUS_07750 778421 778960 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_07750 778953 779369 gene locus_tag LOCUS_07760 778953 779369 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_07760 779366 779827 gene locus_tag LOCUS_07770 779366 779827 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496504.1 protein_id gnl|my_center|LOCUS_07770 779829 780320 gene locus_tag LOCUS_07780 779829 780320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 780317 780985 gene locus_tag LOCUS_07790 gene rpsE 780317 780985 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_07790 780963 781454 gene locus_tag LOCUS_07800 gene rpmD 780963 781454 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 protein_id gnl|my_center|LOCUS_07800 781435 781875 gene locus_tag LOCUS_07810 781435 781875 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270492.1 protein_id gnl|my_center|LOCUS_07810 781853 783613 gene locus_tag LOCUS_07820 gene secY 781853 783613 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_07820 783614 784159 gene locus_tag LOCUS_07830 783614 784159 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_07830 784162 784860 gene locus_tag LOCUS_07840 784162 784860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 784861 785400 gene locus_tag LOCUS_07850 784861 785400 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_07850 785360 786316 gene locus_tag LOCUS_07860 785360 786316 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_07860 786264 787109 gene locus_tag LOCUS_07870 786264 787109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 788502 787057 gene locus_tag LOCUS_07880 gene purF 788502 787057 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878374.1 protein_id gnl|my_center|LOCUS_07880 788874 788617 gene locus_tag LOCUS_07890 788874 788617 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023130.1 protein_id gnl|my_center|LOCUS_07890 789025 789309 gene locus_tag LOCUS_07900 789025 789309 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_07900 789310 789510 gene locus_tag LOCUS_07910 789310 789510 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_07910 789507 790271 gene locus_tag LOCUS_07920 789507 790271 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_07920 790268 790447 gene locus_tag LOCUS_07930 790268 790447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 790422 791186 gene locus_tag LOCUS_07940 790422 791186 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_07940 791202 793019 gene locus_tag LOCUS_07950 gene top6B 791202 793019 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878155.1 protein_id gnl|my_center|LOCUS_07950 793009 794100 gene locus_tag LOCUS_07960 793009 794100 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_07960 794093 794905 gene locus_tag LOCUS_07970 794093 794905 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_07970 795595 794900 gene locus_tag LOCUS_07980 gene otsB 795595 794900 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838240.1 protein_id gnl|my_center|LOCUS_07980 796979 795609 gene locus_tag LOCUS_07990 796979 795609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 797149 797263 gene locus_tag LOCUS_r00030 797149 797263 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 798544 797366 gene locus_tag LOCUS_08000 798544 797366 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_08000 799721 798702 gene locus_tag LOCUS_08010 gene mtnA 799721 798702 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_08010 800593 799718 gene locus_tag LOCUS_08020 800593 799718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 800696 800770 gene locus_tag LOCUS_t00220 800696 800770 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 800787 801050 gene locus_tag LOCUS_08030 800787 801050 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 protein_id gnl|my_center|LOCUS_08030 801047 804652 gene locus_tag LOCUS_08040 801047 804652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 804649 807315 gene locus_tag LOCUS_08050 804649 807315 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_08050 807312 808850 gene locus_tag LOCUS_08060 807312 808850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 808850 809290 gene locus_tag LOCUS_08070 808850 809290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 809424 809768 gene locus_tag LOCUS_08080 gene eif1A 809424 809768 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_08080 809765 810523 gene locus_tag LOCUS_08090 gene rio1 809765 810523 CDS product RIO-type serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879299.1 protein_id gnl|my_center|LOCUS_08090 810594 811157 gene locus_tag LOCUS_08100 810594 811157 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_08100 811198 811272 gene locus_tag LOCUS_t00230 811198 811272 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 811962 811270 gene locus_tag LOCUS_08110 811962 811270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 812849 811962 gene locus_tag LOCUS_08120 gene hemC 812849 811962 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_08120 812927 813928 gene locus_tag LOCUS_08130 812927 813928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 814625 813894 gene locus_tag LOCUS_08140 814625 813894 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763000.1 protein_id gnl|my_center|LOCUS_08140 814757 815080 gene locus_tag LOCUS_08150 814757 815080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 815077 815364 gene locus_tag LOCUS_08160 815077 815364 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_08160 815426 815938 gene locus_tag LOCUS_08170 815426 815938 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879774.1 protein_id gnl|my_center|LOCUS_08170 815948 816514 gene locus_tag LOCUS_08180 gene rpsD 815948 816514 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879773.1 protein_id gnl|my_center|LOCUS_08180 816511 816894 gene locus_tag LOCUS_08190 816511 816894 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_08190 816895 817716 gene locus_tag LOCUS_08200 816895 817716 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_08200 817801 818568 gene locus_tag LOCUS_08210 817801 818568 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_08210 818565 819383 gene locus_tag LOCUS_08220 818565 819383 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_08220 819370 819732 gene locus_tag LOCUS_08230 819370 819732 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250213.1 protein_id gnl|my_center|LOCUS_08230 820645 819725 gene locus_tag LOCUS_08240 gene prpB 820645 819725 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846659.1 protein_id gnl|my_center|LOCUS_08240 821960 820632 gene locus_tag LOCUS_08250 821960 820632 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763429.1 protein_id gnl|my_center|LOCUS_08250 822104 823090 gene locus_tag LOCUS_08260 822104 823090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 823123 823473 gene locus_tag LOCUS_08270 823123 823473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 823743 823474 gene locus_tag LOCUS_08280 823743 823474 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259014.1 protein_id gnl|my_center|LOCUS_08280 823946 824521 gene locus_tag LOCUS_08290 823946 824521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 824503 825396 gene locus_tag LOCUS_08300 824503 825396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 825578 825372 gene locus_tag LOCUS_08310 825578 825372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 825620 826399 gene locus_tag LOCUS_08320 825620 826399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 827506 826337 gene locus_tag LOCUS_08330 827506 826337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 827771 828211 gene locus_tag LOCUS_08340 827771 828211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 828270 828740 gene locus_tag LOCUS_08350 828270 828740 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_08350 828744 829943 gene locus_tag LOCUS_08360 828744 829943 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429682.1 protein_id gnl|my_center|LOCUS_08360 830892 829978 gene locus_tag LOCUS_08370 830892 829978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 831076 831774 gene locus_tag LOCUS_08380 831076 831774 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_08380 831776 832900 gene locus_tag LOCUS_08390 gene sat 831776 832900 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_08390 833002 834837 gene locus_tag LOCUS_08400 833002 834837 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980651.1 protein_id gnl|my_center|LOCUS_08400 834842 835558 gene locus_tag LOCUS_08410 gene cobA 834842 835558 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_08410 835533 836168 gene locus_tag LOCUS_08420 835533 836168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 836314 837111 gene locus_tag LOCUS_08430 836314 837111 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978323.1 protein_id gnl|my_center|LOCUS_08430 837113 837301 gene locus_tag LOCUS_08440 837113 837301 CDS product TRASH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742615.1 protein_id gnl|my_center|LOCUS_08440 837437 838810 gene locus_tag LOCUS_08450 837437 838810 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_08450 839783 838815 gene locus_tag LOCUS_08460 839783 838815 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846974.1 protein_id gnl|my_center|LOCUS_08460 842140 839939 gene locus_tag LOCUS_08470 gene katG 842140 839939 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119918646.1 protein_id gnl|my_center|LOCUS_08470 842548 843972 gene locus_tag LOCUS_08480 842548 843972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 844026 845129 gene locus_tag LOCUS_08490 844026 845129 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 protein_id gnl|my_center|LOCUS_08490 846766 845483 gene locus_tag LOCUS_08500 846766 845483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028416.1 protein_id gnl|my_center|LOCUS_08500 847230 847700 gene locus_tag LOCUS_08510 847230 847700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 847697 848695 gene locus_tag LOCUS_08520 847697 848695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 848928 849959 gene locus_tag LOCUS_08530 gene ilvC 848928 849959 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_08530 849956 850678 gene locus_tag LOCUS_08540 849956 850678 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_08540 850679 852037 gene locus_tag LOCUS_08550 850679 852037 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764782.1 protein_id gnl|my_center|LOCUS_08550 852409 852660 gene locus_tag LOCUS_08560 852409 852660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 853185 852841 gene locus_tag LOCUS_08570 853185 852841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 853973 854413 gene locus_tag LOCUS_08580 853973 854413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 854410 855243 gene locus_tag LOCUS_08590 854410 855243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 855200 857806 gene locus_tag LOCUS_08600 855200 857806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 858043 858576 gene locus_tag LOCUS_08610 858043 858576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 859589 858570 gene locus_tag LOCUS_08620 859589 858570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 860259 859681 gene locus_tag LOCUS_08630 860259 859681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 860852 860259 gene locus_tag LOCUS_08640 860852 860259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 861227 860937 gene locus_tag LOCUS_08650 861227 860937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 861276 861422 gene locus_tag LOCUS_08660 861276 861422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 861492 861686 gene locus_tag LOCUS_08670 861492 861686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 861683 861931 gene locus_tag LOCUS_08680 861683 861931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 861928 862842 gene locus_tag LOCUS_08690 861928 862842 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872254.1 protein_id gnl|my_center|LOCUS_08690 862837 862766 gene locus_tag LOCUS_t00240 862837 862766 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 862945 864342 gene locus_tag LOCUS_08700 862945 864342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 864326 865195 gene locus_tag LOCUS_08710 864326 865195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 865192 865932 gene locus_tag LOCUS_08720 865192 865932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 865929 867233 gene locus_tag LOCUS_08730 865929 867233 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148183415.1 protein_id gnl|my_center|LOCUS_08730 868541 867222 gene locus_tag LOCUS_08740 868541 867222 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868413.1 protein_id gnl|my_center|LOCUS_08740 869313 868591 gene locus_tag LOCUS_08750 gene nadE 869313 868591 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_08750 870172 869345 gene locus_tag LOCUS_08760 870172 869345 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082313.1 protein_id gnl|my_center|LOCUS_08760 871266 870175 gene locus_tag LOCUS_08770 871266 870175 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979764.1 protein_id gnl|my_center|LOCUS_08770 871883 871305 gene locus_tag LOCUS_08780 gene ribA 871883 871305 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634253.1 protein_id gnl|my_center|LOCUS_08780 873150 871975 gene locus_tag LOCUS_08790 873150 871975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868147.1 protein_id gnl|my_center|LOCUS_08790 873210 874139 gene locus_tag LOCUS_08800 873210 874139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 874312 874860 gene locus_tag LOCUS_08810 874312 874860 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979808.1 protein_id gnl|my_center|LOCUS_08810 874918 876174 gene locus_tag LOCUS_08820 874918 876174 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979252.1 protein_id gnl|my_center|LOCUS_08820 876171 876905 gene locus_tag LOCUS_08830 gene trpA 876171 876905 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979251.1 protein_id gnl|my_center|LOCUS_08830 876895 877905 gene locus_tag LOCUS_08840 gene trpD 876895 877905 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_08840 877874 878494 gene locus_tag LOCUS_08850 877874 878494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 878478 879632 gene locus_tag LOCUS_08860 878478 879632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 879616 880161 gene locus_tag LOCUS_08870 879616 880161 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933229.1 protein_id gnl|my_center|LOCUS_08870 880154 880906 gene locus_tag LOCUS_08880 gene trpC 880154 880906 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_08880 880903 881655 gene locus_tag LOCUS_08890 880903 881655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 881705 883381 gene locus_tag LOCUS_08900 gene pyk 881705 883381 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869581.1 protein_id gnl|my_center|LOCUS_08900 884864 883389 gene locus_tag LOCUS_08910 gene aldA 884864 883389 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115926.1 protein_id gnl|my_center|LOCUS_08910 885742 884903 