>Feature sequence01 601 410 gene locus_tag LOCUS_00010 601 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 666 1013 gene locus_tag LOCUS_00020 666 1013 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888499.1 protein_id gnl|my_center|LOCUS_00020 1019 1684 gene locus_tag LOCUS_00030 1019 1684 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977507.1 protein_id gnl|my_center|LOCUS_00030 3816 1693 gene locus_tag LOCUS_00040 3816 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4714 3926 gene locus_tag LOCUS_00050 4714 3926 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479550.1 protein_id gnl|my_center|LOCUS_00050 5017 4778 gene locus_tag LOCUS_00060 5017 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888634.1 protein_id gnl|my_center|LOCUS_00060 5409 5014 gene locus_tag LOCUS_00070 5409 5014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5489 5878 gene locus_tag LOCUS_00080 5489 5878 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887820.1 protein_id gnl|my_center|LOCUS_00080 6128 7513 gene locus_tag LOCUS_00090 6128 7513 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541772.1 protein_id gnl|my_center|LOCUS_00090 7510 8271 gene locus_tag LOCUS_00100 gene eutC 7510 8271 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266524.1 protein_id gnl|my_center|LOCUS_00100 9061 8387 gene locus_tag LOCUS_00110 9061 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9322 9140 gene locus_tag LOCUS_00120 9322 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9276 11213 gene locus_tag LOCUS_00130 9276 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11297 12421 gene locus_tag LOCUS_00140 11297 12421 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229643.1 protein_id gnl|my_center|LOCUS_00140 12720 13820 gene locus_tag LOCUS_00150 12720 13820 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887765.1 protein_id gnl|my_center|LOCUS_00150 14264 14088 gene locus_tag LOCUS_00160 14264 14088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14615 14274 gene locus_tag LOCUS_00170 14615 14274 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_00170 15105 14617 gene locus_tag LOCUS_00180 15105 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 15586 15230 gene locus_tag LOCUS_00190 15586 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15676 16038 gene locus_tag LOCUS_00200 gene apaG 15676 16038 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_00200 16135 16695 gene locus_tag LOCUS_00210 16135 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 18177 16789 gene locus_tag LOCUS_00220 18177 16789 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888503.1 protein_id gnl|my_center|LOCUS_00220 18500 18168 gene locus_tag LOCUS_00230 18500 18168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 19363 18497 gene locus_tag LOCUS_00240 gene rsmH 19363 18497 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888501.1 protein_id gnl|my_center|LOCUS_00240 19800 19372 gene locus_tag LOCUS_00250 gene mraZ 19800 19372 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888500.1 protein_id gnl|my_center|LOCUS_00250 21613 20192 gene locus_tag LOCUS_00260 21613 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 22223 22609 gene locus_tag LOCUS_00270 22223 22609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 22732 24204 gene locus_tag LOCUS_00280 22732 24204 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_00280 24278 24655 gene locus_tag LOCUS_00290 24278 24655 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041222525.1 protein_id gnl|my_center|LOCUS_00290 25935 24709 gene locus_tag LOCUS_00300 25935 24709 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889265.1 protein_id gnl|my_center|LOCUS_00300 26684 25932 gene locus_tag LOCUS_00310 26684 25932 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138672.1 protein_id gnl|my_center|LOCUS_00310 27439 26867 gene locus_tag LOCUS_00320 27439 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 29377 27464 gene locus_tag LOCUS_00330 29377 27464 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480054.1 protein_id gnl|my_center|LOCUS_00330 29587 30819 gene locus_tag LOCUS_00340 29587 30819 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479503.1 protein_id gnl|my_center|LOCUS_00340 30835 32097 gene locus_tag LOCUS_00350 30835 32097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32250 34955 gene locus_tag LOCUS_00360 gene acnA 32250 34955 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_00360 37738 35021 gene locus_tag LOCUS_00370 37738 35021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 40669 37922 gene locus_tag LOCUS_00380 40669 37922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 41083 40823 gene locus_tag LOCUS_00390 41083 40823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 41093 41569 gene locus_tag LOCUS_00400 41093 41569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41909 41655 gene locus_tag LOCUS_00410 41909 41655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42735 42295 gene locus_tag LOCUS_00420 42735 42295 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_00420 44786 42732 gene locus_tag LOCUS_00430 44786 42732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46111 44783 gene locus_tag LOCUS_00440 46111 44783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 46477 48321 gene locus_tag LOCUS_00450 46477 48321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50079 48325 gene locus_tag LOCUS_00460 50079 48325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 50284 51906 gene locus_tag LOCUS_00470 gene pgi 50284 51906 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888377.1 protein_id gnl|my_center|LOCUS_00470 53664 52111 gene locus_tag LOCUS_00480 53664 52111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54807 53767 gene locus_tag LOCUS_00490 54807 53767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55157 56146 gene locus_tag LOCUS_00500 55157 56146 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921545.1 protein_id gnl|my_center|LOCUS_00500 57953 56244 gene locus_tag LOCUS_00510 57953 56244 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_00510 58207 59211 gene locus_tag LOCUS_00520 gene trpS 58207 59211 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_00520 59285 60181 gene locus_tag LOCUS_00530 59285 60181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 60245 61318 gene locus_tag LOCUS_00540 60245 61318 CDS product protease complex subunit PrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888260.1 protein_id gnl|my_center|LOCUS_00540 64539 61405 gene locus_tag LOCUS_00550 64539 61405 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480098.1 protein_id gnl|my_center|LOCUS_00550 64934 65341 gene locus_tag LOCUS_00560 64934 65341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 65405 65803 gene locus_tag LOCUS_00570 65405 65803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 67820 65874 gene locus_tag LOCUS_00580 67820 65874 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080133.1 protein_id gnl|my_center|LOCUS_00580 68684 67893 gene locus_tag LOCUS_00590 gene agaR 68684 67893 CDS product transcriptional repressor AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 protein_id gnl|my_center|LOCUS_00590 69029 70636 gene locus_tag LOCUS_00600 gene recN 69029 70636 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888116.1 protein_id gnl|my_center|LOCUS_00600 70733 71503 gene locus_tag LOCUS_00610 70733 71503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 71836 71567 gene locus_tag LOCUS_00620 71836 71567 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887574.1 protein_id gnl|my_center|LOCUS_00620 71982 82970 gene locus_tag LOCUS_00630 71982 82970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 83053 83703 gene locus_tag LOCUS_00640 gene ecsA 83053 83703 CDS product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233230.1 protein_id gnl|my_center|LOCUS_00640 83700 85163 gene locus_tag LOCUS_00650 83700 85163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 86712 85234 gene locus_tag LOCUS_00660 86712 85234 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_00660 87676 86777 gene locus_tag LOCUS_00670 87676 86777 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177599.1 protein_id gnl|my_center|LOCUS_00670 88429 87734 gene locus_tag LOCUS_00680 88429 87734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889187.1 protein_id gnl|my_center|LOCUS_00680 88571 88903 gene locus_tag LOCUS_00690 88571 88903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 88887 89276 gene locus_tag LOCUS_00700 88887 89276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 89251 89649 gene locus_tag LOCUS_00710 89251 89649 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887511.1 protein_id gnl|my_center|LOCUS_00710 91557 89869 gene locus_tag LOCUS_00720 gene aceF 91557 89869 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480295.1 protein_id gnl|my_center|LOCUS_00720 94383 91675 gene locus_tag LOCUS_00730 gene aceE 94383 91675 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480294.1 protein_id gnl|my_center|LOCUS_00730 95134 94709 gene locus_tag LOCUS_00740 95134 94709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351008.1 protein_id gnl|my_center|LOCUS_00740 96647 95412 gene locus_tag LOCUS_00750 96647 95412 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208502.1 protein_id gnl|my_center|LOCUS_00750 97389 96712 gene locus_tag LOCUS_00760 97389 96712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 97499 97924 gene locus_tag LOCUS_00770 97499 97924 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350861.1 protein_id gnl|my_center|LOCUS_00770 98342 97899 gene locus_tag LOCUS_00780 98342 97899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 100393 98339 gene locus_tag LOCUS_00790 100393 98339 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479627.1 protein_id gnl|my_center|LOCUS_00790 100619 101950 gene locus_tag LOCUS_00800 100619 101950 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103359.1 protein_id gnl|my_center|LOCUS_00800 102504 103649 gene locus_tag LOCUS_00810 gene sucC 102504 103649 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887890.1 protein_id gnl|my_center|LOCUS_00810 103646 104551 gene locus_tag LOCUS_00820 gene sucD 103646 104551 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887891.1 protein_id gnl|my_center|LOCUS_00820 104820 105293 gene locus_tag LOCUS_00830 104820 105293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 105948 105385 gene locus_tag LOCUS_00840 105948 105385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 106337 107143 gene locus_tag LOCUS_00850 106337 107143 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_00850 107267 108136 gene locus_tag LOCUS_00860 107267 108136 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_00860 108845 108219 gene locus_tag LOCUS_00870 108845 108219 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479823.1 protein_id gnl|my_center|LOCUS_00870 108921 109259 gene locus_tag LOCUS_00880 108921 109259 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632387.1 protein_id gnl|my_center|LOCUS_00880 109378 111132 gene locus_tag LOCUS_00890 109378 111132 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479878.1 protein_id gnl|my_center|LOCUS_00890 111762 111457 gene locus_tag LOCUS_00900 111762 111457 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888583.1 protein_id gnl|my_center|LOCUS_00900 112858 111800 gene locus_tag LOCUS_00910 112858 111800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 114560 112998 gene locus_tag LOCUS_00920 114560 112998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 117273 114853 gene locus_tag LOCUS_00930 117273 114853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 118985 117369 gene locus_tag LOCUS_00940 118985 117369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 119373 119122 gene locus_tag LOCUS_00950 119373 119122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 119162 119171 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 121808 119511 gene locus_tag LOCUS_00960 121808 119511 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_00960 123649 122306 gene locus_tag LOCUS_00970 gene sufD 123649 122306 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888732.1 protein_id gnl|my_center|LOCUS_00970 124176 123688 gene locus_tag LOCUS_00980 124176 123688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 125580 124180 gene locus_tag LOCUS_00990 gene sufB 125580 124180 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_00990 126204 125614 gene locus_tag LOCUS_01000 126204 125614 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479672.1 protein_id gnl|my_center|LOCUS_01000 126973 126218 gene locus_tag LOCUS_01010 gene sufC 126973 126218 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888738.1 protein_id gnl|my_center|LOCUS_01010 127224 127463 gene locus_tag LOCUS_01020 127224 127463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 127402 127962 gene locus_tag LOCUS_01030 127402 127962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 128108 130741 gene locus_tag LOCUS_01040 128108 130741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 132432 130888 gene locus_tag LOCUS_01050 132432 130888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 133093 132629 gene locus_tag LOCUS_01060 133093 132629 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_01060 133632 133183 gene locus_tag LOCUS_01070 133632 133183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 133964 135031 gene locus_tag LOCUS_01080 gene ribD 133964 135031 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886799.1 protein_id gnl|my_center|LOCUS_01080 135032 135658 gene locus_tag LOCUS_01090 135032 135658 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886800.1 protein_id gnl|my_center|LOCUS_01090 135655 136839 gene locus_tag LOCUS_01100 135655 136839 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886801.1 protein_id gnl|my_center|LOCUS_01100 136883 137512 gene locus_tag LOCUS_01110 136883 137512 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_01110 138064 137720 gene locus_tag LOCUS_01120 138064 137720 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246564.1 protein_id gnl|my_center|LOCUS_01120 138149 138562 gene locus_tag LOCUS_01130 gene ribH 138149 138562 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886802.1 protein_id gnl|my_center|LOCUS_01130 138774 140576 gene locus_tag LOCUS_01140 138774 140576 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018463.1 protein_id gnl|my_center|LOCUS_01140 140589 141698 gene locus_tag LOCUS_01150 140589 141698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 142123 142383 gene locus_tag LOCUS_01160 142123 142383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 142483 143622 gene locus_tag LOCUS_01170 142483 143622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 143670 144449 gene locus_tag LOCUS_01180 143670 144449 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887106.1 protein_id gnl|my_center|LOCUS_01180 144436 144822 gene locus_tag LOCUS_01190 144436 144822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 144931 145548 gene locus_tag LOCUS_01200 144931 145548 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_01200 145778 147451 gene locus_tag LOCUS_01210 145778 147451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 147458 149134 gene locus_tag LOCUS_01220 147458 149134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 149141 150400 gene locus_tag LOCUS_01230 149141 150400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 150408 152048 gene locus_tag LOCUS_01240 150408 152048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 152103 154526 gene locus_tag LOCUS_01250 152103 154526 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228229.1 protein_id gnl|my_center|LOCUS_01250 156453 154648 gene locus_tag LOCUS_01260 156453 154648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350502.1 protein_id gnl|my_center|LOCUS_01260 158963 156603 gene locus_tag LOCUS_01270 158963 156603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942102.1 protein_id gnl|my_center|LOCUS_01270 159222 160337 gene locus_tag LOCUS_01280 gene dnaJ 159222 160337 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927968.1 protein_id gnl|my_center|LOCUS_01280 162915 160411 gene locus_tag LOCUS_01290 162915 160411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 163423 164382 gene locus_tag LOCUS_01300 163423 164382 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767767.1 protein_id gnl|my_center|LOCUS_01300 164513 165151 gene locus_tag LOCUS_01310 164513 165151 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_01310 165144 166148 gene locus_tag LOCUS_01320 165144 166148 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887570.1 protein_id gnl|my_center|LOCUS_01320 166675 166232 gene locus_tag LOCUS_01330 166675 166232 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142675.1 protein_id gnl|my_center|LOCUS_01330 166795 168009 gene locus_tag LOCUS_01340 gene rocD 166795 168009 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_01340 169828 168299 gene locus_tag LOCUS_01350 169828 168299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 170186 173827 gene locus_tag LOCUS_01360 gene metH 170186 173827 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887611.1 protein_id gnl|my_center|LOCUS_01360 174008 174505 gene locus_tag LOCUS_01370 174008 174505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 174626 175381 gene locus_tag LOCUS_01380 174626 175381 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328024.1 protein_id gnl|my_center|LOCUS_01380 175491 176063 gene locus_tag LOCUS_01390 175491 176063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 176066 176740 gene locus_tag LOCUS_01400 176066 176740 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480061.1 protein_id gnl|my_center|LOCUS_01400 176743 178152 gene locus_tag LOCUS_01410 176743 178152 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889042.1 protein_id gnl|my_center|LOCUS_01410 178342 178722 gene locus_tag LOCUS_01420 178342 178722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 178719 179552 gene locus_tag LOCUS_01430 178719 179552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 179604 180827 gene locus_tag LOCUS_01440 179604 180827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 181398 180814 gene locus_tag LOCUS_01450 181398 180814 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549931.1 protein_id gnl|my_center|LOCUS_01450 181510 182148 gene locus_tag LOCUS_01460 181510 182148 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676633.1 protein_id gnl|my_center|LOCUS_01460 183660 182215 gene locus_tag LOCUS_01470 gene cysS 183660 182215 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479901.1 protein_id gnl|my_center|LOCUS_01470 184111 185007 gene locus_tag LOCUS_01480 184111 185007 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055673.1 protein_id gnl|my_center|LOCUS_01480 185624 185088 gene locus_tag LOCUS_01490 185624 185088 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888688.1 protein_id gnl|my_center|LOCUS_01490 185743 186123 gene locus_tag LOCUS_01500 185743 186123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 187139 186192 gene locus_tag LOCUS_01510 187139 186192 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_01510 187539 187150 gene locus_tag LOCUS_01520 187539 187150 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_01520 187854 187687 gene locus_tag LOCUS_01530 187854 187687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 187853 189334 gene locus_tag LOCUS_01540 187853 189334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 190744 189422 gene locus_tag LOCUS_01550 gene glmM 190744 189422 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888702.1 protein_id gnl|my_center|LOCUS_01550 190859 191575 gene locus_tag LOCUS_01560 190859 191575 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350041.1 protein_id gnl|my_center|LOCUS_01560 191572 192654 gene locus_tag LOCUS_01570 191572 192654 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479799.1 protein_id gnl|my_center|LOCUS_01570 193269 192658 gene locus_tag LOCUS_01580 193269 192658 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216917.1 protein_id gnl|my_center|LOCUS_01580 193268 193966 gene locus_tag LOCUS_01590 193268 193966 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970775.1 protein_id gnl|my_center|LOCUS_01590 193975 194925 gene locus_tag LOCUS_01600 193975 194925 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814870.1 protein_id gnl|my_center|LOCUS_01600 195098 195847 gene locus_tag LOCUS_01610 195098 195847 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_01610 197179 195878 gene locus_tag LOCUS_01620 197179 195878 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888533.1 protein_id gnl|my_center|LOCUS_01620 197510 197301 gene locus_tag LOCUS_01630 197510 197301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 198422 197886 gene locus_tag LOCUS_01640 198422 197886 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887523.1 protein_id gnl|my_center|LOCUS_01640 198585 199811 gene locus_tag LOCUS_01650 198585 199811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 199884 201248 gene locus_tag LOCUS_01660 199884 201248 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_01660 201245 203740 gene locus_tag LOCUS_01670 201245 203740 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_01670 204448 203816 gene locus_tag LOCUS_01680 204448 203816 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974610.1 protein_id gnl|my_center|LOCUS_01680 205811 204663 gene locus_tag LOCUS_01690 205811 204663 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_01690 206045 205851 gene locus_tag LOCUS_01700 206045 205851 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889079.1 protein_id gnl|my_center|LOCUS_01700 206440 206042 gene locus_tag LOCUS_01710 206440 206042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 206832 206437 gene locus_tag LOCUS_01720 206832 206437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 207092 207595 gene locus_tag LOCUS_01730 207092 207595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 207726 208502 gene locus_tag LOCUS_01740 207726 208502 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888160.1 protein_id gnl|my_center|LOCUS_01740 208499 209197 gene locus_tag LOCUS_01750 208499 209197 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480216.1 protein_id gnl|my_center|LOCUS_01750 209199 209750 gene locus_tag LOCUS_01760 209199 209750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 209737 210147 gene locus_tag LOCUS_01770 209737 210147 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887782.1 protein_id gnl|my_center|LOCUS_01770 210835 210101 gene locus_tag LOCUS_01780 210835 210101 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479631.1 protein_id gnl|my_center|LOCUS_01780 212102 210849 gene locus_tag LOCUS_01790 212102 210849 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887720.1 protein_id gnl|my_center|LOCUS_01790 213253 212099 gene locus_tag LOCUS_01800 213253 212099 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479632.1 protein_id gnl|my_center|LOCUS_01800 213999 213265 gene locus_tag LOCUS_01810 213999 213265 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228266.1 protein_id gnl|my_center|LOCUS_01810 215381 214107 gene locus_tag LOCUS_01820 215381 214107 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889306.1 protein_id gnl|my_center|LOCUS_01820 216633 215371 gene locus_tag LOCUS_01830 216633 215371 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887866.1 protein_id gnl|my_center|LOCUS_01830 217056 216637 gene locus_tag LOCUS_01840 gene fabZ 217056 216637 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479633.1 protein_id gnl|my_center|LOCUS_01840 218167 217127 gene locus_tag LOCUS_01850 218167 217127 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173840.1 protein_id gnl|my_center|LOCUS_01850 218625 218371 gene locus_tag LOCUS_01860 218625 218371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 218671 218937 gene locus_tag LOCUS_01870 218671 218937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 219497 218994 gene locus_tag LOCUS_01880 219497 218994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 220702 219533 gene locus_tag LOCUS_01890 220702 219533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166479973.1 protein_id gnl|my_center|LOCUS_01890 220924 222186 gene locus_tag LOCUS_01900 220924 222186 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888391.1 protein_id gnl|my_center|LOCUS_01900 222418 222215 gene locus_tag LOCUS_01910 222418 222215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 222332 222964 gene locus_tag LOCUS_01920 222332 222964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 223017 223679 gene locus_tag LOCUS_01930 223017 223679 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228230.1 protein_id gnl|my_center|LOCUS_01930 223880 224590 gene locus_tag LOCUS_01940 223880 224590 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480166.1 protein_id gnl|my_center|LOCUS_01940 224587 224850 gene locus_tag LOCUS_01950 gene purS 224587 224850 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886870.1 protein_id gnl|my_center|LOCUS_01950 224853 225554 gene locus_tag LOCUS_01960 gene purQ 224853 225554 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480167.1 protein_id gnl|my_center|LOCUS_01960 225551 227779 gene locus_tag LOCUS_01970 gene purL 225551 227779 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886868.1 protein_id gnl|my_center|LOCUS_01970 228024 229439 gene locus_tag LOCUS_01980 gene purF 228024 229439 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886866.1 protein_id gnl|my_center|LOCUS_01980 229691 231418 gene locus_tag LOCUS_01990 229691 231418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 232041 232232 gene locus_tag LOCUS_02000 232041 232232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 232652 232846 gene locus_tag LOCUS_02010 232652 232846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 233198 232878 gene locus_tag LOCUS_02020 233198 232878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 233996 233256 gene locus_tag LOCUS_02030 233996 233256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 235247 234330 gene locus_tag LOCUS_02040 235247 234330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 235354 236223 gene locus_tag LOCUS_02050 235354 236223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 236250 236765 gene locus_tag LOCUS_02060 236250 236765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 237814 236792 gene locus_tag LOCUS_02070 237814 236792 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_02070 238306 237890 gene locus_tag LOCUS_02080 238306 237890 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_02080 239009 238479 gene locus_tag LOCUS_02090 239009 238479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 240200 239058 gene locus_tag LOCUS_02100 240200 239058 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739648.1 protein_id gnl|my_center|LOCUS_02100 241288 240290 gene locus_tag LOCUS_02110 241288 240290 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921545.1 protein_id gnl|my_center|LOCUS_02110 242623 241412 gene locus_tag LOCUS_02120 242623 241412 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257464.1 protein_id gnl|my_center|LOCUS_02120 243422 242823 gene locus_tag LOCUS_02130 243422 242823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 243801 243712 gene locus_tag LOCUS_t00010 243801 243712 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 243942 245159 gene locus_tag LOCUS_02140 gene hmpA 243942 245159 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889502.1 protein_id gnl|my_center|LOCUS_02140 245507 247345 gene locus_tag LOCUS_02150 245507 247345 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_02150 247374 247880 gene locus_tag LOCUS_02160 247374 247880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 248987 247935 gene locus_tag LOCUS_02170 248987 247935 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887517.1 protein_id gnl|my_center|LOCUS_02170 249385 250590 gene locus_tag LOCUS_02180 249385 250590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 250717 252219 gene locus_tag LOCUS_02190 gene purH 250717 252219 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443404.1 protein_id gnl|my_center|LOCUS_02190 252228 253094 gene locus_tag LOCUS_02200 252228 253094 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887513.1 protein_id gnl|my_center|LOCUS_02200 253091 253696 gene locus_tag LOCUS_02210 253091 253696 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886969.1 protein_id gnl|my_center|LOCUS_02210 253885 256974 gene locus_tag LOCUS_02220 253885 256974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 259205 257106 gene locus_tag LOCUS_02230 259205 257106 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176758209.1 protein_id gnl|my_center|LOCUS_02230 260678 259689 gene locus_tag LOCUS_02240 260678 259689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 261083 260742 gene locus_tag LOCUS_02250 261083 260742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 262075 261161 gene locus_tag LOCUS_02260 262075 261161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 262266 262892 gene locus_tag LOCUS_02270 262266 262892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 263481 262918 gene locus_tag LOCUS_02280 263481 262918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 264359 263826 gene locus_tag LOCUS_02290 264359 263826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 265145 264591 gene locus_tag LOCUS_02300 265145 264591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 266981 265335 gene locus_tag LOCUS_02310 266981 265335 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479602.1 protein_id gnl|my_center|LOCUS_02310 267068 267718 gene locus_tag LOCUS_02320 267068 267718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 268347 267724 gene locus_tag LOCUS_02330 268347 267724 CDS product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304072.1 protein_id gnl|my_center|LOCUS_02330 269383 268451 gene locus_tag LOCUS_02340 269383 268451 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888082.1 protein_id gnl|my_center|LOCUS_02340 269760 270290 gene locus_tag LOCUS_02350 269760 270290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 270573 271088 gene locus_tag LOCUS_02360 270573 271088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 272006 271206 gene locus_tag LOCUS_02370 272006 271206 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_02370 272770 272045 gene locus_tag LOCUS_02380 272770 272045 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173486.1 protein_id gnl|my_center|LOCUS_02380 273530 272880 gene locus_tag LOCUS_02390 273530 272880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_02390 273808 274509 gene locus_tag LOCUS_02400 273808 274509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 275665 274517 gene locus_tag LOCUS_02410 gene queG 275665 274517 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480231.1 protein_id gnl|my_center|LOCUS_02410 276442 276807 gene locus_tag LOCUS_02420 gene aroH 276442 276807 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172959.1 protein_id gnl|my_center|LOCUS_02420 277510 276857 gene locus_tag LOCUS_02430 277510 276857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 278069 277494 gene locus_tag LOCUS_02440 278069 277494 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284106.1 protein_id gnl|my_center|LOCUS_02440 278326 280374 gene locus_tag LOCUS_02450 278326 280374 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479701.1 protein_id gnl|my_center|LOCUS_02450 281403 280432 gene locus_tag LOCUS_02460 gene bioB 281403 280432 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217196.1 protein_id gnl|my_center|LOCUS_02460 282977 281400 gene locus_tag LOCUS_02470 282977 281400 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 protein_id gnl|my_center|LOCUS_02470 284972 283377 gene locus_tag LOCUS_02480 284972 283377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 286660 285401 gene locus_tag LOCUS_02490 286660 285401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887571.1 protein_id gnl|my_center|LOCUS_02490 287381 286650 gene locus_tag LOCUS_02500 287381 286650 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887572.1 protein_id gnl|my_center|LOCUS_02500 287634 288311 gene locus_tag LOCUS_02510 287634 288311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 288910 288335 gene locus_tag LOCUS_02520 288910 288335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 290176 289223 gene locus_tag LOCUS_02530 290176 289223 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887541.1 protein_id gnl|my_center|LOCUS_02530 290526 290176 gene locus_tag LOCUS_02540 290526 290176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 291559 290756 gene locus_tag LOCUS_02550 291559 290756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 292445 291543 gene locus_tag LOCUS_02560 292445 291543 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 protein_id gnl|my_center|LOCUS_02560 292885 292442 gene locus_tag LOCUS_02570 292885 292442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 293063 294001 gene locus_tag LOCUS_02580 gene truB 293063 294001 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887965.1 protein_id gnl|my_center|LOCUS_02580 294059 294856 gene locus_tag LOCUS_02590 294059 294856 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472607.1 protein_id gnl|my_center|LOCUS_02590 295184 296302 gene locus_tag LOCUS_02600 gene ald 295184 296302 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_02600 297037 296381 gene locus_tag LOCUS_02610 297037 296381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 297721 297215 gene locus_tag LOCUS_02620 297721 297215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 297853 298188 gene locus_tag LOCUS_02630 297853 298188 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887034.1 protein_id gnl|my_center|LOCUS_02630 298181 299770 gene locus_tag LOCUS_02640 298181 299770 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349557.1 protein_id gnl|my_center|LOCUS_02640 299903 301150 gene locus_tag LOCUS_02650 299903 301150 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887414.1 protein_id gnl|my_center|LOCUS_02650 301143 301892 gene locus_tag LOCUS_02660 301143 301892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 301889 302830 gene locus_tag LOCUS_02670 gene mraY 301889 302830 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888470.1 protein_id gnl|my_center|LOCUS_02670 302827 304107 gene locus_tag LOCUS_02680 gene murD 302827 304107 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889121.1 protein_id gnl|my_center|LOCUS_02680 304086 305240 gene locus_tag LOCUS_02690 304086 305240 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889122.1 protein_id gnl|my_center|LOCUS_02690 305504 306589 gene locus_tag LOCUS_02700 gene murG 305504 306589 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349463.1 protein_id gnl|my_center|LOCUS_02700 306589 307944 gene locus_tag LOCUS_02710 gene murC 306589 307944 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887272.1 protein_id gnl|my_center|LOCUS_02710 307941 308786 gene locus_tag LOCUS_02720 307941 308786 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887273.1 protein_id gnl|my_center|LOCUS_02720 308777 309373 gene locus_tag LOCUS_02730 308777 309373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 309373 310764 gene locus_tag LOCUS_02740 gene ftsA 309373 310764 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887275.1 protein_id gnl|my_center|LOCUS_02740 310853 311902 gene locus_tag LOCUS_02750 gene ftsZ 310853 311902 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887276.1 protein_id gnl|my_center|LOCUS_02750 312266 313153 gene locus_tag LOCUS_02760 gene ribF 312266 313153 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887651.1 protein_id gnl|my_center|LOCUS_02760 314092 313172 gene locus_tag LOCUS_02770 314092 313172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 315645 314089 gene locus_tag LOCUS_02780 315645 314089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 316354 315815 gene locus_tag LOCUS_02790 gene raiA 316354 315815 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887725.1 protein_id gnl|my_center|LOCUS_02790 316600 317967 gene locus_tag LOCUS_02800 316600 317967 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350172.1 protein_id gnl|my_center|LOCUS_02800 320656 318041 gene locus_tag LOCUS_02810 320656 318041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 322673 321087 gene locus_tag LOCUS_02820 322673 321087 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888192.1 protein_id gnl|my_center|LOCUS_02820 322819 323724 gene locus_tag LOCUS_02830 322819 323724 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_02830 323904 325052 gene locus_tag LOCUS_02840 gene bshA 323904 325052 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 protein_id gnl|my_center|LOCUS_02840 325549 326220 gene locus_tag LOCUS_02850 325549 326220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 326534 326779 gene locus_tag LOCUS_02860 326534 326779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 326871 327677 gene locus_tag LOCUS_02870 326871 327677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 327664 329013 gene locus_tag LOCUS_02880 327664 329013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 329089 330243 gene locus_tag LOCUS_02890 329089 330243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887132.1 protein_id gnl|my_center|LOCUS_02890 330374 331165 gene locus_tag LOCUS_02900 330374 331165 CDS product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528224.1 protein_id gnl|my_center|LOCUS_02900 331643 331194 gene locus_tag LOCUS_02910 331643 331194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 333222 331636 gene locus_tag LOCUS_02920 gene tilS 333222 331636 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732762.1 protein_id gnl|my_center|LOCUS_02920 333287 333883 gene locus_tag LOCUS_02930 333287 333883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 333894 334391 gene locus_tag LOCUS_02940 333894 334391 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887852.1 protein_id gnl|my_center|LOCUS_02940 334375 335541 gene locus_tag LOCUS_02950 334375 335541 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618807.1 protein_id gnl|my_center|LOCUS_02950 335615 335884 gene locus_tag LOCUS_02960 335615 335884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 335881 336540 gene locus_tag LOCUS_02970 335881 336540 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_02970 337428 336631 gene locus_tag LOCUS_02980 337428 336631 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_02980 338270 337491 gene locus_tag LOCUS_02990 gene trpC 338270 337491 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888065.1 protein_id gnl|my_center|LOCUS_02990 338370 339305 gene locus_tag LOCUS_03000 338370 339305 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_03000 339482 340012 gene locus_tag LOCUS_03010 gene hpt 339482 340012 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888017.1 protein_id gnl|my_center|LOCUS_03010 340014 340847 gene locus_tag LOCUS_03020 gene nadC 340014 340847 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_03020 341098 342048 gene locus_tag LOCUS_03030 gene nadA 341098 342048 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228349.1 protein_id gnl|my_center|LOCUS_03030 342135 343610 gene locus_tag LOCUS_03040 342135 343610 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228348.1 protein_id gnl|my_center|LOCUS_03040 343607 344476 gene locus_tag LOCUS_03050 343607 344476 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228998.1 protein_id gnl|my_center|LOCUS_03050 344473 345321 gene locus_tag LOCUS_03060 344473 345321 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173912.1 protein_id gnl|my_center|LOCUS_03060 345360 345596 gene locus_tag LOCUS_03070 345360 345596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 346158 345685 gene