gene locus_tag LOCUS_08920 885742 884903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 885825 886583 gene locus_tag LOCUS_08930 885825 886583 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867875.1 protein_id gnl|my_center|LOCUS_08930 886567 887304 gene locus_tag LOCUS_08940 886567 887304 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496840.1 protein_id gnl|my_center|LOCUS_08940 887353 887721 gene locus_tag LOCUS_08950 887353 887721 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250453.1 protein_id gnl|my_center|LOCUS_08950 887728 888141 gene locus_tag LOCUS_08960 gene rplM 887728 888141 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_08960 888144 888545 gene locus_tag LOCUS_08970 888144 888545 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_08970 888550 888768 gene locus_tag LOCUS_08980 888550 888768 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_08980 888770 888847 gene locus_tag LOCUS_t00250 888770 888847 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 889074 888832 gene locus_tag LOCUS_08990 889074 888832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 889982 890506 gene locus_tag LOCUS_09000 889982 890506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 890458 890616 gene locus_tag LOCUS_09010 890458 890616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 890621 891196 gene locus_tag LOCUS_09020 890621 891196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 892520 891624 gene locus_tag LOCUS_09030 892520 891624 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970212.1 protein_id gnl|my_center|LOCUS_09030 892693 893436 gene locus_tag LOCUS_09040 892693 893436 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146484.1 protein_id gnl|my_center|LOCUS_09040 893965 893507 gene locus_tag LOCUS_09050 893965 893507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 894079 894561 gene locus_tag LOCUS_09060 894079 894561 CDS product AAA-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980406.1 protein_id gnl|my_center|LOCUS_09060 896186 894564 gene locus_tag LOCUS_09070 896186 894564 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846899.1 protein_id gnl|my_center|LOCUS_09070 896968 896183 gene locus_tag LOCUS_09080 896968 896183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978575.1 protein_id gnl|my_center|LOCUS_09080 897203 898156 gene locus_tag LOCUS_09090 897203 898156 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761777.1 protein_id gnl|my_center|LOCUS_09090 899066 898146 gene locus_tag LOCUS_09100 899066 898146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267088.1 protein_id gnl|my_center|LOCUS_09100 899264 900445 gene locus_tag LOCUS_09110 899264 900445 CDS product isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978517.1 protein_id gnl|my_center|LOCUS_09110 900451 901707 gene locus_tag LOCUS_09120 gene leuC 900451 901707 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_09120 901704 902189 gene locus_tag LOCUS_09130 gene leuD 901704 902189 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_09130 902231 903226 gene locus_tag LOCUS_09140 902231 903226 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_09140 904237 903227 gene locus_tag LOCUS_09150 gene ilvC 904237 903227 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_09150 904482 904231 gene locus_tag LOCUS_09160 904482 904231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 906151 904454 gene locus_tag LOCUS_09170 906151 904454 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_09170 906384 906740 gene locus_tag LOCUS_09180 906384 906740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 907287 906700 gene locus_tag LOCUS_09190 gene cobO 907287 906700 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812021.1 protein_id gnl|my_center|LOCUS_09190 907300 908034 gene locus_tag LOCUS_09200 907300 908034 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249827.1 protein_id gnl|my_center|LOCUS_09200 908134 908310 gene locus_tag LOCUS_09210 908134 908310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 908356 908784 gene locus_tag LOCUS_09220 908356 908784 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_09220 908794 910155 gene locus_tag LOCUS_09230 908794 910155 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_09230 910256 910900 gene locus_tag LOCUS_09240 910256 910900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 911867 911085 gene locus_tag LOCUS_09250 911867 911085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 918127 911864 gene locus_tag LOCUS_09260 918127 911864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 918236 919258 gene locus_tag LOCUS_09270 918236 919258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270489.1 protein_id gnl|my_center|LOCUS_09270 920819 919248 gene locus_tag LOCUS_09280 gene pheT 920819 919248 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_09280 921169 920840 gene locus_tag LOCUS_09290 921169 920840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 921408 921920 gene locus_tag LOCUS_09300 921408 921920 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_09300 922011 922772 gene locus_tag LOCUS_09310 922011 922772 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_09310 922803 923285 gene locus_tag LOCUS_09320 922803 923285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 923275 923967 gene locus_tag LOCUS_09330 923275 923967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 923957 924373 gene locus_tag LOCUS_09340 923957 924373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 924375 924818 gene locus_tag LOCUS_09350 924375 924818 CDS product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320043.1 protein_id gnl|my_center|LOCUS_09350 924822 925493 gene locus_tag LOCUS_09360 924822 925493 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868606.1 protein_id gnl|my_center|LOCUS_09360 925503 927122 gene locus_tag LOCUS_09370 925503 927122 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249003.1 protein_id gnl|my_center|LOCUS_09370 927129 928784 gene locus_tag LOCUS_09380 gene flaJ 927129 928784 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147051.1 protein_id gnl|my_center|LOCUS_09380 928903 932442 gene locus_tag LOCUS_09390 928903 932442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 932442 933038 gene locus_tag LOCUS_09400 932442 933038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 933315 933010 gene locus_tag LOCUS_09410 933315 933010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 933380 933547 gene locus_tag LOCUS_09420 933380 933547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 933549 933824 gene locus_tag LOCUS_09430 933549 933824 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762438.1 protein_id gnl|my_center|LOCUS_09430 933826 934905 gene locus_tag LOCUS_09440 933826 934905 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980376.1 protein_id gnl|my_center|LOCUS_09440 934946 936304 gene locus_tag LOCUS_09450 gene glmM 934946 936304 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065480.1 protein_id gnl|my_center|LOCUS_09450 936909 936301 gene locus_tag LOCUS_09460 936909 936301 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_09460 937380 936934 gene locus_tag LOCUS_09470 937380 936934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 938759 937482 gene locus_tag LOCUS_09480 938759 937482 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_09480 939546 938761 gene locus_tag LOCUS_09490 gene uppS 939546 938761 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_09490 940532 939597 gene locus_tag LOCUS_09500 gene trm5b 940532 939597 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_09500 942583 940529 gene locus_tag LOCUS_09510 942583 940529 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_09510 942651 943277 gene locus_tag LOCUS_09520 942651 943277 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_09520 943347 944603 gene locus_tag LOCUS_09530 gene ahcY 943347 944603 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_09530 944600 945820 gene locus_tag LOCUS_09540 944600 945820 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877199.1 protein_id gnl|my_center|LOCUS_09540 945869 946474 gene locus_tag LOCUS_09550 945869 946474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 946514 947839 gene locus_tag LOCUS_09560 gene serS 946514 947839 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_09560 949382 947928 gene locus_tag LOCUS_09570 949382 947928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 949813 949430 gene locus_tag LOCUS_09580 949813 949430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 950799 949813 gene locus_tag LOCUS_09590 950799 949813 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980461.1 protein_id gnl|my_center|LOCUS_09590 951101 952048 gene locus_tag LOCUS_09600 gene pdxS 951101 952048 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249172.1 protein_id gnl|my_center|LOCUS_09600 952217 952768 gene locus_tag LOCUS_09610 952217 952768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 953394 952771 gene locus_tag LOCUS_09620 953394 952771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 955060 953387 gene locus_tag LOCUS_09630 955060 953387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 955841 955074 gene locus_tag LOCUS_09640 955841 955074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 955998 956070 gene locus_tag LOCUS_t00260 955998 956070 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 957097 956093 gene locus_tag LOCUS_09650 957097 956093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 957634 957131 gene locus_tag LOCUS_09660 957634 957131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 959147 957729 gene locus_tag LOCUS_09670 959147 957729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 959487 959296 gene locus_tag LOCUS_09680 959487 959296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 959393 959809 gene locus_tag LOCUS_09690 959393 959809 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_09690 959809 960453 gene locus_tag LOCUS_09700 959809 960453 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722009.1 protein_id gnl|my_center|LOCUS_09700 960933 960763 gene locus_tag LOCUS_09710 960933 960763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 961702 960944 gene locus_tag LOCUS_09720 961702 960944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 962490 961699 gene locus_tag LOCUS_09730 962490 961699 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 protein_id gnl|my_center|LOCUS_09730 964202 962490 gene locus_tag LOCUS_09740 964202 962490 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_09740 964440 964994 gene locus_tag LOCUS_09750 964440 964994 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_09750 965001 965600 gene locus_tag LOCUS_09760 965001 965600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 966362 965592 gene locus_tag LOCUS_09770 gene dph5 966362 965592 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877888.1 protein_id gnl|my_center|LOCUS_09770 967573 966359 gene locus_tag LOCUS_09780 gene eno 967573 966359 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064335.1 protein_id gnl|my_center|LOCUS_09780 968600 967722 gene locus_tag LOCUS_09790 968600 967722 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_09790 969007 968597 gene locus_tag LOCUS_09800 969007 968597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 970967 969000 gene locus_tag LOCUS_09810 gene lonB 970967 969000 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_09810 971365 971024 gene locus_tag LOCUS_09820 971365 971024 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868615.1 protein_id gnl|my_center|LOCUS_09820 971493 972611 gene locus_tag LOCUS_09830 gene aroC 971493 972611 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_09830 974324 972579 gene locus_tag LOCUS_09840 974324 972579 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 protein_id gnl|my_center|LOCUS_09840 975500 974394 gene locus_tag LOCUS_09850 975500 974394 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287605.1 protein_id gnl|my_center|LOCUS_09850 976569 975502 gene locus_tag LOCUS_09860 976569 975502 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979266.1 protein_id gnl|my_center|LOCUS_09860 978322 976610 gene locus_tag LOCUS_09870 978322 976610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 980958 978331 gene locus_tag LOCUS_09880 gene alaS 980958 978331 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868790.1 protein_id gnl|my_center|LOCUS_09880 981572 980994 gene locus_tag LOCUS_09890 981572 980994 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879579.1 protein_id gnl|my_center|LOCUS_09890 981686 982120 gene locus_tag LOCUS_09900 981686 982120 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_09900 982223 982513 gene locus_tag LOCUS_09910 982223 982513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 982613 982747 gene locus_tag LOCUS_09920 982613 982747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 983998 982712 gene locus_tag LOCUS_09930 gene aspS 983998 982712 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_09930 984090 985055 gene locus_tag LOCUS_09940 984090 985055 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_09940 985447 986076 gene locus_tag LOCUS_09950 985447 986076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 986095 986889 gene locus_tag LOCUS_09960 986095 986889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 986876 987724 gene locus_tag LOCUS_09970 986876 987724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_09970 987724 988602 gene locus_tag LOCUS_09980 987724 988602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 988595 989026 gene locus_tag LOCUS_09990 988595 989026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 989961 989752 gene locus_tag LOCUS_10000 989961 989752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 991542 991111 gene locus_tag LOCUS_10010 991542 991111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 991800 991600 gene locus_tag LOCUS_10020 991800 991600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 992836 992763 gene locus_tag LOCUS_t00270 992836 992763 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 993146 995263 gene locus_tag LOCUS_10030 993146 995263 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_10030 995263 995571 gene locus_tag LOCUS_10040 995263 995571 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_10040 995576 996253 gene locus_tag LOCUS_10050 gene ubiE 995576 996253 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_10050 996289 996642 gene locus_tag LOCUS_10060 996289 996642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 996581 996811 gene locus_tag LOCUS_10070 996581 996811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 997757 996792 gene locus_tag LOCUS_10080 gene thiL 997757 996792 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066048.1 protein_id gnl|my_center|LOCUS_10080 998817 997762 gene locus_tag LOCUS_10090 998817 997762 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_10090 998916 1000055 gene locus_tag LOCUS_10100 998916 1000055 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_10100 1000058 1000996 gene locus_tag LOCUS_10110 1000058 1000996 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975888.1 protein_id gnl|my_center|LOCUS_10110 1000986 1001321 gene locus_tag LOCUS_10120 1000986 1001321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1001323 1003230 gene locus_tag LOCUS_10130 1001323 1003230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1004219 1003251 gene locus_tag LOCUS_10140 1004219 1003251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1005027 1004269 gene locus_tag LOCUS_10150 1005027 1004269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1005131 1005730 gene locus_tag LOCUS_10160 1005131 1005730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1005860 1006723 gene locus_tag LOCUS_10170 gene dapA 1005860 1006723 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317384.1 protein_id gnl|my_center|LOCUS_10170 1006901 1007269 gene locus_tag LOCUS_10180 gene rpl7ae 1006901 1007269 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053601.1 protein_id gnl|my_center|LOCUS_10180 1007281 1007490 gene locus_tag LOCUS_10190 1007281 1007490 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878268.1 protein_id gnl|my_center|LOCUS_10190 1007496 1007705 gene locus_tag LOCUS_10200 1007496 1007705 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_10200 1007711 1008157 gene locus_tag LOCUS_10210 gene ndk 1007711 1008157 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_10210 1008132 1009904 gene locus_tag LOCUS_10220 gene infB 1008132 1009904 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_10220 1010869 1009901 gene locus_tag LOCUS_10230 1010869 1009901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1011283 1010885 gene locus_tag LOCUS_10240 gene speD 1011283 1010885 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_10240 1012247 1011465 gene locus_tag LOCUS_10250 1012247 1011465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1012315 1012965 gene locus_tag LOCUS_10260 gene lipB 1012315 1012965 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_10260 1014499 1012931 gene locus_tag LOCUS_10270 gene pruA 1014499 1012931 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234655.1 protein_id gnl|my_center|LOCUS_10270 1014620 1015993 gene locus_tag LOCUS_10280 gene purB 1014620 1015993 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_10280 1015974 1016561 gene locus_tag LOCUS_10290 1015974 1016561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1017184 1016543 gene locus_tag LOCUS_10300 1017184 1016543 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066212.1 protein_id gnl|my_center|LOCUS_10300 1017242 1017733 gene locus_tag LOCUS_10310 1017242 1017733 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_10310 1017756 1018235 gene locus_tag LOCUS_10320 1017756 1018235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1018978 1018232 gene locus_tag LOCUS_10330 1018978 1018232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1020290 1019007 gene locus_tag LOCUS_10340 1020290 1019007 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_10340 1020413 1021318 gene locus_tag LOCUS_10350 gene pyrB 1020413 1021318 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_10350 1021315 1021788 gene locus_tag LOCUS_10360 gene pyrI 1021315 1021788 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_10360 1022534 1021791 gene locus_tag LOCUS_10370 1022534 1021791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1022964 1022554 gene locus_tag LOCUS_10380 1022964 1022554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1023230 1023856 gene locus_tag LOCUS_10390 1023230 1023856 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_10390 1023857 1024282 gene locus_tag LOCUS_10400 1023857 1024282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1024230 1024889 gene locus_tag LOCUS_10410 1024230 1024889 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_10410 1025140 1024886 gene locus_tag LOCUS_10420 1025140 1024886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1027426 1025141 gene locus_tag LOCUS_10430 gene purL 1027426 1025141 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_10430 1027605 1027393 gene locus_tag LOCUS_10440 1027605 1027393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1028548 1028306 gene locus_tag LOCUS_10450 1028548 1028306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1028963 1030069 gene locus_tag LOCUS_10460 1028963 1030069 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249495.1 protein_id gnl|my_center|LOCUS_10460 1030544 1030050 gene locus_tag LOCUS_10470 1030544 1030050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1030596 1031345 gene locus_tag LOCUS_10480 gene ribB 1030596 1031345 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879598.1 protein_id gnl|my_center|LOCUS_10480 1031272 1031703 gene locus_tag LOCUS_10490 1031272 1031703 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_10490 1031700 1032188 gene locus_tag LOCUS_10500 gene ribC 1031700 1032188 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_10500 1032199 1032606 gene locus_tag LOCUS_10510 gene ribH 1032199 1032606 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496458.1 protein_id gnl|my_center|LOCUS_10510 1032603 1033211 gene locus_tag LOCUS_10520 1032603 1033211 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242345.1 protein_id gnl|my_center|LOCUS_10520 1034088 1033201 gene locus_tag LOCUS_10530 gene mptA 1034088 1033201 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066005.1 protein_id gnl|my_center|LOCUS_10530 1034457 1034089 gene locus_tag LOCUS_10540 1034457 1034089 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496690.1 protein_id gnl|my_center|LOCUS_10540 1034690 1034463 gene locus_tag LOCUS_10550 1034690 1034463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1034835 1034912 gene locus_tag LOCUS_t00280 1034835 1034912 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1035840 1035361 gene locus_tag LOCUS_10560 1035840 1035361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1036012 1036767 gene locus_tag LOCUS_10570 1036012 1036767 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_10570 1037602 1036832 gene locus_tag LOCUS_10580 gene bacC 1037602 1036832 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243359.1 protein_id gnl|my_center|LOCUS_10580 1038068 1037658 gene locus_tag LOCUS_10590 1038068 1037658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1038364 1039494 gene locus_tag LOCUS_10600 gene yjiB 1038364 1039494 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_10600 1039556 1040701 gene locus_tag LOCUS_10610 gene yjiB 1039556 1040701 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_10610 1040764 1041663 gene locus_tag LOCUS_10620 1040764 1041663 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404262.1 protein_id gnl|my_center|LOCUS_10620 1042048 1041665 gene locus_tag LOCUS_10630 1042048 1041665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1042154 1042618 gene locus_tag LOCUS_10640 1042154 1042618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007889.1 protein_id gnl|my_center|LOCUS_10640 1042647 1043303 gene locus_tag LOCUS_10650 1042647 1043303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1044701 1043292 gene locus_tag LOCUS_10660 1044701 1043292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_10660 1045129 1044707 gene locus_tag LOCUS_10670 1045129 1044707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1046405 1045167 gene locus_tag LOCUS_10680 1046405 1045167 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979148.1 protein_id gnl|my_center|LOCUS_10680 1046662 1047327 gene locus_tag LOCUS_10690 gene psmB 1046662 1047327 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_10690 1047379 1049301 gene locus_tag LOCUS_10700 1047379 1049301 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_10700 1049963 1049298 gene locus_tag LOCUS_10710 gene fsa 1049963 1049298 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_10710 1050906 1049947 gene locus_tag LOCUS_10720 1050906 1049947 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_10720 1051751 1050903 gene locus_tag LOCUS_10730 1051751 1050903 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870186.1 protein_id gnl|my_center|LOCUS_10730 1052925 1051855 gene locus_tag LOCUS_10740 gene ftsZ 1052925 1051855 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_10740 1054255 1052993 gene locus_tag LOCUS_10750 1054255 1052993 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429692.1 protein_id gnl|my_center|LOCUS_10750 1055475 1054438 gene locus_tag LOCUS_10760 1055475 1054438 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965219.1 protein_id gnl|my_center|LOCUS_10760 1056599 1055460 gene locus_tag LOCUS_10770 1056599 1055460 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_10770 1057503 1056604 gene locus_tag LOCUS_10780 1057503 1056604 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000674004.1 protein_id gnl|my_center|LOCUS_10780 1058588 1057503 gene locus_tag LOCUS_10790 gene hppD 1058588 1057503 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838760.1 protein_id gnl|my_center|LOCUS_10790 1058739 1059380 gene locus_tag LOCUS_10800 1058739 1059380 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429825.1 protein_id gnl|my_center|LOCUS_10800 1059726 1059370 gene locus_tag LOCUS_10810 1059726 1059370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1059880 1061337 gene locus_tag LOCUS_10820 gene thiI 1059880 1061337 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_10820 1061318 1061671 gene locus_tag LOCUS_10830 1061318 1061671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1062155 1061634 gene locus_tag LOCUS_10840 1062155 1061634 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320322.1 protein_id gnl|my_center|LOCUS_10840 1062786 1062160 gene locus_tag LOCUS_10850 1062786 1062160 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979166.1 protein_id gnl|my_center|LOCUS_10850 1062850 1064121 gene locus_tag LOCUS_10860 1062850 1064121 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_10860 1064108 1064869 gene locus_tag LOCUS_10870 1064108 1064869 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_10870 1065217 1065005 gene locus_tag LOCUS_10880 1065217 1065005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1067000 1065288 gene locus_tag LOCUS_10890 gene cobJ 1067000 1065288 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258424.1 protein_id gnl|my_center|LOCUS_10890 1067790 1066975 gene locus_tag LOCUS_10900 gene cobM 1067790 1066975 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_10900 1068503 1067787 gene locus_tag LOCUS_10910 1068503 1067787 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979885.1 protein_id gnl|my_center|LOCUS_10910 1069102 1068500 gene locus_tag LOCUS_10920 gene cbiT 1069102 1068500 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979887.1 protein_id gnl|my_center|LOCUS_10920 1070178 1069102 gene locus_tag LOCUS_10930 gene cbiD 1070178 1069102 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155864053.1 protein_id gnl|my_center|LOCUS_10930 1070928 1070179 gene locus_tag LOCUS_10940 1070928 1070179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1071707 1070925 gene locus_tag LOCUS_10950 1071707 1070925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1072443 1071691 gene locus_tag LOCUS_10960 1072443 1071691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 1073093 1072440 gene locus_tag LOCUS_10970 1073093 1072440 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_10970 1073282 1073593 gene locus_tag LOCUS_10980 1073282 1073593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1073598 1073855 gene locus_tag LOCUS_10990 1073598 1073855 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012980461.1 protein_id gnl|my_center|LOCUS_10990 1073938 1074294 gene locus_tag LOCUS_11000 1073938 1074294 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064265.1 protein_id gnl|my_center|LOCUS_11000 1074975 1074295 gene locus_tag LOCUS_11010 gene rpiA 1074975 1074295 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_11010 1075056 1075514 gene locus_tag LOCUS_11020 1075056 1075514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1076009 1075515 gene locus_tag LOCUS_11030 1076009 1075515 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688183.1 protein_id gnl|my_center|LOCUS_11030 1076192 1076488 gene locus_tag LOCUS_11040 1076192 1076488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1076485 1077351 gene locus_tag LOCUS_11050 1076485 1077351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1077411 1079060 gene locus_tag LOCUS_11060 1077411 1079060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1079272 1079057 gene locus_tag LOCUS_11070 1079272 1079057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1079585 1079965 gene locus_tag LOCUS_11080 1079585 1079965 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_11080 1079943 1080512 gene locus_tag LOCUS_11090 1079943 1080512 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876692.1 protein_id gnl|my_center|LOCUS_11090 1080509 1081573 gene locus_tag LOCUS_11100 1080509 1081573 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_11100 1081590 1082486 gene locus_tag LOCUS_11110 1081590 1082486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1082488 1083240 gene locus_tag LOCUS_11120 1082488 1083240 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_11120 1083304 1084281 gene locus_tag LOCUS_11130 1083304 1084281 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732701.1 protein_id gnl|my_center|LOCUS_11130 1084278 1085330 gene locus_tag LOCUS_11140 1084278 1085330 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_11140 1085314 1086336 gene locus_tag LOCUS_11150 1085314 1086336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1087166 1086252 gene locus_tag LOCUS_11160 1087166 1086252 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387325.1 protein_id gnl|my_center|LOCUS_11160 1088153 1087218 gene locus_tag LOCUS_11170 gene cbiB 1088153 1087218 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867171.1 protein_id gnl|my_center|LOCUS_11170 1089148 1088153 gene locus_tag LOCUS_11180 gene cobD 1089148 1088153 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_11180 1089278 1090057 gene locus_tag LOCUS_11190 gene cobS 1089278 1090057 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496830.1 protein_id gnl|my_center|LOCUS_11190 1090536 1090000 gene locus_tag LOCUS_11200 1090536 1090000 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879810.1 protein_id gnl|my_center|LOCUS_11200 1091733 1090879 gene locus_tag LOCUS_11210 1091733 1090879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1091941 1092657 gene locus_tag LOCUS_11220 1091941 1092657 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870406.1 protein_id gnl|my_center|LOCUS_11220 1092752 1093102 gene locus_tag LOCUS_11230 1092752 1093102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1093258 1093176 gene locus_tag LOCUS_t00290 1093258 1093176 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1093427 1093266 gene locus_tag LOCUS_11240 1093427 1093266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1093681 1096380 gene locus_tag LOCUS_11250 1093681 1096380 