locus_tag LOCUS_03080 346158 345685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 346267 347307 gene locus_tag LOCUS_03090 346267 347307 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757677.1 protein_id gnl|my_center|LOCUS_03090 347372 347824 gene locus_tag LOCUS_03100 347372 347824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 348747 347905 gene locus_tag LOCUS_03110 gene purU 348747 347905 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887229.1 protein_id gnl|my_center|LOCUS_03110 349273 348926 gene locus_tag LOCUS_03120 349273 348926 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480312.1 protein_id gnl|my_center|LOCUS_03120 349584 350288 gene locus_tag LOCUS_03130 349584 350288 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480313.1 protein_id gnl|my_center|LOCUS_03130 350511 350951 gene locus_tag LOCUS_03140 gene rimP 350511 350951 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888431.1 protein_id gnl|my_center|LOCUS_03140 350973 352166 gene locus_tag LOCUS_03150 gene nusA 350973 352166 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350009.1 protein_id gnl|my_center|LOCUS_03150 352170 352403 gene locus_tag LOCUS_03160 352170 352403 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350011.1 protein_id gnl|my_center|LOCUS_03160 352403 354142 gene locus_tag LOCUS_03170 gene infB 352403 354142 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888434.1 protein_id gnl|my_center|LOCUS_03170 354423 354761 gene locus_tag LOCUS_03180 354423 354761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 354857 357103 gene locus_tag LOCUS_03190 gene secD 354857 357103 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888457.1 protein_id gnl|my_center|LOCUS_03190 357428 358639 gene locus_tag LOCUS_03200 357428 358639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 358723 359430 gene locus_tag LOCUS_03210 358723 359430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 359432 359758 gene locus_tag LOCUS_03220 359432 359758 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329333.1 protein_id gnl|my_center|LOCUS_03220 359755 360090 gene locus_tag LOCUS_03230 359755 360090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 360087 362246 gene locus_tag LOCUS_03240 gene recJ 360087 362246 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479621.1 protein_id gnl|my_center|LOCUS_03240 362285 362809 gene locus_tag LOCUS_03250 362285 362809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 362784 363692 gene locus_tag LOCUS_03260 362784 363692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 365578 363719 gene locus_tag LOCUS_03270 365578 363719 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567324.1 protein_id gnl|my_center|LOCUS_03270 365769 366452 gene locus_tag LOCUS_03280 365769 366452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 366626 366378 gene locus_tag LOCUS_03290 366626 366378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 366702 367445 gene locus_tag LOCUS_03300 366702 367445 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262442.1 protein_id gnl|my_center|LOCUS_03300 368952 367513 gene locus_tag LOCUS_03310 368952 367513 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888131.1 protein_id gnl|my_center|LOCUS_03310 370377 368956 gene locus_tag LOCUS_03320 370377 368956 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888132.1 protein_id gnl|my_center|LOCUS_03320 372239 370374 gene locus_tag LOCUS_03330 gene nuoL 372239 370374 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025566951.1 protein_id gnl|my_center|LOCUS_03330 372546 372244 gene locus_tag LOCUS_03340 gene nuoK 372546 372244 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_03340 373115 372546 gene locus_tag LOCUS_03350 373115 372546 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888135.1 protein_id gnl|my_center|LOCUS_03350 373642 373112 gene locus_tag LOCUS_03360 gene nuoI 373642 373112 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888136.1 protein_id gnl|my_center|LOCUS_03360 374778 373642 gene locus_tag LOCUS_03370 gene nuoH 374778 373642 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888137.1 protein_id gnl|my_center|LOCUS_03370 376915 374759 gene locus_tag LOCUS_03380 gene nuoG 376915 374759 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888138.1 protein_id gnl|my_center|LOCUS_03380 378304 376970 gene locus_tag LOCUS_03390 gene nuoF 378304 376970 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888139.1 protein_id gnl|my_center|LOCUS_03390 378912 378301 gene locus_tag LOCUS_03400 gene nuoE 378912 378301 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888140.1 protein_id gnl|my_center|LOCUS_03400 379432 378926 gene locus_tag LOCUS_03410 379432 378926 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886698.1 protein_id gnl|my_center|LOCUS_03410 380631 379429 gene locus_tag LOCUS_03420 gene nuoD 380631 379429 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888142.1 protein_id gnl|my_center|LOCUS_03420 381242 380628 gene locus_tag LOCUS_03430 381242 380628 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888143.1 protein_id gnl|my_center|LOCUS_03430 381766 381230 gene locus_tag LOCUS_03440 381766 381230 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174271.1 protein_id gnl|my_center|LOCUS_03440 382107 381757 gene locus_tag LOCUS_03450 382107 381757 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480222.1 protein_id gnl|my_center|LOCUS_03450 383414 382575 gene locus_tag LOCUS_03460 383414 382575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 384707 383565 gene locus_tag LOCUS_03470 384707 383565 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887506.1 protein_id gnl|my_center|LOCUS_03470 385122 387350 gene locus_tag LOCUS_03480 385122 387350 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887760.1 protein_id gnl|my_center|LOCUS_03480 387538 388881 gene locus_tag LOCUS_03490 gene radA 387538 388881 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479626.1 protein_id gnl|my_center|LOCUS_03490 389067 390110 gene locus_tag LOCUS_03500 389067 390110 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887761.1 protein_id gnl|my_center|LOCUS_03500 391364 390171 gene locus_tag LOCUS_03510 391364 390171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_03510 392035 391361 gene locus_tag LOCUS_03520 392035 391361 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045103290.1 protein_id gnl|my_center|LOCUS_03520 393309 392032 gene locus_tag LOCUS_03530 393309 392032 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140777.1 protein_id gnl|my_center|LOCUS_03530 394316 393306 gene locus_tag LOCUS_03540 394316 393306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 395536 394292 gene locus_tag LOCUS_03550 395536 394292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 395677 396984 gene locus_tag LOCUS_03560 gene trmFO 395677 396984 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350703.1 protein_id gnl|my_center|LOCUS_03560 398486 397059 gene locus_tag LOCUS_03570 398486 397059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 399097 400038 gene locus_tag LOCUS_03580 399097 400038 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888469.1 protein_id gnl|my_center|LOCUS_03580 400113 400736 gene locus_tag LOCUS_03590 400113 400736 CDS product DUF2847 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888467.1 protein_id gnl|my_center|LOCUS_03590 401694 400867 gene locus_tag LOCUS_03600 gene panB 401694 400867 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459073.1 protein_id gnl|my_center|LOCUS_03600 402287 401808 gene locus_tag LOCUS_03610 402287 401808 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034358328.1 protein_id gnl|my_center|LOCUS_03610 402516 403466 gene locus_tag LOCUS_03620 402516 403466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03620 403463 404350 gene locus_tag LOCUS_03630 403463 404350 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889242.1 protein_id gnl|my_center|LOCUS_03630 404481 405710 gene locus_tag LOCUS_03640 gene coxB 404481 405710 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227850.1 protein_id gnl|my_center|LOCUS_03640 405726 408146 gene locus_tag LOCUS_03650 405726 408146 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889244.1 protein_id gnl|my_center|LOCUS_03650 408305 408895 gene locus_tag LOCUS_03660 408305 408895 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887242.1 protein_id gnl|my_center|LOCUS_03660 408892 409284 gene locus_tag LOCUS_03670 408892 409284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 409821 409591 gene locus_tag LOCUS_03680 409821 409591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 410723 409731 gene locus_tag LOCUS_03690 410723 409731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03690 410851 411369 gene locus_tag LOCUS_03700 gene bstA 410851 411369 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_03700 412449 411373 gene locus_tag LOCUS_03710 412449 411373 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_03710 412554 413096 gene locus_tag LOCUS_03720 412554 413096 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_03720 413105 413371 gene locus_tag LOCUS_03730 413105 413371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 413365 414132 gene locus_tag LOCUS_03740 413365 414132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 414136 415389 gene locus_tag LOCUS_03750 414136 415389 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_03750 415402 416568 gene locus_tag LOCUS_03760 415402 416568 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225440.1 protein_id gnl|my_center|LOCUS_03760 416630 417040 gene locus_tag LOCUS_03770 416630 417040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 417895 417080 gene locus_tag LOCUS_03780 417895 417080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 418467 417898 gene locus_tag LOCUS_03790 418467 417898 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888617.1 protein_id gnl|my_center|LOCUS_03790 418717 419961 gene locus_tag LOCUS_03800 418717 419961 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983670.1 protein_id gnl|my_center|LOCUS_03800 420150 420076 gene locus_tag LOCUS_t00020 420150 420076 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 420780 420316 gene locus_tag LOCUS_03810 420780 420316 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479831.1 protein_id gnl|my_center|LOCUS_03810 421363 420836 gene locus_tag LOCUS_03820 421363 420836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 422134 421373 gene locus_tag LOCUS_03830 422134 421373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 423244 422312 gene locus_tag LOCUS_03840 gene trxB 423244 422312 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_03840 423742 425403 gene locus_tag LOCUS_03850 423742 425403 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479832.1 protein_id gnl|my_center|LOCUS_03850 425609 427033 gene locus_tag LOCUS_03860 425609 427033 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888739.1 protein_id gnl|my_center|LOCUS_03860 427979 427101 gene locus_tag LOCUS_03870 gene murQ 427979 427101 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889472.1 protein_id gnl|my_center|LOCUS_03870 428110 428874 gene locus_tag LOCUS_03880 428110 428874 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423797.1 protein_id gnl|my_center|LOCUS_03880 429053 430150 gene locus_tag LOCUS_03890 gene nagA 429053 430150 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889325.1 protein_id gnl|my_center|LOCUS_03890 430143 431174 gene locus_tag LOCUS_03900 430143 431174 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889414.1 protein_id gnl|my_center|LOCUS_03900 431306 431917 gene locus_tag LOCUS_03910 431306 431917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 432790 431891 gene locus_tag LOCUS_03920 432790 431891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_03920 433559 432792 gene locus_tag LOCUS_03930 433559 432792 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889488.1 protein_id gnl|my_center|LOCUS_03930 434200 433556 gene locus_tag LOCUS_03940 434200 433556 CDS product DUF1990 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889489.1 protein_id gnl|my_center|LOCUS_03940 435424 434276 gene locus_tag LOCUS_03950 gene mnmA 435424 434276 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480311.1 protein_id gnl|my_center|LOCUS_03950 435528 435737 gene locus_tag LOCUS_03960 435528 435737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 436358 436020 gene locus_tag LOCUS_03970 436358 436020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 436481 437626 gene locus_tag LOCUS_03980 gene lysA 436481 437626 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888393.1 protein_id gnl|my_center|LOCUS_03980 438189 437644 gene locus_tag LOCUS_03990 438189 437644 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887360.1 protein_id gnl|my_center|LOCUS_03990 438907 438314 gene locus_tag LOCUS_04000 438907 438314 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887361.1 protein_id gnl|my_center|LOCUS_04000 439199 440110 gene locus_tag LOCUS_04010 439199 440110 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228784.1 protein_id gnl|my_center|LOCUS_04010 441884 440193 gene locus_tag LOCUS_04020 441884 440193 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479876.1 protein_id gnl|my_center|LOCUS_04020 442840 441959 gene locus_tag LOCUS_04030 gene meaB 442840 441959 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 protein_id gnl|my_center|LOCUS_04030 443741 443040 gene locus_tag LOCUS_04040 443741 443040 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_04040 444769 443738 gene locus_tag LOCUS_04050 gene purM 444769 443738 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177712.1 protein_id gnl|my_center|LOCUS_04050 445146 445829 gene locus_tag LOCUS_04060 445146 445829 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_04060 447647 445833 gene locus_tag LOCUS_04070 447647 445833 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109113.1 protein_id gnl|my_center|LOCUS_04070 447779 448753 gene locus_tag LOCUS_04080 gene crtE 447779 448753 CDS product geranylgeranyl diphosphate synthase CrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888034.1 protein_id gnl|my_center|LOCUS_04080 449466 448750 gene locus_tag LOCUS_04090 449466 448750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 449688 449566 gene locus_tag LOCUS_04100 449688 449566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 449738 449908 gene locus_tag LOCUS_04110 449738 449908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 450049 449852 gene locus_tag LOCUS_04120 450049 449852 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480233.1 protein_id gnl|my_center|LOCUS_04120 450312 451064 gene locus_tag LOCUS_04130 450312 451064 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888267.1 protein_id gnl|my_center|LOCUS_04130 451094 451687 gene locus_tag LOCUS_04140 gene plsY 451094 451687 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228511.1 protein_id gnl|my_center|LOCUS_04140 451690 452394 gene locus_tag LOCUS_04150 gene bshB1 451690 452394 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888991.1 protein_id gnl|my_center|LOCUS_04150 452592 453140 gene locus_tag LOCUS_04160 452592 453140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 453235 453600 gene locus_tag LOCUS_04170 453235 453600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 453660 454268 gene locus_tag LOCUS_04180 453660 454268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 454291 456015 gene locus_tag LOCUS_04190 454291 456015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 457064 456075 gene locus_tag LOCUS_04200 gene thiO 457064 456075 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928950.1 protein_id gnl|my_center|LOCUS_04200 457868 457074 gene locus_tag LOCUS_04210 457868 457074 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479758.1 protein_id gnl|my_center|LOCUS_04210 458233 458039 gene locus_tag LOCUS_04220 458233 458039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 458864 458223 gene locus_tag LOCUS_04230 gene thiE 458864 458223 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_04230 460664 458865 gene locus_tag LOCUS_04240 gene thiC 460664 458865 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_04240 461047 461811 gene locus_tag LOCUS_04250 gene thiD 461047 461811 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177646.1 protein_id gnl|my_center|LOCUS_04250 462491 463441 gene locus_tag LOCUS_04260 gene argF 462491 463441 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177765.1 protein_id gnl|my_center|LOCUS_04260 463510 463947 gene locus_tag LOCUS_04270 463510 463947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 463940 464926 gene locus_tag LOCUS_04280 gene argC 463940 464926 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886726.1 protein_id gnl|my_center|LOCUS_04280 464976 465566 gene locus_tag LOCUS_04290 464976 465566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 465638 466801 gene locus_tag LOCUS_04300 gene argJ 465638 466801 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966302.1 protein_id gnl|my_center|LOCUS_04300 467039 466875 gene locus_tag LOCUS_04310 467039 466875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 467413 467069 gene locus_tag LOCUS_04320 467413 467069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 467907 467575 gene locus_tag LOCUS_04330 467907 467575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 470113 467987 gene locus_tag LOCUS_04340 470113 467987 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888489.1 protein_id gnl|my_center|LOCUS_04340 470481 470113 gene locus_tag LOCUS_04350 470481 470113 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888490.1 protein_id gnl|my_center|LOCUS_04350 471623 470577 gene locus_tag LOCUS_04360 471623 470577 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228826.1 protein_id gnl|my_center|LOCUS_04360 471770 472483 gene locus_tag LOCUS_04370 gene rlmB 471770 472483 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_04370 472547 473497 gene locus_tag LOCUS_04380 472547 473497 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_04380 473951 473502 gene locus_tag LOCUS_04390 473951 473502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 474479 473967 gene locus_tag LOCUS_04400 474479 473967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 475467 474535 gene locus_tag LOCUS_04410 475467 474535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 477254 475617 gene locus_tag LOCUS_04420 gene groL 477254 475617 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887252.1 protein_id gnl|my_center|LOCUS_04420 477596 477312 gene locus_tag LOCUS_04430 gene groES 477596 477312 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 protein_id gnl|my_center|LOCUS_04430 478231 477800 gene locus_tag LOCUS_04440 478231 477800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 479035 478277 gene locus_tag LOCUS_04450 479035 478277 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480190.1 protein_id gnl|my_center|LOCUS_04450 479183 480178 gene locus_tag LOCUS_04460 479183 480178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 480413 480985 gene locus_tag LOCUS_04470 480413 480985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056491.1 protein_id gnl|my_center|LOCUS_04470 480982 481863 gene locus_tag LOCUS_04480 480982 481863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888947.1 protein_id gnl|my_center|LOCUS_04480 481923 482714 gene locus_tag LOCUS_04490 481923 482714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 482763 483314 gene locus_tag LOCUS_04500 482763 483314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 483435 483361 gene locus_tag LOCUS_t00030 483435 483361 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 483659 484396 gene locus_tag LOCUS_04510 483659 484396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227948.1 protein_id gnl|my_center|LOCUS_04510 484412 485227 gene locus_tag LOCUS_04520 484412 485227 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_04520 485264 485719 gene locus_tag LOCUS_04530 485264 485719 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_04530 485987 487045 gene locus_tag LOCUS_04540 485987 487045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 487528 487100 gene locus_tag LOCUS_04550 487528 487100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 488983 487580 gene locus_tag LOCUS_04560 488983 487580 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888422.1 protein_id gnl|my_center|LOCUS_04560 489874 489086 gene locus_tag LOCUS_04570 489874 489086 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479930.1 protein_id gnl|my_center|LOCUS_04570 490678 489926 gene locus_tag LOCUS_04580 490678 489926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479931.1 protein_id gnl|my_center|LOCUS_04580 492043 490949 gene locus_tag LOCUS_04590 492043 490949 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869840.1 protein_id gnl|my_center|LOCUS_04590 495168 492337 gene locus_tag LOCUS_04600 gene secA 495168 492337 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228548.1 protein_id gnl|my_center|LOCUS_04600 496561 495503 gene locus_tag LOCUS_04610 gene tsaD 496561 495503 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479578.1 protein_id gnl|my_center|LOCUS_04610 497453 496641 gene locus_tag LOCUS_04620 497453 496641 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887099.1 protein_id gnl|my_center|LOCUS_04620 498270 497569 gene locus_tag LOCUS_04630 498270 497569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 499294 498557 gene locus_tag LOCUS_04640 499294 498557 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_04640 500499 499408 gene locus_tag LOCUS_04650 500499 499408 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_04650 501148 502326 gene locus_tag LOCUS_04660 501148 502326 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528101.1 protein_id gnl|my_center|LOCUS_04660 502967 502296 gene locus_tag LOCUS_04670 gene nudK 502967 502296 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540486.1 protein_id gnl|my_center|LOCUS_04670 503108 503644 gene locus_tag LOCUS_04680 503108 503644 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228210.1 protein_id gnl|my_center|LOCUS_04680 505636 503756 gene locus_tag LOCUS_04690 505636 503756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 506857 505892 gene locus_tag LOCUS_04700 gene cysK 506857 505892 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 protein_id gnl|my_center|LOCUS_04700 507742 506930 gene locus_tag LOCUS_04710 gene cysE 507742 506930 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004106845.1 protein_id gnl|my_center|LOCUS_04710 508324 507971 gene locus_tag LOCUS_04720 508324 507971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 509378 508524 gene locus_tag LOCUS_04730 509378 508524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 509932 510132 gene locus_tag LOCUS_04740 509932 510132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 510252 510512 gene locus_tag LOCUS_04750 510252 510512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 510908 510690 gene locus_tag LOCUS_04760 gene rpmE 510908 510690 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887471.1 protein_id gnl|my_center|LOCUS_04760 512701 511049 gene locus_tag LOCUS_04770 gene mutL 512701 511049 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888331.1 protein_id gnl|my_center|LOCUS_04770 515172 512698 gene locus_tag LOCUS_04780 gene mutS 515172 512698 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732769.1 protein_id gnl|my_center|LOCUS_04780 515458 515964 gene locus_tag LOCUS_04790 515458 515964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 516758 516024 gene locus_tag LOCUS_04800 516758 516024 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_04800 517406 516762 gene locus_tag LOCUS_04810 517406 516762 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_04810 518026 517409 gene locus_tag LOCUS_04820 518026 517409 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_04820 518673 518062 gene locus_tag LOCUS_04830 gene kynB 518673 518062 CDS product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 protein_id gnl|my_center|LOCUS_04830 520184 518670 gene locus_tag LOCUS_04840 520184 518670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479598.1 protein_id gnl|my_center|LOCUS_04840 520648 520331 gene locus_tag LOCUS_04850 520648 520331 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_04850 521077 521424 gene locus_tag LOCUS_04860 521077 521424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 522149 521430 gene locus_tag LOCUS_04870 522149 521430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 522869 522252 gene locus_tag LOCUS_04880 gene tmk 522869 522252 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886759.1 protein_id gnl|my_center|LOCUS_04880 523595 522870 gene locus_tag LOCUS_04890 523595 522870 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480305.1 protein_id gnl|my_center|LOCUS_04890 524376 523720 gene locus_tag LOCUS_04900 524376 523720 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886653.1 protein_id gnl|my_center|LOCUS_04900 525848 524499 gene locus_tag LOCUS_04910 525848 524499 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479857.1 protein_id gnl|my_center|LOCUS_04910 526165 526848 gene locus_tag LOCUS_04920 gene ftsE 526165 526848 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173352.1 protein_id gnl|my_center|LOCUS_04920 526845 527714 gene locus_tag LOCUS_04930 526845 527714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479855.1 protein_id gnl|my_center|LOCUS_04930 527714 529150 gene locus_tag LOCUS_04940 527714 529150 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139721929.1 protein_id gnl|my_center|LOCUS_04940 529441 529689 gene locus_tag LOCUS_04950 gene rpsP 529441 529689 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887937.1 protein_id gnl|my_center|LOCUS_04950 529785 530024 gene locus_tag LOCUS_04960 529785 530024 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479840.1 protein_id gnl|my_center|LOCUS_04960 530203 530685 gene locus_tag LOCUS_04970 530203 530685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 530862 531320 gene locus_tag LOCUS_04980 530862 531320 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_04980 531399 531947 gene locus_tag LOCUS_04990 531399 531947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 531994 532482 gene locus_tag LOCUS_05000 gene rimM 531994 532482 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888643.1 protein_id gnl|my_center|LOCUS_05000 532472 533272 gene locus_tag LOCUS_05010 gene trmD 532472 533272 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888644.1 protein_id gnl|my_center|LOCUS_05010 533830 533312 gene locus_tag LOCUS_05020 533830 533312 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351055.1 protein_id gnl|my_center|LOCUS_05020 534201 536621 gene locus_tag LOCUS_05030 gene gyrA 534201 536621 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888548.1 protein_id gnl|my_center|LOCUS_05030 536694 537149 gene locus_tag LOCUS_05040 536694 537149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 537217 538233 gene locus_tag LOCUS_05050 537217 538233 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837478.1 protein_id gnl|my_center|LOCUS_05050 538230 539039 gene locus_tag LOCUS_05060 538230 539039 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080087.1 protein_id gnl|my_center|LOCUS_05060 539041 539829 gene locus_tag LOCUS_05070 539041 539829 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170564.1 protein_id gnl|my_center|LOCUS_05070 540452 539826 gene locus_tag LOCUS_05080 540452 539826 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888933.1 protein_id gnl|my_center|LOCUS_05080 540602 541447 gene locus_tag LOCUS_05090 540602 541447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 542286 541411 gene locus_tag LOCUS_05100 542286 541411 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_05100 543201 542305 gene locus_tag LOCUS_05110 543201 542305 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726832.1 protein_id gnl|my_center|LOCUS_05110 543710 544309 gene locus_tag LOCUS_05120 543710 544309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 546037 544367 gene locus_tag LOCUS_05130 546037 544367 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_05130 547070 546150 gene locus_tag LOCUS_05140 547070 546150 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480376.1 protein_id gnl|my_center|LOCUS_05140 547240 548580 gene locus_tag LOCUS_05150 547240 548580 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887096.1 protein_id gnl|my_center|LOCUS_05150 549136 550116 gene locus_tag LOCUS_05160 549136 550116 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479651.1 protein_id gnl|my_center|LOCUS_05160 550126 551445 gene locus_tag LOCUS_05170 550126 551445 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887679.1 protein_id gnl|my_center|LOCUS_05170 551445 552233 gene locus_tag LOCUS_05180 551445 552233 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887678.1 protein_id gnl|my_center|LOCUS_05180 552233 552943 gene locus_tag LOCUS_05190 552233 552943 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887677.1 protein_id gnl|my_center|LOCUS_05190 553171 554337 gene locus_tag LOCUS_05200 553171 554337 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869357.1 protein_id gnl|my_center|LOCUS_05200 554684 556267 gene locus_tag LOCUS_05210 554684 556267 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887933.1 protein_id gnl|my_center|LOCUS_05210 556372 557400 gene locus_tag LOCUS_05220 556372 557400 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 protein_id gnl|my_center|LOCUS_05220 557409 558359 gene locus_tag LOCUS_05230 557409 558359 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887603.1 protein_id gnl|my_center|LOCUS_05230 559357 558410 gene locus_tag LOCUS_05240 559357 558410 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_05240 560029 559421 gene locus_tag LOCUS_05250 560029 559421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 561502 560222 gene locus_tag LOCUS_05260 561502 560222 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886673.1 protein_id gnl|my_center|LOCUS_05260 562164 561853 gene locus_tag LOCUS_05270 562164 561853 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229084.1 protein_id gnl|my_center|LOCUS_05270 562743 562174 gene locus_tag LOCUS_05280 gene rdgB 562743 562174 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_05280 563458 562754 gene locus_tag LOCUS_05290 gene rph 563458 562754 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888224.1 protein_id gnl|my_center|LOCUS_05290 564326 563451 gene locus_tag LOCUS_05300 gene murI 564326 563451 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166466071.1 protein_id gnl|my_center|LOCUS_05300 565428 564382 gene locus_tag LOCUS_05310 565428 564382 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888504.1 protein_id gnl|my_center|LOCUS_05310 565776 565489 gene locus_tag LOCUS_05320 565776 565489 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351049.1 protein_id gnl|my_center|LOCUS_05320 566317 565838 gene locus_tag LOCUS_05330 566317 565838 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_05330 566793 566317 gene locus_tag LOCUS_05340 566793 566317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 567269 566787 gene locus_tag LOCUS_05350 567269 566787 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887054.1 protein_id gnl|my_center|LOCUS_05350 568351 567266 gene locus_tag LOCUS_05360 568351 567266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 569429 568800 gene locus_tag LOCUS_05370 gene wrbA 569429 568800 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889473.1 protein_id gnl|my_center|LOCUS_05370 569835 571625 gene locus_tag LOCUS_05380 569835 571625 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140379.1 protein_id gnl|my_center|LOCUS_05380 571757 572314 gene locus_tag LOCUS_05390 571757 572314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 572716 572390 gene locus_tag LOCUS_05400 572716 572390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 573278 572805 gene locus_tag LOCUS_05410 573278 572805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 573515 574723 gene locus_tag LOCUS_05420 573515 574723 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 protein_id gnl|my_center|LOCUS_05420 575429 574794 gene locus_tag LOCUS_05430 575429 574794 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978556.1 protein_id gnl|my_center|LOCUS_05430 575474 576316 gene locus_tag LOCUS_05440 gene qqlR 575474 576316 CDS product N-acyl homoserine lactonase QqlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886818.1 protein_id gnl|my_center|LOCUS_05440 577197 576340 gene locus_tag LOCUS_05450 577197 576340 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_05450 577459 579024 gene locus_tag LOCUS_05460 577459 579024 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887958.1 protein_id gnl|my_center|LOCUS_05460 580542 579085 gene locus_tag LOCUS_05470 580542 579085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 580665 581465 gene locus_tag LOCUS_05480 580665 581465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 581712 585176 gene locus_tag LOCUS_05490 581712 585176 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479684.1 protein_id gnl|my_center|LOCUS_05490 585262 589839 gene locus_tag LOCUS_05500 gene rpoC 585262 589839 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887556.1 protein_id gnl|my_center|LOCUS_05500 590232 590510 gene locus_tag LOCUS_05510 590232 590510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 590591 591415 gene locus_tag LOCUS_05520 590591 591415 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_05520 591471 592061 gene locus_tag LOCUS_05530 591471 592061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 592190 592828 gene locus_tag LOCUS_05540 592190 592828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 592914 593819 gene locus_tag LOCUS_05550 592914 593819 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174107.1 protein_id gnl|my_center|LOCUS_05550 595309 593870 gene locus_tag LOCUS_05560 595309 593870 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350737.1 protein_id gnl|my_center|LOCUS_05560 596017 595415 gene locus_tag LOCUS_05570 596017 595415 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480040.1 protein_id gnl|my_center|LOCUS_05570 597211 596282 gene locus_tag LOCUS_05580 597211 596282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 599235 597379 gene locus_tag LOCUS_05590 599235 597379 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888683.1 protein_id gnl|my_center|LOCUS_05590 601067 599232 gene locus_tag LOCUS_05600 601067 599232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618939.1 protein_id gnl|my_center|LOCUS_05600 601437 602363 gene locus_tag LOCUS_05610 601437 602363 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888990.1 protein_id gnl|my_center|LOCUS_05610 602545 602620 gene locus_tag LOCUS_t00040 602545 602620 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 602649 602734 gene locus_tag LOCUS_t00050 602649 602734 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 602740 602814 gene locus_tag LOCUS_t00060 602740 602814 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 319 486 gene locus_tag LOCUS_05620 gene rpmG 319 486 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888681.1 protein_id gnl|my_center|LOCUS_05620 489 671 gene locus_tag LOCUS_05630 gene secE 489 671 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630510.1 protein_id gnl|my_center|LOCUS_05630 668 1240 gene locus_tag LOCUS_05640 gene nusG 668 1240 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888679.1 protein_id gnl|my_center|LOCUS_05640 1313 1747 gene locus_tag LOCUS_05650 gene rplK 1313 1747 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888678.1 protein_id gnl|my_center|LOCUS_05650 1740 2432 gene locus_tag LOCUS_05660 gene rplA 1740 2432 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888677.1 protein_id gnl|my_center|LOCUS_05660 2692 3186 gene locus_tag LOCUS_05670 gene rplJ 2692 3186 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888676.1 protein_id gnl|my_center|LOCUS_05670 3258 3617 gene locus_tag LOCUS_05680 gene rplL 3258 3617 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888675.1 protein_id gnl|my_center|LOCUS_05680 3782 5173 gene locus_tag LOCUS_05690 3782 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5935 5513 gene locus_tag LOCUS_05700 5935 5513 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531183.1 protein_id gnl|my_center|LOCUS_05700 6349 6155 gene locus_tag LOCUS_05710 6349 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 7035 6349 gene locus_tag LOCUS_05720 7035 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7698 7165 gene locus_tag LOCUS_05730 7698 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 8271 7765 gene locus_tag LOCUS_05740 8271 7765 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888278.1 protein_id gnl|my_center|LOCUS_05740 9266 8289 gene locus_tag LOCUS_05750 9266 8289 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231290.1 protein_id gnl|my_center|LOCUS_05750 9377 10690 gene locus_tag LOCUS_05760 9377 10690 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889588.1 protein_id gnl|my_center|LOCUS_05760 10977 11900 gene locus_tag LOCUS_05770 10977 11900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 12788 11901 gene locus_tag LOCUS_05780 12788 11901 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_05780 15590 13008 gene locus_tag LOCUS_05790 15590 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16923 15796 gene locus_tag LOCUS_05800 gene wecB 16923 15796 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350154.1 protein_id gnl|my_center|LOCUS_05800 18032 16923 gene locus_tag LOCUS_05810 18032 16923 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888201.1 protein_id gnl|my_center|LOCUS_05810 18665 18042 gene locus_tag LOCUS_05820 gene upp 18665 18042 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479860.1 protein_id gnl|my_center|LOCUS_05820 19167 18832 gene locus_tag LOCUS_05830 19167 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 20009 19227 gene locus_tag LOCUS_05840 20009 19227 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888203.1 protein_id gnl|my_center|LOCUS_05840 21182 20139 gene locus_tag LOCUS_05850 21182 20139 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531254.1 protein_id gnl|my_center|LOCUS_05850 22982 21432 gene locus_tag LOCUS_05860 gene pruA 22982 21432 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887459.1 protein_id gnl|my_center|LOCUS_05860 24010 23072 gene locus_tag LOCUS_05870 24010 23072 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887460.1 protein_id gnl|my_center|LOCUS_05870 24729 24076 gene locus_tag LOCUS_05880 24729 24076 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618822.1 protein_id gnl|my_center|LOCUS_05880 25599 24928 gene locus_tag LOCUS_05890 gene nucS 25599 24928 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763467.1 protein_id gnl|my_center|LOCUS_05890 25896 25969 gene locus_tag LOCUS_t00070 25896 25969 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26070 26152 gene locus_tag LOCUS_t00080 26070 26152 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 26158 26244 gene locus_tag LOCUS_t00090 26158 26244 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26247 26322 gene locus_tag LOCUS_t00100 26247 26322 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 26403 27056 gene locus_tag LOCUS_05900 26403 27056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 28236 27112 gene locus_tag LOCUS_05910 28236 27112 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480170.1 protein_id gnl|my_center|LOCUS_05910 30091 28418 gene locus_tag LOCUS_05920 30091 28418 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886995.1 protein_id gnl|my_center|LOCUS_05920 31074 30232 gene locus_tag LOCUS_05930 31074 30232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 31251 31613 gene locus_tag LOCUS_05940 31251 31613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888253.1 