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_11250 1096736 1096377 gene locus_tag LOCUS_11260 1096736 1096377 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979093.1 protein_id gnl|my_center|LOCUS_11260 1097050 1097271 gene locus_tag LOCUS_11270 1097050 1097271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1097381 1097764 gene locus_tag LOCUS_11280 1097381 1097764 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496879.1 protein_id gnl|my_center|LOCUS_11280 1097804 1098718 gene locus_tag LOCUS_11290 gene rnz 1097804 1098718 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_11290 1099189 1098719 gene locus_tag LOCUS_11300 gene dcd 1099189 1098719 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868899.1 protein_id gnl|my_center|LOCUS_11300 1100544 1099222 gene locus_tag LOCUS_11310 1100544 1099222 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728732.1 protein_id gnl|my_center|LOCUS_11310 1100659 1101135 gene locus_tag LOCUS_11320 1100659 1101135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1101113 1102447 gene locus_tag LOCUS_11330 gene purD 1101113 1102447 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061056.1 protein_id gnl|my_center|LOCUS_11330 1103311 1102388 gene locus_tag LOCUS_11340 1103311 1102388 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_11340 1104191 1103313 gene locus_tag LOCUS_11350 gene hemH 1104191 1103313 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989926.1 protein_id gnl|my_center|LOCUS_11350 1105192 1104188 gene locus_tag LOCUS_11360 gene hemE 1105192 1104188 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228059.1 protein_id gnl|my_center|LOCUS_11360 1106505 1105195 gene locus_tag LOCUS_11370 gene asnS 1106505 1105195 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_11370 1106995 1106537 gene locus_tag LOCUS_11380 1106995 1106537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1106916 1107092 gene locus_tag LOCUS_11390 1106916 1107092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1107144 1108103 gene locus_tag LOCUS_11400 gene htpX 1107144 1108103 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980430.1 protein_id gnl|my_center|LOCUS_11400 1108146 1108217 gene locus_tag LOCUS_t00300 1108146 1108217 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1109054 1109659 gene locus_tag LOCUS_11410 1109054 1109659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11410 1109629 1110057 gene locus_tag LOCUS_11420 1109629 1110057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11420 1111256 1111444 gene locus_tag LOCUS_11430 1111256 1111444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1111726 1111562 gene locus_tag LOCUS_11440 1111726 1111562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1112195 1112719 gene locus_tag LOCUS_11450 1112195 1112719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1112839 1113768 gene locus_tag LOCUS_11460 1112839 1113768 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485796.1 protein_id gnl|my_center|LOCUS_11460 1113756 1114472 gene locus_tag LOCUS_11470 1113756 1114472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1115929 1114418 gene locus_tag LOCUS_11480 gene crtI 1115929 1114418 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061143.1 protein_id gnl|my_center|LOCUS_11480 1116408 1115926 gene locus_tag LOCUS_11490 1116408 1115926 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_11490 1116882 1118294 gene locus_tag LOCUS_11500 1116882 1118294 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_11500 1119344 1120564 gene locus_tag LOCUS_11510 1119344 1120564 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978791.1 protein_id gnl|my_center|LOCUS_11510 1121135 1121062 gene locus_tag LOCUS_t00310 1121135 1121062 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1121284 1123575 gene locus_tag LOCUS_11520 1121284 1123575 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528921.1 protein_id gnl|my_center|LOCUS_11520 1123565 1123750 gene locus_tag LOCUS_11530 1123565 1123750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1123865 1124461 gene locus_tag LOCUS_11540 1123865 1124461 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_11540 1125276 1124467 gene locus_tag LOCUS_11550 1125276 1124467 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_11550 1125775 1125299 gene locus_tag LOCUS_11560 1125775 1125299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1126974 1125772 gene locus_tag LOCUS_11570 1126974 1125772 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878404.1 protein_id gnl|my_center|LOCUS_11570 1127352 1128749 gene locus_tag LOCUS_11580 gene proS 1127352 1128749 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_11580 1130715 1128757 gene locus_tag LOCUS_11590 1130715 1128757 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_11590 1131380 1130781 gene locus_tag LOCUS_11600 1131380 1130781 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846725.1 protein_id gnl|my_center|LOCUS_11600 1131473 1133419 gene locus_tag LOCUS_11610 gene acs 1131473 1133419 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978720.1 protein_id gnl|my_center|LOCUS_11610 1134023 1133535 gene locus_tag LOCUS_11620 1134023 1133535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1134026 1134766 gene locus_tag LOCUS_11630 1134026 1134766 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_11630 1134934 1135224 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctactaaggttctattttac 1136221 1135373 gene locus_tag LOCUS_11640 1136221 1135373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1136220 1136900 gene locus_tag LOCUS_11650 gene cas6 1136220 1136900 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251203.1 protein_id gnl|my_center|LOCUS_11650 1136901 1139813 gene locus_tag LOCUS_11660 1136901 1139813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1139830 1140777 gene locus_tag LOCUS_11670 1139830 1140777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1140774 1141457 gene locus_tag LOCUS_11680 1140774 1141457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1141442 1143238 gene locus_tag LOCUS_11690 1141442 1143238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1143243 1143752 gene locus_tag LOCUS_11700 1143243 1143752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1143871 1144716 gene locus_tag LOCUS_11710 gene cas1b 1143871 1144716 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060964.1 protein_id gnl|my_center|LOCUS_11710 1144719 1144982 gene locus_tag LOCUS_11720 gene cas2 1144719 1144982 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_11720 1145083 1151099 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctacttaggttctattttac 1151100 1151283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1151310 >1153754 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctacttaggttctattttac >Feature sequence2 2 1348 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctacttaggttctattttac 1874 1801 gene locus_tag LOCUS_t00320 1874 1801 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3105 1891 gene locus_tag LOCUS_11730 3105 1891 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_11730 4439 3102 gene locus_tag LOCUS_11740 gene cysS 4439 3102 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_11740 4529 5824 gene locus_tag LOCUS_11750 4529 5824 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113751.1 protein_id gnl|my_center|LOCUS_11750 6927 5803 gene locus_tag LOCUS_11760 6927 5803 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_11760 7124 7471 gene locus_tag LOCUS_11770 7124 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 9100 7700 gene locus_tag LOCUS_11780 9100 7700 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847046.1 protein_id gnl|my_center|LOCUS_11780 10415 9207 gene locus_tag LOCUS_11790 gene lysA 10415 9207 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_11790 10807 10514 gene locus_tag LOCUS_11800 gene tatA 10807 10514 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879548.1 protein_id gnl|my_center|LOCUS_11800 10928 11335 gene locus_tag LOCUS_11810 10928 11335 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240265.1 protein_id gnl|my_center|LOCUS_11810 11338 12465 gene locus_tag LOCUS_11820 11338 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 12492 13085 gene locus_tag LOCUS_11830 12492 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 14157 13063 gene locus_tag LOCUS_11840 14157 13063 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391684.1 protein_id gnl|my_center|LOCUS_11840 14244 14546 gene locus_tag LOCUS_11850 14244 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 14732 14547 gene locus_tag LOCUS_11860 14732 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 15034 14735 gene locus_tag LOCUS_11870 15034 14735 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_11870 15518 15027 gene locus_tag LOCUS_11880 15518 15027 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_11880 15693 15496 gene locus_tag LOCUS_11890 15693 15496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 16329 15700 gene locus_tag LOCUS_11900 gene rpoE 16329 15700 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_11900 16412 17557 gene locus_tag LOCUS_11910 16412 17557 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044389757.1 protein_id gnl|my_center|LOCUS_11910 17554 18552 gene locus_tag LOCUS_11920 17554 18552 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296895.1 protein_id gnl|my_center|LOCUS_11920 18600 19856 gene locus_tag LOCUS_11930 18600 19856 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010923212.1 protein_id gnl|my_center|LOCUS_11930 19872 20573 gene locus_tag LOCUS_11940 19872 20573 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870494.1 protein_id gnl|my_center|LOCUS_11940 20697 21857 gene locus_tag LOCUS_11950 20697 21857 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979124.1 protein_id gnl|my_center|LOCUS_11950 21861 22217 gene locus_tag LOCUS_11960 21861 22217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 22980 22210 gene locus_tag LOCUS_11970 22980 22210 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_11970 23142 24710 gene locus_tag LOCUS_11980 23142 24710 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978016.1 protein_id gnl|my_center|LOCUS_11980 24895 24716 gene locus_tag LOCUS_11990 24895 24716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 25027 25206 gene locus_tag LOCUS_12000 25027 25206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 25736 25119 gene locus_tag LOCUS_12010 25736 25119 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146835.1 protein_id gnl|my_center|LOCUS_12010 27030 25951 gene locus_tag LOCUS_12020 27030 25951 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980662.1 protein_id gnl|my_center|LOCUS_12020 27214 27999 gene locus_tag LOCUS_12030 27214 27999 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978009.1 protein_id gnl|my_center|LOCUS_12030 29448 28000 gene locus_tag LOCUS_12040 29448 28000 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846143.1 protein_id gnl|my_center|LOCUS_12040 29681 30253 gene locus_tag LOCUS_12050 29681 30253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 30295 31470 gene locus_tag LOCUS_12060 30295 31470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 31470 32252 gene locus_tag LOCUS_12070 31470 32252 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_12070 33244 32243 gene locus_tag LOCUS_12080 gene acdB 33244 32243 CDS product putative isocaproyl-CoA dehydrogenase AcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986694.1 protein_id gnl|my_center|LOCUS_12080 34358 33234 gene locus_tag LOCUS_12090 34358 33234 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877943.1 protein_id gnl|my_center|LOCUS_12090 35169 34402 gene locus_tag LOCUS_12100 35169 34402 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651002.1 protein_id gnl|my_center|LOCUS_12100 36025 35240 gene locus_tag LOCUS_12110 36025 35240 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_12110 36161 36985 gene locus_tag LOCUS_12120 36161 36985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204824.1 protein_id gnl|my_center|LOCUS_12120 36986 37681 gene locus_tag LOCUS_12130 36986 37681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936279.1 protein_id gnl|my_center|LOCUS_12130 38980 37685 gene locus_tag LOCUS_12140 38980 37685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 39223 39816 gene locus_tag LOCUS_12150 39223 39816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 40454 39813 gene locus_tag LOCUS_12160 40454 39813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 40565 40738 gene locus_tag LOCUS_12170 gene lysW 40565 40738 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_12170 40809 41861 gene locus_tag LOCUS_12180 gene argC 40809 41861 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_12180 41867 42664 gene locus_tag LOCUS_12190 41867 42664 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_12190 42655 43854 gene locus_tag LOCUS_12200 42655 43854 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_12200 43851 44699 gene locus_tag LOCUS_12210 gene lysX 43851 44699 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 protein_id gnl|my_center|LOCUS_12210 44696 45766 gene locus_tag LOCUS_12220 44696 45766 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867567.1 protein_id gnl|my_center|LOCUS_12220 46009 46794 gene locus_tag LOCUS_12230 46009 46794 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053641.1 protein_id gnl|my_center|LOCUS_12230 46791 47399 gene locus_tag LOCUS_12240 gene hisG 46791 47399 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249198.1 protein_id gnl|my_center|LOCUS_12240 47386 48516 gene locus_tag LOCUS_12250 gene hisD 47386 48516 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249199.1 protein_id gnl|my_center|LOCUS_12250 48513 49043 gene locus_tag LOCUS_12260 gene hisB 48513 49043 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249200.1 protein_id gnl|my_center|LOCUS_12260 49040 49609 gene locus_tag LOCUS_12270 gene hisH 49040 49609 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249201.1 protein_id gnl|my_center|LOCUS_12270 49606 50292 gene locus_tag LOCUS_12280 gene hisA 49606 50292 CDS product 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249202.1 protein_id gnl|my_center|LOCUS_12280 50294 51046 gene locus_tag LOCUS_12290 gene hisF 50294 51046 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868978.1 protein_id gnl|my_center|LOCUS_12290 51033 51656 gene locus_tag LOCUS_12300 gene hisIE 51033 51656 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249204.1 protein_id gnl|my_center|LOCUS_12300 51653 52636 gene locus_tag LOCUS_12310 gene hisC 51653 52636 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249205.1 protein_id gnl|my_center|LOCUS_12310 53045 54718 gene locus_tag LOCUS_12320 53045 54718 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980561.1 protein_id gnl|my_center|LOCUS_12320 54862 56115 gene locus_tag LOCUS_12330 54862 56115 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731589.1 protein_id gnl|my_center|LOCUS_12330 56112 56621 gene locus_tag LOCUS_12340 56112 56621 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893865.1 protein_id gnl|my_center|LOCUS_12340 56630 57700 gene locus_tag LOCUS_12350 56630 57700 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 protein_id gnl|my_center|LOCUS_12350 57896 59296 gene locus_tag LOCUS_12360 gene lysS 57896 59296 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_12360 59825 59484 gene locus_tag LOCUS_12370 59825 59484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 59900 60511 gene locus_tag LOCUS_12380 gene paiB 59900 60511 CDS product protease synthase/sporulation negative transcriptional regulator PaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244329.1 protein_id gnl|my_center|LOCUS_12380 60987 60529 gene locus_tag LOCUS_12390 60987 60529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 62671 60959 gene locus_tag LOCUS_12400 62671 60959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979769.1 protein_id gnl|my_center|LOCUS_12400 62735 62860 gene locus_tag LOCUS_12410 62735 62860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 62903 63097 gene locus_tag LOCUS_12420 62903 63097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 63128 63898 gene locus_tag LOCUS_12430 63128 63898 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979458.1 protein_id gnl|my_center|LOCUS_12430 64923 63895 gene locus_tag LOCUS_12440 64923 63895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 65652 65020 gene locus_tag LOCUS_12450 65652 65020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 65746 66960 gene locus_tag LOCUS_12460 65746 66960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 67046 70120 gene locus_tag LOCUS_12470 gene ileS 67046 70120 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_12470 70139 70672 gene locus_tag LOCUS_12480 70139 70672 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_12480 70703 71551 gene locus_tag LOCUS_12490 70703 71551 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_12490 71887 71540 gene locus_tag LOCUS_12500 gene sdx 71887 71540 CDS product sulredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846395.1 protein_id gnl|my_center|LOCUS_12500 72311 74095 gene locus_tag LOCUS_12510 72311 74095 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978774.1 protein_id gnl|my_center|LOCUS_12510 74082 74861 gene locus_tag LOCUS_12520 74082 74861 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651002.1 protein_id gnl|my_center|LOCUS_12520 76120 74858 gene locus_tag LOCUS_12530 76120 74858 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240344.1 protein_id gnl|my_center|LOCUS_12530 77085 76183 gene locus_tag LOCUS_12540 77085 76183 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966109.1 protein_id gnl|my_center|LOCUS_12540 77229 77933 gene locus_tag LOCUS_12550 gene radB 77229 77933 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320585.1 protein_id gnl|my_center|LOCUS_12550 77937 78953 gene locus_tag LOCUS_12560 gene fen 77937 78953 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_12560 79239 79388 gene locus_tag LOCUS_12570 79239 79388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 80377 79391 gene locus_tag LOCUS_12580 80377 79391 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_12580 81135 80392 gene locus_tag LOCUS_12590 81135 80392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 84638 81132 gene locus_tag LOCUS_12600 gene smc 84638 81132 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053701.1 protein_id gnl|my_center|LOCUS_12600 85444 84719 gene locus_tag LOCUS_12610 85444 84719 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_12610 86290 85454 gene locus_tag LOCUS_12620 86290 85454 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_12620 87453 86290 gene locus_tag LOCUS_12630 87453 86290 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763039.1 protein_id gnl|my_center|LOCUS_12630 87509 87688 gene locus_tag LOCUS_12640 87509 87688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 87676 88116 gene locus_tag LOCUS_12650 87676 88116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 88192 89871 gene locus_tag LOCUS_12660 88192 89871 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968009.1 protein_id gnl|my_center|LOCUS_12660 90023 90856 gene locus_tag LOCUS_12670 90023 90856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 92070 90859 gene locus_tag LOCUS_12680 92070 90859 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113027.1 protein_id gnl|my_center|LOCUS_12680 92284 92556 gene locus_tag LOCUS_12690 92284 92556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 93529 92540 gene locus_tag LOCUS_12700 gene pdxA 93529 92540 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224213.1 protein_id gnl|my_center|LOCUS_12700 94718 93855 gene locus_tag LOCUS_12710 94718 93855 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_12710 96042 94693 gene locus_tag LOCUS_12720 96042 94693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 97487 96036 gene locus_tag LOCUS_12730 97487 96036 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_12730 97688 99070 gene locus_tag LOCUS_12740 97688 99070 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429707.1 protein_id gnl|my_center|LOCUS_12740 99910 99080 gene locus_tag LOCUS_12750 99910 99080 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064999.1 protein_id gnl|my_center|LOCUS_12750 100006 100710 gene locus_tag LOCUS_12760 100006 100710 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980372.1 protein_id gnl|my_center|LOCUS_12760 100982 100707 gene locus_tag LOCUS_12770 100982 100707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 101196 101035 gene locus_tag LOCUS_12780 101196 101035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 101878 101228 gene locus_tag LOCUS_12790 101878 101228 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249007.1 protein_id gnl|my_center|LOCUS_12790 102392 101910 gene locus_tag LOCUS_12800 102392 101910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 103258 102470 gene locus_tag LOCUS_12810 103258 102470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 104082 103258 gene locus_tag LOCUS_12820 104082 103258 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846458.1 protein_id gnl|my_center|LOCUS_12820 104579 104079 gene locus_tag LOCUS_12830 104579 104079 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_12830 105814 104576 gene locus_tag LOCUS_12840 105814 104576 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_12840 106353 106003 gene locus_tag LOCUS_12850 106353 106003 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_12850 106588 108012 gene locus_tag LOCUS_12860 106588 108012 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978906.1 protein_id gnl|my_center|LOCUS_12860 108286 108014 gene locus_tag LOCUS_12870 108286 108014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 108333 109085 gene locus_tag LOCUS_12880 108333 109085 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066594.1 protein_id gnl|my_center|LOCUS_12880 110227 109076 gene locus_tag LOCUS_12890 110227 109076 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_12890 111447 110224 gene locus_tag LOCUS_12900 111447 110224 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_12900 112259 111489 gene locus_tag LOCUS_12910 112259 111489 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184651056.1 protein_id gnl|my_center|LOCUS_12910 112877 112308 gene locus_tag LOCUS_12920 112877 112308 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705959.1 protein_id gnl|my_center|LOCUS_12920 113539 112940 gene locus_tag LOCUS_12930 113539 112940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 114093 113575 gene locus_tag LOCUS_12940 114093 113575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 114377 114090 gene locus_tag LOCUS_12950 114377 114090 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846969.1 protein_id gnl|my_center|LOCUS_12950 114823 114416 gene locus_tag LOCUS_12960 114823 114416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 115259 114810 gene locus_tag LOCUS_12970 115259 114810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 115763 115308 gene locus_tag LOCUS_12980 115763 115308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 115876 117537 gene locus_tag LOCUS_12990 gene polX 115876 117537 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_12990 118018 117593 gene locus_tag LOCUS_13000 118018 117593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 118150 119415 gene locus_tag LOCUS_13010 118150 119415 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846833.1 protein_id gnl|my_center|LOCUS_13010 119854 119402 gene locus_tag LOCUS_13020 119854 119402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 121095 119854 gene locus_tag LOCUS_13030 121095 119854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 122941 121250 gene locus_tag LOCUS_13040 122941 121250 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957525.1 protein_id gnl|my_center|LOCUS_13040 123968 123069 gene locus_tag LOCUS_13050 123968 123069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 124140 124577 gene locus_tag LOCUS_13060 124140 124577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 125898 124609 gene locus_tag LOCUS_13070 125898 124609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030686.1 protein_id gnl|my_center|LOCUS_13070 127869 126502 gene locus_tag LOCUS_13080 127869 126502 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056076.1 protein_id gnl|my_center|LOCUS_13080 129582 128278 gene locus_tag LOCUS_13090 129582 128278 CDS product hydroxyacid-oxoacid transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222287.1 protein_id gnl|my_center|LOCUS_13090 130424 129579 gene locus_tag LOCUS_13100 130424 129579 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_13100 131134 132309 gene locus_tag LOCUS_13110 131134 132309 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_13110 132306 132782 gene locus_tag LOCUS_13120 132306 132782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 133106 133336 gene locus_tag LOCUS_13130 133106 133336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 133443 133949 gene locus_tag LOCUS_13140 133443 133949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 134150 133959 gene locus_tag LOCUS_13150 134150 133959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 136000 135077 gene locus_tag LOCUS_13160 136000 135077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 136787 136059 gene locus_tag LOCUS_13170 136787 136059 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978033.1 protein_id gnl|my_center|LOCUS_13170 136832 137362 gene locus_tag LOCUS_13180 136832 137362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 138630 137359 gene locus_tag LOCUS_13190 138630 137359 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263595.1 protein_id gnl|my_center|LOCUS_13190 138929 139128 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 142316 141084 gene locus_tag LOCUS_13200 142316 141084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 143742 142456 gene locus_tag LOCUS_13210 143742 142456 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703523.1 protein_id gnl|my_center|LOCUS_13210 144252 144860 gene locus_tag LOCUS_13220 144252 144860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 144999 146303 gene locus_tag LOCUS_13230 144999 146303 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023489.1 protein_id gnl|my_center|LOCUS_13230 146654 146893 gene locus_tag LOCUS_13240 146654 146893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 147263 147445 gene locus_tag LOCUS_13250 147263 147445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 148064 148771 gene locus_tag LOCUS_13260 148064 148771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 148893 149552 gene locus_tag LOCUS_13270 148893 149552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 149549 149875 gene locus_tag LOCUS_13280 149549 149875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 149963 151057 gene locus_tag LOCUS_13290 149963 151057 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763227.1 protein_id gnl|my_center|LOCUS_13290 151706 151494 gene locus_tag LOCUS_13300 151706 151494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 152229 153170 gene locus_tag LOCUS_13310 152229 153170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 154201 153920 gene locus_tag LOCUS_13320 154201 153920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 155277 154474 gene locus_tag LOCUS_13330 155277 154474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 155608 155432 gene locus_tag LOCUS_13340 155608 155432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 156590 157831 gene locus_tag LOCUS_13350 156590 157831 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942667.1 protein_id gnl|my_center|LOCUS_13350 158345 158205 gene locus_tag LOCUS_13360 158345 158205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 158346 159701 gene locus_tag LOCUS_13370 158346 159701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 159706 161172 gene locus_tag LOCUS_13380 159706 161172 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065546.1 protein_id gnl|my_center|LOCUS_13380 162178 161174 gene locus_tag LOCUS_13390 162178 161174 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582778.1 protein_id gnl|my_center|LOCUS_13390 162566 162195 gene locus_tag LOCUS_13400 162566 162195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 162767 163204 gene locus_tag LOCUS_13410 gene aroQ 162767 163204 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460281.1 protein_id gnl|my_center|LOCUS_13410 163810 163247 gene locus_tag LOCUS_13420 163810 163247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 164916 165482 gene locus_tag LOCUS_13430 164916 165482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 166793 166500 gene locus_tag LOCUS_13440 166793 166500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 167734 167312 gene locus_tag LOCUS_13450 167734 167312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 168020 167751 gene locus_tag LOCUS_13460 168020 167751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 169462 168449 gene locus_tag LOCUS_13470 169462 168449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 170502 169681 gene locus_tag LOCUS_13480 170502 169681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 171425 172267 gene locus_tag LOCUS_13490 171425 172267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 172427 173056 gene locus_tag LOCUS_13500 172427 173056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 173415 174539 gene locus_tag LOCUS_13510 173415 174539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 174730 174939 gene locus_tag LOCUS_13520 174730 174939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 176132 175119 gene locus_tag LOCUS_13530 176132 175119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 176978 176136 gene locus_tag LOCUS_13540 176978 176136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 178083 177571 gene locus_tag LOCUS_13550 178083 177571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 179676 178660 gene locus_tag LOCUS_13560 179676 178660 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958477.1 protein_id