protein_id gnl|my_center|LOCUS_05940 31610 31783 gene locus_tag LOCUS_05950 31610 31783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 31866 32795 gene locus_tag LOCUS_05960 gene ispH 31866 32795 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888795.1 protein_id gnl|my_center|LOCUS_05960 33654 33034 gene locus_tag LOCUS_05970 33654 33034 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887480.1 protein_id gnl|my_center|LOCUS_05970 34785 33901 gene locus_tag LOCUS_05980 34785 33901 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887479.1 protein_id gnl|my_center|LOCUS_05980 35193 34843 gene locus_tag LOCUS_05990 35193 34843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 36305 35505 gene locus_tag LOCUS_06000 36305 35505 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227694.1 protein_id gnl|my_center|LOCUS_06000 36459 37103 gene locus_tag LOCUS_06010 36459 37103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 37175 38479 gene locus_tag LOCUS_06020 gene purB 37175 38479 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888809.1 protein_id gnl|my_center|LOCUS_06020 38604 39020 gene locus_tag LOCUS_06030 38604 39020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 39230 40075 gene locus_tag LOCUS_06040 gene panC 39230 40075 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887807.1 protein_id gnl|my_center|LOCUS_06040 40072 41142 gene locus_tag LOCUS_06050 40072 41142 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887806.1 protein_id gnl|my_center|LOCUS_06050 41219 41752 gene locus_tag LOCUS_06060 gene greA 41219 41752 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887805.1 protein_id gnl|my_center|LOCUS_06060 41991 42479 gene locus_tag LOCUS_06070 41991 42479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 43282 42539 gene locus_tag LOCUS_06080 43282 42539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 44035 43307 gene locus_tag LOCUS_06090 44035 43307 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350071.1 protein_id gnl|my_center|LOCUS_06090 44224 44679 gene locus_tag LOCUS_06100 44224 44679 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102894.1 protein_id gnl|my_center|LOCUS_06100 44759 45061 gene locus_tag LOCUS_06110 44759 45061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 45435 45124 gene locus_tag LOCUS_06120 45435 45124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 47093 45540 gene locus_tag LOCUS_06130 47093 45540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 47602 47529 gene locus_tag LOCUS_t00110 47602 47529 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 47683 47603 gene locus_tag LOCUS_t00120 47683 47603 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 47756 47682 gene locus_tag LOCUS_t00130 47756 47682 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 48037 48528 gene locus_tag LOCUS_06140 48037 48528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 49467 48547 gene locus_tag LOCUS_06150 49467 48547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 50970 50020 gene locus_tag LOCUS_06160 50970 50020 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887615.1 protein_id gnl|my_center|LOCUS_06160 51728 50967 gene locus_tag LOCUS_06170 51728 50967 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887616.1 protein_id gnl|my_center|LOCUS_06170 53089 51953 gene locus_tag LOCUS_06180 53089 51953 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480016.1 protein_id gnl|my_center|LOCUS_06180 54343 53195 gene locus_tag LOCUS_06190 54343 53195 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887898.1 protein_id gnl|my_center|LOCUS_06190 54557 54802 gene locus_tag LOCUS_06200 54557 54802 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887989.1 protein_id gnl|my_center|LOCUS_06200 54941 56566 gene locus_tag LOCUS_06210 54941 56566 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479947.1 protein_id gnl|my_center|LOCUS_06210 56639 57352 gene locus_tag LOCUS_06220 56639 57352 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887538.1 protein_id gnl|my_center|LOCUS_06220 57690 59663 gene locus_tag LOCUS_06230 gene metG 57690 59663 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888072.1 protein_id gnl|my_center|LOCUS_06230 61240 59819 gene locus_tag LOCUS_06240 61240 59819 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_06240 61677 61751 gene locus_tag LOCUS_t00140 61677 61751 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 61952 61818 gene locus_tag LOCUS_06250 61952 61818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 62201 62677 gene locus_tag LOCUS_06260 62201 62677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 62825 63484 gene locus_tag LOCUS_06270 62825 63484 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582866.1 protein_id gnl|my_center|LOCUS_06270 63505 64152 gene locus_tag LOCUS_06280 63505 64152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 65039 64203 gene locus_tag LOCUS_06290 65039 64203 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887790.1 protein_id gnl|my_center|LOCUS_06290 65333 66121 gene locus_tag LOCUS_06300 gene proC 65333 66121 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888161.1 protein_id gnl|my_center|LOCUS_06300 66221 66445 gene locus_tag LOCUS_06310 66221 66445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 67077 66427 gene locus_tag LOCUS_06320 67077 66427 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887723.1 protein_id gnl|my_center|LOCUS_06320 68227 67157 gene locus_tag LOCUS_06330 68227 67157 CDS product RIP metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888146.1 protein_id gnl|my_center|LOCUS_06330 69369 68218 gene locus_tag LOCUS_06340 gene dxr 69369 68218 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888147.1 protein_id gnl|my_center|LOCUS_06340 70420 69545 gene locus_tag LOCUS_06350 70420 69545 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480221.1 protein_id gnl|my_center|LOCUS_06350 71053 70508 gene locus_tag LOCUS_06360 gene frr 71053 70508 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888149.1 protein_id gnl|my_center|LOCUS_06360 71388 72293 gene locus_tag LOCUS_06370 gene holA 71388 72293 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887887.1 protein_id gnl|my_center|LOCUS_06370 72828 72280 gene locus_tag LOCUS_06380 72828 72280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 73037 72831 gene locus_tag LOCUS_06390 73037 72831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 74804 73176 gene locus_tag LOCUS_06400 74804 73176 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888212.1 protein_id gnl|my_center|LOCUS_06400 74803 74973 gene locus_tag LOCUS_06410 74803 74973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 75742 75059 gene locus_tag LOCUS_06420 75742 75059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 76742 76164 gene locus_tag LOCUS_06430 gene lepB 76742 76164 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887963.1 protein_id gnl|my_center|LOCUS_06430 76838 77431 gene locus_tag LOCUS_06440 gene ruvA 76838 77431 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887917.1 protein_id gnl|my_center|LOCUS_06440 77758 78924 gene locus_tag LOCUS_06450 77758 78924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 79092 79772 gene locus_tag LOCUS_06460 79092 79772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 81362 79836 gene locus_tag LOCUS_06470 gene lysS 81362 79836 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887017.1 protein_id gnl|my_center|LOCUS_06470 82221 81514 gene locus_tag LOCUS_06480 82221 81514 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177613.1 protein_id gnl|my_center|LOCUS_06480 83989 82235 gene locus_tag LOCUS_06490 gene sdhA 83989 82235 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887597.1 protein_id gnl|my_center|LOCUS_06490 84391 83999 gene locus_tag LOCUS_06500 84391 83999 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887598.1 protein_id gnl|my_center|LOCUS_06500 84770 84396 gene locus_tag LOCUS_06510 gene sdhC 84770 84396 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887599.1 protein_id gnl|my_center|LOCUS_06510 85076 85516 gene locus_tag LOCUS_06520 gene speD 85076 85516 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014510642.1 protein_id gnl|my_center|LOCUS_06520 87613 85628 gene locus_tag LOCUS_06530 87613 85628 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886706.1 protein_id gnl|my_center|LOCUS_06530 88662 87679 gene locus_tag LOCUS_06540 gene hemB 88662 87679 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_06540 88576 88881 gene locus_tag LOCUS_06550 88576 88881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 89599 88883 gene locus_tag LOCUS_06560 gene pyrH 89599 88883 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480220.1 protein_id gnl|my_center|LOCUS_06560 90481 89672 gene locus_tag LOCUS_06570 gene tsf 90481 89672 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888151.1 protein_id gnl|my_center|LOCUS_06570 91418 90651 gene locus_tag LOCUS_06580 gene rpsB 91418 90651 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888152.1 protein_id gnl|my_center|LOCUS_06580 91703 92476 gene locus_tag LOCUS_06590 91703 92476 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 protein_id gnl|my_center|LOCUS_06590 93451 92606 gene locus_tag LOCUS_06600 93451 92606 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027867.1 protein_id gnl|my_center|LOCUS_06600 93552 94991 gene locus_tag LOCUS_06610 93552 94991 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_06610 95909 95085 gene locus_tag LOCUS_06620 95909 95085 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029656.1 protein_id gnl|my_center|LOCUS_06620 96288 96073 gene locus_tag LOCUS_06630 96288 96073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 96187 96948 gene locus_tag LOCUS_06640 96187 96948 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704781.1 protein_id gnl|my_center|LOCUS_06640 96927 97709 gene locus_tag LOCUS_06650 96927 97709 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969126.1 protein_id gnl|my_center|LOCUS_06650 97718 98779 gene locus_tag LOCUS_06660 97718 98779 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123141.1 protein_id gnl|my_center|LOCUS_06660 98820 99770 gene locus_tag LOCUS_06670 98820 99770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480038.1 protein_id gnl|my_center|LOCUS_06670 101326 99854 gene locus_tag LOCUS_06680 101326 99854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 101939 101523 gene locus_tag LOCUS_06690 101939 101523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 102306 102866 gene locus_tag LOCUS_06700 gene efp 102306 102866 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886767.1 protein_id gnl|my_center|LOCUS_06700 102866 103384 gene locus_tag LOCUS_06710 102866 103384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 103462 104808 gene locus_tag LOCUS_06720 gene accC 103462 104808 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886765.1 protein_id gnl|my_center|LOCUS_06720 105291 104848 gene locus_tag LOCUS_06730 105291 104848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 105806 105288 gene locus_tag LOCUS_06740 105806 105288 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083846.1 protein_id gnl|my_center|LOCUS_06740 105925 106344 gene locus_tag LOCUS_06750 105925 106344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 106328 107326 gene locus_tag LOCUS_06760 106328 107326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 107419 108036 gene locus_tag LOCUS_06770 107419 108036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 108033 108620 gene locus_tag LOCUS_06780 gene coaE 108033 108620 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888527.1 protein_id gnl|my_center|LOCUS_06780 109047 108691 gene locus_tag LOCUS_06790 109047 108691 CDS product DUF3208 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888787.1 protein_id gnl|my_center|LOCUS_06790 109628 109032 gene locus_tag LOCUS_06800 109628 109032 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887473.1 protein_id gnl|my_center|LOCUS_06800 110313 109675 gene locus_tag LOCUS_06810 110313 109675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 110345 111388 gene locus_tag LOCUS_06820 110345 111388 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887472.1 protein_id gnl|my_center|LOCUS_06820 112300 111542 gene locus_tag LOCUS_06830 112300 111542 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763460.1 protein_id gnl|my_center|LOCUS_06830 113127 112297 gene locus_tag LOCUS_06840 113127 112297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 113645 113124 gene locus_tag LOCUS_06850 113645 113124 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479952.1 protein_id gnl|my_center|LOCUS_06850 114002 113649 gene locus_tag LOCUS_06860 114002 113649 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228981.1 protein_id gnl|my_center|LOCUS_06860 114249 114506 gene locus_tag LOCUS_06870 gene pprM 114249 114506 CDS product DNA damage response modulator PprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869024.1 protein_id gnl|my_center|LOCUS_06870 115930 114662 gene locus_tag LOCUS_06880 115930 114662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 116890 116246 gene locus_tag LOCUS_06890 116890 116246 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_06890 117272 116946 gene locus_tag LOCUS_06900 117272 116946 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_06900 117798 117265 gene locus_tag LOCUS_06910 117798 117265 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437759.1 protein_id gnl|my_center|LOCUS_06910 118233 117835 gene locus_tag LOCUS_06920 118233 117835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 118301 118660 gene locus_tag LOCUS_06930 118301 118660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 119203 118646 gene locus_tag LOCUS_06940 119203 118646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 120456 119347 gene locus_tag LOCUS_06950 120456 119347 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350047.1 protein_id gnl|my_center|LOCUS_06950 120748 121161 gene locus_tag LOCUS_06960 120748 121161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 121241 122233 gene locus_tag LOCUS_06970 121241 122233 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887921.1 protein_id gnl|my_center|LOCUS_06970 123136 122399 gene locus_tag LOCUS_06980 123136 122399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 123293 124255 gene locus_tag LOCUS_06990 123293 124255 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228837.1 protein_id gnl|my_center|LOCUS_06990 124728 125975 gene locus_tag LOCUS_07000 gene gdhA 124728 125975 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_07000 125972 127249 gene locus_tag LOCUS_07010 125972 127249 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228779.1 protein_id gnl|my_center|LOCUS_07010 127953 128102 gene locus_tag LOCUS_07020 127953 128102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 128359 128643 gene locus_tag LOCUS_07030 128359 128643 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704671.1 protein_id gnl|my_center|LOCUS_07030 128654 129076 gene locus_tag LOCUS_07040 128654 129076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 129467 129997 gene locus_tag LOCUS_07050 129467 129997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 130304 130077 gene locus_tag LOCUS_07060 130304 130077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 130672 130301 gene locus_tag LOCUS_07070 130672 130301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 134825 130800 gene locus_tag LOCUS_07080 134825 130800 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_07080 137654 134838 gene locus_tag LOCUS_07090 137654 134838 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_07090 142845 137665 gene locus_tag LOCUS_07100 142845 137665 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_07100 143042 144460 gene locus_tag LOCUS_07110 143042 144460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 144457 146871 gene locus_tag LOCUS_07120 144457 146871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 147324 146944 gene locus_tag LOCUS_07130 147324 146944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 147792 149984 gene locus_tag LOCUS_07140 147792 149984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 150027 150290 gene locus_tag LOCUS_07150 150027 150290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 150425 150727 gene locus_tag LOCUS_07160 150425 150727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 150802 151344 gene locus_tag LOCUS_07170 150802 151344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 152057 151341 gene locus_tag LOCUS_07180 152057 151341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 153010 152108 gene locus_tag LOCUS_07190 153010 152108 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228747.1 protein_id gnl|my_center|LOCUS_07190 153251 153175 gene locus_tag LOCUS_t00150 153251 153175 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 153824 153330 gene locus_tag LOCUS_07200 153824 153330 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_07200 153912 154475 gene locus_tag LOCUS_07210 153912 154475 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_07210 154476 154688 gene locus_tag LOCUS_07220 154476 154688 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479953.1 protein_id gnl|my_center|LOCUS_07220 154685 154933 gene locus_tag LOCUS_07230 154685 154933 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888716.1 protein_id gnl|my_center|LOCUS_07230 155006 155455 gene locus_tag LOCUS_07240 155006 155455 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704946.1 protein_id gnl|my_center|LOCUS_07240 155448 155954 gene locus_tag LOCUS_07250 155448 155954 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082252685.1 protein_id gnl|my_center|LOCUS_07250 156144 156464 gene locus_tag LOCUS_07260 156144 156464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 156739 158685 gene locus_tag LOCUS_07270 gene thrS 156739 158685 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888712.1 protein_id gnl|my_center|LOCUS_07270 158871 159566 gene locus_tag LOCUS_07280 158871 159566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 159990 159553 gene locus_tag LOCUS_07290 159990 159553 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480232.1 protein_id gnl|my_center|LOCUS_07290 160428 160027 gene locus_tag LOCUS_07300 160428 160027 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_07300 160561 161073 gene locus_tag LOCUS_07310 160561 161073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 161863 161126 gene locus_tag LOCUS_07320 161863 161126 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_07320 161917 162087 gene locus_tag LOCUS_07330 161917 162087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 163173 162118 gene locus_tag LOCUS_07340 gene leuB 163173 162118 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888420.1 protein_id gnl|my_center|LOCUS_07340 163714 163229 gene locus_tag LOCUS_07350 163714 163229 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888419.1 protein_id gnl|my_center|LOCUS_07350 165079 163793 gene locus_tag LOCUS_07360 165079 163793 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888413.1 protein_id gnl|my_center|LOCUS_07360 166193 165417 gene locus_tag LOCUS_07370 166193 165417 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886940.1 protein_id gnl|my_center|LOCUS_07370 166452 166919 gene locus_tag LOCUS_07380 166452 166919 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339211.1 protein_id gnl|my_center|LOCUS_07380 167510 166965 gene locus_tag LOCUS_07390 167510 166965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 168619 167507 gene locus_tag LOCUS_07400 gene alr 168619 167507 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479629.1 protein_id gnl|my_center|LOCUS_07400 169134 169826 gene locus_tag LOCUS_07410 169134 169826 CDS product DUF4397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257289.1 protein_id gnl|my_center|LOCUS_07410 169921 171330 gene locus_tag LOCUS_07420 169921 171330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 171468 172082 gene locus_tag LOCUS_07430 171468 172082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 172553 172095 gene locus_tag LOCUS_07440 172553 172095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 173309 172635 gene locus_tag LOCUS_07450 173309 172635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887118.1 protein_id gnl|my_center|LOCUS_07450 174471 173311 gene locus_tag LOCUS_07460 174471 173311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887119.1 protein_id gnl|my_center|LOCUS_07460 175237 174515 gene locus_tag LOCUS_07470 175237 174515 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 protein_id gnl|my_center|LOCUS_07470 176185 175250 gene locus_tag LOCUS_07480 176185 175250 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704761.1 protein_id gnl|my_center|LOCUS_07480 176381 177568 gene locus_tag LOCUS_07490 176381 177568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 177696 179432 gene locus_tag LOCUS_07500 177696 179432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 179502 180011 gene locus_tag LOCUS_07510 179502 180011 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970935.1 protein_id gnl|my_center|LOCUS_07510 180538 180086 gene locus_tag LOCUS_07520 180538 180086 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928568.1 protein_id gnl|my_center|LOCUS_07520 181256 180714 gene locus_tag LOCUS_07530 gene msrA 181256 180714 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421586.1 protein_id gnl|my_center|LOCUS_07530 181411 182070 gene locus_tag LOCUS_07540 181411 182070 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_07540 182160 183275 gene locus_tag LOCUS_07550 182160 183275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 183429 184730 gene locus_tag LOCUS_07560 gene aroA 183429 184730 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_07560 186184 184784 gene locus_tag LOCUS_07570 186184 184784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 186424 187281 gene locus_tag LOCUS_07580 186424 187281 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_07580 187320 187520 gene locus_tag LOCUS_07590 187320 187520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943033.1 protein_id gnl|my_center|LOCUS_07590 187966 188424 gene locus_tag LOCUS_07600 187966 188424 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227752.1 protein_id gnl|my_center|LOCUS_07600 188474 189772 gene locus_tag LOCUS_07610 188474 189772 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083010.1 protein_id gnl|my_center|LOCUS_07610 189769 190830 gene locus_tag LOCUS_07620 gene proB 189769 190830 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_07620 191105 191581 gene locus_tag LOCUS_07630 191105 191581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256450.1 protein_id gnl|my_center|LOCUS_07630 191596 192045 gene locus_tag LOCUS_07640 191596 192045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 192295 192777 gene locus_tag LOCUS_07650 192295 192777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256450.1 protein_id gnl|my_center|LOCUS_07650 193290 192811 gene locus_tag LOCUS_07660 193290 192811 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 protein_id gnl|my_center|LOCUS_07660 193929 193405 gene locus_tag LOCUS_07670 193929 193405 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479526.1 protein_id gnl|my_center|LOCUS_07670 194410 194144 gene locus_tag LOCUS_07680 194410 194144 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480068.1 protein_id gnl|my_center|LOCUS_07680 194728 195402 gene locus_tag LOCUS_07690 194728 195402 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_07690 195595 197652 gene locus_tag LOCUS_07700 195595 197652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 197713 198537 gene locus_tag LOCUS_07710 197713 198537 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887654.1 protein_id gnl|my_center|LOCUS_07710 199289 198669 gene locus_tag LOCUS_07720 gene mqnB 199289 198669 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328020.1 protein_id gnl|my_center|LOCUS_07720 200319 199291 gene locus_tag LOCUS_07730 200319 199291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 200990 200424 gene locus_tag LOCUS_07740 gene pyrE 200990 200424 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887092.1 protein_id gnl|my_center|LOCUS_07740 201163 202095 gene locus_tag LOCUS_07750 201163 202095 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888038.1 protein_id gnl|my_center|LOCUS_07750 202092 203159 gene locus_tag LOCUS_07760 202092 203159 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479720.1 protein_id gnl|my_center|LOCUS_07760 203234 203467 gene locus_tag LOCUS_07770 203234 203467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 203873 204568 gene locus_tag LOCUS_07780 203873 204568 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480290.1 protein_id gnl|my_center|LOCUS_07780 205123 204845 gene locus_tag LOCUS_07790 205123 204845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 205514 205125 gene locus_tag LOCUS_07800 205514 205125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888245.1 protein_id gnl|my_center|LOCUS_07800 206059 205535 gene locus_tag LOCUS_07810 206059 205535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 206655 206059 gene locus_tag LOCUS_07820 206655 206059 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_07820 207161 206652 gene locus_tag LOCUS_07830 207161 206652 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888246.1 protein_id gnl|my_center|LOCUS_07830 207300 207830 gene locus_tag LOCUS_07840 207300 207830 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_07840 207912 208172 gene locus_tag LOCUS_07850 207912 208172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 209897 208257 gene locus_tag LOCUS_07860 gene pgm 209897 208257 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480279.1 protein_id gnl|my_center|LOCUS_07860 210203 210015 gene locus_tag LOCUS_07870 210203 210015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 210550 210287 gene locus_tag LOCUS_07880 210550 210287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 211483 210791 gene locus_tag LOCUS_07890 211483 210791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 211749 211480 gene locus_tag LOCUS_07900 211749 211480 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_07900 212724 211783 gene locus_tag LOCUS_07910 212724 211783 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_07910 213177 212851 gene locus_tag LOCUS_07920 213177 212851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 213868 213308 gene locus_tag LOCUS_07930 213868 213308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 215029 214271 gene locus_tag LOCUS_07940 215029 214271 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_07940 215182 215481 gene locus_tag LOCUS_07950 215182 215481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 215481 216479 gene locus_tag LOCUS_07960 215481 216479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 217347 216466 gene locus_tag LOCUS_07970 217347 216466 CDS product STM4011 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681897.1 protein_id gnl|my_center|LOCUS_07970 217880 217344 gene locus_tag LOCUS_07980 217880 217344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 219206 217884 gene locus_tag LOCUS_07990 219206 217884 CDS product STM4012 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202627.1 protein_id gnl|my_center|LOCUS_07990 219991 219203 gene locus_tag LOCUS_08000 219991 219203 CDS product STM4013/SEN3800 family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202626.1 protein_id gnl|my_center|LOCUS_08000 221127 219985 gene locus_tag LOCUS_08010 221127 219985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 222049 221132 gene locus_tag LOCUS_08020 222049 221132 CDS product STM4015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992754.1 protein_id gnl|my_center|LOCUS_08020 222684 222100 gene locus_tag LOCUS_08030 222684 222100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 223187 222735 gene locus_tag LOCUS_08040 223187 222735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 224130 223276 gene locus_tag LOCUS_08050 224130 223276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 225154 224114 gene locus_tag LOCUS_08060 gene recF 225154 224114 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887732.1 protein_id gnl|my_center|LOCUS_08060 225355 225696 gene locus_tag LOCUS_08070 225355 225696 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618815.1 protein_id gnl|my_center|LOCUS_08070 225680 226729 gene locus_tag LOCUS_08080 225680 226729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 227488 226823 gene locus_tag LOCUS_08090 227488 226823 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888112.1 protein_id gnl|my_center|LOCUS_08090 227926 228966 gene locus_tag LOCUS_08100 227926 228966 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886907.1 protein_id gnl|my_center|LOCUS_08100 228975 230537 gene locus_tag LOCUS_08110 228975 230537 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889113.1 protein_id gnl|my_center|LOCUS_08110 230512 231456 gene locus_tag LOCUS_08120 230512 231456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886710.1 protein_id gnl|my_center|LOCUS_08120 231453 232085 gene locus_tag LOCUS_08130 231453 232085 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_08130 232612 232133 gene locus_tag LOCUS_08140 232612 232133 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888603.1 protein_id gnl|my_center|LOCUS_08140 233322 232903 gene locus_tag LOCUS_08150 233322 232903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 233461 234150 gene locus_tag LOCUS_08160 gene recO 233461 234150 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887465.1 protein_id gnl|my_center|LOCUS_08160 234836 234159 gene locus_tag LOCUS_08170 234836 234159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 236194 234848 gene locus_tag LOCUS_08180 236194 234848 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617985.1 protein_id gnl|my_center|LOCUS_08180 237038 236205 gene locus_tag LOCUS_08190 237038 236205 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479973.1 protein_id gnl|my_center|LOCUS_08190 237171 237404 gene locus_tag LOCUS_08200 237171 237404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 238903 237452 gene locus_tag LOCUS_08210 gene gatA 238903 237452 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888491.1 protein_id gnl|my_center|LOCUS_08210 239154 239843 gene locus_tag LOCUS_08220 239154 239843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 240368 239856 gene locus_tag LOCUS_08230 gene scpB 240368 239856 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888496.1 protein_id gnl|my_center|LOCUS_08230 240903 240361 gene locus_tag LOCUS_08240 240903 240361 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172885.1 protein_id gnl|my_center|LOCUS_08240 240969 242186 gene locus_tag LOCUS_08250 240969 242186 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_08250 244039 242243 gene locus_tag LOCUS_08260 244039 242243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 244746 244081 gene locus_tag LOCUS_08270 gene pxpB 244746 244081 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_08270 245844 244747 gene locus_tag LOCUS_08280 245844 244747 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888696.1 protein_id gnl|my_center|LOCUS_08280 245949 246899 gene locus_tag LOCUS_08290 gene cysK 245949 246899 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887435.1 protein_id gnl|my_center|LOCUS_08290 247228 248007 gene locus_tag LOCUS_08300 247228 248007 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350459.1 protein_id gnl|my_center|LOCUS_08300 248043 248354 gene locus_tag LOCUS_08310 248043 248354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 248347 249021 gene locus_tag LOCUS_08320 248347 249021 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888088.1 protein_id gnl|my_center|LOCUS_08320 250026 249025 gene locus_tag LOCUS_08330 250026 249025 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705456.1 protein_id gnl|my_center|LOCUS_08330 252033 250102 gene locus_tag LOCUS_08340 252033 250102 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728405.1 protein_id gnl|my_center|LOCUS_08340 252244 253803 gene locus_tag LOCUS_08350 252244 253803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 253894 254241 gene locus_tag LOCUS_08360 253894 254241 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103310811.1 protein_id gnl|my_center|LOCUS_08360 257276 254394 gene locus_tag LOCUS_08370 gene gcvP 257276 254394 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888444.1 protein_id gnl|my_center|LOCUS_08370 257968 257450 gene locus_tag LOCUS_08380 257968 257450 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427918.1 protein_id gnl|my_center|LOCUS_08380 259145 257970 gene locus_tag LOCUS_08390 259145 257970 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_08390 261668 259404 gene locus_tag LOCUS_08400 gene clpA 261668 259404 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383724.1 protein_id gnl|my_center|LOCUS_08400 261955 261665 gene locus_tag LOCUS_08410 gene clpS 261955 261665 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 protein_id gnl|my_center|LOCUS_08410 262330 263967 gene locus_tag LOCUS_08420 262330 263967 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888181.1 protein_id gnl|my_center|LOCUS_08420 264047 264496 gene locus_tag LOCUS_08430 264047 264496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 265746 264562 gene locus_tag LOCUS_08440 265746 264562 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006095218.1 protein_id gnl|my_center|LOCUS_08440 266261 267199 gene locus_tag LOCUS_08450 266261 267199 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990036.1 protein_id gnl|my_center|LOCUS_08450 267283 268530 gene locus_tag LOCUS_08460 267283 268530 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964080.1 protein_id gnl|my_center|LOCUS_08460 268893 268537 gene locus_tag LOCUS_08470 268893 268537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 269130 269441 gene locus_tag LOCUS_08480 269130 269441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 269614 269688 gene locus_tag LOCUS_t00160 269614 269688 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 270360 270112 gene locus_tag LOCUS_08490 270360 270112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 270551 270476 gene locus_tag LOCUS_t00170 270551 270476 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 270631 270556 gene locus_tag LOCUS_t00180 270631 270556 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 271534 270770 gene locus_tag LOCUS_08500 271534 270770 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886690.1 protein_id gnl|my_center|LOCUS_08500 272030 271527 gene locus_tag LOCUS_08510 272030 271527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 273282 272137 gene locus_tag LOCUS_08520 273282 272137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 274679 273279 gene locus_tag LOCUS_08530 274679 273279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 276717 274909 gene locus_tag LOCUS_08540 276717 274909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 276984 277853 gene locus_tag LOCUS_08550 276984 277853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 protein_id gnl|my_center|LOCUS_08550 277882 278634 gene locus_tag LOCUS_08560 277882 278634 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889268.1 protein_id gnl|my_center|LOCUS_08560 278705 279835 gene locus_tag LOCUS_08570 278705 279835 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889269.1 protein_id gnl|my_center|LOCUS_08570 279832 280434 gene locus_tag LOCUS_08580 279832 280434 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889270.1 protein_id gnl|my_center|LOCUS_08580 281030 280656 gene locus_tag LOCUS_08590 281030 280656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 281599 281030 gene locus_tag LOCUS_08600 281599 281030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 282301 281675 gene locus_tag LOCUS_08610 282301 281675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 282523 283080 gene locus_tag LOCUS_08620 282523 283080 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889227.1 protein_id gnl|my_center|LOCUS_08620 283065 283745 gene locus_tag LOCUS_08630 gene ispD 283065 283745 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889228.1 protein_id gnl|my_center|LOCUS_08630 283742 284581 gene locus_tag LOCUS_08640 283742 284581 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889229.1 protein_id gnl|my_center|LOCUS_08640 285152 284583 gene locus_tag LOCUS_08650 285152 284583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 285402 285157 gene locus_tag LOCUS_08660 285402 285157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 285289 285945 gene locus_tag LOCUS_08670 285289 285945 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480641.1 protein_id gnl|my_center|LOCUS_08670 287217 286048 gene locus_tag LOCUS_08680 287217 286048 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479853.1 protein_id gnl|my_center|LOCUS_08680 287436 288218 gene locus_tag LOCUS_08690 287436 288218 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_08690 288211 289092 gene locus_tag LOCUS_08700 288211 289092 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173573.1 protein_id gnl|my_center|LOCUS_08700 289203 290858 gene locus_tag LOCUS_08710 289203 290858 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889293.1 protein_id gnl|my_center|LOCUS_08710 290920 291414 gene locus_tag LOCUS_08720 290920 291414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 291582 292139 gene locus_tag LOCUS_08730 291582 292139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 292132 293445 gene locus_tag LOCUS_08740 292132 293445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 295205 293379 gene locus_tag LOCUS_08750 295205 293379 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 protein_id gnl|my_center|LOCUS_08750 296421 295246 gene locus_tag LOCUS_08760 296421 295246 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_08760 297048 296434 gene locus_tag LOCUS_08770 297048 296434 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_08770 297650 297045 gene locus_tag LOCUS_08780 297650 297045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08780 298693 297647 gene locus_tag LOCUS_08790 298693 297647 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061500.1 protein_id gnl|my_center|LOCUS_08790 299759 298749 gene locus_tag LOCUS_08800 299759 298749 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_08800 301040 299763 gene locus_tag LOCUS_08810 301040 299763 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_08810 302113 301040 gene locus_tag LOCUS_08820 302113 301040 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073063.1 protein_id gnl|my_center|LOCUS_08820 303006 302116 gene locus_tag LOCUS_08830 303006 302116 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_08830 304432 302999 gene locus_tag LOCUS_08840 304432 302999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 305791 304433 gene locus_tag LOCUS_08850 305791 304433 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_08850 307446 306082 gene locus_tag LOCUS_08860 307446 306082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 308593 307631 gene locus_tag LOCUS_08870 308593 307631 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256995.1 protein_id gnl|my_center|LOCUS_08870 309495 308590 gene locus_tag LOCUS_08880 309495 308590 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_08880 310890 309628 gene locus_tag LOCUS_08890 310890 309628 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080852.1 protein_id gnl|my_center|LOCUS_08890 311452 311078 gene locus_tag LOCUS_08900 311452 311078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 311333 312817 gene locus_tag LOCUS_08910 311333 312817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 314632 312884 gene locus_tag LOCUS_08920 314632 312884 CDS product copper amine oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177726.1 