gnl|my_center|LOCUS_13560 181755 179923 gene locus_tag LOCUS_13570 181755 179923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 182676 182095 gene locus_tag LOCUS_13580 182676 182095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 182821 184176 gene locus_tag LOCUS_13590 182821 184176 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485341.1 protein_id gnl|my_center|LOCUS_13590 184167 185129 gene locus_tag LOCUS_13600 184167 185129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 185356 186390 gene locus_tag LOCUS_13610 185356 186390 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980042.1 protein_id gnl|my_center|LOCUS_13610 186396 187247 gene locus_tag LOCUS_13620 186396 187247 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_13620 187248 187799 gene locus_tag LOCUS_13630 gene rfbC 187248 187799 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_13630 188886 187897 gene locus_tag LOCUS_13640 188886 187897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 189500 190753 gene locus_tag LOCUS_13650 189500 190753 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140466.1 protein_id gnl|my_center|LOCUS_13650 191097 192188 gene locus_tag LOCUS_13660 191097 192188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 193335 192532 gene locus_tag LOCUS_13670 gene thiD 193335 192532 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867389.1 protein_id gnl|my_center|LOCUS_13670 194702 193644 gene locus_tag LOCUS_13680 gene uxuA 194702 193644 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964641.1 protein_id gnl|my_center|LOCUS_13680 194813 196117 gene locus_tag LOCUS_13690 194813 196117 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083413.1 protein_id gnl|my_center|LOCUS_13690 196114 197046 gene locus_tag LOCUS_13700 196114 197046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 197687 197043 gene locus_tag LOCUS_13710 197687 197043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 199304 198159 gene locus_tag LOCUS_13720 199304 198159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083278.1 protein_id gnl|my_center|LOCUS_13720 200153 199314 gene locus_tag LOCUS_13730 200153 199314 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584151.1 protein_id gnl|my_center|LOCUS_13730 201003 200143 gene locus_tag LOCUS_13740 201003 200143 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550063.1 protein_id gnl|my_center|LOCUS_13740 202604 201009 gene locus_tag LOCUS_13750 202604 201009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 202809 203465 gene locus_tag LOCUS_13760 gene tenA 202809 203465 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877712.1 protein_id gnl|my_center|LOCUS_13760 204417 203458 gene locus_tag LOCUS_13770 204417 203458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 205557 204508 gene locus_tag LOCUS_13780 205557 204508 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846612.1 protein_id gnl|my_center|LOCUS_13780 206143 205910 gene locus_tag LOCUS_13790 206143 205910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 206069 207475 gene locus_tag LOCUS_13800 206069 207475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 208677 208867 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 208900 209802 gene locus_tag LOCUS_13810 208900 209802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 209874 210683 gene locus_tag LOCUS_13820 209874 210683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 212340 210835 gene locus_tag LOCUS_13830 gene glpK 212340 210835 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146520.1 protein_id gnl|my_center|LOCUS_13830 213230 214678 gene locus_tag LOCUS_13840 213230 214678 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846480.1 protein_id gnl|my_center|LOCUS_13840 214699 215592 gene locus_tag LOCUS_13850 214699 215592 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846481.1 protein_id gnl|my_center|LOCUS_13850 215603 216514 gene locus_tag LOCUS_13860 gene malD 215603 216514 CDS product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 protein_id gnl|my_center|LOCUS_13860 216524 217654 gene locus_tag LOCUS_13870 216524 217654 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 protein_id gnl|my_center|LOCUS_13870 217686 220019 gene locus_tag LOCUS_13880 217686 220019 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141534.1 protein_id gnl|my_center|LOCUS_13880 221837 220005 gene locus_tag LOCUS_13890 221837 220005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 221915 222928 gene locus_tag LOCUS_13900 gene trmB 221915 222928 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_13900 228340 223325 gene locus_tag LOCUS_13910 228340 223325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 229515 230969 gene locus_tag LOCUS_13920 gene bgaS 229515 230969 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_13920 231527 232051 gene locus_tag LOCUS_13930 231527 232051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978666.1 protein_id gnl|my_center|LOCUS_13930 233187 232042 gene locus_tag LOCUS_13940 233187 232042 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_13940 234314 233196 gene locus_tag LOCUS_13950 234314 233196 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978530.1 protein_id gnl|my_center|LOCUS_13950 235023 234499 gene locus_tag LOCUS_13960 235023 234499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 235317 235919 gene locus_tag LOCUS_13970 235317 235919 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 protein_id gnl|my_center|LOCUS_13970 236031 237329 gene locus_tag LOCUS_13980 236031 237329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_13980 238966 237335 gene locus_tag LOCUS_13990 238966 237335 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_13990 239254 240690 gene locus_tag LOCUS_14000 239254 240690 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_14000 240990 242981 gene locus_tag LOCUS_14010 240990 242981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 243060 245204 gene locus_tag LOCUS_14020 gene glgB 243060 245204 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_14020 245242 247125 gene locus_tag LOCUS_14030 245242 247125 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257045.1 protein_id gnl|my_center|LOCUS_14030 247122 248780 gene locus_tag LOCUS_14040 247122 248780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 248777 250048 gene locus_tag LOCUS_14050 248777 250048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 250084 252198 gene locus_tag LOCUS_14060 gene glgX 250084 252198 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978922.1 protein_id gnl|my_center|LOCUS_14060 253969 252095 gene locus_tag LOCUS_14070 gene treZ 253969 252095 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393309.1 protein_id gnl|my_center|LOCUS_14070 256251 253966 gene locus_tag LOCUS_14080 gene treY 256251 253966 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096570.1 protein_id gnl|my_center|LOCUS_14080 256877 257035 gene locus_tag LOCUS_14090 256877 257035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 257051 257476 gene locus_tag LOCUS_14100 257051 257476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 257570 257761 gene locus_tag LOCUS_14110 257570 257761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 257762 257965 gene locus_tag LOCUS_14120 257762 257965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 258495 259667 gene locus_tag LOCUS_14130 gene cas1 258495 259667 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_14130 259664 260350 gene locus_tag LOCUS_14140 259664 260350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 260953 260880 gene locus_tag LOCUS_t00330 260953 260880 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 261180 263696 gene locus_tag LOCUS_14150 261180 263696 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979737.1 protein_id gnl|my_center|LOCUS_14150 264045 264878 gene locus_tag LOCUS_14160 264045 264878 CDS product G1 family endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222210.1 protein_id gnl|my_center|LOCUS_14160 265146 265817 gene locus_tag LOCUS_14170 265146 265817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 265932 267500 gene locus_tag LOCUS_14180 265932 267500 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_14180 267504 268523 gene locus_tag LOCUS_14190 267504 268523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370098.1 protein_id gnl|my_center|LOCUS_14190 268520 269407 gene locus_tag LOCUS_14200 268520 269407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_14200 269412 271484 gene locus_tag LOCUS_14210 269412 271484 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257248.1 protein_id gnl|my_center|LOCUS_14210 273282 271657 gene locus_tag LOCUS_14220 273282 271657 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980485.1 protein_id gnl|my_center|LOCUS_14220 274111 273386 gene locus_tag LOCUS_14230 gene fabG 274111 273386 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_14230 274577 274143 gene locus_tag LOCUS_14240 274577 274143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978769.1 protein_id gnl|my_center|LOCUS_14240 274969 274598 gene locus_tag LOCUS_14250 274969 274598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 276467 275112 gene locus_tag LOCUS_14260 276467 275112 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400819.1 protein_id gnl|my_center|LOCUS_14260 276634 279081 gene locus_tag LOCUS_14270 276634 279081 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_14270 279092 279445 gene locus_tag LOCUS_14280 279092 279445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 280010 279435 gene locus_tag LOCUS_14290 280010 279435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 281490 280000 gene locus_tag LOCUS_14300 281490 280000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 281742 283274 gene locus_tag LOCUS_14310 281742 283274 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_14310 284644 283265 gene locus_tag LOCUS_14320 284644 283265 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539284.1 protein_id gnl|my_center|LOCUS_14320 284812 285240 gene locus_tag LOCUS_14330 284812 285240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 285237 286934 gene locus_tag LOCUS_14340 285237 286934 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_14340 288153 286924 gene locus_tag LOCUS_14350 288153 286924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_14350 288317 289354 gene locus_tag LOCUS_14360 288317 289354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 291108 289393 gene locus_tag LOCUS_14370 291108 289393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 293012 291087 gene locus_tag LOCUS_14380 293012 291087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 294075 292987 gene locus_tag LOCUS_14390 gene ugpC 294075 292987 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_14390 294923 294075 gene locus_tag LOCUS_14400 294923 294075 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287292.1 protein_id gnl|my_center|LOCUS_14400 295848 294925 gene locus_tag LOCUS_14410 295848 294925 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257890.1 protein_id gnl|my_center|LOCUS_14410 297179 295860 gene locus_tag LOCUS_14420 297179 295860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 297528 298208 gene locus_tag LOCUS_14430 297528 298208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 298397 300211 gene locus_tag LOCUS_14440 298397 300211 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933885.1 protein_id gnl|my_center|LOCUS_14440 300345 301505 gene locus_tag LOCUS_14450 300345 301505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 301505 302725 gene locus_tag LOCUS_14460 301505 302725 CDS product oxalate oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393098.1 protein_id gnl|my_center|LOCUS_14460 302729 303736 gene locus_tag LOCUS_14470 gene porB 302729 303736 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_14470 303779 305179 gene locus_tag LOCUS_14480 gene glcD 303779 305179 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878311.1 protein_id gnl|my_center|LOCUS_14480 305934 305176 gene locus_tag LOCUS_14490 305934 305176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 306569 305949 gene locus_tag LOCUS_14500 306569 305949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 307097 306576 gene locus_tag LOCUS_14510 307097 306576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 308659 307196 gene locus_tag LOCUS_14520 308659 307196 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_14520 308756 310387 gene locus_tag LOCUS_14530 308756 310387 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_14530 311126 310389 gene locus_tag LOCUS_14540 311126 310389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249186.1 protein_id gnl|my_center|LOCUS_14540 312012 311098 gene locus_tag LOCUS_14550 312012 311098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980531.1 protein_id gnl|my_center|LOCUS_14550 312151 312510 gene locus_tag LOCUS_14560 312151 312510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 312572 314002 gene locus_tag LOCUS_14570 312572 314002 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846386.1 protein_id gnl|my_center|LOCUS_14570 314063 314581 gene locus_tag LOCUS_14580 314063 314581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 314672 315568 gene locus_tag LOCUS_14590 314672 315568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 315628 316854 gene locus_tag LOCUS_14600 315628 316854 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970459.1 protein_id gnl|my_center|LOCUS_14600 317909 316860 gene locus_tag LOCUS_14610 317909 316860 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980409.1 protein_id gnl|my_center|LOCUS_14610 319519 317915 gene locus_tag LOCUS_14620 319519 317915 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_14620 321164 319485 gene locus_tag LOCUS_14630 321164 319485 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_14630 323205 321157 gene locus_tag LOCUS_14640 323205 321157 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_14640 323939 323202 gene locus_tag LOCUS_14650 323939 323202 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385665.1 protein_id gnl|my_center|LOCUS_14650 325285 323936 gene locus_tag LOCUS_14660 325285 323936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121171.1 protein_id gnl|my_center|LOCUS_14660 325631 326119 gene locus_tag LOCUS_14670 325631 326119 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_14670 326187 326708 gene locus_tag LOCUS_14680 326187 326708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 326957 327262 gene locus_tag LOCUS_14690 326957 327262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14690 >Feature sequence3 301 822 gene locus_tag LOCUS_14700 301 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 794 1426 gene locus_tag LOCUS_14710 794 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1423 1737 gene locus_tag LOCUS_14720 1423 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1722 2177 gene locus_tag LOCUS_14730 1722 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2452 4470 gene locus_tag LOCUS_14740 2452 4470 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870478.1 protein_id gnl|my_center|LOCUS_14740 4467 6128 gene locus_tag LOCUS_14750 4467 6128 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_14750 6246 7535 gene locus_tag LOCUS_14760 6246 7535 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729569.1 protein_id gnl|my_center|LOCUS_14760 7763 8149 gene locus_tag LOCUS_14770 7763 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 8250 8753 gene locus_tag LOCUS_14780 8250 8753 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_14780 8750 9790 gene locus_tag LOCUS_14790 8750 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 9835 9910 gene locus_tag LOCUS_t00340 9835 9910 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10007 10519 gene locus_tag LOCUS_14800 10007 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 10557 10629 gene locus_tag LOCUS_t00350 10557 10629 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10660 11130 gene locus_tag LOCUS_14810 10660 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 11975 11127 gene locus_tag LOCUS_14820 11975 11127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 12087 13322 gene locus_tag LOCUS_14830 12087 13322 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_14830 13319 13801 gene locus_tag LOCUS_14840 13319 13801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 13801 15333 gene locus_tag LOCUS_14850 13801 15333 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872805.1 protein_id gnl|my_center|LOCUS_14850 15395 17035 gene locus_tag LOCUS_14860 gene thsB 15395 17035 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_14860 17113 18078 gene locus_tag LOCUS_14870 17113 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 18294 19400 gene locus_tag LOCUS_14880 gene sucC 18294 19400 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_14880 19402 20259 gene locus_tag LOCUS_14890 gene sucD 19402 20259 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879674.1 protein_id gnl|my_center|LOCUS_14890 20264 21181 gene locus_tag LOCUS_14900 gene argF 20264 21181 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_14900 21302 21610 gene locus_tag LOCUS_14910 21302 21610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 21611 22210 gene locus_tag LOCUS_14920 21611 22210 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868858.1 protein_id gnl|my_center|LOCUS_14920 22261 22334 gene locus_tag LOCUS_t00360 22261 22334 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 22615 23346 gene locus_tag LOCUS_14930 22615 23346 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980502.1 protein_id gnl|my_center|LOCUS_14930 23573 23358 gene locus_tag LOCUS_14940 23573 23358 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_14940 23744 23583 gene locus_tag LOCUS_14950 23744 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 24337 23744 gene locus_tag LOCUS_14960 24337 23744 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_14960 24458 26017 gene locus_tag LOCUS_14970 gene arcS 24458 26017 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_14970 26053 28887 gene locus_tag LOCUS_14980 26053 28887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 28887 29414 gene locus_tag LOCUS_14990 28887 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 29411 29908 gene locus_tag LOCUS_15000 29411 29908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 29892 30866 gene locus_tag LOCUS_15010 29892 30866 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_15010 30863 32170 gene locus_tag LOCUS_15020 30863 32170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 32176 32988 gene locus_tag LOCUS_15030 32176 32988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 32988 34268 gene locus_tag LOCUS_15040 32988 34268 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_15040 34338 34727 gene locus_tag LOCUS_15050 gene eif5A 34338 34727 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_15050 34685 35596 gene locus_tag LOCUS_15060 gene speB 34685 35596 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_15060 36138 35599 gene locus_tag LOCUS_15070 gene rplJ 36138 35599 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_15070 36235 37296 gene locus_tag LOCUS_15080 36235 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 38362 37298 gene locus_tag LOCUS_15090 38362 37298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 39111 38395 gene locus_tag LOCUS_15100 39111 38395 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205380.1 protein_id gnl|my_center|LOCUS_15100 39190 40491 gene locus_tag LOCUS_15110 39190 40491 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544919.1 protein_id gnl|my_center|LOCUS_15110 40541 41839 gene locus_tag LOCUS_15120 40541 41839 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_15120 42559 41843 gene locus_tag LOCUS_15130 42559 41843 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_15130 42723 43316 gene locus_tag LOCUS_15140 42723 43316 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978110.1 protein_id gnl|my_center|LOCUS_15140 43701 43462 gene locus_tag LOCUS_15150 43701 43462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 44812 43883 gene locus_tag LOCUS_15160 44812 43883 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_15160 46634 44802 gene locus_tag LOCUS_15170 46634 44802 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847039.1 protein_id gnl|my_center|LOCUS_15170 46927 47220 gene locus_tag LOCUS_15180 46927 47220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 47227 47760 gene locus_tag LOCUS_15190 47227 47760 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 protein_id gnl|my_center|LOCUS_15190 48551 47769 gene locus_tag LOCUS_15200 gene purQ 48551 47769 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_15200 50333 48783 gene locus_tag LOCUS_15210 50333 48783 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_15210 50550 51707 gene locus_tag LOCUS_15220 gene fbp 50550 51707 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868421.1 protein_id gnl|my_center|LOCUS_15220 51914 52165 gene locus_tag LOCUS_15230 51914 52165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 52162 52608 gene locus_tag LOCUS_15240 52162 52608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 52608 54284 gene locus_tag LOCUS_15250 gene ctaD 52608 54284 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140742.1 protein_id gnl|my_center|LOCUS_15250 54286 54891 gene locus_tag LOCUS_15260 54286 54891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 54906 55766 gene locus_tag LOCUS_15270 gene cyoE 54906 55766 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506322.1 protein_id gnl|my_center|LOCUS_15270 55768 57201 gene locus_tag LOCUS_15280 55768 57201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 57194 57805 gene locus_tag LOCUS_15290 57194 57805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 58173 57784 gene locus_tag LOCUS_15300 58173 57784 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228953.1 protein_id gnl|my_center|LOCUS_15300 58558 58148 gene locus_tag LOCUS_15310 58558 58148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 58649 59449 gene locus_tag LOCUS_15320 58649 59449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 59460 61304 gene locus_tag LOCUS_15330 gene rqcH 59460 61304 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250389.1 protein_id gnl|my_center|LOCUS_15330 62198 61284 gene locus_tag LOCUS_15340 62198 61284 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_15340 63255 62482 gene locus_tag LOCUS_15350 63255 62482 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868422.1 protein_id gnl|my_center|LOCUS_15350 63426 64700 gene locus_tag LOCUS_15360 gene tuf 63426 64700 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_15360 64711 65025 gene locus_tag LOCUS_15370 gene rpsJ 64711 65025 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_15370 65585 67786 gene locus_tag LOCUS_15380 65585 67786 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_15380 67824 68855 gene locus_tag LOCUS_15390 67824 68855 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846928.1 protein_id gnl|my_center|LOCUS_15390 69312 68842 gene locus_tag LOCUS_15400 69312 68842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 69803 69309 gene locus_tag LOCUS_15410 69803 69309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 70953 69814 gene locus_tag LOCUS_15420 70953 69814 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_15420 71099 70965 gene locus_tag LOCUS_15430 71099 70965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 71689 72021 gene locus_tag LOCUS_15440 71689 72021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 72032 72988 gene locus_tag LOCUS_15450 72032 72988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 73030 73554 gene locus_tag LOCUS_15460 73030 73554 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839740.1 protein_id gnl|my_center|LOCUS_15460 73561 75414 gene locus_tag LOCUS_15470 gene dnaK 73561 75414 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_15470 75426 76526 gene locus_tag LOCUS_15480 gene dnaJ 75426 76526 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_15480 76575 77015 gene locus_tag LOCUS_15490 76575 77015 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_15490 77206 77433 gene locus_tag LOCUS_15500 77206 77433 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_15500 77486 77935 gene locus_tag LOCUS_15510 77486 77935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 77976 78665 gene locus_tag LOCUS_15520 77976 78665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 78691 79284 gene locus_tag LOCUS_15530 78691 79284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 79265 79972 gene locus_tag LOCUS_15540 79265 79972 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_15540 80818 79955 gene locus_tag LOCUS_15550 80818 79955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 81126 80818 gene locus_tag LOCUS_15560 81126 80818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 81236 82996 gene locus_tag LOCUS_15570 81236 82996 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762861.1 protein_id gnl|my_center|LOCUS_15570 83456 82998 gene locus_tag LOCUS_15580 83456 82998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 84425 83592 gene locus_tag LOCUS_15590 84425 83592 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980282.1 protein_id gnl|my_center|LOCUS_15590 84832 84488 gene locus_tag LOCUS_15600 84832 84488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064500.1 protein_id gnl|my_center|LOCUS_15600 84933 85430 gene locus_tag LOCUS_15610 84933 85430 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_15610 85433 85505 gene locus_tag LOCUS_t00370 85433 85505 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 85633 86817 gene locus_tag LOCUS_15620 85633 86817 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979634.1 protein_id gnl|my_center|LOCUS_15620 88373 86937 gene locus_tag LOCUS_15630 gene merA 88373 86937 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031939.1 protein_id gnl|my_center|LOCUS_15630 88618 88385 gene locus_tag LOCUS_15640 88618 88385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 88960 88888 gene locus_tag LOCUS_t00380 88960 88888 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 89445 91265 gene locus_tag LOCUS_15650 89445 91265 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_15650 91849 91430 gene locus_tag LOCUS_15660 91849 91430 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878992.1 protein_id gnl|my_center|LOCUS_15660 92151 92696 gene locus_tag LOCUS_15670 92151 92696 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_15670 92702 95434 gene locus_tag LOCUS_15680 gene leuS 92702 95434 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_15680 95468 97441 gene locus_tag LOCUS_15690 95468 97441 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_15690 98417 97434 gene locus_tag LOCUS_15700 98417 97434 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_15700 98452 99231 gene locus_tag LOCUS_15710 gene truA 98452 99231 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_15710 99228 100424 gene locus_tag LOCUS_15720 99228 100424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 101119 100451 gene locus_tag LOCUS_15730 101119 100451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 101852 101136 gene locus_tag LOCUS_15740 101852 101136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 101861 102832 gene locus_tag LOCUS_15750 101861 102832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 103944 102883 gene locus_tag LOCUS_15760 103944 102883 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978064.1 protein_id gnl|my_center|LOCUS_15760 104044 104128 gene locus_tag LOCUS_t00390 104044 104128 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 104539 105300 gene locus_tag LOCUS_15770 104539 105300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 105390 105659 gene locus_tag LOCUS_15780 105390 105659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15780 105663 106229 gene locus_tag LOCUS_15790 105663 106229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15790 106204 106896 gene locus_tag LOCUS_15800 106204 106896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 107630 107082 gene locus_tag LOCUS_15810 107630 107082 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978217.1 protein_id gnl|my_center|LOCUS_15810 109524 107797 gene locus_tag LOCUS_15820 109524 107797 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246447.1 protein_id gnl|my_center|LOCUS_15820 111069 109789 gene locus_tag LOCUS_15830 111069 109789 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023499.1 protein_id gnl|my_center|LOCUS_15830 112519 111188 gene locus_tag LOCUS_15840 112519 111188 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902070.1 protein_id gnl|my_center|LOCUS_15840 113312 112647 gene locus_tag LOCUS_15850 gene ppaX 113312 112647 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_15850 113381 114469 gene locus_tag LOCUS_15860 113381 114469 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537162.1 protein_id gnl|my_center|LOCUS_15860 115899 114466 gene locus_tag LOCUS_15870 115899 114466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 116813 115896 gene locus_tag LOCUS_15880 116813 115896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979801.1 protein_id gnl|my_center|LOCUS_15880 118025 116841 gene locus_tag LOCUS_15890 118025 116841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 119087 118140 gene locus_tag LOCUS_15900 119087 118140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 120112 119117 gene locus_tag LOCUS_15910 gene aroF 120112 119117 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980355.1 protein_id gnl|my_center|LOCUS_15910 120768 120109 gene locus_tag LOCUS_15920 120768 120109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 121340 120765 gene locus_tag LOCUS_15930 121340 120765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 121445 122236 gene locus_tag LOCUS_15940 121445 122236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 122246 123073 gene locus_tag LOCUS_15950 122246 123073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 123070 123960 gene locus_tag LOCUS_15960 