protein_id gnl|my_center|LOCUS_08920 316818 314668 gene locus_tag LOCUS_08930 316818 314668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888899.1 protein_id gnl|my_center|LOCUS_08930 317363 316815 gene locus_tag LOCUS_08940 317363 316815 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888898.1 protein_id gnl|my_center|LOCUS_08940 317482 320031 gene locus_tag LOCUS_08950 317482 320031 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 protein_id gnl|my_center|LOCUS_08950 320061 320258 gene locus_tag LOCUS_08960 320061 320258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 320265 320966 gene locus_tag LOCUS_08970 320265 320966 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888897.1 protein_id gnl|my_center|LOCUS_08970 321144 321698 gene locus_tag LOCUS_08980 321144 321698 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081580.1 protein_id gnl|my_center|LOCUS_08980 321822 322103 gene locus_tag LOCUS_08990 321822 322103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 323269 322193 gene locus_tag LOCUS_09000 323269 322193 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_09000 323939 323304 gene locus_tag LOCUS_09010 323939 323304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 326262 324052 gene locus_tag LOCUS_09020 326262 324052 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_09020 327778 326522 gene locus_tag LOCUS_09030 327778 326522 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888648.1 protein_id gnl|my_center|LOCUS_09030 328746 327886 gene locus_tag LOCUS_09040 328746 327886 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_09040 329033 330433 gene locus_tag LOCUS_09050 gene trpE 329033 330433 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888426.1 protein_id gnl|my_center|LOCUS_09050 330437 330823 gene locus_tag LOCUS_09060 330437 330823 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_09060 330826 331416 gene locus_tag LOCUS_09070 330826 331416 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926075.1 protein_id gnl|my_center|LOCUS_09070 331571 332569 gene locus_tag LOCUS_09080 gene trpD 331571 332569 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480347.1 protein_id gnl|my_center|LOCUS_09080 333557 332910 gene locus_tag LOCUS_09090 333557 332910 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888515.1 protein_id gnl|my_center|LOCUS_09090 334736 333669 gene locus_tag LOCUS_09100 334736 333669 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942021.1 protein_id gnl|my_center|LOCUS_09100 336457 334994 gene locus_tag LOCUS_09110 gene guaB 336457 334994 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888513.1 protein_id gnl|my_center|LOCUS_09110 337542 336763 gene locus_tag LOCUS_09120 gene rfbD 337542 336763 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946494.1 protein_id gnl|my_center|LOCUS_09120 338512 337553 gene locus_tag LOCUS_09130 338512 337553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 339824 338685 gene locus_tag LOCUS_09140 339824 338685 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887595.1 protein_id gnl|my_center|LOCUS_09140 341019 339982 gene locus_tag LOCUS_09150 341019 339982 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869626.1 protein_id gnl|my_center|LOCUS_09150 342874 341282 gene locus_tag LOCUS_09160 342874 341282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 343555 342977 gene locus_tag LOCUS_09170 343555 342977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 346416 343783 gene locus_tag LOCUS_09180 346416 343783 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886794.1 protein_id gnl|my_center|LOCUS_09180 346480 346710 gene locus_tag LOCUS_09190 346480 346710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 347298 346906 gene locus_tag LOCUS_09200 347298 346906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 348072 347302 gene locus_tag LOCUS_09210 gene yjjG 348072 347302 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095482.1 protein_id gnl|my_center|LOCUS_09210 348157 348333 gene locus_tag LOCUS_09220 348157 348333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 348508 349056 gene locus_tag LOCUS_09230 gene tsaB 348508 349056 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887402.1 protein_id gnl|my_center|LOCUS_09230 350121 349141 gene locus_tag LOCUS_09240 350121 349141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 351620 350316 gene locus_tag LOCUS_09250 351620 350316 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_09250 352093 351791 gene locus_tag LOCUS_09260 352093 351791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 353148 352093 gene locus_tag LOCUS_09270 353148 352093 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887007.1 protein_id gnl|my_center|LOCUS_09270 353435 355144 gene locus_tag LOCUS_09280 353435 355144 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_09280 355389 356411 gene locus_tag LOCUS_09290 355389 356411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887009.1 protein_id gnl|my_center|LOCUS_09290 356408 357283 gene locus_tag LOCUS_09300 356408 357283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_09300 357529 357693 gene locus_tag LOCUS_09310 357529 357693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 359979 357829 gene locus_tag LOCUS_09320 359979 357829 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480377.1 protein_id gnl|my_center|LOCUS_09320 360445 360657 gene locus_tag LOCUS_09330 360445 360657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 362266 360614 gene locus_tag LOCUS_09340 gene rny 362266 360614 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889087.1 protein_id gnl|my_center|LOCUS_09340 363527 362484 gene locus_tag LOCUS_09350 gene recA 363527 362484 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888966.1 protein_id gnl|my_center|LOCUS_09350 364109 363588 gene locus_tag LOCUS_09360 364109 363588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 365299 364106 gene locus_tag LOCUS_09370 365299 364106 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888964.1 protein_id gnl|my_center|LOCUS_09370 365376 366014 gene locus_tag LOCUS_09380 365376 366014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 366180 367445 gene locus_tag LOCUS_09390 366180 367445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 367520 368167 gene locus_tag LOCUS_09400 367520 368167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205180329.1 protein_id gnl|my_center|LOCUS_09400 368230 369225 gene locus_tag LOCUS_09410 368230 369225 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618830.1 protein_id gnl|my_center|LOCUS_09410 370207 369314 gene locus_tag LOCUS_09420 370207 369314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 370437 370216 gene locus_tag LOCUS_09430 370437 370216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 371077 370607 gene locus_tag LOCUS_09440 371077 370607 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479688.1 protein_id gnl|my_center|LOCUS_09440 371577 371080 gene locus_tag LOCUS_09450 371577 371080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 372078 371584 gene locus_tag LOCUS_09460 372078 371584 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_09460 372341 372165 gene locus_tag LOCUS_09470 372341 372165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 372729 372373 gene locus_tag LOCUS_09480 372729 372373 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480250.1 protein_id gnl|my_center|LOCUS_09480 373322 372765 gene locus_tag LOCUS_09490 373322 372765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 374111 373335 gene locus_tag LOCUS_09500 374111 373335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 374325 374855 gene locus_tag LOCUS_09510 374325 374855 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480058.1 protein_id gnl|my_center|LOCUS_09510 375149 374868 gene locus_tag LOCUS_09520 375149 374868 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480331.1 protein_id gnl|my_center|LOCUS_09520 376153 375167 gene locus_tag LOCUS_09530 376153 375167 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888962.1 protein_id gnl|my_center|LOCUS_09530 377001 376210 gene locus_tag LOCUS_09540 gene kynA 377001 376210 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661957.1 protein_id gnl|my_center|LOCUS_09540 377529 377317 gene locus_tag LOCUS_09550 377529 377317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 377431 378699 gene locus_tag LOCUS_09560 377431 378699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 378800 379237 gene locus_tag LOCUS_09570 378800 379237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 379289 379744 gene locus_tag LOCUS_09580 379289 379744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 382706 379782 gene locus_tag LOCUS_09590 382706 379782 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480204.1 protein_id gnl|my_center|LOCUS_09590 383615 382935 gene locus_tag LOCUS_09600 383615 382935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_09600 383854 385563 gene locus_tag LOCUS_09610 gene pabB 383854 385563 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 protein_id gnl|my_center|LOCUS_09610 385551 386135 gene locus_tag LOCUS_09620 385551 386135 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186792.1 protein_id gnl|my_center|LOCUS_09620 386337 387062 gene locus_tag LOCUS_09630 386337 387062 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228076.1 protein_id gnl|my_center|LOCUS_09630 388893 387031 gene locus_tag LOCUS_09640 388893 387031 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350387.1 protein_id gnl|my_center|LOCUS_09640 390465 389077 gene locus_tag LOCUS_09650 390465 389077 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887208.1 protein_id gnl|my_center|LOCUS_09650 391847 390462 gene locus_tag LOCUS_09660 391847 390462 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887207.1 protein_id gnl|my_center|LOCUS_09660 393109 391910 gene locus_tag LOCUS_09670 393109 391910 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887206.1 protein_id gnl|my_center|LOCUS_09670 393460 394671 gene locus_tag LOCUS_09680 393460 394671 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 protein_id gnl|my_center|LOCUS_09680 395563 395249 gene locus_tag LOCUS_09690 395563 395249 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479928.1 protein_id gnl|my_center|LOCUS_09690 395891 395565 gene locus_tag LOCUS_09700 395891 395565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 395938 396336 gene locus_tag LOCUS_09710 395938 396336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 396455 397345 gene locus_tag LOCUS_09720 396455 397345 CDS product DUF2167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035601.1 protein_id gnl|my_center|LOCUS_09720 397458 398435 gene locus_tag LOCUS_09730 gene ruvB 397458 398435 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887241.1 protein_id gnl|my_center|LOCUS_09730 398649 400427 gene locus_tag LOCUS_09740 gene dnaG 398649 400427 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887246.1 protein_id gnl|my_center|LOCUS_09740 400510 401901 gene locus_tag LOCUS_09750 400510 401901 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_09750 403476 401956 gene locus_tag LOCUS_09760 gene hutH 403476 401956 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_09760 404678 403473 gene locus_tag LOCUS_09770 gene hutI 404678 403473 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889408.1 protein_id gnl|my_center|LOCUS_09770 405583 404675 gene locus_tag LOCUS_09780 405583 404675 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889409.1 protein_id gnl|my_center|LOCUS_09780 407242 405593 gene locus_tag LOCUS_09790 gene hutU 407242 405593 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889411.1 protein_id gnl|my_center|LOCUS_09790 407316 408092 gene locus_tag LOCUS_09800 407316 408092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 408096 408806 gene locus_tag LOCUS_09810 408096 408806 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887860.1 protein_id gnl|my_center|LOCUS_09810 408905 409333 gene locus_tag LOCUS_09820 408905 409333 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_09820 412499 409542 gene locus_tag LOCUS_09830 412499 409542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 413289 412771 gene locus_tag LOCUS_09840 413289 412771 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479588.1 protein_id gnl|my_center|LOCUS_09840 415939 413492 gene locus_tag LOCUS_09850 gene lon 415939 413492 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886994.1 protein_id gnl|my_center|LOCUS_09850 416111 415929 gene locus_tag LOCUS_09860 416111 415929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 416636 416217 gene locus_tag LOCUS_09870 416636 416217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 417849 416746 gene locus_tag LOCUS_09880 417849 416746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 417871 418272 gene locus_tag LOCUS_09890 417871 418272 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618908.1 protein_id gnl|my_center|LOCUS_09890 419129 418290 gene locus_tag LOCUS_09900 419129 418290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 419260 420033 gene locus_tag LOCUS_09910 419260 420033 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_09910 420220 421902 gene locus_tag LOCUS_09920 420220 421902 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887112.1 protein_id gnl|my_center|LOCUS_09920 421996 422070 gene locus_tag LOCUS_t00190 421996 422070 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 422076 422150 gene locus_tag LOCUS_t00200 422076 422150 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 422388 422747 gene locus_tag LOCUS_09930 422388 422747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 422791 423111 gene locus_tag LOCUS_09940 422791 423111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 423259 423636 gene locus_tag LOCUS_09950 423259 423636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 424024 423659 gene locus_tag LOCUS_09960 424024 423659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 424338 424096 gene locus_tag LOCUS_09970 424338 424096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 424662 424510 gene locus_tag LOCUS_09980 424662 424510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 424848 425144 gene locus_tag LOCUS_09990 424848 425144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 425266 425388 gene locus_tag LOCUS_10000 425266 425388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 425519 425782 gene locus_tag LOCUS_10010 425519 425782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 426442 426765 gene locus_tag LOCUS_10020 426442 426765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 426997 427572 gene locus_tag LOCUS_10030 426997 427572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 427727 428149 gene locus_tag LOCUS_10040 427727 428149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 430227 428209 gene locus_tag LOCUS_10050 gene fusA 430227 428209 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886952.1 protein_id gnl|my_center|LOCUS_10050 430904 430650 gene locus_tag LOCUS_10060 430904 430650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 433057 430982 gene locus_tag LOCUS_10070 gene fusA 433057 430982 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886952.1 protein_id gnl|my_center|LOCUS_10070 433531 433061 gene locus_tag LOCUS_10080 gene rpsG 433531 433061 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886951.1 protein_id gnl|my_center|LOCUS_10080 433803 433627 gene locus_tag LOCUS_10090 433803 433627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 433988 434209 gene locus_tag LOCUS_10100 433988 434209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 434682 434155 gene locus_tag LOCUS_10110 434682 434155 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888772.1 protein_id gnl|my_center|LOCUS_10110 434796 435263 gene locus_tag LOCUS_10120 434796 435263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 436399 435377 gene locus_tag LOCUS_10130 436399 435377 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_10130 436716 437627 gene locus_tag LOCUS_10140 gene gnd 436716 437627 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350162.1 protein_id gnl|my_center|LOCUS_10140 437620 439122 gene locus_tag LOCUS_10150 gene zwf 437620 439122 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888234.1 protein_id gnl|my_center|LOCUS_10150 439131 440057 gene locus_tag LOCUS_10160 439131 440057 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888235.1 protein_id gnl|my_center|LOCUS_10160 440122 440784 gene locus_tag LOCUS_10170 gene pgl 440122 440784 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122137.1 protein_id gnl|my_center|LOCUS_10170 440913 441974 gene locus_tag LOCUS_10180 440913 441974 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889130.1 protein_id gnl|my_center|LOCUS_10180 442932 441985 gene locus_tag LOCUS_10190 442932 441985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 443912 442929 gene locus_tag LOCUS_10200 443912 442929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 444235 443909 gene locus_tag LOCUS_10210 444235 443909 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349611.1 protein_id gnl|my_center|LOCUS_10210 445424 444363 gene locus_tag LOCUS_10220 445424 444363 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539776.1 protein_id gnl|my_center|LOCUS_10220 446329 445562 gene locus_tag LOCUS_10230 446329 445562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 446770 446333 gene locus_tag LOCUS_10240 gene ybiA 446770 446333 CDS product N-glycosidase YbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145139.1 protein_id gnl|my_center|LOCUS_10240 446977 447780 gene locus_tag LOCUS_10250 446977 447780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_10250 448019 449275 gene locus_tag LOCUS_10260 448019 449275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177565.1 protein_id gnl|my_center|LOCUS_10260 449278 449595 gene locus_tag LOCUS_10270 449278 449595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 449614 452841 gene locus_tag LOCUS_10280 449614 452841 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107137465.1 protein_id gnl|my_center|LOCUS_10280 452838 454130 gene locus_tag LOCUS_10290 452838 454130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887182.1 protein_id gnl|my_center|LOCUS_10290 454127 454729 gene locus_tag LOCUS_10300 454127 454729 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887181.1 protein_id gnl|my_center|LOCUS_10300 455124 457244 gene locus_tag LOCUS_10310 455124 457244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 458646 457273 gene locus_tag LOCUS_10320 458646 457273 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_10320 458755 459063 gene locus_tag LOCUS_10330 458755 459063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 459416 462610 gene locus_tag LOCUS_10340 459416 462610 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258122.1 protein_id gnl|my_center|LOCUS_10340 462949 463131 gene locus_tag LOCUS_10350 462949 463131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 463239 466478 gene locus_tag LOCUS_10360 463239 466478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 466555 468951 gene locus_tag LOCUS_10370 466555 468951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 470008 469016 gene locus_tag LOCUS_10380 470008 469016 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_10380 471270 470245 gene locus_tag LOCUS_10390 471270 470245 CDS product bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141659.1 protein_id gnl|my_center|LOCUS_10390 471391 472665 gene locus_tag LOCUS_10400 471391 472665 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_10400 472658 473188 gene locus_tag LOCUS_10410 472658 473188 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898339.1 protein_id gnl|my_center|LOCUS_10410 473397 474248 gene locus_tag LOCUS_10420 473397 474248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 475059 474331 gene locus_tag LOCUS_10430 475059 474331 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704940.1 protein_id gnl|my_center|LOCUS_10430 475945 475124 gene locus_tag LOCUS_10440 475945 475124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 477533 476064 gene locus_tag LOCUS_10450 477533 476064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 478352 477753 gene locus_tag LOCUS_10460 478352 477753 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888833.1 protein_id gnl|my_center|LOCUS_10460 479007 478423 gene locus_tag LOCUS_10470 479007 478423 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888834.1 protein_id gnl|my_center|LOCUS_10470 479006 480058 gene locus_tag LOCUS_10480 479006 480058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 480116 480973 gene locus_tag LOCUS_10490 480116 480973 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618859.1 protein_id gnl|my_center|LOCUS_10490 481711 481004 gene locus_tag LOCUS_10500 481711 481004 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351086.1 protein_id gnl|my_center|LOCUS_10500 482725 481712 gene locus_tag LOCUS_10510 482725 481712 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480119.1 protein_id gnl|my_center|LOCUS_10510 483249 482776 gene locus_tag LOCUS_10520 483249 482776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 484569 483280 gene locus_tag LOCUS_10530 484569 483280 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_10530 484646 485848 gene locus_tag LOCUS_10540 484646 485848 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854964.1 protein_id gnl|my_center|LOCUS_10540 485903 486286 gene locus_tag LOCUS_10550 485903 486286 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820593.1 protein_id gnl|my_center|LOCUS_10550 487520 486519 gene locus_tag LOCUS_10560 487520 486519 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870267.1 protein_id gnl|my_center|LOCUS_10560 487723 488196 gene locus_tag LOCUS_10570 487723 488196 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889066.1 protein_id gnl|my_center|LOCUS_10570 488259 489011 gene locus_tag LOCUS_10580 gene argB 488259 489011 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889067.1 protein_id gnl|my_center|LOCUS_10580 489115 489188 gene locus_tag LOCUS_t00210 489115 489188 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 489814 489380 gene locus_tag LOCUS_10590 489814 489380 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142675.1 protein_id gnl|my_center|LOCUS_10590 489855 490064 gene locus_tag LOCUS_10600 489855 490064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 490212 490880 gene locus_tag LOCUS_10610 490212 490880 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617263.1 protein_id gnl|my_center|LOCUS_10610 491793 490885 gene locus_tag LOCUS_10620 491793 490885 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_10620 492923 491892 gene locus_tag LOCUS_10630 gene dusA 492923 491892 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477377.1 protein_id gnl|my_center|LOCUS_10630 493128 495308 gene locus_tag LOCUS_10640 493128 495308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 496044 495319 gene locus_tag LOCUS_10650 496044 495319 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_10650 497274 496153 gene locus_tag LOCUS_10660 gene mqnC 497274 496153 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886712.1 protein_id gnl|my_center|LOCUS_10660 497471 497986 gene locus_tag LOCUS_10670 497471 497986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 498033 499205 gene locus_tag LOCUS_10680 498033 499205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 499501 499223 gene locus_tag LOCUS_10690 499501 499223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 502518 499678 gene locus_tag LOCUS_10700 gene topA 502518 499678 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480031.1 protein_id gnl|my_center|LOCUS_10700 503226 502792 gene locus_tag LOCUS_10710 503226 502792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 504330 503410 gene locus_tag LOCUS_10720 504330 503410 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926019.1 protein_id gnl|my_center|LOCUS_10720 504565 505089 gene locus_tag LOCUS_10730 504565 505089 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172651.1 protein_id gnl|my_center|LOCUS_10730 505198 506373 gene locus_tag LOCUS_10740 505198 506373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229029.1 protein_id gnl|my_center|LOCUS_10740 506455 507402 gene locus_tag LOCUS_10750 gene ftsY 506455 507402 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888888.1 protein_id gnl|my_center|LOCUS_10750 507423 508016 gene locus_tag LOCUS_10760 507423 508016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888214.1 protein_id gnl|my_center|LOCUS_10760 508080 508313 gene locus_tag LOCUS_10770 508080 508313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 509265 508366 gene locus_tag LOCUS_10780 509265 508366 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257820.1 protein_id gnl|my_center|LOCUS_10780 511054 509375 gene locus_tag LOCUS_10790 511054 509375 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480202.1 protein_id gnl|my_center|LOCUS_10790 511557 511111 gene locus_tag LOCUS_10800 511557 511111 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887668.1 protein_id gnl|my_center|LOCUS_10800 511975 511544 gene locus_tag LOCUS_10810 511975 511544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 512113 512562 gene locus_tag LOCUS_10820 512113 512562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 512575 513024 gene locus_tag LOCUS_10830 512575 513024 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_10830 513942 513091 gene locus_tag LOCUS_10840 gene sdaAA 513942 513091 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479580.1 protein_id gnl|my_center|LOCUS_10840 514644 513979 gene locus_tag LOCUS_10850 gene sdaAB 514644 513979 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479548.1 protein_id gnl|my_center|LOCUS_10850 514791 515627 gene locus_tag LOCUS_10860 514791 515627 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350357.1 protein_id gnl|my_center|LOCUS_10860 515694 516557 gene locus_tag LOCUS_10870 515694 516557 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350357.1 protein_id gnl|my_center|LOCUS_10870 516936 518246 gene locus_tag LOCUS_10880 516936 518246 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767762.1 protein_id gnl|my_center|LOCUS_10880 520553 518406 gene locus_tag LOCUS_10890 520553 518406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 521636 521043 gene locus_tag LOCUS_10900 521636 521043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 523190 521655 gene locus_tag LOCUS_10910 523190 521655 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223376.1 protein_id gnl|my_center|LOCUS_10910 524395 523199 gene locus_tag LOCUS_10920 524395 523199 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479620.1 protein_id gnl|my_center|LOCUS_10920 525487 524420 gene locus_tag LOCUS_10930 525487 524420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223374.1 protein_id gnl|my_center|LOCUS_10930 526180 525731 gene locus_tag LOCUS_10940 526180 525731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 526608 526183 gene locus_tag LOCUS_10950 526608 526183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 527490 526609 gene locus_tag LOCUS_10960 527490 526609 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479587.1 protein_id gnl|my_center|LOCUS_10960 527587 527913 gene locus_tag LOCUS_10970 527587 527913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 528948 527920 gene locus_tag LOCUS_10980 528948 527920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 529099 529308 gene locus_tag LOCUS_10990 529099 529308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 529238 532549 gene locus_tag LOCUS_11000 gene pulA 529238 532549 CDS product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479569.1 protein_id gnl|my_center|LOCUS_11000 532837 536004 gene locus_tag LOCUS_11010 532837 536004 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071683.1 protein_id gnl|my_center|LOCUS_11010 536319 536702 gene locus_tag LOCUS_11020 536319 536702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 536793 537128 gene locus_tag LOCUS_11030 536793 537128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence03 157 840 gene locus_tag LOCUS_11040 157 840 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_11040 842 2167 gene locus_tag LOCUS_11050 842 2167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_11050 2493 3806 gene locus_tag LOCUS_11060 2493 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5648 3780 gene locus_tag LOCUS_11070 5648 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6073 5636 gene locus_tag LOCUS_11080 6073 5636 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_11080 8341 6077 gene locus_tag LOCUS_11090 8341 6077 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268475.1 protein_id gnl|my_center|LOCUS_11090 8961 8338 gene locus_tag LOCUS_11100 8961 8338 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_11100 9864 9187 gene locus_tag LOCUS_11110 9864 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887104.1 protein_id gnl|my_center|LOCUS_11110 12105 9973 gene locus_tag LOCUS_11120 12105 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12508 12107 gene locus_tag LOCUS_11130 12508 12107 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887102.1 protein_id gnl|my_center|LOCUS_11130 13203 12505 gene locus_tag LOCUS_11140 13203 12505 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887101.1 protein_id gnl|my_center|LOCUS_11140 13981 13475 gene locus_tag LOCUS_11150 13981 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 14720 14226 gene locus_tag LOCUS_11160 14720 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 14922 15290 gene locus_tag LOCUS_11170 14922 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 15551 15303 gene locus_tag LOCUS_11180 15551 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 16282 15548 gene locus_tag LOCUS_11190 16282 15548 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678254.1 protein_id gnl|my_center|LOCUS_11190 16506 18035 gene locus_tag LOCUS_11200 16506 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 18035 18439 gene locus_tag LOCUS_11210 gene dhaM 18035 18439 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528085.1 protein_id gnl|my_center|LOCUS_11210 18519 20465 gene locus_tag LOCUS_11220 gene ptsG 18519 20465 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_11220 21511 20477 gene locus_tag LOCUS_11230 21511 20477 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_11230 23406 21499 gene locus_tag LOCUS_11240 23406 21499 CDS product LodA/GoxA family CTQ-dependent oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_11240 23644 24159 gene locus_tag LOCUS_11250 23644 24159 CDS product DUF3105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029732672.1 protein_id gnl|my_center|LOCUS_11250 24409 26571 gene locus_tag LOCUS_11260 24409 26571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 27970 26555 gene locus_tag LOCUS_11270 gene lpdA 27970 26555 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118855.1 protein_id gnl|my_center|LOCUS_11270 28159 28545 gene locus_tag LOCUS_11280 28159 28545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 29770 28550 gene locus_tag LOCUS_11290 29770 28550 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_11290 31234 29771 gene locus_tag LOCUS_11300 31234 29771 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_11300 31790 31374 gene locus_tag LOCUS_11310 31790 31374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 32749 31787 gene locus_tag LOCUS_11320 32749 31787 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_11320 33458 32751 gene locus_tag LOCUS_11330 33458 32751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767772.1 protein_id gnl|my_center|LOCUS_11330 33642 34586 gene locus_tag LOCUS_11340 33642 34586 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970774.1 protein_id gnl|my_center|LOCUS_11340 34623 35927 gene locus_tag LOCUS_11350 34623 35927 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152603799.1 protein_id gnl|my_center|LOCUS_11350 39521 35964 gene locus_tag LOCUS_11360 39521 35964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 40138 39596 gene locus_tag LOCUS_11370 40138 39596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 41439 40480 gene locus_tag LOCUS_11380 41439 40480 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314766.1 protein_id gnl|my_center|LOCUS_11380 42486 41488 gene locus_tag LOCUS_11390 42486 41488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 protein_id gnl|my_center|LOCUS_11390 43978 42473 gene locus_tag LOCUS_11400 43978 42473 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 protein_id gnl|my_center|LOCUS_11400 44219 45250 gene locus_tag LOCUS_11410 44219 45250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 45539 45348 gene locus_tag LOCUS_11420 45539 45348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 45940 50058 gene locus_tag LOCUS_11430 45940 50058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 51404 50385 gene locus_tag LOCUS_11440 51404 50385 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_11440 53310 51619 gene locus_tag LOCUS_11450 53310 51619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 53896 54834 gene locus_tag LOCUS_11460 53896 54834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 55552 55148 gene locus_tag LOCUS_11470 55552 55148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 56107 55562 gene locus_tag LOCUS_11480 56107 55562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 56362 57312 gene locus_tag LOCUS_11490 56362 57312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 57309 58193 gene locus_tag LOCUS_11500 57309 58193 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_11500 58357 58992 gene locus_tag LOCUS_11510 58357 58992 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015235258.1 protein_id gnl|my_center|LOCUS_11510 59089 60060 gene locus_tag LOCUS_11520 59089 60060 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_11520 60744 60160 gene locus_tag LOCUS_11530 60744 60160 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356834.1 protein_id gnl|my_center|LOCUS_11530 61181 60741 gene locus_tag LOCUS_11540 61181 60741 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_11540 61214 62011 gene locus_tag LOCUS_11550 61214 62011 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070651736.1 protein_id gnl|my_center|LOCUS_11550 63094 62015 gene locus_tag LOCUS_11560 63094 62015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 64115 63285 gene locus_tag LOCUS_11570 64115 63285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 65154 64189 gene locus_tag LOCUS_11580 65154 64189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 66974 65592 gene locus_tag LOCUS_11590 66974 65592 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229172.1 protein_id gnl|my_center|LOCUS_11590 68849 68013 gene locus_tag LOCUS_11600 68849 68013 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921853.1 protein_id gnl|my_center|LOCUS_11600 69065 69784 gene locus_tag LOCUS_11610 69065 69784 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_11610 69784 70806 gene locus_tag LOCUS_11620 69784 70806 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527783.1 protein_id gnl|my_center|LOCUS_11620 71024 72031 gene locus_tag LOCUS_11630 71024 72031 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_11630 72028 73161 gene locus_tag LOCUS_11640 72028 73161 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 protein_id gnl|my_center|LOCUS_11640 74447 73203 gene locus_tag LOCUS_11650 74447 73203 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888819.1 protein_id gnl|my_center|LOCUS_11650 74572 75189 gene locus_tag LOCUS_11660 74572 75189 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_11660 75485 75919 gene locus_tag LOCUS_11670 75485 75919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 75937 77508 gene locus_tag LOCUS_11680 75937 77508 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_11680 79948 77525 gene locus_tag LOCUS_11690 79948 77525 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618777.1 protein_id gnl|my_center|LOCUS_11690 80192 80983 gene locus_tag LOCUS_11700 80192 80983 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639024.1 protein_id gnl|my_center|LOCUS_11700 81204 82715 gene locus_tag LOCUS_11710 81204 82715 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_11710 82743 83999 gene locus_tag LOCUS_11720 82743 83999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 84791 84255 gene locus_tag LOCUS_11730 84791 84255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 84892 85653 gene locus_tag LOCUS_11740 84892 85653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_11740 85697 88891 gene locus_tag LOCUS_11750 85697 88891 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_11750 88888 89640 gene locus_tag LOCUS_11760 88888 89640 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_11760 89973 90920 gene locus_tag LOCUS_11770 89973 90920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 93921 90973 gene locus_tag LOCUS_11780 93921 90973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 94825 94460 gene locus_tag LOCUS_11790 94825 94460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 96132 95101 gene locus_tag LOCUS_11800 96132 95101 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229118.1 protein_id gnl|my_center|LOCUS_11800 96989 97123 gene locus_tag LOCUS_11810 96989 97123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11810 97120 97965 gene locus_tag LOCUS_11820 97120 97965 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_11820 97995 98153 gene locus_tag LOCUS_11830 97995 98153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 99821 98160 gene locus_tag LOCUS_11840 99821 98160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 100216 99881 gene locus_tag LOCUS_11850 gene trxA 100216 99881 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_11850 101607 100303 gene locus_tag LOCUS_11860 101607 100303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 101844 104327 gene locus_tag LOCUS_11870 gene hrpB 101844 104327 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887065.1 protein_id gnl|my_center|LOCUS_11870 104544 104341 gene locus_tag LOCUS_11880 104544 104341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 104594 104968 gene locus_tag LOCUS_11890 104594 104968 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971113.1 protein_id gnl|my_center|LOCUS_11890 105349 105816 gene locus_tag LOCUS_11900 gene slyA 105349 105816 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705156.1 protein_id gnl|my_center|LOCUS_11900 105847 106806 gene locus_tag LOCUS_11910 105847 106806 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257482.1 protein_id gnl|my_center|LOCUS_11910 106957 107586 gene locus_tag LOCUS_11920 106957 107586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 108834 107857 gene locus_tag LOCUS_11930 108834 107857 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_11930 109382 108924 gene locus_tag LOCUS_11940 109382 108924 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_11940 109621 110607 gene locus_tag LOCUS_11950 109621 110607 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 protein_id gnl|my_center|LOCUS_11950 111452 110670 gene locus_tag LOCUS_11960 111452 110670 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_11960 111921 116897 gene locus_tag LOCUS_11970 111921 116897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 117286 118452 gene locus_tag LOCUS_11980 117286 118452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 118455 119864 gene locus_tag LOCUS_11990 118455 119864 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942100.1 protein_id gnl|my_center|LOCUS_11990 120204 122066 gene locus_tag LOCUS_12000 120204 122066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 122587 122069 gene locus_tag LOCUS_12010 gene ureE 122587 122069 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889573.1 protein_id gnl|my_center|LOCUS_12010 123245 122592 gene locus_tag LOCUS_12020 gene hypB 123245 122592 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889574.1 protein_id gnl|my_center|LOCUS_12020 123589 123242 gene locus_tag LOCUS_12030 123589 123242 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889575.1 protein_id gnl|my_center|LOCUS_12030 124074 123589 gene locus_tag LOCUS_12040 124074 123589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 124546 125928 gene locus_tag LOCUS_12050 124546 125928 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103108.1 protein_id gnl|my_center|LOCUS_12050 128228 126000 gene locus_tag LOCUS_12060 128228 126000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 128485 129918 gene locus_tag LOCUS_12070 gene zwf 128485 129918 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888234.1 protein_id gnl|my_center|LOCUS_12070 130000 130170 gene locus_tag LOCUS_12080 130000 130170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 131968 130220 gene locus_tag LOCUS_12090 131968 130220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889608.1 protein_id gnl|my_center|LOCUS_12090 134286 132472 gene locus_tag LOCUS_12100 134286 132472 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225976.1 protein_id gnl|my_center|LOCUS_12100 134762 135376 gene locus_tag LOCUS_12110 134762 135376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 135978 135397 gene locus_tag LOCUS_12120 135978 135397 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141893.1 protein_id gnl|my_center|LOCUS_12120 136166 135975 gene locus_tag LOCUS_12130 136166 135975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721789.1 protein_id gnl|my_center|LOCUS_12130 139626 136423 gene locus_tag LOCUS_12140 139626 136423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 140042 139623 gene locus_tag LOCUS_12150 140042 139623 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672395.1 protein_id gnl|my_center|LOCUS_12150 140041 140916 gene locus_tag LOCUS_12160 140041 140916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 140901 142157 gene locus_tag LOCUS_12170 140901 142157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 143341 142574 gene locus_tag LOCUS_12180 143341 142574 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120779.1 protein_id gnl|my_center|LOCUS_12180 144780 143422 gene locus_tag LOCUS_12190 144780 143422 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228367.1 protein_id gnl|my_center|LOCUS_12190 145442 144777 gene locus_tag LOCUS_12200 145442 144777 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118816.1 protein_id gnl|my_center|LOCUS_12200 145720 146886 gene locus_tag LOCUS_12210 145720 146886 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479600.1 protein_id gnl|my_center|LOCUS_12210 147050 147526 gene locus_tag LOCUS_12220 147050 147526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 147999 148214 gene locus_tag LOCUS_12230 147999 148214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 148325 149956 gene locus_tag LOCUS_12240 148325 149956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 149967 150557 gene locus_tag LOCUS_12250 149967 150557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 151184 150570 gene locus_tag LOCUS_12260 151184 150570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 154327 151469 gene locus_tag LOCUS_12270 154327 151469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 154721 154497 gene locus_tag LOCUS_12280 154721 154497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 155059 156225 gene locus_tag LOCUS_12290 155059 156225 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889233.1 protein_id gnl|my_center|LOCUS_12290 156692 158281 gene locus_tag LOCUS_12300 156692 158281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 158815 158327 gene locus_tag LOCUS_12310 158815 158327 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023053.1 protein_id gnl|my_center|LOCUS_12310 159040 159288 gene locus_tag LOCUS_12320 159040 159288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 161082 159592 gene locus_tag LOCUS_12330 161082 159592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 161823 161350 gene locus_tag LOCUS_12340 161823 161350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 162649 162236 gene locus_tag LOCUS_12350 162649 162236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 163502 162720 gene locus_tag LOCUS_12360 163502 162720 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_12360 164406 163495 gene locus_tag LOCUS_12370 164406 163495 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888863.1 protein_id gnl|my_center|LOCUS_12370 165390 164488 gene locus_tag LOCUS_12380 165390 164488 CDS product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118502.1 protein_id gnl|my_center|LOCUS_12380 165720 166238 gene locus_tag LOCUS_12390 165720 166238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 167520 166384 gene locus_tag LOCUS_12400 167520 166384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 168263 167601 gene locus_tag LOCUS_12410 168263 167601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_12410 169621 168260 gene locus_tag LOCUS_12420 169621 168260 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888244.1 protein_id gnl|my_center|LOCUS_12420 169726 170208 gene locus_tag LOCUS_12430 169726 170208 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888078.1 protein_id gnl|my_center|LOCUS_12430 171170 170295 gene locus_tag LOCUS_12440 171170 170295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 171505 173175 gene locus_tag LOCUS_12450 171505 173175 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172599.1 protein_id gnl|my_center|LOCUS_12450 173206 173448 gene locus_tag LOCUS_12460 173206 173448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 173630 175114 gene locus_tag LOCUS_12470 173630 175114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 175116 175586 gene locus_tag LOCUS_12480 175116 175586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 175561 176010 gene locus_tag LOCUS_12490 175561 176010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 176048 176746 gene locus_tag LOCUS_12500 176048 176746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 176879 177430 gene locus_tag LOCUS_12510 176879 177430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 177434 178114 gene locus_tag LOCUS_12520 177434 178114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480061.1 protein_id gnl|my_center|LOCUS_12520 179085 178174 gene locus_tag LOCUS_12530 179085 178174 CDS product DUF2268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836465.1 protein_id gnl|my_center|LOCUS_12530 179207 180202 gene locus_tag LOCUS_12540 179207 180202 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030266.1 protein_id gnl|my_center|LOCUS_12540 180528 180812 gene locus_tag LOCUS_12550 180528 180812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 181138 181341 gene locus_tag LOCUS_12560 181138 181341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 182170 183834 gene locus_tag LOCUS_12570 182170 183834 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889497.1 protein_id gnl|my_center|LOCUS_12570 184325 183891 gene locus_tag LOCUS_12580 184325 183891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 184959 184528 gene locus_tag LOCUS_12590 184959 184528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 185481 185756 gene locus_tag LOCUS_12600 185481 185756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 185987 186721 gene locus_tag LOCUS_12610 185987 186721 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368275.1 protein_id gnl|my_center|LOCUS_12610 186718 187422 gene locus_tag LOCUS_12620 186718 187422 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257174.1 protein_id gnl|my_center|LOCUS_12620 187978 187397 gene locus_tag LOCUS_12630 187978 187397 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_12630 188477 187980 gene locus_tag LOCUS_12640 188477 187980 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889277.1 protein_id gnl|my_center|LOCUS_12640 189718 188480 gene locus_tag LOCUS_12650 gene fabF 189718 188480 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227920.1 protein_id gnl|my_center|LOCUS_12650 190233 189874 gene locus_tag LOCUS_12660 190233 189874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 191506 190274 gene locus_tag LOCUS_12670 191506 190274 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_12670 192178 191918 gene locus_tag LOCUS_12680 192178 191918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 192355 196722 gene locus_tag LOCUS_12690 192355 196722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 198948 196729 gene locus_tag LOCUS_12700 198948 196729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 200437 199088 gene locus_tag LOCUS_12710 200437 199088 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_12710 200914 200537 gene locus_tag LOCUS_12720 200914 200537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 202024 200966 gene locus_tag LOCUS_12730 202024 200966 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_12730 202565 203773 gene locus_tag LOCUS_12740 202565 203773 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887206.1 protein_id gnl|my_center|LOCUS_12740 203954 206650 gene locus_tag LOCUS_12750 203954 206650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 206660 208888 gene locus_tag LOCUS_12760 206660 208888 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527693.1 protein_id gnl|my_center|LOCUS_12760 209007 210119 gene locus_tag LOCUS_12770 209007 210119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 210419 210189 gene locus_tag LOCUS_12780 210419 210189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 210542 211144 gene locus_tag LOCUS_12790 210542 211144 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886693.1 protein_id gnl|my_center|LOCUS_12790 211505 212743 gene locus_tag LOCUS_12800 211505 212743 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349486.1 protein_id gnl|my_center|LOCUS_12800 213193 212771 gene locus_tag LOCUS_12810 213193 212771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 214443 213292 gene locus_tag LOCUS_12820 214443 213292 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479937.1 protein_id gnl|my_center|LOCUS_12820 215161 214448 gene locus_tag LOCUS_12830 gene deoD 215161 214448 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479926.1 protein_id gnl|my_center|LOCUS_12830 216773 215481 gene locus_tag LOCUS_12840 216773 215481 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_12840 217449 216775 gene locus_tag LOCUS_12850 gene deoC 217449 216775 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887848.1 protein_id gnl|my_center|LOCUS_12850 218347 217442 gene locus_tag LOCUS_12860 218347 217442 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480159.1 protein_id gnl|my_center|LOCUS_12860 220209 218344 gene locus_tag LOCUS_12870 220209 218344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177742.1 protein_id gnl|my_center|LOCUS_12870 221826 220237 gene locus_tag LOCUS_12880 221826 220237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887602.1 protein_id gnl|my_center|LOCUS_12880 222220 222002 gene locus_tag LOCUS_12890 222220 222002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 222460 222233 gene locus_tag LOCUS_12900 222460 222233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 222677 222829 gene locus_tag LOCUS_12910 222677 222829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 223769 222870 gene locus_tag LOCUS_12920 223769 222870 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479905.1 protein_id gnl|my_center|LOCUS_12920 224884 223781 gene locus_tag LOCUS_12930 224884 223781 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977184.1 protein_id gnl|my_center|LOCUS_12930 225189 224929 gene locus_tag LOCUS_12940 225189 224929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 226538 225306 gene locus_tag LOCUS_12950 226538 225306 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_12950 226787 227848 gene locus_tag LOCUS_12960 gene gutB 226787 227848 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_12960 227883 228428 gene locus_tag LOCUS_12970 227883 228428 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 protein_id gnl|my_center|LOCUS_12970 228494 229864 gene locus_tag LOCUS_12980 228494 229864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 230687 229782 gene locus_tag LOCUS_12990 230687 229782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 230931 230677 gene locus_tag LOCUS_13000 230931 230677 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884060.1 protein_id gnl|my_center|LOCUS_13000 231291 232217 gene locus_tag LOCUS_13010 231291 232217 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887266.1 protein_id gnl|my_center|LOCUS_13010 232214 233107 gene locus_tag LOCUS_13020 232214 233107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 233104 235029 gene locus_tag LOCUS_13030 233104 235029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13030 235230 237848 gene locus_tag LOCUS_13040 235230 237848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 237858 238628 gene locus_tag LOCUS_13050 237858 238628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 238674 239120 gene locus_tag LOCUS_13060 238674 239120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 239505 240029 gene locus_tag LOCUS_13070 239505 240029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 240172 240600 gene locus_tag LOCUS_13080 240172 240600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 241397 240663 gene locus_tag LOCUS_13090 241397 240663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 242042 241527 gene locus_tag LOCUS_13100 242042 241527 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809303.1 protein_id gnl|my_center|LOCUS_13100 242631 242035 gene locus_tag LOCUS_13110 242631 242035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 243110 242718 gene locus_tag LOCUS_13120 243110 242718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 244829 243465 gene locus_tag LOCUS_13130 244829 243465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_13130 245014 245457 gene locus_tag LOCUS_13140 245014 245457 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027124.1 protein_id gnl|my_center|LOCUS_13140 245454 246701 gene locus_tag LOCUS_13150 245454 246701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230206.1 protein_id gnl|my_center|LOCUS_13150 246975 246727 gene locus_tag LOCUS_13160 246975 246727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 248871 247273 gene locus_tag LOCUS_13170 248871 247273 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941681.1 protein_id gnl|my_center|LOCUS_13170 250857 249007 gene locus_tag LOCUS_13180 250857 249007 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_13180 251016 251471 gene locus_tag LOCUS_13190 251016 251471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 252493 251567 gene locus_tag LOCUS_13200 252493 251567 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888990.1 protein_id gnl|my_center|LOCUS_13200 253495 252635 gene locus_tag LOCUS_13210 253495 252635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 253670 254077 gene locus_tag LOCUS_13220 253670 254077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 254178 255161 gene locus_tag LOCUS_13230 254178 255161 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_13230 255770 255213 gene locus_tag LOCUS_13240 255770 255213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 256166 256426 gene locus_tag LOCUS_13250 gene pprM 256166 256426 CDS product DNA damage response modulator PprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869024.1 protein_id gnl|my_center|LOCUS_13250 256709 256500 gene locus_tag LOCUS_13260 256709 256500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 256845 257471 gene locus_tag LOCUS_13270 256845 257471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530791.1 protein_id gnl|my_center|LOCUS_13270 257491 258042 gene locus_tag LOCUS_13280 257491 258042 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887708.1 protein_id gnl|my_center|LOCUS_13280 258350 258045 gene locus_tag LOCUS_13290 258350 258045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 259013 258405 gene locus_tag LOCUS_13300 259013 258405 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811244.1 protein_id gnl|my_center|LOCUS_13300 260051 259068 gene locus_tag LOCUS_13310 260051 259068 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074249.1 protein_id gnl|my_center|LOCUS_13310 260899 260048 gene locus_tag LOCUS_13320 gene cysW 260899 260048 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_13320 261705 260896 gene locus_tag LOCUS_13330 gene cysT 261705 260896 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_13330 262740 261754 gene locus_tag LOCUS_13340 262740 261754 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 protein_id gnl|my_center|LOCUS_13340 263084 263287 gene locus_tag LOCUS_13350 263084 263287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 264265 263345 gene locus_tag LOCUS_13360 264265 263345 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_13360 264970 264347 gene locus_tag LOCUS_13370 264970 264347 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479823.1 protein_id gnl|my_center|LOCUS_13370 265458 265237 gene locus_tag LOCUS_13380 265458 265237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 265425 265434 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 265523 266362 gene locus_tag LOCUS_13390 265523 266362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 265857 265866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 266610 267581 gene locus_tag LOCUS_13400 266610 267581 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_13400 267578 268390 gene locus_tag LOCUS_13410 gene ssuC 267578 268390 CDS product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102309.1 protein_id gnl|my_center|LOCUS_13410 268369 269121 gene locus_tag LOCUS_13420 gene ssuB 268369 269121 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102311.1 protein_id gnl|my_center|LOCUS_13420 269205 270791 gene locus_tag LOCUS_13430 269205 270791 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886903.1 protein_id gnl|my_center|LOCUS_13430 271144 271512 gene locus_tag LOCUS_13440 271144 271512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 271581 271913 gene locus_tag LOCUS_13450 271581 271913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 272011 272712 gene locus_tag LOCUS_13460 272011 272712 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_13460 273548 272715 gene locus_tag LOCUS_13470 273548 272715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 274056 276296 gene locus_tag LOCUS_13480 274056 276296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 276622 277641 gene locus_tag LOCUS_13490 276622 277641 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227073.1 protein_id gnl|my_center|LOCUS_13490 277775 277918 gene locus_tag LOCUS_13500 277775 277918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 278563 277991 gene locus_tag LOCUS_13510 278563 277991 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888427.1 protein_id gnl|my_center|LOCUS_13510 279209 278616 gene locus_tag LOCUS_13520 279209 278616 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888428.1 protein_id gnl|my_center|LOCUS_13520 280169 279258 gene locus_tag LOCUS_13530 280169 279258 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350008.1 protein_id gnl|my_center|LOCUS_13530 281674 280361 gene locus_tag LOCUS_13540 281674 280361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 283662 282028 gene locus_tag LOCUS_13550 283662 282028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 284046 285059 gene locus_tag LOCUS_13560 284046 285059 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082568.1 protein_id gnl|my_center|LOCUS_13560 285226 285486 gene locus_tag LOCUS_13570 gene pprM 285226 285486 CDS product DNA damage response modulator PprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869024.1 protein_id gnl|my_center|LOCUS_13570 286911 285565 gene locus_tag LOCUS_13580 286911 285565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 288732 287206 gene locus_tag LOCUS_13590 gene cydC 288732 287206 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205201.1 protein_id gnl|my_center|LOCUS_13590 290344 288725 gene locus_tag LOCUS_13600 290344 288725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 291364 290348 gene locus_tag LOCUS_13610 gene cydB 291364 290348 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_13610 292773 291364 gene locus_tag LOCUS_13620 292773 291364 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393585.1 protein_id gnl|my_center|LOCUS_13620 293370 293011 gene locus_tag LOCUS_13630 293370 293011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_13630 293499 293864 gene locus_tag LOCUS_13640 293499 293864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 296094 295045 gene locus_tag LOCUS_13650 296094 295045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 298765 296342 gene locus_tag LOCUS_13660 298765 296342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 300434 299136 gene locus_tag LOCUS_13670 300434 299136 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_13670 301965 300628 gene locus_tag LOCUS_13680 301965 300628 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_13680 302984 302079 gene locus_tag LOCUS_13690 302984 302079 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258521.1 protein_id gnl|my_center|LOCUS_13690 303835 302981 gene locus_tag LOCUS_13700 303835 302981 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_13700 304785 303832 gene locus_tag LOCUS_13710 304785 303832 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080849.1 protein_id gnl|my_center|LOCUS_13710 305828 304881 gene locus_tag LOCUS_13720 305828 304881 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582760.1 protein_id gnl|my_center|LOCUS_13720 307093 305828 gene locus_tag LOCUS_13730 307093 305828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 308030 307152 gene locus_tag LOCUS_13740 308030 307152 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_13740 308961 308017 gene locus_tag LOCUS_13750 308961 308017 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582766.1 protein_id gnl|my_center|LOCUS_13750 310453 308999 gene locus_tag LOCUS_13760 310453 308999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 310693 310926 gene locus_tag LOCUS_13770 310693 310926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 311079 311858 gene locus_tag LOCUS_13780 311079 311858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 313893 312007 gene locus_tag LOCUS_13790 gene thrS 313893 312007 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881086.1 protein_id gnl|my_center|LOCUS_13790 314177 314518 gene locus_tag LOCUS_13800 314177 314518 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888735.1 protein_id gnl|my_center|LOCUS_13800 315685 314570 gene locus_tag LOCUS_13810 gene nagA 315685 314570 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889325.1 protein_id gnl|my_center|LOCUS_13810 316476 315682 gene locus_tag LOCUS_13820 316476 315682 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_13820 316874 318145 gene locus_tag LOCUS_13830 316874 318145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 318589 320073 gene locus_tag LOCUS_13840 318589 320073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 320338 321633 gene locus_tag LOCUS_13850 320338 321633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 322050 321643 gene locus_tag LOCUS_13860 322050 321643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 322349 322747 gene locus_tag LOCUS_13870 322349 322747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 322744 324567 gene locus_tag LOCUS_13880 322744 324567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 324716 325057 gene locus_tag LOCUS_13890 324716 325057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 325212 325622 gene locus_tag LOCUS_13900 325212 325622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 325830 326504 gene locus_tag LOCUS_13910 325830 326504 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_13910 326537 327829 gene locus_tag LOCUS_13920 326537 327829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 329059 327845 gene locus_tag LOCUS_13930 gene khtU 329059 327845 CDS product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 protein_id gnl|my_center|LOCUS_13930 329612 329133 gene locus_tag LOCUS_13940 329612 329133 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930802.1 protein_id gnl|my_center|LOCUS_13940 330010 331020 gene locus_tag LOCUS_13950 330010 331020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 331153 333060 gene locus_tag LOCUS_13960 331153 333060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 334943 333051 gene locus_tag LOCUS_13970 334943 333051 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_13970 335132 335950 gene locus_tag LOCUS_13980 335132 335950 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891802.1 protein_id gnl|my_center|LOCUS_13980 336044 336814 gene locus_tag LOCUS_13990 336044 336814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 336807 337376 gene locus_tag LOCUS_14000 336807 337376 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889427.1 protein_id gnl|my_center|LOCUS_14000 338638 337382 gene locus_tag LOCUS_14010 338638 337382 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227981.1 protein_id gnl|my_center|LOCUS_14010 338984 339958 gene locus_tag LOCUS_14020 338984 339958 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_14020 340248 341621 gene locus_tag LOCUS_14030 340248 341621 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092263432.1 protein_id gnl|my_center|LOCUS_14030 342319 341723 gene locus_tag LOCUS_14040 342319 341723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 342371 342520 gene locus_tag LOCUS_14050 342371 342520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 343140 342730 gene locus_tag LOCUS_14060 343140 342730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 343940 344383 gene locus_tag LOCUS_14070 343940 344383 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880763.1 protein_id gnl|my_center|LOCUS_14070 344456 346021 gene locus_tag LOCUS_14080 gene katA 344456 346021 CDS product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245322.1 protein_id gnl|my_center|LOCUS_14080 348588 346120 gene locus_tag LOCUS_14090 348588 346120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 349175 348753 gene locus_tag LOCUS_14100 349175 348753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 349730 349305 gene locus_tag LOCUS_14110 349730 349305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 349788 350048 gene locus_tag LOCUS_14120 349788 350048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 350045 352627 gene locus_tag LOCUS_14130 350045 352627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 354523 352646 gene locus_tag LOCUS_14140 354523 352646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 357736 354560 gene locus_tag LOCUS_14150 357736 354560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 358183 360330 gene locus_tag LOCUS_14160 358183 360330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 361254 360391 gene locus_tag LOCUS_14170 361254 360391 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_14170 362719 361496 gene locus_tag LOCUS_14180 362719 361496 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887964.1 protein_id gnl|my_center|LOCUS_14180 363182 364018 gene locus_tag LOCUS_14190 363182 364018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 364011 364661 gene locus_tag LOCUS_14200 364011 364661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 364754 365659 gene locus_tag LOCUS_14210 364754 365659 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168154.1 protein_id gnl|my_center|LOCUS_14210 365678 366814 gene locus_tag LOCUS_14220 365678 366814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983970.1 protein_id gnl|my_center|LOCUS_14220 366821 367762 gene locus_tag LOCUS_14230 366821 367762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 367759 368502 gene locus_tag LOCUS_14240 367759 368502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390135.1 protein_id gnl|my_center|LOCUS_14240 368809 369684 gene locus_tag LOCUS_14250 368809 369684 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584123.1 protein_id gnl|my_center|LOCUS_14250 369709 371190 gene locus_tag LOCUS_14260 369709 371190 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081523.1 protein_id gnl|my_center|LOCUS_14260 371221 372582 gene locus_tag LOCUS_14270 371221 372582 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_14270 372608 373501 gene locus_tag LOCUS_14280 372608 373501 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618835.1 protein_id gnl|my_center|LOCUS_14280 373797 375056 gene locus_tag LOCUS_14290 373797 375056 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_14290 375971 375123 gene locus_tag LOCUS_14300 375971 375123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence04 3533 228 gene locus_tag LOCUS_14310 3533 228 CDS product chromosome segregation SMC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480229.1 protein_id gnl|my_center|LOCUS_14310 4075 3530 gene locus_tag LOCUS_14320 4075 3530 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888109.1 protein_id gnl|my_center|LOCUS_14320 5454 4072 gene locus_tag LOCUS_14330 5454 4072 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888108.1 protein_id gnl|my_center|LOCUS_14330 5882 5451 gene locus_tag LOCUS_14340 gene smpB 5882 5451 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480230.1 protein_id gnl|my_center|LOCUS_14340 7025 6165 gene locus_tag LOCUS_14350 7025 6165 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172776.1 protein_id gnl|my_center|LOCUS_14350 8221 7022 gene locus_tag LOCUS_14360 8221 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 9633 8398 gene locus_tag LOCUS_14370 9633 8398 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926040.1 protein_id gnl|my_center|LOCUS_14370 10125 11420 gene locus_tag LOCUS_14380 gene asnS 10125 11420 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480195.1 protein_id gnl|my_center|LOCUS_14380 12774 11524 gene locus_tag LOCUS_14390 12774 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 13480 13028 gene locus_tag LOCUS_14400 13480 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 13790 14782 gene locus_tag LOCUS_14410 gene gap 13790 14782 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887984.1 protein_id gnl|my_center|LOCUS_14410 14876 16039 gene locus_tag LOCUS_14420 14876 16039 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480023.1 protein_id gnl|my_center|LOCUS_14420 16155 16910 gene locus_tag LOCUS_14430 gene tpiA 16155 16910 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480022.1 protein_id gnl|my_center|LOCUS_14430 17049 17471 gene locus_tag LOCUS_14440 17049 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 17596 18312 gene locus_tag LOCUS_14450 17596 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 19446 18382 gene locus_tag LOCUS_14460 19446 18382 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350436.1 protein_id gnl|my_center|LOCUS_14460 19568 20557 gene locus_tag LOCUS_14470 19568 20557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 20603 21661 gene locus_tag LOCUS_14480 20603 21661 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_14480 21662 21994 gene locus_tag LOCUS_14490 21662 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 22092 22535 gene locus_tag LOCUS_14500 22092 22535 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480199.1 protein_id gnl|my_center|LOCUS_14500 22662 23456 gene locus_tag LOCUS_14510 22662 23456 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887971.1 protein_id gnl|my_center|LOCUS_14510 24708 23422 gene locus_tag LOCUS_14520 gene lnt 24708 23422 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350439.1 protein_id gnl|my_center|LOCUS_14520 25017 24853 gene locus_tag LOCUS_14530 25017 24853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 25118 25828 gene locus_tag LOCUS_14540 25118 25828 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888001.1 protein_id gnl|my_center|LOCUS_14540 27340 25952 gene locus_tag LOCUS_14550 27340 25952 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888006.1 protein_id gnl|my_center|LOCUS_14550 28217 27630 gene locus_tag LOCUS_14560 gene pdxT 28217 27630 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888007.1 protein_id gnl|my_center|LOCUS_14560 29238 28348 gene locus_tag LOCUS_14570 gene pdxS 29238 28348 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480030.1 protein_id gnl|my_center|LOCUS_14570 29662 29297 gene locus_tag LOCUS_14580 29662 29297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 31177 29717 gene locus_tag LOCUS_14590 31177 29717 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228133.1 protein_id gnl|my_center|LOCUS_14590 32807 31518 gene locus_tag LOCUS_14600 gene rho 32807 31518 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869108.1 protein_id gnl|my_center|LOCUS_14600 33608 33937 gene locus_tag LOCUS_14610 33608 33937 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_14610 34117 37266 gene locus_tag LOCUS_14620 gene ileS 34117 37266 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_14620 37544 37353 gene locus_tag LOCUS_14630 37544 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 38363 37632 gene locus_tag LOCUS_14640 38363 37632 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037558.1 protein_id gnl|my_center|LOCUS_14640 38464 39390 gene locus_tag LOCUS_14650 38464 39390 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037557.1 protein_id gnl|my_center|LOCUS_14650 39387 40481 gene locus_tag LOCUS_14660 gene lhpB 39387 40481 CDS product D-hydroxyproline dehydrogenase subunit beta LhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114955.1 protein_id gnl|my_center|LOCUS_14660 40474 40713 gene locus_tag LOCUS_14670 40474 40713 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037555.1 protein_id gnl|my_center|LOCUS_14670 40703 41887 gene locus_tag LOCUS_14680 40703 41887 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 protein_id gnl|my_center|LOCUS_14680 41884 42813 gene locus_tag LOCUS_14690 41884 42813 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_14690 42810 44294 gene locus_tag LOCUS_14700 42810 44294 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_14700 46548 44272 gene locus_tag LOCUS_14710 46548 44272 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_14710 49092 46807 gene locus_tag LOCUS_14720 49092 46807 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927300.1 protein_id gnl|my_center|LOCUS_14720 50063 49290 gene locus_tag LOCUS_14730 50063 49290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 51001 50060 gene locus_tag LOCUS_14740 51001 50060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626612.1 protein_id gnl|my_center|LOCUS_14740 51414 50998 gene locus_tag LOCUS_14750 51414 50998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 52474 51572 gene locus_tag LOCUS_14760 gene miaA 52474 51572 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888325.1 protein_id gnl|my_center|LOCUS_14760 52587 52970 gene locus_tag LOCUS_14770 52587 52970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 53058 54143 gene locus_tag LOCUS_14780 53058 54143 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480088.1 protein_id gnl|my_center|LOCUS_14780 54124 55029 gene locus_tag LOCUS_14790 54124 55029 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888939.1 protein_id gnl|my_center|LOCUS_14790 57849 55096 gene locus_tag LOCUS_14800 57849 55096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 59260 58199 gene locus_tag LOCUS_14810 59260 58199 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888452.1 protein_id gnl|my_center|LOCUS_14810 60395 59628 gene locus_tag LOCUS_14820 gene map 60395 59628 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480012.1 protein_id gnl|my_center|LOCUS_14820 60524 60784 gene locus_tag LOCUS_14830 60524 60784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 61257 60805 gene locus_tag LOCUS_14840 61257 60805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 64296 61348 gene locus_tag LOCUS_14850 64296 61348 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_14850 64702 65319 gene locus_tag LOCUS_14860 64702 65319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 66358 65453 gene locus_tag LOCUS_14870 66358 65453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 66708 66355 gene locus_tag LOCUS_14880 66708 66355 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071043.1 protein_id gnl|my_center|LOCUS_14880 68343 66895 gene locus_tag LOCUS_14890 68343 66895 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889263.1 protein_id gnl|my_center|LOCUS_14890 69830 68340 gene locus_tag LOCUS_14900 69830 68340 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970054.1 protein_id gnl|my_center|LOCUS_14900 70459 69827 gene locus_tag LOCUS_14910 70459 69827 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259201.1 protein_id gnl|my_center|LOCUS_14910 71807 70452 gene locus_tag LOCUS_14920 71807 70452 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259200.1 protein_id gnl|my_center|LOCUS_14920 73051 72011 gene locus_tag LOCUS_14930 gene potD 73051 72011 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772485.1 protein_id gnl|my_center|LOCUS_14930 73839 73048 gene locus_tag LOCUS_14940 73839 73048 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228542.1 protein_id gnl|my_center|LOCUS_14940 74741 73836 gene locus_tag LOCUS_14950 74741 73836 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887945.1 protein_id gnl|my_center|LOCUS_14950 75775 74738 gene locus_tag LOCUS_14960 gene potA 75775 74738 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005253.1 protein_id gnl|my_center|LOCUS_14960 77067 75772 gene locus_tag LOCUS_14970 gene gabT 77067 75772 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103055.1 protein_id gnl|my_center|LOCUS_14970 78641 77151 gene locus_tag LOCUS_14980 78641 77151 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_14980 78742 79914 gene locus_tag LOCUS_14990 78742 79914 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888092.1 protein_id gnl|my_center|LOCUS_14990 80030 80170 gene locus_tag LOCUS_15000 80030 80170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 80298 80945 gene locus_tag LOCUS_15010 80298 80945 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_15010 82230 81010 gene locus_tag LOCUS_15020 gene ispG 82230 81010 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_15020 83425 82307 gene locus_tag LOCUS_15030 83425 82307 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618910.1 protein_id gnl|my_center|LOCUS_15030 83633 84400 gene locus_tag LOCUS_15040 83633 84400 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_15040 84431 84910 gene locus_tag LOCUS_15050 84431 84910 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251763.1 protein_id gnl|my_center|LOCUS_15050 85354 84911 gene locus_tag LOCUS_15060 gene cynS 85354 84911 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194284.1 protein_id gnl|my_center|LOCUS_15060 87109 85517 gene locus_tag LOCUS_15070 87109 85517 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349485.1 protein_id gnl|my_center|LOCUS_15070 90342 87268 gene locus_tag LOCUS_15080 90342 87268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 93795 90628 gene locus_tag LOCUS_15090 93795 90628 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888171.1 protein_id gnl|my_center|LOCUS_15090 94722 93988 gene locus_tag LOCUS_15100 94722 93988 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479969.1 protein_id gnl|my_center|LOCUS_15100 95500 94742 gene locus_tag LOCUS_15110 gene aroE 95500 94742 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081608222.1 protein_id gnl|my_center|LOCUS_15110 95779 98307 gene locus_tag LOCUS_15120 95779 98307 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618777.1 protein_id gnl|my_center|LOCUS_15120 98600 98364 gene locus_tag LOCUS_15130 98600 98364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 99337 98693 gene locus_tag LOCUS_15140 gene pdxH 99337 98693 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_15140 100294 99404 gene locus_tag LOCUS_15150 100294 99404 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889314.1 protein_id gnl|my_center|LOCUS_15150 100913 100302 gene locus_tag LOCUS_15160 100913 100302 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_15160 101037 102005 gene locus_tag LOCUS_15170 101037 102005 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350512.1 protein_id gnl|my_center|LOCUS_15170 102002 102691 gene locus_tag LOCUS_15180 102002 102691 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_15180 102763 103023 gene locus_tag LOCUS_15190 102763 103023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 103023 104063 gene locus_tag LOCUS_15200 103023 104063 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871086.1 protein_id gnl|my_center|LOCUS_15200 104091 104624 gene locus_tag LOCUS_15210 gene ybeY 104091 104624 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479950.1 protein_id gnl|my_center|LOCUS_15210 104651 105049 gene locus_tag LOCUS_15220 104651 105049 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228397.1 protein_id gnl|my_center|LOCUS_15220 105046 105438 gene locus_tag LOCUS_15230 gene cdd 105046 105438 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888808.1 protein_id gnl|my_center|LOCUS_15230 107152 105554 gene locus_tag LOCUS_15240 107152 105554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 108340 107255 gene locus_tag LOCUS_15250 gene cax 108340 107255 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 protein_id gnl|my_center|LOCUS_15250 108518 110839 gene locus_tag LOCUS_15260 gene recG 108518 110839 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479810.1 protein_id gnl|my_center|LOCUS_15260 111083 112795 gene locus_tag LOCUS_15270 111083 112795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 113145 116111 gene locus_tag LOCUS_15280 gene uvrA 113145 116111 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888406.1 protein_id gnl|my_center|LOCUS_15280 116108 116593 gene locus_tag LOCUS_15290 116108 116593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 116621 117319 gene locus_tag LOCUS_15300 116621 117319 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479991.1 protein_id gnl|my_center|LOCUS_15300 117428 118207 gene locus_tag LOCUS_15310 117428 118207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 118801 118232 gene locus_tag LOCUS_15320 118801 118232 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_15320 119896 118889 gene locus_tag LOCUS_15330 gene galE 119896 118889 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_15330 121281 120028 gene locus_tag LOCUS_15340 121281 120028 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887749.1 protein_id gnl|my_center|LOCUS_15340 122368 121445 gene locus_tag LOCUS_15350 122368 121445 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887752.1 protein_id gnl|my_center|LOCUS_15350 122892 122353 gene locus_tag LOCUS_15360 gene pyrR 122892 122353 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_15360 123342 123875 gene locus_tag LOCUS_15370 123342 123875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 124026 124697 gene locus_tag LOCUS_15380 124026 124697 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_15380 124917 124768 gene locus_tag LOCUS_15390 124917 124768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 125063 126091 gene locus_tag LOCUS_15400 gene pstS 125063 126091 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_15400 126178 127803 gene locus_tag LOCUS_15410 126178 127803 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350668.1 protein_id gnl|my_center|LOCUS_15410 127874 128749 gene locus_tag LOCUS_15420 127874 128749 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_15420 129555 128824 gene locus_tag LOCUS_15430 129555 128824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 129652 130248 gene locus_tag LOCUS_15440 129652 130248 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480036.1 protein_id gnl|my_center|LOCUS_15440 130864 130355 gene locus_tag LOCUS_15450 130864 130355 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888029.1 protein_id gnl|my_center|LOCUS_15450 131052 130861 gene locus_tag LOCUS_15460 131052 130861 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_15460 131950 131141 gene locus_tag LOCUS_15470 131950 131141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 132411 131947 gene locus_tag LOCUS_15480 132411 131947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888045.1 protein_id gnl|my_center|LOCUS_15480 133463 132408 gene locus_tag LOCUS_15490 133463 132408 CDS product Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888046.1 protein_id gnl|my_center|LOCUS_15490 133579 136491 gene locus_tag LOCUS_15500 133579 136491 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479509.1 protein_id gnl|my_center|LOCUS_15500 137297 136566 gene locus_tag LOCUS_15510 137297 136566 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479643.1 protein_id gnl|my_center|LOCUS_15510 137590 138159 gene locus_tag LOCUS_15520 137590 138159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 139518 138220 gene locus_tag LOCUS_15530 gene aspS 139518 138220 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887698.1 protein_id gnl|my_center|LOCUS_15530 139961 140803 gene locus_tag LOCUS_15540 139961 140803 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888619.1 protein_id gnl|my_center|LOCUS_15540 140886 142139 gene locus_tag LOCUS_15550 140886 142139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 142849 142220 gene locus_tag LOCUS_15560 142849 142220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632535.1 protein_id gnl|my_center|LOCUS_15560 142946 144064 gene locus_tag LOCUS_15570 142946 144064 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228631.1 protein_id gnl|my_center|LOCUS_15570 144696 144139 gene locus_tag LOCUS_15580 144696 144139 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888275.1 protein_id gnl|my_center|LOCUS_15580 144815 145591 gene locus_tag LOCUS_15590 144815 145591 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095898091.1 protein_id gnl|my_center|LOCUS_15590 147186 145660 gene locus_tag LOCUS_15600 gene malQ 147186 145660 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479885.1 protein_id gnl|my_center|LOCUS_15600 148259 147333 gene locus_tag LOCUS_15610 148259 147333 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804290.1 protein_id gnl|my_center|LOCUS_15610 148816 148256 gene locus_tag LOCUS_15620 148816 148256 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350207.1 protein_id gnl|my_center|LOCUS_15620 149241 148873 gene locus_tag LOCUS_15630 149241 148873 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_15630 150911 149310 gene locus_tag LOCUS_15640 150911 149310 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479527.1 protein_id gnl|my_center|LOCUS_15640 153163 151010 gene locus_tag LOCUS_15650 153163 151010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 153753 153160 gene locus_tag LOCUS_15660 153753 153160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 154455 153754 gene locus_tag LOCUS_15670 154455 153754 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479676.1 protein_id gnl|my_center|LOCUS_15670 155554 154460 gene locus_tag LOCUS_15680 155554 154460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 157071 155551 gene locus_tag LOCUS_15690 157071 155551 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887582.1 protein_id gnl|my_center|LOCUS_15690 158184 157156 gene locus_tag LOCUS_15700 gene rlmN 158184 157156 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887581.1 protein_id gnl|my_center|LOCUS_15700 158757 158338 gene locus_tag LOCUS_15710 158757 158338 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244797.1 protein_id gnl|my_center|LOCUS_15710 161151 158926 gene locus_tag LOCUS_15720 161151 158926 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479827.1 protein_id gnl|my_center|LOCUS_15720 161832 161227 gene locus_tag LOCUS_15730 161832 161227 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391994.1 protein_id gnl|my_center|LOCUS_15730 162660 161956 gene locus_tag LOCUS_15740 162660 161956 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391993.1 protein_id gnl|my_center|LOCUS_15740 162705 163514 gene locus_tag LOCUS_15750 162705 163514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 164522 163515 gene locus_tag LOCUS_15760 164522 163515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391992.1 protein_id gnl|my_center|LOCUS_15760 164675 165682 gene locus_tag LOCUS_15770 164675 165682 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172884.1 protein_id gnl|my_center|LOCUS_15770 165663 166313 gene locus_tag LOCUS_15780 gene mnmD 165663 166313 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479902.1 protein_id gnl|my_center|LOCUS_15780 166310 167269 gene locus_tag LOCUS_15790 166310 167269 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869575.1 protein_id gnl|my_center|LOCUS_15790 167381 168379 gene locus_tag LOCUS_15800 167381 168379 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888309.1 protein_id gnl|my_center|LOCUS_15800 168620 169450 gene locus_tag LOCUS_15810 168620 169450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 170243 169455 gene locus_tag LOCUS_15820 170243 169455 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_15820 170432 170983 gene locus_tag LOCUS_15830 170432 170983 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888187.1 protein_id gnl|my_center|LOCUS_15830 171640 171095 gene locus_tag LOCUS_15840 171640 171095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 172397 171798 gene locus_tag LOCUS_15850 172397 171798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 174233 172452 gene locus_tag LOCUS_15860 gene typA 174233 172452 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_15860 174503 174428 gene locus_tag LOCUS_t00220 174503 174428 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 174692 175588 gene locus_tag LOCUS_15870 174692 175588 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_15870 175585 176190 gene locus_tag LOCUS_15880 175585 176190 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887480.1 protein_id gnl|my_center|LOCUS_15880 176187 177065 gene locus_tag LOCUS_15890 176187 177065 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479830.1 protein_id gnl|my_center|LOCUS_15890 177513 177079 gene locus_tag LOCUS_15900 177513 177079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 178524 177526 gene locus_tag LOCUS_15910 gene moaA 178524 177526 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243488.1 protein_id gnl|my_center|LOCUS_15910 179256 178576 gene locus_tag LOCUS_15920 179256 178576 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887056.1 protein_id gnl|my_center|LOCUS_15920 179337 180947 gene locus_tag LOCUS_15930 179337 180947 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479846.1 protein_id gnl|my_center|LOCUS_15930 180949 181701 gene locus_tag LOCUS_15940 180949 181701 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887189.1 protein_id gnl|my_center|LOCUS_15940 181704 181961 gene locus_tag LOCUS_15950 181704 181961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 184979 182124 gene locus_tag LOCUS_15960 184979 182124 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102209.1 protein_id gnl|my_center|LOCUS_15960 186711 185191 gene locus_tag LOCUS_15970 186711 185191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918445.1 protein_id gnl|my_center|LOCUS_15970 187747 187103 gene locus_tag LOCUS_15980 gene pgmB 187747 187103 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228210.1 protein_id gnl|my_center|LOCUS_15980 190092 187744 gene locus_tag LOCUS_15990 190092 187744 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_15990 190366 191454 gene locus_tag LOCUS_16000 gene truD 190366 191454 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479835.1 protein_id gnl|my_center|LOCUS_16000 191396 191839 gene locus_tag LOCUS_16010 191396 191839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 191940 193661 gene locus_tag LOCUS_16020 191940 193661 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888829.1 protein_id gnl|my_center|LOCUS_16020 193671 194795 gene locus_tag LOCUS_16030 193671 194795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 194895 196073 gene locus_tag LOCUS_16040 gene pilM 194895 196073 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_16040 196066 196752 gene locus_tag LOCUS_16050 196066 196752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887417.1 protein_id gnl|my_center|LOCUS_16050 196749 197405 gene locus_tag LOCUS_16060 196749 197405 CDS product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887418.1 protein_id gnl|my_center|LOCUS_16060 197402 198400 gene locus_tag LOCUS_16070 197402 198400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 198404 200701 gene locus_tag LOCUS_16080 198404 200701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 200799 201950 gene locus_tag LOCUS_16090 gene aroC 200799 201950 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887421.1 protein_id gnl|my_center|LOCUS_16090 201993 202559 gene locus_tag LOCUS_16100 201993 202559 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350371.1 protein_id gnl|my_center|LOCUS_16100 202531 203553 gene locus_tag LOCUS_16110 gene aroB 202531 203553 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887423.1 protein_id gnl|my_center|LOCUS_16110 203691 204125 gene locus_tag LOCUS_16120 gene aroQ 203691 204125 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887424.1 protein_id gnl|my_center|LOCUS_16120 204122 205255 gene locus_tag LOCUS_16130 204122 205255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 206212 205259 gene locus_tag LOCUS_16140 206212 205259 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480066.1 protein_id gnl|my_center|LOCUS_16140 208938 206314 gene locus_tag LOCUS_16150 208938 206314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 209540 210412 gene locus_tag LOCUS_16160 209540 210412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 211625 210420 gene locus_tag LOCUS_16170 211625 210420 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888092.1 protein_id gnl|my_center|LOCUS_16170 212317 211691 gene locus_tag LOCUS_16180 212317 211691 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880861.1 protein_id gnl|my_center|LOCUS_16180 212678 212328 gene locus_tag LOCUS_16190 212678 212328 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044173324.1 protein_id gnl|my_center|LOCUS_16190 213006 212689 gene locus_tag LOCUS_16200 213006 212689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 213105 213815 gene locus_tag LOCUS_16210 213105 213815 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349631.1 protein_id gnl|my_center|LOCUS_16210 213812 214585 gene locus_tag LOCUS_16220 213812 214585 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230235.1 protein_id gnl|my_center|LOCUS_16220 214603 215373 gene locus_tag LOCUS_16230 214603 215373 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993974.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 215550 216893 gene locus_tag LOCUS_16240 215550 216893 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_16240 216999 217220 gene locus_tag LOCUS_16250 216999 217220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 217507 218730 gene locus_tag LOCUS_16260 217507 218730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 219794 218802 gene locus_tag LOCUS_16270 gene ilvA 219794 218802 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259722.1 protein_id gnl|my_center|LOCUS_16270 219837 221240 gene locus_tag LOCUS_16280 219837 221240 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_16280 221320 221790 gene locus_tag LOCUS_16290 221320 221790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 222032 223060 gene locus_tag LOCUS_16300 222032 223060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 224609 223083 gene locus_tag LOCUS_16310 224609 223083 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887610.1 protein_id gnl|my_center|LOCUS_16310 224702 225151 gene locus_tag LOCUS_16320 224702 225151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 227283 225319 gene locus_tag LOCUS_16330 227283 225319 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888111.1 protein_id gnl|my_center|LOCUS_16330 229193 227796 gene locus_tag LOCUS_16340 229193 227796 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480147.1 protein_id gnl|my_center|LOCUS_16340 229544 231406 gene locus_tag LOCUS_16350 gene ftsH 229544 231406 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480146.1 protein_id gnl|my_center|LOCUS_16350 231500 232303 gene locus_tag LOCUS_16360 gene minD 231500 232303 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479992.1 protein_id gnl|my_center|LOCUS_16360 232303 232542 gene locus_tag LOCUS_16370 232303 232542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 233029 232703 gene locus_tag LOCUS_16380 233029 232703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 234002 233124 gene locus_tag LOCUS_16390 234002 233124 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_16390 234946 233999 gene locus_tag LOCUS_16400 234946 233999 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_16400 236509 234953 gene locus_tag LOCUS_16410 236509 234953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 236939 237322 gene locus_tag LOCUS_16420 236939 237322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 239207 237378 gene locus_tag LOCUS_16430 239207 237378 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_16430 240429 239392 gene locus_tag LOCUS_16440 gene tdh 240429 239392 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094910.1 protein_id gnl|my_center|LOCUS_16440 241622 240426 gene locus_tag LOCUS_16450 241622 240426 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772253.1 protein_id gnl|my_center|LOCUS_16450 243091 241820 gene locus_tag LOCUS_16460 243091 241820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_16460 243927 243394 gene locus_tag LOCUS_16470 243927 243394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 244559 243924 gene locus_tag LOCUS_16480 244559 243924 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888009.1 protein_id gnl|my_center|LOCUS_16480 244923 247439 gene locus_tag LOCUS_16490 244923 247439 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887024.1 protein_id gnl|my_center|LOCUS_16490 249103 247541 gene locus_tag LOCUS_16500 249103 247541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 249856 249116 gene locus_tag LOCUS_16510 gene lptB 249856 249116 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888765.1 protein_id gnl|my_center|LOCUS_16510 250634 249942 gene locus_tag LOCUS_16520 250634 249942 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479948.1 protein_id gnl|my_center|LOCUS_16520 251520 250954 gene locus_tag LOCUS_16530 251520 250954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 251960 251664 gene locus_tag LOCUS_16540 251960 251664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 253138 252014 gene locus_tag LOCUS_16550 253138 252014 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349607.1 protein_id gnl|my_center|LOCUS_16550 253353 254417 gene locus_tag LOCUS_16560 253353 254417 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479637.1 protein_id gnl|my_center|LOCUS_16560 254525 255304 gene locus_tag LOCUS_16570 254525 255304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 255304 256440 gene locus_tag LOCUS_16580 255304 256440 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618821.1 protein_id gnl|my_center|LOCUS_16580 256593 257825 gene locus_tag LOCUS_16590 256593 257825 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888819.1 protein_id gnl|my_center|LOCUS_16590 258393 257905 gene locus_tag LOCUS_16600 gene folK 258393 257905 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886816.1 protein_id gnl|my_center|LOCUS_16600 259187 258390 gene locus_tag LOCUS_16610 259187 258390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 259886 259323 gene locus_tag LOCUS_16620 259886 259323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 260835 260032 gene locus_tag LOCUS_16630 gene folP 260835 260032 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886814.1 protein_id gnl|my_center|LOCUS_16630 261423 260911 gene locus_tag LOCUS_16640 261423 260911 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102722.1 protein_id gnl|my_center|LOCUS_16640 261920 261426 gene locus_tag LOCUS_16650 261920 261426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_16650 262083 263006 gene locus_tag LOCUS_16660 262083 263006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 263425 267105 gene locus_tag LOCUS_16670 263425 267105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 267200 267766 gene locus_tag LOCUS_16680 267200 267766 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885396.1 protein_id gnl|my_center|LOCUS_16680 268466 267894 gene locus_tag LOCUS_16690 268466 267894 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027533.1 protein_id gnl|my_center|LOCUS_16690 268855 268457 gene locus_tag LOCUS_16700 268855 268457 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968136.1 protein_id gnl|my_center|LOCUS_16700 268957 269841 gene locus_tag LOCUS_16710 268957 269841 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 protein_id gnl|my_center|LOCUS_16710 270481 269843 gene locus_tag LOCUS_16720 270481 269843 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510731.1 protein_id gnl|my_center|LOCUS_16720 270783 270535 gene locus_tag LOCUS_16730 270783 270535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 270930 271358 gene locus_tag LOCUS_16740 270930 271358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 271597 272211 gene locus_tag LOCUS_16750 271597 272211 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 protein_id gnl|my_center|LOCUS_16750 272196 272813 gene locus_tag LOCUS_16760 272196 272813 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_16760 272810 274261 gene locus_tag LOCUS_16770 272810 274261 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886942.1 protein_id gnl|my_center|LOCUS_16770 274495 275376 gene locus_tag LOCUS_16780 274495 275376 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174516.1 protein_id gnl|my_center|LOCUS_16780 275504 276079 gene locus_tag LOCUS_16790 275504 276079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 276228 277469 gene locus_tag LOCUS_16800 gene icd 276228 277469 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_16800 277754 277539 gene locus_tag LOCUS_16810 277754 277539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 279373 277856 gene locus_tag LOCUS_16820 gene guaA 279373 277856 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888509.1 protein_id gnl|my_center|LOCUS_16820 280942 279782 gene locus_tag LOCUS_16830 280942 279782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 281336 282391 gene locus_tag LOCUS_16840 281336 282391 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887641.1 protein_id gnl|my_center|LOCUS_16840 282397 283020 gene locus_tag LOCUS_16850 282397 283020 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887642.1 protein_id gnl|my_center|LOCUS_16850 283173 283550 gene locus_tag LOCUS_16860 283173 283550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 283963 283574 gene locus_tag LOCUS_16870 283963 283574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887645.1 protein_id gnl|my_center|LOCUS_16870 285783 283966 gene locus_tag LOCUS_16880 285783 283966 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_16880 286595 285990 gene locus_tag LOCUS_16890 286595 285990 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227771.1 protein_id gnl|my_center|LOCUS_16890 286709 287851 gene locus_tag LOCUS_16900 286709 287851 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349636.1 protein_id gnl|my_center|LOCUS_16900 287966 289354 gene locus_tag LOCUS_16910 gene rpoD 287966 289354 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869017.1 protein_id gnl|my_center|LOCUS_16910 290046 289429 gene locus_tag LOCUS_16920 290046 289429 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887810.1 protein_id gnl|my_center|LOCUS_16920 290233 291087 gene locus_tag LOCUS_16930 290233 291087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 291493 291062 gene locus_tag LOCUS_16940 291493 291062 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_16940 292724 291495 gene locus_tag LOCUS_16950 292724 291495 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_16950 293095 295398 gene locus_tag LOCUS_16960 293095 295398 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567519.1 protein_id gnl|my_center|LOCUS_16960 295479 295709 gene locus_tag LOCUS_16970 295479 295709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886772.1 protein_id gnl|my_center|LOCUS_16970 295754 296368 gene locus_tag LOCUS_16980 295754 296368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 296413 297492 gene locus_tag LOCUS_16990 296413 297492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480301.1 protein_id gnl|my_center|LOCUS_16990 297697 298458 gene locus_tag LOCUS_17000 297697 298458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 298460 298627 gene locus_tag LOCUS_17010 298460 298627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 299146 298925 gene locus_tag LOCUS_17020 299146 298925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888507.1 protein_id gnl|my_center|LOCUS_17020 299301 300590 gene locus_tag LOCUS_17030 gene murA 299301 300590 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887766.1 protein_id gnl|my_center|LOCUS_17030 300791 301879 gene locus_tag LOCUS_17040 gene prfA 300791 301879 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349619.1 protein_id gnl|my_center|LOCUS_17040 301889 302383 gene locus_tag LOCUS_17050 301889 302383 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887620.1 protein_id gnl|my_center|LOCUS_17050 303043 302426 gene locus_tag LOCUS_17060 303043 302426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 304054 303068 gene locus_tag LOCUS_17070 304054 303068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 305241 304195 gene locus_tag LOCUS_17080 305241 304195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 305741 305340 gene locus_tag LOCUS_17090 305741 305340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 307743 305923 gene locus_tag LOCUS_17100 gene glmS 307743 305923 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480280.1 protein_id gnl|my_center|LOCUS_17100 308311 308126 gene locus_tag LOCUS_17110 308311 308126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 308495 308692 gene locus_tag LOCUS_17120 308495 308692 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480281.1 protein_id gnl|my_center|LOCUS_17120 308693 309793 gene locus_tag LOCUS_17130 308693 309793 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480282.1 protein_id gnl|my_center|LOCUS_17130 310288 309878 gene locus_tag LOCUS_17140 310288 309878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 312070 310463 gene locus_tag LOCUS_17150 gene pckA 312070 310463 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234944679.1 protein_id gnl|my_center|LOCUS_17150 312497 313714 gene locus_tag LOCUS_17160 gene glgC 312497 313714 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_17160 314848 313772 gene locus_tag LOCUS_17170 314848 313772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 315401 314850 gene locus_tag LOCUS_17180 315401 314850 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184030840.1 protein_id gnl|my_center|LOCUS_17180 316472 315423 gene locus_tag LOCUS_17190 316472 315423 CDS product RNA ligase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884030.1 protein_id gnl|my_center|LOCUS_17190 318132 316867 gene locus_tag LOCUS_17200 318132 316867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 319792 318392 gene locus_tag LOCUS_17210 319792 318392 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_17210 320986 319994 gene locus_tag LOCUS_17220 320986 319994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480209.1 protein_id gnl|my_center|LOCUS_17220 321353 322561 gene locus_tag LOCUS_17230 321353 322561 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926086.1 protein_id gnl|my_center|LOCUS_17230 322990 322577 gene locus_tag LOCUS_17240 322990 322577 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_17240 323557 323120 gene locus_tag LOCUS_17250 323557 323120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence05 404 174 gene locus_tag LOCUS_17260 404 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 573 1520 gene locus_tag LOCUS_17270 573 1520 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_17270 5246 1599 gene locus_tag LOCUS_17280 5246 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 5472 5642 gene locus_tag LOCUS_17290 5472 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 6257 7252 gene locus_tag LOCUS_17300 6257 7252 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_17300 7486 7304 gene locus_tag LOCUS_17310 7486 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 7614 8969 gene locus_tag LOCUS_17320 7614 8969 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258588.1 protein_id gnl|my_center|LOCUS_17320 9049 10032 gene locus_tag LOCUS_17330 9049 10032 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313059.1 protein_id gnl|my_center|LOCUS_17330 10032 10910 gene locus_tag LOCUS_17340 10032 10910 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_17340 12049 11066 gene locus_tag LOCUS_17350 gene nrdF 12049 11066 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203029.1 protein_id gnl|my_center|LOCUS_17350 14130 12037 gene locus_tag LOCUS_17360 gene nrdE 14130 12037 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_17360 14491 14054 gene locus_tag LOCUS_17370 gene nrdI 14491 14054 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922922.1 protein_id gnl|my_center|LOCUS_17370 14941 14741 gene locus_tag LOCUS_17380 14941 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 15657 15010 gene locus_tag LOCUS_17390 15657 15010 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888427.1 protein_id gnl|my_center|LOCUS_17390 16246 15635 gene locus_tag LOCUS_17400 16246 15635 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888428.1 protein_id gnl|my_center|LOCUS_17400 17270 16251 gene locus_tag LOCUS_17410 17270 16251 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_17410 18281 17271 gene locus_tag LOCUS_17420 18281 17271 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228817.1 protein_id gnl|my_center|LOCUS_17420 18461 18880 gene locus_tag LOCUS_17430 18461 18880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 19064 19519 gene locus_tag LOCUS_17440 19064 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 19527 20111 gene locus_tag LOCUS_17450 19527 20111 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143546.1 protein_id gnl|my_center|LOCUS_17450 20108 20539 gene locus_tag LOCUS_17460 20108 20539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928903.1 protein_id gnl|my_center|LOCUS_17460 21252 20617 gene locus_tag LOCUS_17470 21252 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 21393 21941 gene locus_tag LOCUS_17480 21393 21941 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207207.1 protein_id gnl|my_center|LOCUS_17480 24104 21945 gene locus_tag LOCUS_17490 24104 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 26318 24225 gene locus_tag LOCUS_17500 26318 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 26779 26531 gene locus_tag LOCUS_17510 26779 26531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 27044 27682 gene locus_tag LOCUS_17520 27044 27682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 28110 27742 gene locus_tag LOCUS_17530 28110 27742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 28310 28107 gene locus_tag LOCUS_17540 28310 28107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 28694 28314 gene locus_tag LOCUS_17550 28694 28314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 29246 30121 gene locus_tag LOCUS_17560 29246 30121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 30236 31942 gene locus_tag LOCUS_17570 30236 31942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 36505 32003 gene locus_tag LOCUS_17580 36505 32003 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228702.1 protein_id gnl|my_center|LOCUS_17580 36948 37217 gene locus_tag LOCUS_17590 36948 37217 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630673.1 protein_id gnl|my_center|LOCUS_17590 37431 38654 gene locus_tag LOCUS_17600 37431 38654 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479925.1 protein_id gnl|my_center|LOCUS_17600 38661 39071 gene locus_tag LOCUS_17610 38661 39071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 39290 39775 gene locus_tag LOCUS_17620 39290 39775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 39857 39939 gene locus_tag LOCUS_t00230 39857 39939 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39955 40176 gene locus_tag LOCUS_17630 39955 40176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 40528 41544 gene locus_tag LOCUS_17640 40528 41544 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_17640 41541 42560 gene locus_tag LOCUS_17650 41541 42560 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888206.1 protein_id gnl|my_center|LOCUS_17650 42706 43056 gene locus_tag LOCUS_17660 42706 43056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 43242 45107 gene locus_tag LOCUS_17670 43242 45107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 45144 45575 gene locus_tag LOCUS_17680 45144 45575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 45632 46969 gene locus_tag LOCUS_17690 45632 46969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 47068 48288 gene locus_tag LOCUS_17700 47068 48288 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887614.1 protein_id gnl|my_center|LOCUS_17700 48601 48422 gene locus_tag LOCUS_17710 48601 48422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 48725 49588 gene locus_tag LOCUS_17720 48725 49588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 49607 51784 gene locus_tag LOCUS_17730 gene scpA 49607 51784 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_17730 51771 52754 gene locus_tag LOCUS_17740 gene meaB 51771 52754 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479640.1 protein_id gnl|my_center|LOCUS_17740 52723 53073 gene locus_tag LOCUS_17750 52723 53073 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888258.1 protein_id gnl|my_center|LOCUS_17750 53127 54047 gene locus_tag LOCUS_17760 53127 54047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 54096 54515 gene locus_tag LOCUS_17770 54096 54515 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704076.1 protein_id gnl|my_center|LOCUS_17770 54590 55216 gene locus_tag LOCUS_17780 54590 55216 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861284.1 protein_id gnl|my_center|LOCUS_17780 55554 55279 gene locus_tag LOCUS_17790 gene rpsT 55554 55279 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887951.1 protein_id gnl|my_center|LOCUS_17790 55900 57216 gene locus_tag LOCUS_17800 55900 57216 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867488.1 protein_id gnl|my_center|LOCUS_17800 57195 57674 gene locus_tag LOCUS_17810 57195 57674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 57695 57771 gene locus_tag LOCUS_t00240 57695 57771 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 57844 58536 gene locus_tag LOCUS_17820 57844 58536 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887762.1 protein_id gnl|my_center|LOCUS_17820 58766 59530 gene locus_tag LOCUS_17830 58766 59530 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887924.1 protein_id gnl|my_center|LOCUS_17830 59530 62043 gene locus_tag LOCUS_17840 59530 62043 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887926.1 protein_id gnl|my_center|LOCUS_17840 64274 62337 gene locus_tag LOCUS_17850 64274 62337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 64410 64958 gene locus_tag LOCUS_17860 64410 64958 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888217.1 protein_id gnl|my_center|LOCUS_17860 65015 66031 gene locus_tag LOCUS_17870 gene queA 65015 66031 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888216.1 protein_id gnl|my_center|LOCUS_17870 66127 68184 gene locus_tag LOCUS_17880 66127 68184 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888294.1 protein_id gnl|my_center|LOCUS_17880 68337 69005 gene locus_tag LOCUS_17890 gene rpe 68337 69005 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174250.1 protein_id gnl|my_center|LOCUS_17890 68990 69697 gene locus_tag LOCUS_17900 68990 69697 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 protein_id gnl|my_center|LOCUS_17900 69803 70225 gene locus_tag LOCUS_17910 69803 70225 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_17910 70768 70340 gene locus_tag LOCUS_17920 gene rnhA 70768 70340 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887544.1 protein_id gnl|my_center|LOCUS_17920 71297 71016 gene locus_tag LOCUS_17930 71297 71016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 71567 71986 gene locus_tag LOCUS_17940 71567 71986 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618913.1 protein_id gnl|my_center|LOCUS_17940 72301 73119 gene locus_tag LOCUS_17950 72301 73119 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888839.1 protein_id gnl|my_center|LOCUS_17950 73159 73848 gene locus_tag LOCUS_17960 73159 73848 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887846.1 protein_id gnl|my_center|LOCUS_17960 73853 76537 gene locus_tag LOCUS_17970 73853 76537 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228363.1 protein_id gnl|my_center|LOCUS_17970 76542 77063 gene locus_tag LOCUS_17980 76542 77063 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888229.1 protein_id gnl|my_center|LOCUS_17980 77851 77135 gene locus_tag LOCUS_17990 77851 77135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 77987 78619 gene locus_tag LOCUS_18000 77987 78619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 78640 79980 gene locus_tag LOCUS_18010 78640 79980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 80066 80794 gene locus_tag LOCUS_18020 80066 80794 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_18020 81260 80796 gene locus_tag LOCUS_18030 81260 80796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 81470 83209 gene locus_tag LOCUS_18040 81470 83209 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 protein_id gnl|my_center|LOCUS_18040 83290 83709 gene locus_tag LOCUS_18050 83290 83709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884048.1 protein_id gnl|my_center|LOCUS_18050 83706 84359 gene locus_tag LOCUS_18060 83706 84359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226991426.1 protein_id gnl|my_center|LOCUS_18060 84356 85549 gene locus_tag LOCUS_18070 84356 85549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884049.1 protein_id gnl|my_center|LOCUS_18070 85778 86794 gene locus_tag LOCUS_18080 85778 86794 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_18080 86915 87343 gene locus_tag LOCUS_18090 86915 87343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 87891 87340 gene locus_tag LOCUS_18100 87891 87340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 87984 88991 gene locus_tag LOCUS_18110 87984 88991 CDS product IS630-like element ISDra3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480514.1 protein_id gnl|my_center|LOCUS_18110 89002 89535 gene locus_tag LOCUS_18120 89002 89535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 89546 90448 gene locus_tag LOCUS_18130 89546 90448 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026977.1 protein_id gnl|my_center|LOCUS_18130 90618 91934 gene locus_tag LOCUS_18140 90618 91934 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804375.1 protein_id gnl|my_center|LOCUS_18140 92022 93527 gene locus_tag LOCUS_18150 gene galA 92022 93527 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080136.1 protein_id gnl|my_center|LOCUS_18150 93691 94173 gene locus_tag LOCUS_18160 93691 94173 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887492.1 protein_id gnl|my_center|LOCUS_18160 94170 94847 gene locus_tag LOCUS_18170 gene rpiA 94170 94847 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887491.1 protein_id gnl|my_center|LOCUS_18170 94989 95237 gene locus_tag LOCUS_18180 94989 95237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 95980 95276 gene locus_tag LOCUS_18190 95980 95276 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_18190 96605 96117 gene locus_tag LOCUS_18200 96605 96117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 98899 96809 gene locus_tag LOCUS_18210 gene pta 98899 96809 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480235.1 protein_id gnl|my_center|LOCUS_18210 100077 98896 gene locus_tag LOCUS_18220 100077 98896 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085814.1 protein_id gnl|my_center|LOCUS_18220 101158 100259 gene locus_tag LOCUS_18230 101158 100259 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187219.1 protein_id gnl|my_center|LOCUS_18230 101589 101155 gene locus_tag LOCUS_18240 101589 101155 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612374.1 protein_id gnl|my_center|LOCUS_18240 101680 102141 gene locus_tag LOCUS_18250 101680 102141 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463567.1 protein_id gnl|my_center|LOCUS_18250 102168 102413 gene locus_tag LOCUS_18260 102168 102413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 102417 103046 gene locus_tag LOCUS_18270 102417 103046 CDS product MazG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887826.1 protein_id gnl|my_center|LOCUS_18270 103024 103590 gene locus_tag LOCUS_18280 103024 103590 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887827.1 protein_id gnl|my_center|LOCUS_18280 104240 103671 gene locus_tag LOCUS_18290 104240 103671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 104315 105274 gene locus_tag LOCUS_18300 104315 105274 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172506.1 protein_id gnl|my_center|LOCUS_18300 107239 105422 gene locus_tag LOCUS_18310 107239 105422 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173259.1 protein_id gnl|my_center|LOCUS_18310 107736 107236 gene locus_tag LOCUS_18320 107736 107236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 108506 107733 gene locus_tag LOCUS_18330 gene mreC 108506 107733 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228502.1 protein_id gnl|my_center|LOCUS_18330 109074 108499 gene locus_tag LOCUS_18340 109074 108499 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887849.1 protein_id gnl|my_center|LOCUS_18340 109304 110689 gene locus_tag LOCUS_18350 109304 110689 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349847.1 protein_id gnl|my_center|LOCUS_18350 110686 111699 gene locus_tag LOCUS_18360 gene ccpA 110686 111699 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103297.1 protein_id gnl|my_center|LOCUS_18360 112422 111718 gene locus_tag LOCUS_18370 112422 111718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 112624 113418 gene locus_tag LOCUS_18380 112624 113418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 113929 113447 gene locus_tag LOCUS_18390 113929 113447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 114509 114003 gene locus_tag LOCUS_18400 114509 114003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 116131 114506 gene locus_tag LOCUS_18410 116131 114506 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888387.1 protein_id gnl|my_center|LOCUS_18410 117731 116190 gene locus_tag LOCUS_18420 gene bshC 117731 116190 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479890.1 protein_id gnl|my_center|LOCUS_18420 118285 117728 gene locus_tag LOCUS_18430 118285 117728 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479889.1 protein_id gnl|my_center|LOCUS_18430 120470 118608 gene locus_tag LOCUS_18440 120470 118608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 121038 121520 gene locus_tag LOCUS_18450 121038 121520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 121549 121926 gene locus_tag LOCUS_18460 121549 121926 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886831.1 protein_id gnl|my_center|LOCUS_18460 122904 121945 gene locus_tag LOCUS_18470 122904 121945 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 protein_id gnl|my_center|LOCUS_18470 123041 123259 gene locus_tag LOCUS_18480 123041 123259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 124089 123610 gene locus_tag LOCUS_18490 124089 123610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 124340 124495 gene locus_tag LOCUS_18500 124340 124495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 125509 124499 gene locus_tag LOCUS_18510 125509 124499 CDS product DUF3298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042030482.1 protein_id gnl|my_center|LOCUS_18510 126908 125565 gene locus_tag LOCUS_18520 126908 125565 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887438.1 protein_id gnl|my_center|LOCUS_18520 127522 127004 gene locus_tag LOCUS_18530 127522 127004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 127770 128129 gene locus_tag LOCUS_18540 127770 128129 CDS product IPT/TIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480028.1 protein_id gnl|my_center|LOCUS_18540 128250 129527 gene locus_tag LOCUS_18550 gene hisS 128250 129527 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887990.1 protein_id gnl|my_center|LOCUS_18550 129604 131355 gene locus_tag LOCUS_18560 gene aspS 129604 131355 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480025.1 protein_id gnl|my_center|LOCUS_18560 131938 131510 gene locus_tag LOCUS_18570 131938 131510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 132169 133548 gene locus_tag LOCUS_18580 132169 133548 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948035.1 protein_id gnl|my_center|LOCUS_18580 136984 133607 gene locus_tag LOCUS_18590 136984 133607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 137262 137038 gene locus_tag LOCUS_18600 137262 137038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 137404 137204 gene locus_tag LOCUS_18610 137404 137204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 137568 138227 gene locus_tag LOCUS_18620 137568 138227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 138785 138324 gene locus_tag LOCUS_18630 138785 138324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 139009 140865 gene locus_tag LOCUS_18640 139009 140865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 140993 141718 gene locus_tag LOCUS_18650 140993 141718 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_18650 142389 141760 gene locus_tag LOCUS_18660 142389 141760 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350151.1 protein_id gnl|my_center|LOCUS_18660 143464 142391 gene locus_tag LOCUS_18670 143464 142391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 145236 143476 gene locus_tag LOCUS_18680 145236 143476 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888195.1 protein_id gnl|my_center|LOCUS_18680 145353 145676 gene locus_tag LOCUS_18690 145353 145676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 145964 145656 gene locus_tag LOCUS_18700 145964 145656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 146495 148075 gene locus_tag LOCUS_18710 146495 148075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 149963 148137 gene locus_tag LOCUS_18720 149963 148137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_18720 151038 150043 gene locus_tag LOCUS_18730 151038 150043 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_18730 151176 151496 gene locus_tag LOCUS_18740 151176 151496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 151719 151546 gene locus_tag LOCUS_18750 151719 151546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 152729 151947 gene locus_tag LOCUS_18760 gene trpA 152729 151947 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887587.1 protein_id gnl|my_center|LOCUS_18760 153985 152726 gene locus_tag LOCUS_18770 gene trpB 153985 152726 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349629.1 protein_id gnl|my_center|LOCUS_18770 154899 153985 gene locus_tag LOCUS_18780 gene gluQRS 154899 153985 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888322.1 protein_id gnl|my_center|LOCUS_18780 155108 155701 gene locus_tag LOCUS_18790 155108 155701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 155925 157277 gene locus_tag LOCUS_18800 155925 157277 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888111.1 protein_id gnl|my_center|LOCUS_18800 157274 157948 gene locus_tag LOCUS_18810 157274 157948 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887985.1 protein_id gnl|my_center|LOCUS_18810 158204 159196 gene locus_tag LOCUS_18820 158204 159196 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_18820 160575 159283 gene locus_tag LOCUS_18830 160575 159283 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_18830 161502 160621 gene locus_tag LOCUS_18840 161502 160621 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_18840 162141 161839 gene locus_tag LOCUS_18850 162141 161839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 162184 164028 gene locus_tag LOCUS_18860 gene uvrC 162184 164028 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887995.1 protein_id gnl|my_center|LOCUS_18860 164109 164351 gene locus_tag LOCUS_18870 164109 164351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 164420 165190 gene locus_tag LOCUS_18880 164420 165190 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887067.1 protein_id gnl|my_center|LOCUS_18880 166132 165224 gene locus_tag LOCUS_18890 166132 165224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 167106 166129 gene locus_tag LOCUS_18900 167106 166129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 167499 167128 gene locus_tag LOCUS_18910 167499 167128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 167571 168935 gene locus_tag LOCUS_18920 167571 168935 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_18920 169013 169789 gene locus_tag LOCUS_18930 169013 169789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 170767 169781 gene locus_tag LOCUS_18940 170767 169781 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082579.1 protein_id gnl|my_center|LOCUS_18940 170827 171411 gene locus_tag LOCUS_18950 170827 171411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 173238 171436 gene locus_tag LOCUS_18960 173238 171436 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889193.1 protein_id gnl|my_center|LOCUS_18960 173481 173912 gene locus_tag LOCUS_18970 173481 173912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 174008 174340 gene locus_tag LOCUS_18980 174008 174340 CDS product NADH-quinone oxidoreductase subunit 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480001.1 protein_id gnl|my_center|LOCUS_18980 174530 174276 gene locus_tag LOCUS_18990 174530 174276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 174454 175686 gene locus_tag LOCUS_19000 174454 175686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 176152 175688 gene locus_tag LOCUS_19010 176152 175688 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888697.1 protein_id gnl|my_center|LOCUS_19010 176982 176155 gene locus_tag LOCUS_19020 176982 176155 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228455.1 protein_id gnl|my_center|LOCUS_19020 177572 176979 gene locus_tag LOCUS_19030 gene nusB 177572 176979 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888698.1 protein_id gnl|my_center|LOCUS_19030 177900 177634 gene locus_tag LOCUS_19040 177900 177634 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888699.1 protein_id gnl|my_center|LOCUS_19040 178132 179679 gene locus_tag LOCUS_19050 178132 179679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 181793 179754 gene locus_tag LOCUS_19060 gene ligA 181793 179754 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871048.1 protein_id gnl|my_center|LOCUS_19060 182280 183386 gene locus_tag LOCUS_19070 182280 183386 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479956.1 protein_id gnl|my_center|LOCUS_19070 184313 183462 gene locus_tag LOCUS_19080 184313 183462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 184568 186106 gene locus_tag LOCUS_19090 184568 186106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887602.1 protein_id gnl|my_center|LOCUS_19090 187411 186155 gene locus_tag LOCUS_19100 gene bioA 187411 186155 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_19100 187994 187401 gene locus_tag LOCUS_19110 187994 187401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19110 188740 187991 gene locus_tag LOCUS_19120 gene bioC 188740 187991 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460024.1 protein_id gnl|my_center|LOCUS_19120 189327 188737 gene locus_tag LOCUS_19130 189327 188737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 190517 189354 gene locus_tag LOCUS_19140 gene bioF 190517 189354 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077285.1 protein_id gnl|my_center|LOCUS_19140 190659 193526 gene locus_tag LOCUS_19150 190659 193526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 194291 193587 gene locus_tag LOCUS_19160 gene queC 194291 193587 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_19160 194992 194300 gene locus_tag LOCUS_19170 194992 194300 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_19170 195388 194999 gene locus_tag LOCUS_19180 gene queD 195388 194999 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 protein_id gnl|my_center|LOCUS_19180 195681 196589 gene locus_tag LOCUS_19190 195681 196589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 197930 196677 gene locus_tag LOCUS_19200 gene purD 197930 196677 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480053.1 protein_id gnl|my_center|LOCUS_19200 198888 197941 gene locus_tag LOCUS_19210 198888 197941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 199054 199506 gene locus_tag LOCUS_19220 199054 199506 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480176.1 protein_id gnl|my_center|LOCUS_19220 199770 200801 gene locus_tag LOCUS_19230 199770 200801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 200826 202868 gene locus_tag LOCUS_19240 200826 202868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 202926 204104 gene locus_tag LOCUS_19250 202926 204104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 204149 204577 gene locus_tag LOCUS_19260 204149 204577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 205138 204665 gene locus_tag LOCUS_19270 205138 204665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 216708 205135 gene locus_tag LOCUS_19280 216708 205135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 216841 217581 gene locus_tag LOCUS_19290 216841 217581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19290 217587 218186 gene locus_tag LOCUS_19300 217587 218186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 218957 218214 gene locus_tag LOCUS_19310 218957 218214 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888282.1 protein_id gnl|my_center|LOCUS_19310 219664 218954 gene locus_tag LOCUS_19320 219664 218954 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888039.1 protein_id gnl|my_center|LOCUS_19320 219831 219655 gene locus_tag LOCUS_19330 219831 219655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 220809 219880 gene locus_tag LOCUS_19340 220809 219880 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765249.1 protein_id gnl|my_center|LOCUS_19340 221998 220874 gene locus_tag LOCUS_19350 221998 220874 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_19350 222978 221995 gene locus_tag LOCUS_19360 222978 221995 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_19360 224210 222975 gene locus_tag LOCUS_19370 224210 222975 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525271.1 protein_id gnl|my_center|LOCUS_19370 225070 224207 gene locus_tag LOCUS_19380 225070 224207 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257889.1 protein_id gnl|my_center|LOCUS_19380 226020 225067 gene locus_tag LOCUS_19390 226020 225067 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027842956.1 protein_id gnl|my_center|LOCUS_19390 227379 226078 gene locus_tag LOCUS_19400 227379 226078 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_19400 229290 227458 gene locus_tag LOCUS_19410 229290 227458 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_19410 229515 230477 gene locus_tag LOCUS_19420 229515 230477 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_19420 230907 232727 gene locus_tag LOCUS_19430 230907 232727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 233674 232787 gene locus_tag LOCUS_19440 233674 232787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_19440 233883 234695 gene locus_tag LOCUS_19450 233883 234695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 235226 234714 gene locus_tag LOCUS_19460 235226 234714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 235663 235223 gene locus_tag LOCUS_19470 235663 235223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 238994 235812 gene locus_tag LOCUS_19480 238994 235812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 240748 238991 gene locus_tag LOCUS_19490 240748 238991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 242301 240745 gene locus_tag LOCUS_19500 242301 240745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 243538 242426 gene locus_tag LOCUS_19510 243538 242426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 245793 243535 gene locus_tag LOCUS_19520 245793 243535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 247902 245833 gene locus_tag LOCUS_19530 247902 245833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 250021 247904 gene locus_tag LOCUS_19540 250021 247904 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941654.1 protein_id gnl|my_center|LOCUS_19540 250410 250021 gene locus_tag LOCUS_19550 250410 250021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 251874 250414 gene locus_tag LOCUS_19560 251874 250414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 252535 251891 gene locus_tag LOCUS_19570 252535 251891 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_19570 253584 252535 gene locus_tag LOCUS_19580 253584 252535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 253748 253581 gene locus_tag LOCUS_19590 253748 253581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 254500 253748 gene locus_tag LOCUS_19600 254500 253748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 254933 254493 gene locus_tag LOCUS_19610 254933 254493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 256615 254936 gene locus_tag LOCUS_19620 256615 254936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 257061 256624 gene locus_tag LOCUS_19630 257061 256624 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_19630 259260 257209 gene locus_tag LOCUS_19640 259260 257209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 260035 259313 gene locus_tag LOCUS_19650 260035 259313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 260631 260026 gene locus_tag LOCUS_19660 260631 260026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 260800 260624 gene locus_tag LOCUS_19670 260800 260624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 260926 262800 gene locus_tag LOCUS_19680 260926 262800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 265448 262878 gene locus_tag LOCUS_19690 265448 262878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 269049 265774 gene locus_tag LOCUS_19700 269049 265774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 269607 270620 gene locus_tag LOCUS_19710 269607 270620 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_19710 270742 271863 gene locus_tag LOCUS_19720 270742 271863 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_19720 271867 273063 gene locus_tag LOCUS_19730 271867 273063 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence06 172 273 gene locus_tag LOCUS_r00010 172 273 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 373 448 gene locus_tag LOCUS_t00250 373 448 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1449 514 gene locus_tag LOCUS_19740 gene fmt 1449 514 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889060.1 protein_id gnl|my_center|LOCUS_19740 2076 1453 gene locus_tag LOCUS_19750 gene def 2076 1453 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889059.1 protein_id gnl|my_center|LOCUS_19750 3021 2128 gene locus_tag LOCUS_19760 3021 2128 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886656.1 protein_id gnl|my_center|LOCUS_19760 3767 3018 gene locus_tag LOCUS_19770 gene cdaA 3767 3018 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177770.1 protein_id gnl|my_center|LOCUS_19770 4094 5431 gene locus_tag LOCUS_19780 4094 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351083.1 protein_id gnl|my_center|LOCUS_19780 5529 6455 gene locus_tag LOCUS_19790 5529 6455 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887048.1 protein_id gnl|my_center|LOCUS_19790 6486 7292 gene locus_tag LOCUS_19800 6486 7292 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_19800 8117 7569 gene locus_tag LOCUS_19810 8117 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 9440 8211 gene locus_tag LOCUS_19820 9440 8211 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887828.1 protein_id gnl|my_center|LOCUS_19820 10036 9608 gene locus_tag LOCUS_19830 10036 9608 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887201.1 protein_id gnl|my_center|LOCUS_19830 11396 10080 gene locus_tag LOCUS_19840 gene hemL 11396 10080 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479528.1 protein_id gnl|my_center|LOCUS_19840 13553 11469 gene locus_tag LOCUS_19850 gene dnaX 13553 11469 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480062.1 protein_id gnl|my_center|LOCUS_19850 13829 14212 gene locus_tag LOCUS_19860 gene mgsA 13829 14212 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228922.1 protein_id gnl|my_center|LOCUS_19860 14805 15197 gene locus_tag LOCUS_19870 14805 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 15317 15931 gene locus_tag LOCUS_19880 15317 15931 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888994.1 protein_id gnl|my_center|LOCUS_19880 15967 16761 gene locus_tag LOCUS_19890 15967 16761 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021026.1 protein_id gnl|my_center|LOCUS_19890 17578 16775 gene locus_tag LOCUS_19900 17578 16775 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588494.1 protein_id gnl|my_center|LOCUS_19900 17625 17963 gene locus_tag LOCUS_19910 17625 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 18300 18070 gene locus_tag LOCUS_19920 18300 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 18378 18851 gene locus_tag LOCUS_19930 18378 18851 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888871.1 protein_id gnl|my_center|LOCUS_19930 19583 18924 gene locus_tag LOCUS_19940 19583 18924 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 protein_id gnl|my_center|LOCUS_19940 21461 19917 gene locus_tag LOCUS_19950 gene murJ 21461 19917 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177570.1 protein_id gnl|my_center|LOCUS_19950 21538 21627 gene locus_tag LOCUS_t00260 21538 21627 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21906 22490 gene locus_tag LOCUS_19960 21906 22490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 22646 22783 gene locus_tag LOCUS_19970 22646 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 23752 22826 gene locus_tag LOCUS_19980 23752 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 24766 23882 gene locus_tag LOCUS_19990 gene nac 24766 23882 CDS product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399193.1 protein_id gnl|my_center|LOCUS_19990 24907 25827 gene locus_tag LOCUS_20000 24907 25827 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227827.1 protein_id gnl|my_center|LOCUS_20000 27163 25880 gene locus_tag LOCUS_20010 27163 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 28168 27341 gene locus_tag LOCUS_20020 28168 27341 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888839.1 protein_id gnl|my_center|LOCUS_20020 28733 30457 gene locus_tag LOCUS_20030 gene hflX 28733 30457 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480296.1 protein_id gnl|my_center|LOCUS_20030 30482 30895 gene locus_tag LOCUS_20040 30482 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 31154 32077 gene locus_tag LOCUS_20050 31154 32077 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228102.1 protein_id gnl|my_center|LOCUS_20050 32188 32733 gene locus_tag LOCUS_20060 32188 32733 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_20060 32733 34058 gene locus_tag LOCUS_20070 32733 34058 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173616429.1 protein_id gnl|my_center|LOCUS_20070 35212 34124 gene locus_tag LOCUS_20080 35212 34124 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_20080 36464 35385 gene locus_tag LOCUS_20090 36464 35385 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349615.1 protein_id gnl|my_center|LOCUS_20090 37410 36646 gene locus_tag LOCUS_20100 gene tatC 37410 36646 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_20100 37713 37510 gene locus_tag LOCUS_20110 gene tatA 37713 37510 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631606.1 protein_id gnl|my_center|LOCUS_20110 39277 37841 gene locus_tag LOCUS_20120 gene glmU 39277 37841 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479974.1 protein_id gnl|my_center|LOCUS_20120 40166 39270 gene locus_tag LOCUS_20130 40166 39270 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350359.1 protein_id gnl|my_center|LOCUS_20130 40389 40168 gene locus_tag LOCUS_20140 40389 40168 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886705.1 protein_id gnl|my_center|LOCUS_20140 40856 40386 gene locus_tag LOCUS_20150 40856 40386 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480055.1 protein_id gnl|my_center|LOCUS_20150 41274 42452 gene locus_tag LOCUS_20160 41274 42452 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_20160 42542 43378 gene locus_tag LOCUS_20170 42542 43378 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887711.1 protein_id gnl|my_center|LOCUS_20170 43596 44045 gene locus_tag LOCUS_20180 43596 44045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 44117 44677 gene locus_tag LOCUS_20190 44117 44677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 46154 47776 gene locus_tag LOCUS_20200 46154 47776 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887905.1 protein_id gnl|my_center|LOCUS_20200 49104 47938 gene locus_tag LOCUS_20210 49104 47938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 49395 50639 gene locus_tag LOCUS_20220 49395 50639 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_20220 51208 50672 gene locus_tag LOCUS_20230 51208 50672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 52682 51258 gene locus_tag LOCUS_20240 gene gltX 52682 51258 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227935.1 protein_id gnl|my_center|LOCUS_20240 53073 55775 gene locus_tag LOCUS_20250 53073 55775 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038297.1 protein_id gnl|my_center|LOCUS_20250 55772 56050 gene locus_tag LOCUS_20260 55772 56050 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_20260 57168 56068 gene locus_tag LOCUS_20270 57168 56068 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887564.1 protein_id gnl|my_center|LOCUS_20270 58094 57165 gene locus_tag LOCUS_20280 58094 57165 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887563.1 protein_id gnl|my_center|LOCUS_20280 59452 58091 gene locus_tag LOCUS_20290 59452 58091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 60460 59537 gene locus_tag LOCUS_20300 60460 59537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 61131 60496 gene locus_tag LOCUS_20310 61131 60496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 61255 61752 gene locus_tag LOCUS_20320 61255 61752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 62635 61817 gene locus_tag LOCUS_20330 gene pyrF 62635 61817 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479917.1 protein_id gnl|my_center|LOCUS_20330 62794 63864 gene locus_tag LOCUS_20340 62794 63864 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704793.1 protein_id gnl|my_center|LOCUS_20340 63861 64355 gene locus_tag LOCUS_20350 63861 64355 CDS product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970333.1 protein_id gnl|my_center|LOCUS_20350 64784 64422 gene locus_tag LOCUS_20360 gene rplT 64784 64422 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888637.1 protein_id gnl|my_center|LOCUS_20360 64987 64784 gene locus_tag LOCUS_20370 gene rpmI 64987 64784 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888638.1 protein_id gnl|my_center|LOCUS_20370 65250 65441 gene locus_tag LOCUS_20380 65250 65441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 65426 66508 gene locus_tag LOCUS_20390 65426 66508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 66519 67517 gene locus_tag LOCUS_20400 66519 67517 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888304.1 protein_id gnl|my_center|LOCUS_20400 67985 67581 gene locus_tag LOCUS_20410 67985 67581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 68706 68110 gene locus_tag LOCUS_20420 gene infC 68706 68110 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888718.1 protein_id gnl|my_center|LOCUS_20420 69308 69943 gene locus_tag LOCUS_20430 69308 69943 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886838.1 protein_id gnl|my_center|LOCUS_20430 70081 70380 gene locus_tag LOCUS_20440 70081 70380 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886845.1 protein_id gnl|my_center|LOCUS_20440 70382 70975 gene locus_tag LOCUS_20450 gene recR 70382 70975 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886844.1 protein_id gnl|my_center|LOCUS_20450 71553 71080 gene locus_tag LOCUS_20460 71553 71080 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887521.1 protein_id gnl|my_center|LOCUS_20460 74440 71969 gene locus_tag LOCUS_20470 74440 71969 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228025.1 protein_id gnl|my_center|LOCUS_20470 74768 75661 gene locus_tag LOCUS_20480 gene yedA 74768 75661 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212216.1 protein_id gnl|my_center|LOCUS_20480 76157 75597 gene locus_tag LOCUS_20490 76157 75597 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886987.1 protein_id gnl|my_center|LOCUS_20490 77194 76154 gene locus_tag LOCUS_20500 77194 76154 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886988.1 protein_id gnl|my_center|LOCUS_20500 77676 77191 gene locus_tag LOCUS_20510 77676 77191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 78185 77673 gene locus_tag LOCUS_20520 78185 77673 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_20520 80158 78182 gene locus_tag LOCUS_20530 80158 78182 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_20530 80616 80155 gene locus_tag LOCUS_20540 gene ccmE 80616 80155 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886992.1 protein_id gnl|my_center|LOCUS_20540 81418 80720 gene locus_tag LOCUS_20550 gene ccsA 81418 80720 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886993.1 protein_id gnl|my_center|LOCUS_20550 82252 81587 gene locus_tag LOCUS_20560 82252 81587 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887052.1 protein_id gnl|my_center|LOCUS_20560 82863 82249 gene locus_tag LOCUS_20570 gene ccmA 82863 82249 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_20570 83552 82866 gene locus_tag LOCUS_20580 83552 82866 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887942.1 protein_id gnl|my_center|LOCUS_20580 83969 83559 gene locus_tag LOCUS_20590 83969 83559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 86155 83966 gene locus_tag LOCUS_20600 86155 83966 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177182973.1 protein_id gnl|my_center|LOCUS_20600 86716 86318 gene locus_tag LOCUS_20610 86716 86318 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888057.1 protein_id gnl|my_center|LOCUS_20610 88547 86859 gene locus_tag LOCUS_20620 88547 86859 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888327.1 protein_id gnl|my_center|LOCUS_20620 88559 88813 gene locus_tag LOCUS_20630 88559 88813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 88810 89874 gene locus_tag LOCUS_20640 88810 89874 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_20640 90822 89881 gene locus_tag LOCUS_20650 90822 89881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 91471 90812 gene locus_tag LOCUS_20660 gene phoU 91471 90812 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888872.1 protein_id gnl|my_center|LOCUS_20660 92474 91524 gene locus_tag LOCUS_20670 92474 91524 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227733.1 protein_id gnl|my_center|LOCUS_20670 93181 92492 gene locus_tag LOCUS_20680 93181 92492 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888874.1 protein_id gnl|my_center|LOCUS_20680 93890 93243 gene locus_tag LOCUS_20690 93890 93243 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889182.1 protein_id gnl|my_center|LOCUS_20690 93930 94682 gene locus_tag LOCUS_20700 93930 94682 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_20700 94752 94931 gene locus_tag LOCUS_20710 94752 94931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 95135 95656 gene locus_tag LOCUS_20720 95135 95656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 97037 95667 gene locus_tag LOCUS_20730 97037 95667 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_20730 97166 97822 gene locus_tag LOCUS_20740 97166 97822 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920462.1 protein_id gnl|my_center|LOCUS_20740 98116 98041 gene locus_tag LOCUS_t00270 98116 98041 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 98773 98189 gene locus_tag LOCUS_20750 98773 98189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 100036 98927 gene locus_tag LOCUS_20760 100036 98927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_20760 100923 100033 gene locus_tag LOCUS_20770 100923 100033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_20770 102384 101050 gene locus_tag LOCUS_20780 102384 101050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 103172 102384 gene locus_tag LOCUS_20790 103172 102384 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618886.1 protein_id gnl|my_center|LOCUS_20790 104163 103429 gene locus_tag LOCUS_20800 104163 103429 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889173.1 protein_id gnl|my_center|LOCUS_20800 105564 104374 gene locus_tag LOCUS_20810 105564 104374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 105757 105557 gene locus_tag LOCUS_20820 105757 105557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 107226 105826 gene locus_tag LOCUS_20830 107226 105826 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887081.1 protein_id gnl|my_center|LOCUS_20830 107870 107226 gene locus_tag LOCUS_20840 107870 107226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 108749 107886 gene locus_tag LOCUS_20850 108749 107886 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177183020.1 protein_id gnl|my_center|LOCUS_20850 109728 108907 gene locus_tag LOCUS_20860 109728 108907 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_20860 109964 109740 gene locus_tag LOCUS_20870 109964 109740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 110640 109993 gene locus_tag LOCUS_20880 110640 109993 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887077.1 protein_id gnl|my_center|LOCUS_20880 110692 111156 gene locus_tag LOCUS_20890 110692 111156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 111389 112384 gene locus_tag LOCUS_20900 111389 112384 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228817.1 protein_id gnl|my_center|LOCUS_20900 112489 114057 gene locus_tag LOCUS_20910 112489 114057 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840173.1 protein_id gnl|my_center|LOCUS_20910 114054 115130 gene locus_tag LOCUS_20920 114054 115130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 protein_id gnl|my_center|LOCUS_20920 115191 115541 gene locus_tag LOCUS_20930 115191 115541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 118195 115682 gene locus_tag LOCUS_20940 118195 115682 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479940.1 protein_id gnl|my_center|LOCUS_20940 118376 118678 gene locus_tag LOCUS_20950 118376 118678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 119080 118718 gene locus_tag LOCUS_20960 119080 118718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 119339 120898 gene locus_tag LOCUS_20970 119339 120898 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479711.1 protein_id gnl|my_center|LOCUS_20970 120895 121434 gene locus_tag LOCUS_20980 gene cysC 120895 121434 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479712.1 protein_id gnl|my_center|LOCUS_20980 121439 122089 gene locus_tag LOCUS_20990 121439 122089 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349823.1 protein_id gnl|my_center|LOCUS_20990 122173 123324 gene locus_tag LOCUS_21000 gene sat 122173 123324 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889276.1 protein_id gnl|my_center|LOCUS_21000 124036 123434 gene locus_tag LOCUS_21010 124036 123434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 124544 124212 gene locus_tag LOCUS_21020 124544 124212 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776016.1 protein_id gnl|my_center|LOCUS_21020 125121 124711 gene locus_tag LOCUS_21030 125121 124711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 126342 125308 gene locus_tag LOCUS_21040 126342 125308 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_21040 126445 127500 gene locus_tag LOCUS_21050 gene gcvT 126445 127500 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479785.1 protein_id gnl|my_center|LOCUS_21050 127582 127953 gene locus_tag LOCUS_21060 gene gcvH 127582 127953 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888446.1 protein_id gnl|my_center|LOCUS_21060 128208 129797 gene locus_tag LOCUS_21070 128208 129797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 130194 129880 gene locus_tag LOCUS_21080 130194 129880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 130264 130857 gene locus_tag LOCUS_21090 130264 130857 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035734.1 protein_id gnl|my_center|LOCUS_21090 131175 130882 gene locus_tag LOCUS_21100 131175 130882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 131283 132137 gene locus_tag LOCUS_21110 131283 132137 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_21110 132193 132861 gene locus_tag LOCUS_21120 132193 132861 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_21120 133452 132877 gene locus_tag LOCUS_21130 133452 132877 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_21130 133574 133822 gene locus_tag LOCUS_21140 133574 133822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 133942 135252 gene locus_tag LOCUS_21150 133942 135252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 135236 135454 gene locus_tag LOCUS_21160 135236 135454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 135396 135551 gene locus_tag LOCUS_21170 135396 135551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 135604 136884 gene locus_tag LOCUS_21180 135604 136884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 137192 137662 gene locus_tag LOCUS_21190 137192 137662 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446112.1 protein_id gnl|my_center|LOCUS_21190 137696 138811 gene locus_tag LOCUS_21200 gene hppD 137696 138811 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_21200 138818 139984 gene locus_tag LOCUS_21210 138818 139984 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_21210 139981 140841 gene locus_tag LOCUS_21220 139981 140841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 140801 142126 gene locus_tag LOCUS_21230 gene fahA 140801 142126 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 protein_id gnl|my_center|LOCUS_21230 142123 142626 gene locus_tag LOCUS_21240 142123 142626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 142994 143494 gene locus_tag LOCUS_21250 142994 143494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 143954 143454 gene locus_tag LOCUS_21260 143954 143454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 145231 143969 gene locus_tag LOCUS_21270 145231 143969 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 protein_id gnl|my_center|LOCUS_21270 145480 145262 gene locus_tag LOCUS_21280 145480 145262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21280 146002 145505 gene locus_tag LOCUS_21290 146002 145505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21290 146824 146051 gene locus_tag LOCUS_21300 146824 146051 CDS product cystine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191674.1 protein_id gnl|my_center|LOCUS_21300 148038 147070 gene locus_tag LOCUS_21310 148038 147070 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 protein_id gnl|my_center|LOCUS_21310 149062 148253 gene locus_tag LOCUS_21320 149062 148253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21320 149034 149414 gene locus_tag LOCUS_21330 149034 149414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 149078 149087 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 149652 150623 gene locus_tag LOCUS_21340 149652 150623 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_21340 150674 151315 gene locus_tag LOCUS_21350 gene pcp 150674 151315 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_21350 153571 151385 gene locus_tag LOCUS_21360 153571 151385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 154170 153706 gene locus_tag LOCUS_21370 154170 153706 CDS product GspH/FimT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228522.1 protein_id gnl|my_center|LOCUS_21370 157216 154253 gene locus_tag LOCUS_21380 157216 154253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 157395 157625 gene locus_tag LOCUS_21390 157395 157625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 157781 158167 gene locus_tag LOCUS_21400 157781 158167 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349510.1 protein_id gnl|my_center|LOCUS_21400 160196 158253 gene locus_tag LOCUS_21410 160196 158253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 160363 161622 gene locus_tag LOCUS_21420 160363 161622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887966.1 protein_id gnl|my_center|LOCUS_21420 161855 161676 gene locus_tag LOCUS_21430 161855 161676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 163821 162073 gene locus_tag LOCUS_21440 163821 162073 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888050.1 protein_id gnl|my_center|LOCUS_21440 164936 163878 gene locus_tag LOCUS_21450 164936 163878 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888052.1 protein_id gnl|my_center|LOCUS_21450 165598 164933 gene locus_tag LOCUS_21460 165598 164933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 165697 166374 gene locus_tag LOCUS_21470 165697 166374 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887187.1 protein_id gnl|my_center|LOCUS_21470 169684 166616 gene locus_tag LOCUS_21480 gene carB 169684 166616 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887313.1 protein_id gnl|my_center|LOCUS_21480 170448 171647 gene locus_tag LOCUS_21490 170448 171647 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887319.1 protein_id gnl|my_center|LOCUS_21490 171854 172804 gene locus_tag LOCUS_21500 171854 172804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 172801 173283 gene locus_tag LOCUS_21510 172801 173283 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887321.1 protein_id gnl|my_center|LOCUS_21510 173280 174671 gene locus_tag LOCUS_21520 gene argH 173280 174671 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479496.1 protein_id gnl|my_center|LOCUS_21520 174702 175214 gene locus_tag LOCUS_21530 174702 175214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 175265 175789 gene locus_tag LOCUS_21540 175265 175789 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887328.1 protein_id gnl|my_center|LOCUS_21540 175786 176193 gene locus_tag LOCUS_21550 175786 176193 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431730.1 protein_id gnl|my_center|LOCUS_21550 176186 176326 gene locus_tag LOCUS_21560 176186 176326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 176323 177507 gene locus_tag LOCUS_21570 gene carA 176323 177507 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887329.1 protein_id gnl|my_center|LOCUS_21570 177855 178355 gene locus_tag LOCUS_21580 177855 178355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119628.1 protein_id gnl|my_center|LOCUS_21580 178374 181397 gene locus_tag LOCUS_21590 178374 181397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 181501 184812 gene locus_tag LOCUS_21600 181501 184812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 184809 190337 gene locus_tag LOCUS_21610 184809 190337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 190341 202019 gene locus_tag LOCUS_21620 190341 202019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 202772 203938 gene locus_tag LOCUS_21630 202772 203938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 204493 204104 gene locus_tag LOCUS_21640 204493 204104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 204689 205381 gene locus_tag LOCUS_21650 204689 205381 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479982.1 protein_id gnl|my_center|LOCUS_21650 206785 205385 gene locus_tag LOCUS_21660 206785 205385 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537927.1 protein_id gnl|my_center|LOCUS_21660 207116 208138 gene locus_tag LOCUS_21670 gene zapE 207116 208138 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887405.1 protein_id gnl|my_center|LOCUS_21670 208209 209915 gene locus_tag LOCUS_21680 208209 209915 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_21680 210042 211250 gene locus_tag LOCUS_21690 210042 211250 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889118.1 protein_id gnl|my_center|LOCUS_21690 211330 211638 gene locus_tag LOCUS_21700 211330 211638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 211882 213666 gene locus_tag LOCUS_21710 211882 213666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 213909 215303 gene locus_tag LOCUS_21720 213909 215303 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889294.1 protein_id gnl|my_center|LOCUS_21720 215304 216557 gene locus_tag LOCUS_21730 215304 216557 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_21730 216554 217693 gene locus_tag LOCUS_21740 gene glf 216554 217693 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 protein_id gnl|my_center|LOCUS_21740 217680 218891 gene locus_tag LOCUS_21750 217680 218891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 218959 219855 gene locus_tag LOCUS_21760 218959 219855 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112489.1 protein_id gnl|my_center|LOCUS_21760 219852 220778 gene locus_tag LOCUS_21770 219852 220778 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113718.1 protein_id gnl|my_center|LOCUS_21770 220814 221839 gene locus_tag LOCUS_21780 gene rfbB 220814 221839 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889301.1 protein_id gnl|my_center|LOCUS_21780 221836 222909 gene locus_tag LOCUS_21790 221836 222909 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_21790 222910 223458 gene locus_tag LOCUS_21800 222910 223458 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889303.1 protein_id gnl|my_center|LOCUS_21800 223455 224192 gene locus_tag LOCUS_21810 223455 224192 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349836.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence07 66 770 gene locus_tag LOCUS_21820 66 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1396 2370 gene locus_tag LOCUS_21830 1396 2370 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_21830 2499 4031 gene locus_tag LOCUS_21840 2499 4031 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525260.1 protein_id gnl|my_center|LOCUS_21840 4024 5022 gene locus_tag LOCUS_21850 4024 5022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525259.1 protein_id gnl|my_center|LOCUS_21850 5024 5989 gene locus_tag LOCUS_21860 5024 5989 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311691.1 protein_id gnl|my_center|LOCUS_21860 6553 8244 gene locus_tag LOCUS_21870 gene araB 6553 8244 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_21870 8222 8875 gene locus_tag LOCUS_21880 8222 8875 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_21880 8885 10387 gene locus_tag LOCUS_21890 gene araA 8885 10387 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776919.1 protein_id gnl|my_center|LOCUS_21890 10784 10482 gene locus_tag LOCUS_21900 10784 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 11190 11705 gene locus_tag LOCUS_21910 11190 11705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 11726 12502 gene locus_tag LOCUS_21920 11726 12502 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 protein_id gnl|my_center|LOCUS_21920 13153 12503 gene locus_tag LOCUS_21930 13153 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 13722 13150 gene locus_tag LOCUS_21940 13722 13150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 13903 14457 gene locus_tag LOCUS_21950 13903 14457 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049681146.1 protein_id gnl|my_center|LOCUS_21950 14931 14461 gene locus_tag LOCUS_21960 14931 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 15202 15363 gene locus_tag LOCUS_21970 15202 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 15780 15364 gene locus_tag LOCUS_21980 15780 15364 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971206.1 protein_id gnl|my_center|LOCUS_21980 16146 15871 gene locus_tag LOCUS_21990 16146 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 17533 16181 gene locus_tag LOCUS_22000 17533 16181 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_22000 18827 17592 gene locus_tag LOCUS_22010 18827 17592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_22010 19207 19001 gene locus_tag LOCUS_22020 19207 19001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 19704 19204 gene locus_tag LOCUS_22030 19704 19204 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808186.1 protein_id gnl|my_center|LOCUS_22030 20348 19701 gene locus_tag LOCUS_22040 20348 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 22663 20345 gene locus_tag LOCUS_22050 gene nasC 22663 20345 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_22050 23760 22663 gene locus_tag LOCUS_22060 23760 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 23938 23744 gene locus_tag LOCUS_22070 23938 23744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 24191 24514 gene locus_tag LOCUS_22080 24191 24514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 24511 25362 gene locus_tag LOCUS_22090 24511 25362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 25559 25401 gene locus_tag LOCUS_22100 25559 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 25510 27165 gene locus_tag LOCUS_22110 25510 27165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 27981 27178 gene locus_tag LOCUS_22120 27981 27178 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_22120 28635 28108 gene locus_tag LOCUS_22130 28635 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 29110 30564 gene locus_tag LOCUS_22140 29110 30564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 31919 30777 gene locus_tag LOCUS_22150 31919 30777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 32729 32400 gene locus_tag LOCUS_22160 32729 32400 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889074.1 protein_id gnl|my_center|LOCUS_22160 32929 32726 gene locus_tag LOCUS_22170 32929 32726 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_22170 33166 35682 gene locus_tag LOCUS_22180 33166 35682 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889078.1 protein_id gnl|my_center|LOCUS_22180 37938 35758 gene locus_tag LOCUS_22190 37938 35758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 39477 38524 gene locus_tag LOCUS_22200 39477 38524 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888399.1 protein_id gnl|my_center|LOCUS_22200 39737 40576 gene locus_tag LOCUS_22210 39737 40576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 40665 41699 gene locus_tag LOCUS_22220 40665 41699 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_22220 42352 42164 gene locus_tag LOCUS_22230 42352 42164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 43553 42426 gene locus_tag LOCUS_22240 43553 42426 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_22240 45065 44112 gene locus_tag LOCUS_22250 45065 44112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 46177 45248 gene locus_tag LOCUS_22260 46177 45248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 48916 46694 gene locus_tag LOCUS_22270 48916 46694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 49168 50532 gene locus_tag LOCUS_22280 49168 50532 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177674.1 protein_id gnl|my_center|LOCUS_22280 50559 51221 gene locus_tag LOCUS_22290 50559 51221 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479898.1 protein_id gnl|my_center|LOCUS_22290 51968 51222 gene locus_tag LOCUS_22300 51968 51222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 53645 52098 gene locus_tag LOCUS_22310 53645 52098 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393317.1 protein_id gnl|my_center|LOCUS_22310 54619 53861 gene locus_tag LOCUS_22320 54619 53861 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480061.1 protein_id gnl|my_center|LOCUS_22320 55131 56798 gene locus_tag LOCUS_22330 55131 56798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 56795 57250 gene locus_tag LOCUS_22340 56795 57250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 57247 57648 gene locus_tag LOCUS_22350 57247 57648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 57645 58352 gene locus_tag LOCUS_22360 57645 58352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 59412 58417 gene locus_tag LOCUS_22370 59412 58417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 60965 59409 gene locus_tag LOCUS_22380 60965 59409 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114901.1 protein_id gnl|my_center|LOCUS_22380 61215 61919 gene locus_tag LOCUS_22390 61215 61919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 63191 61971 gene locus_tag LOCUS_22400 63191 61971 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816831.1 protein_id gnl|my_center|LOCUS_22400 64059 63256 gene locus_tag LOCUS_22410 64059 63256 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_22410 64910 64218 gene locus_tag LOCUS_22420 64910 64218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 65262 64957 gene locus_tag LOCUS_22430 65262 64957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 66087 65482 gene locus_tag LOCUS_22440 66087 65482 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886843.1 protein_id gnl|my_center|LOCUS_22440 67098 66202 gene locus_tag LOCUS_22450 67098 66202 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031765.1 protein_id gnl|my_center|LOCUS_22450 67240 67827 gene locus_tag LOCUS_22460 67240 67827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729092.1 protein_id gnl|my_center|LOCUS_22460 68707 67796 gene locus_tag LOCUS_22470 68707 67796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 69179 68883 gene locus_tag LOCUS_22480 69179 68883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 70360 69185 gene locus_tag LOCUS_22490 70360 69185 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705629.1 protein_id gnl|my_center|LOCUS_22490 71679 70624 gene locus_tag LOCUS_22500 71679 70624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 72877 71948 gene locus_tag LOCUS_22510 72877 71948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 74356 72995 gene locus_tag LOCUS_22520 74356 72995 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_22520 74906 74397 gene locus_tag LOCUS_22530 74906 74397 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_22530 75052 76104 gene locus_tag LOCUS_22540 75052 76104 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084237.1 protein_id gnl|my_center|LOCUS_22540 76814 76089 gene locus_tag LOCUS_22550 76814 76089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_22550 77565 76807 gene locus_tag LOCUS_22560 77565 76807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870136.1 protein_id gnl|my_center|LOCUS_22560 78601 77567 gene locus_tag LOCUS_22570 78601 77567 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942650.1 protein_id gnl|my_center|LOCUS_22570 79521 78598 gene locus_tag LOCUS_22580 79521 78598 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_22580 80688 79525 gene locus_tag LOCUS_22590 80688 79525 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942648.1 protein_id gnl|my_center|LOCUS_22590 81950 80742 gene locus_tag LOCUS_22600 81950 80742 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_22600 82271 82966 gene locus_tag LOCUS_22610 82271 82966 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221295.1 protein_id gnl|my_center|LOCUS_22610 84256 83003 gene locus_tag LOCUS_22620 84256 83003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 85874 84339 gene locus_tag LOCUS_22630 85874 84339 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_22630 86642 85905 gene locus_tag LOCUS_22640 86642 85905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 86967 88865 gene locus_tag LOCUS_22650 86967 88865 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227075.1 protein_id gnl|my_center|LOCUS_22650 89178 89489 gene locus_tag LOCUS_22660 89178 89489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22660 89486 90367 gene locus_tag LOCUS_22670 89486 90367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22670 90870 90415 gene locus_tag LOCUS_22680 90870 90415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22680 91073 90873 gene locus_tag LOCUS_22690 91073 90873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22690 92379 91363 gene locus_tag LOCUS_22700 92379 91363 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_22700 92665 94002 gene locus_tag LOCUS_22710 92665 94002 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_22710 94314 95072 gene locus_tag LOCUS_22720 94314 95072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 protein_id gnl|my_center|LOCUS_22720 95117 96553 gene locus_tag LOCUS_22730 95117 96553 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066701.1 protein_id gnl|my_center|LOCUS_22730 96570 97490 gene locus_tag LOCUS_22740 96570 97490 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066580.1 protein_id gnl|my_center|LOCUS_22740 97487 98353 gene locus_tag LOCUS_22750 97487 98353 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969939.1 protein_id gnl|my_center|LOCUS_22750 98359 99396 gene locus_tag LOCUS_22760 98359 99396 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_22760 99440 100450 gene locus_tag LOCUS_22770 99440 100450 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256271.1 protein_id gnl|my_center|LOCUS_22770 100587 100940 gene locus_tag LOCUS_22780 100587 100940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 101348 100953 gene locus_tag LOCUS_22790 101348 100953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 101790 102056 gene locus_tag LOCUS_22800 101790 102056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 102533 102072 gene locus_tag LOCUS_22810 102533 102072 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_22810 102732 103355 gene locus_tag LOCUS_22820 102732 103355 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_22820 103839 103468 gene locus_tag LOCUS_22830 103839 103468 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965266.1 protein_id gnl|my_center|LOCUS_22830 104008 104769 gene locus_tag LOCUS_22840 104008 104769 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088525.1 protein_id gnl|my_center|LOCUS_22840 108203 104814 gene locus_tag LOCUS_22850 108203 104814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 109172 108543 gene locus_tag LOCUS_22860 109172 108543 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889162.1 protein_id gnl|my_center|LOCUS_22860 110194 109217 gene locus_tag LOCUS_22870 gene msrP 110194 109217 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889161.1 protein_id gnl|my_center|LOCUS_22870 110488 111537 gene locus_tag LOCUS_22880 110488 111537 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384492.1 protein_id gnl|my_center|LOCUS_22880 112690 111554 gene locus_tag LOCUS_22890 gene vanS-Sc 112690 111554 CDS product VanSc-type vancomycin resistance histidine kinase VanS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975349.1 protein_id gnl|my_center|LOCUS_22890 113378 112683 gene locus_tag LOCUS_22900 113378 112683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467764.1 protein_id gnl|my_center|LOCUS_22900 113325 114092 gene locus_tag LOCUS_22910 113325 114092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 114162 114656 gene locus_tag LOCUS_22920 114162 114656 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480055.1 protein_id gnl|my_center|LOCUS_22920 114846 117494 gene locus_tag LOCUS_22930 114846 117494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 117491 120721 gene locus_tag LOCUS_22940 117491 120721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 122016 120859 gene locus_tag LOCUS_22950 gene iscS 122016 120859 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703173.1 protein_id gnl|my_center|LOCUS_22950 127232 122013 gene locus_tag LOCUS_22960 127232 122013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 128923 127229 gene locus_tag LOCUS_22970 128923 127229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 130665 128926 gene locus_tag LOCUS_22980 130665 128926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 131482 130676 gene locus_tag LOCUS_22990 131482 130676 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727532.1 protein_id gnl|my_center|LOCUS_22990 134864 131475 gene locus_tag LOCUS_23000 134864 131475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727531.1 protein_id gnl|my_center|LOCUS_23000 135784 134861 gene locus_tag LOCUS_23010 135784 134861 CDS product DUF4007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_23010 137817 136252 gene locus_tag LOCUS_23020 137817 136252 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480084.1 protein_id gnl|my_center|LOCUS_23020 138246 138073 gene locus_tag LOCUS_23030 138246 138073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 138200 138817 gene locus_tag LOCUS_23040 138200 138817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 138941 139432 gene locus_tag LOCUS_23050 138941 139432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 139694 140635 gene locus_tag LOCUS_23060 139694 140635 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229391.1 protein_id gnl|my_center|LOCUS_23060 143147 140754 gene locus_tag LOCUS_23070 143147 140754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 145854 143140 gene locus_tag LOCUS_23080 145854 143140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 151148 145857 gene locus_tag LOCUS_23090 151148 145857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 153868 151292 gene locus_tag LOCUS_23100 153868 151292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 154419 154300 gene locus_tag LOCUS_23110 154419 154300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 156826 154430 gene locus_tag LOCUS_23120 156826 154430 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927835.1 protein_id gnl|my_center|LOCUS_23120 157536 156823 gene locus_tag LOCUS_23130 157536 156823 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_23130 157655 158314 gene locus_tag LOCUS_23140 157655 158314 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480183.1 protein_id gnl|my_center|LOCUS_23140 158403 158882 gene locus_tag LOCUS_23150 158403 158882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 160309 158918 gene locus_tag LOCUS_23160 160309 158918 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479767.1 protein_id gnl|my_center|LOCUS_23160 161616 160306 gene locus_tag LOCUS_23170 161616 160306 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479768.1 protein_id gnl|my_center|LOCUS_23170 162647 161742 gene locus_tag LOCUS_23180 162647 161742 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947621.1 protein_id gnl|my_center|LOCUS_23180 163650 162658 gene locus_tag LOCUS_23190 163650 162658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 163662 164540 gene locus_tag LOCUS_23200 163662 164540 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731454.1 protein_id gnl|my_center|LOCUS_23200 164783 165256 gene locus_tag LOCUS_23210 164783 165256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 165420 165740 gene locus_tag LOCUS_23220 165420 165740 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089489.1 protein_id gnl|my_center|LOCUS_23220 165737 166177 gene locus_tag LOCUS_23230 165737 166177 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061436.1 protein_id gnl|my_center|LOCUS_23230 166336 166674 gene locus_tag LOCUS_23240 166336 166674 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226694.1 protein_id gnl|my_center|LOCUS_23240 166732 167364 gene locus_tag LOCUS_23250 gene pdaB 166732 167364 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 protein_id gnl|my_center|LOCUS_23250 168563 167478 gene locus_tag LOCUS_23260 168563 167478 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225221.1 protein_id gnl|my_center|LOCUS_23260 169663 168674 gene locus_tag LOCUS_23270 169663 168674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525258.1 protein_id gnl|my_center|LOCUS_23270 170663 169665 gene locus_tag LOCUS_23280 170663 169665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061668.1 protein_id gnl|my_center|LOCUS_23280 172191 170650 gene locus_tag LOCUS_23290 172191 170650 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525260.1 protein_id gnl|my_center|LOCUS_23290 173241 172270 gene locus_tag LOCUS_23300 173241 172270 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 protein_id gnl|my_center|LOCUS_23300 173637 174599 gene locus_tag LOCUS_23310 173637 174599 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_23310 174869 175795 gene locus_tag LOCUS_23320 174869 175795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 175951 178701 gene locus_tag LOCUS_23330 175951 178701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 179452 178781 gene locus_tag LOCUS_23340 179452 178781 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227430.1 protein_id gnl|my_center|LOCUS_23340 180288 179449 gene locus_tag LOCUS_23350 180288 179449 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225904.1 protein_id gnl|my_center|LOCUS_23350 180399 181319 gene locus_tag LOCUS_23360 180399 181319 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225905.1 protein_id gnl|my_center|LOCUS_23360 182767 181370 gene locus_tag LOCUS_23370 182767 181370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 183292 182900 gene locus_tag LOCUS_23380 183292 182900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 183488 184480 gene locus_tag LOCUS_23390 183488 184480 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_23390 184795 184529 gene locus_tag LOCUS_23400 184795 184529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 185095 184859 gene locus_tag LOCUS_23410 185095 184859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 185641 185790 gene locus_tag LOCUS_23420 185641 185790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 186140 187111 gene locus_tag LOCUS_23430 186140 187111 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_23430 187156 188379 gene locus_tag LOCUS_23440 187156 188379 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967720.1 protein_id gnl|my_center|LOCUS_23440 188632 189783 gene locus_tag LOCUS_23450 188632 189783 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967719.1 protein_id gnl|my_center|LOCUS_23450 189780 191351 gene locus_tag LOCUS_23460 189780 191351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 191391 193262 gene locus_tag LOCUS_23470 191391 193262 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173582854.1 protein_id gnl|my_center|LOCUS_23470 193994 193563 gene locus_tag LOCUS_23480 193994 193563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 194541 194972 gene locus_tag LOCUS_23490 194541 194972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 194997 195536 gene locus_tag LOCUS_23500 194997 195536 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 protein_id gnl|my_center|LOCUS_23500 196380 195592 gene locus_tag LOCUS_23510 196380 195592 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 protein_id gnl|my_center|LOCUS_23510 196909 196409 gene locus_tag LOCUS_23520 196909 196409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 197800 198252 gene locus_tag LOCUS_23530 197800 198252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 198459 198815 gene locus_tag LOCUS_23540 198459 198815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 199067 199888 gene locus_tag LOCUS_23550 199067 199888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 199945 200877 gene locus_tag LOCUS_23560 gene yedA 199945 200877 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_23560 201200 200985 gene locus_tag LOCUS_23570 201200 200985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 202408 201320 gene locus_tag LOCUS_23580 202408 201320 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 protein_id gnl|my_center|LOCUS_23580 202602 203720 gene locus_tag LOCUS_23590 202602 203720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 204440 203799 gene locus_tag LOCUS_23600 gene lexA 204440 203799 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479703.1 protein_id gnl|my_center|LOCUS_23600 204573 205280 gene locus_tag LOCUS_23610 204573 205280 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_23610 206442 205432 gene locus_tag LOCUS_23620 206442 205432 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229118.1 protein_id gnl|my_center|LOCUS_23620 206980 206624 gene locus_tag LOCUS_23630 206980 206624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 207372 208499 gene locus_tag LOCUS_23640 207372 208499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 208558 209391 gene locus_tag LOCUS_23650 208558 209391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 210603 209416 gene locus_tag LOCUS_23660 210603 209416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 212007 210613 gene locus_tag LOCUS_23670 212007 210613 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_23670 212106 212032 gene locus_tag LOCUS_t00280 212106 212032 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 212185 212114 gene locus_tag LOCUS_t00290 212185 212114 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 212297 213181 gene locus_tag LOCUS_23680 212297 213181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 213181 213480 gene locus_tag LOCUS_23690 213181 213480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 213641 213569 gene locus_tag LOCUS_t00300 213641 213569 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 213715 213641 gene locus_tag LOCUS_t00310 213715 213641 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 214074 214721 gene locus_tag LOCUS_23700 214074 214721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 215806 214739 gene locus_tag LOCUS_23710 215806 214739 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103359.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23710 216025 215891 gene locus_tag LOCUS_23720 216025 215891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 217330 216122 gene locus_tag LOCUS_23730 217330 216122 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230887.1 protein_id gnl|my_center|LOCUS_23730 217926 217327 gene locus_tag LOCUS_23740 217926 217327 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223522.1 protein_id gnl|my_center|LOCUS_23740 218041 218697 gene locus_tag LOCUS_23750 218041 218697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 218708 218959 gene locus_tag LOCUS_23760 218708 218959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence08 724 494 gene locus_tag LOCUS_23770 gene acpP 724 494 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479819.1 protein_id gnl|my_center|LOCUS_23770 1579 845 gene locus_tag LOCUS_23780 gene fabG 1579 845 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_23780 2493 1576 gene locus_tag LOCUS_23790 gene fabD 2493 1576 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888578.1 protein_id gnl|my_center|LOCUS_23790 3467 2490 gene locus_tag LOCUS_23800 3467 2490 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172506.1 protein_id gnl|my_center|LOCUS_23800 3629 5167 gene locus_tag LOCUS_23810 3629 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 5850 5227 gene locus_tag LOCUS_23820 5850 5227 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243175.1 protein_id gnl|my_center|LOCUS_23820 6126 5944 gene locus_tag LOCUS_23830 gene rpmF 6126 5944 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888992.1 protein_id gnl|my_center|LOCUS_23830 6592 6227 gene locus_tag LOCUS_23840 6592 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886716.1 protein_id gnl|my_center|LOCUS_23840 7495 6611 gene locus_tag LOCUS_23850 7495 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 7962 7492 gene locus_tag LOCUS_23860 gene moaC 7962 7492 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889196.1 protein_id gnl|my_center|LOCUS_23860 8536 7955 gene locus_tag LOCUS_23870 8536 7955 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480095.1 protein_id gnl|my_center|LOCUS_23870 8700 9584 gene locus_tag LOCUS_23880 gene rocF 8700 9584 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887296.1 protein_id gnl|my_center|LOCUS_23880 9775 10296 gene locus_tag LOCUS_23890 9775 10296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 10388 11308 gene locus_tag LOCUS_23900 10388 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 11552 12970 gene locus_tag LOCUS_23910 gene glnA 11552 12970 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775685.1 protein_id gnl|my_center|LOCUS_23910 13398 12958 gene locus_tag LOCUS_23920 13398 12958 CDS product DUF3052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_23920 13850 13461 gene locus_tag LOCUS_23930 13850 13461 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480093.1 protein_id gnl|my_center|LOCUS_23930 14044 14355 gene locus_tag LOCUS_23940 14044 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 16021 14519 gene locus_tag LOCUS_23950 16021 14519 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_23950 16430 18568 gene locus_tag LOCUS_23960 16430 18568 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_23960 18852 19385 gene locus_tag LOCUS_23970 18852 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 20182 19442 gene locus_tag LOCUS_23980 20182 19442 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 protein_id gnl|my_center|LOCUS_23980 20280 21011 gene locus_tag LOCUS_23990 20280 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 21402 21025 gene locus_tag LOCUS_24000 21402 21025 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888656.1 protein_id gnl|my_center|LOCUS_24000 21836 21399 gene locus_tag LOCUS_24010 21836 21399 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888655.1 protein_id gnl|my_center|LOCUS_24010 22879 21821 gene locus_tag LOCUS_24020 22879 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 25577 22890 gene locus_tag LOCUS_24030 25577 22890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887218.1 protein_id gnl|my_center|LOCUS_24030 26784 25609 gene locus_tag LOCUS_24040 26784 25609 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887217.1 protein_id gnl|my_center|LOCUS_24040 26820 28181 gene locus_tag LOCUS_24050 26820 28181 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349521.1 protein_id gnl|my_center|LOCUS_24050 28194 28269 gene locus_tag LOCUS_t00320 28194 28269 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30093 28513 gene locus_tag LOCUS_24060 gene katX 30093 28513 CDS product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 protein_id gnl|my_center|LOCUS_24060 30376 30792 gene locus_tag LOCUS_24070 30376 30792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 32637 30934 gene locus_tag LOCUS_24080 32637 30934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 32925 33830 gene locus_tag LOCUS_24090 gene era 32925 33830 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887291.1 protein_id gnl|my_center|LOCUS_24090 34508 34131 gene locus_tag LOCUS_24100 34508 34131 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889137.1 protein_id gnl|my_center|LOCUS_24100 35508 34582 gene locus_tag LOCUS_24110 35508 34582 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889138.1 protein_id gnl|my_center|LOCUS_24110 35731 37038 gene locus_tag LOCUS_24120 35731 37038 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_24120 37303 38262 gene locus_tag LOCUS_24130 37303 38262 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080296.1 protein_id gnl|my_center|LOCUS_24130 38252 39103 gene locus_tag LOCUS_24140 38252 39103 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014683564.1 protein_id gnl|my_center|LOCUS_24140 39260 40336 gene locus_tag LOCUS_24150 39260 40336 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_24150 40486 40722 gene locus_tag LOCUS_24160 40486 40722 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480082.1 protein_id gnl|my_center|LOCUS_24160 40797 41033 gene locus_tag LOCUS_24170 40797 41033 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480082.1 protein_id gnl|my_center|LOCUS_24170 41119 41808 gene locus_tag LOCUS_24180 41119 41808 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887903.1 protein_id gnl|my_center|LOCUS_24180 42606 41908 gene locus_tag LOCUS_24190 42606 41908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 42812 42612 gene locus_tag LOCUS_24200 42812 42612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 43753 42785 gene locus_tag LOCUS_24210 43753 42785 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328036.1 protein_id gnl|my_center|LOCUS_24210 44319 43840 gene locus_tag LOCUS_24220 44319 43840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 44963 44316 gene locus_tag LOCUS_24230 44963 44316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 45840 44941 gene locus_tag LOCUS_24240 45840 44941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229772.1 protein_id gnl|my_center|LOCUS_24240 46561 45833 gene locus_tag LOCUS_24250 46561 45833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 47492 46545 gene locus_tag LOCUS_24260 47492 46545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 47771 48364 gene locus_tag LOCUS_24270 47771 48364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 48445 48663 gene locus_tag LOCUS_24280 48445 48663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 48632 48778 gene locus_tag LOCUS_24290 48632 48778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 48933 49070 gene locus_tag LOCUS_24300 48933 49070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 49141 49263 gene locus_tag LOCUS_24310 49141 49263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 49242 49382 gene locus_tag LOCUS_24320 49242 49382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 49440 50135 gene locus_tag LOCUS_24330 49440 50135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 52779 50311 gene locus_tag LOCUS_24340 52779 50311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 54245 52935 gene locus_tag LOCUS_24350 54245 52935 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_24350 54156 54353 gene locus_tag LOCUS_24360 54156 54353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 54579 55670 gene locus_tag LOCUS_24370 54579 55670 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480247.1 protein_id gnl|my_center|LOCUS_24370 55667 56683 gene locus_tag LOCUS_24380 55667 56683 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886678.1 protein_id gnl|my_center|LOCUS_24380 56702 56965 gene locus_tag LOCUS_24390 56702 56965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 56974 58329 gene locus_tag LOCUS_24400 56974 58329 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886680.1 protein_id gnl|