123070 123960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207738.1 protein_id gnl|my_center|LOCUS_15960 123992 124384 gene locus_tag LOCUS_15970 123992 124384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 124411 125064 gene locus_tag LOCUS_15980 124411 125064 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257014.1 protein_id gnl|my_center|LOCUS_15980 125546 125061 gene locus_tag LOCUS_15990 125546 125061 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978052.1 protein_id gnl|my_center|LOCUS_15990 126883 125543 gene locus_tag LOCUS_16000 126883 125543 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_16000 127139 128071 gene locus_tag LOCUS_16010 127139 128071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 129018 128074 gene locus_tag LOCUS_16020 129018 128074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 129394 129077 gene locus_tag LOCUS_16030 129394 129077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 129571 130143 gene locus_tag LOCUS_16040 129571 130143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 130174 130746 gene locus_tag LOCUS_16050 130174 130746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 131227 131042 gene locus_tag LOCUS_16060 131227 131042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 131249 131629 gene locus_tag LOCUS_16070 131249 131629 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_16070 131634 131891 gene locus_tag LOCUS_16080 131634 131891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 132862 131888 gene locus_tag LOCUS_16090 gene priL 132862 131888 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_16090 133938 132859 gene locus_tag LOCUS_16100 133938 132859 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082509.1 protein_id gnl|my_center|LOCUS_16100 134010 134639 gene locus_tag LOCUS_16110 gene queE 134010 134639 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267001.1 protein_id gnl|my_center|LOCUS_16110 134651 135892 gene locus_tag LOCUS_16120 134651 135892 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_16120 135931 136599 gene locus_tag LOCUS_16130 135931 136599 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846565.1 protein_id gnl|my_center|LOCUS_16130 136596 136901 gene locus_tag LOCUS_16140 136596 136901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 137118 136891 gene locus_tag LOCUS_16150 137118 136891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 140419 137309 gene locus_tag LOCUS_16160 140419 137309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 140887 140528 gene locus_tag LOCUS_16170 140887 140528 CDS product DUF2203 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978601.1 protein_id gnl|my_center|LOCUS_16170 141272 140928 gene locus_tag LOCUS_16180 141272 140928 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355771.1 protein_id gnl|my_center|LOCUS_16180 142565 141342 gene locus_tag LOCUS_16190 142565 141342 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979972.1 protein_id gnl|my_center|LOCUS_16190 142795 142721 gene locus_tag LOCUS_t00400 142795 142721 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 143409 142837 gene locus_tag LOCUS_16200 143409 142837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 143571 143690 gene locus_tag LOCUS_16210 143571 143690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 143710 144684 gene locus_tag LOCUS_16220 143710 144684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 145147 144710 gene locus_tag LOCUS_16230 145147 144710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 145948 145211 gene locus_tag LOCUS_16240 145948 145211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 146845 145994 gene locus_tag LOCUS_16250 146845 145994 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979100.1 protein_id gnl|my_center|LOCUS_16250 147108 147192 gene locus_tag LOCUS_t00410 147108 147192 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 148119 148967 gene locus_tag LOCUS_16260 148119 148967 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846818.1 protein_id gnl|my_center|LOCUS_16260 149491 149213 gene locus_tag LOCUS_16270 149491 149213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 151062 149503 gene locus_tag LOCUS_16280 151062 149503 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590753.1 protein_id gnl|my_center|LOCUS_16280 151290 152807 gene locus_tag LOCUS_16290 gene ppcA 151290 152807 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980180.1 protein_id gnl|my_center|LOCUS_16290 152961 154373 gene locus_tag LOCUS_16300 152961 154373 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978643.1 protein_id gnl|my_center|LOCUS_16300 154548 156545 gene locus_tag LOCUS_16310 154548 156545 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846742.1 protein_id gnl|my_center|LOCUS_16310 156545 157561 gene locus_tag LOCUS_16320 156545 157561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 157605 158441 gene locus_tag LOCUS_16330 157605 158441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 158599 159201 gene locus_tag LOCUS_16340 158599 159201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 159198 159833 gene locus_tag LOCUS_16350 159198 159833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 159820 160881 gene locus_tag LOCUS_16360 159820 160881 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256513.1 protein_id gnl|my_center|LOCUS_16360 160932 161702 gene locus_tag LOCUS_16370 160932 161702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 162822 161671 gene locus_tag LOCUS_16380 162822 161671 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846353.1 protein_id gnl|my_center|LOCUS_16380 163720 162797 gene locus_tag LOCUS_16390 163720 162797 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978483.1 protein_id gnl|my_center|LOCUS_16390 163986 163801 gene locus_tag LOCUS_16400 163986 163801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 164155 166044 gene locus_tag LOCUS_16410 164155 166044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 166993 166052 gene locus_tag LOCUS_16420 166993 166052 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_16420 167133 167951 gene locus_tag LOCUS_16430 167133 167951 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_16430 168151 170394 gene locus_tag LOCUS_16440 168151 170394 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_16440 170480 170752 gene locus_tag LOCUS_16450 170480 170752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 171139 172464 gene locus_tag LOCUS_16460 171139 172464 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125470.1 protein_id gnl|my_center|LOCUS_16460 172577 173602 gene locus_tag LOCUS_16470 172577 173602 CDS product acryloyl-coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978456.1 protein_id gnl|my_center|LOCUS_16470 173756 175108 gene locus_tag LOCUS_16480 173756 175108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978704.1 protein_id gnl|my_center|LOCUS_16480 175270 175449 gene locus_tag LOCUS_16490 175270 175449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 175514 176413 gene locus_tag LOCUS_16500 175514 176413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 176901 176410 gene locus_tag LOCUS_16510 176901 176410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 177192 176905 gene locus_tag LOCUS_16520 177192 176905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 182335 177209 gene locus_tag LOCUS_16530 182335 177209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 182494 182787 gene locus_tag LOCUS_16540 182494 182787 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980193.1 protein_id gnl|my_center|LOCUS_16540 183060 184526 gene locus_tag LOCUS_16550 183060 184526 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847046.1 protein_id gnl|my_center|LOCUS_16550 184565 185035 gene locus_tag LOCUS_16560 184565 185035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 185013 186002 gene locus_tag LOCUS_16570 185013 186002 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_16570 185999 186811 gene locus_tag LOCUS_16580 185999 186811 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_16580 186813 187964 gene locus_tag LOCUS_16590 186813 187964 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173365.1 protein_id gnl|my_center|LOCUS_16590 188642 187968 gene locus_tag LOCUS_16600 gene pyrH 188642 187968 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_16600 188692 189951 gene locus_tag LOCUS_16610 gene prf1 188692 189951 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878715.1 protein_id gnl|my_center|LOCUS_16610 189988 191217 gene locus_tag LOCUS_16620 189988 191217 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980446.1 protein_id gnl|my_center|LOCUS_16620 191312 192874 gene locus_tag LOCUS_16630 191312 192874 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250525.1 protein_id gnl|my_center|LOCUS_16630 193054 194808 gene locus_tag LOCUS_16640 gene kdpA 193054 194808 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_16640 194787 196787 gene locus_tag LOCUS_16650 gene kdpB 194787 196787 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883953.1 protein_id gnl|my_center|LOCUS_16650 196784 197443 gene locus_tag LOCUS_16660 gene kdpC 196784 197443 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085543.1 protein_id gnl|my_center|LOCUS_16660 198251 197433 gene locus_tag LOCUS_16670 198251 197433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 198458 198964 gene locus_tag LOCUS_16680 198458 198964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 199026 199931 gene locus_tag LOCUS_16690 199026 199931 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496573.1 protein_id gnl|my_center|LOCUS_16690 199928 200683 gene locus_tag LOCUS_16700 199928 200683 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_16700 200872 203397 gene locus_tag LOCUS_16710 200872 203397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 203397 203636 gene locus_tag LOCUS_16720 203397 203636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 204637 203624 gene locus_tag LOCUS_16730 204637 203624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 205191 204745 gene locus_tag LOCUS_16740 205191 204745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 205679 206296 gene locus_tag LOCUS_16750 205679 206296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 206726 206418 gene locus_tag LOCUS_16760 206726 206418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 207784 206903 gene locus_tag LOCUS_16770 207784 206903 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_16770 207883 208635 gene locus_tag LOCUS_16780 207883 208635 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978883.1 protein_id gnl|my_center|LOCUS_16780 209627 208638 gene locus_tag LOCUS_16790 209627 208638 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_16790 210529 209624 gene locus_tag LOCUS_16800 210529 209624 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_16800 211140 210580 gene locus_tag LOCUS_16810 gene gmhA 211140 210580 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_16810 212221 211172 gene locus_tag LOCUS_16820 212221 211172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 212956 212303 gene locus_tag LOCUS_16830 212956 212303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 213057 215129 gene locus_tag LOCUS_16840 213057 215129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 215205 216950 gene locus_tag LOCUS_16850 215205 216950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 216947 218692 gene locus_tag LOCUS_16860 216947 218692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence4 166 250 gene locus_tag LOCUS_t00420 166 250 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 513 352 gene locus_tag LOCUS_16870 513 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 604 1263 gene locus_tag LOCUS_16880 604 1263 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_16880 1494 1883 gene locus_tag LOCUS_16890 1494 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978746.1 protein_id gnl|my_center|LOCUS_16890 1931 2944 gene locus_tag LOCUS_16900 1931 2944 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_16900 2922 3134 gene locus_tag LOCUS_16910 2922 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 4076 3135 gene locus_tag LOCUS_16920 4076 3135 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_16920 4301 4086 gene locus_tag LOCUS_16930 4301 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4543 5469 gene locus_tag LOCUS_16940 4543 5469 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_16940 5470 6036 gene locus_tag LOCUS_16950 5470 6036 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_16950 6119 6370 gene locus_tag LOCUS_16960 6119 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 8031 6373 gene locus_tag LOCUS_16970 gene gltX 8031 6373 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_16970 8980 7994 gene locus_tag LOCUS_16980 8980 7994 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867947.1 protein_id gnl|my_center|LOCUS_16980 9290 9090 gene locus_tag LOCUS_16990 9290 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 9379 10344 gene locus_tag LOCUS_17000 9379 10344 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_17000 10382 10630 gene locus_tag LOCUS_17010 10382 10630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 10689 12623 gene locus_tag LOCUS_17020 gene gyrB 10689 12623 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583896.1 protein_id gnl|my_center|LOCUS_17020 12665 15073 gene locus_tag LOCUS_17030 gene gyrA 12665 15073 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_17030 15073 16056 gene locus_tag LOCUS_17040 15073 16056 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_17040 16099 17049 gene locus_tag LOCUS_17050 16099 17049 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240578.1 protein_id gnl|my_center|LOCUS_17050 17846 17046 gene locus_tag LOCUS_17060 17846 17046 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_17060 17946 18338 gene locus_tag LOCUS_17070 17946 18338 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_17070 18342 20213 gene locus_tag LOCUS_17080 18342 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 21084 20215 gene locus_tag LOCUS_17090 21084 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 21204 22100 gene locus_tag LOCUS_17100 21204 22100 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_17100 22277 22104 gene locus_tag LOCUS_17110 22277 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 22433 22507 gene locus_tag LOCUS_t00430 22433 22507 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23361 22930 gene locus_tag LOCUS_17120 23361 22930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17120 >Feature sequence5 264 1382 gene locus_tag LOCUS_17130 264 1382 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_17130 1357 2214 gene locus_tag LOCUS_17140 1357 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386427.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence6 852 421 gene locus_tag LOCUS_17150 852 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 432 441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 627 636 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends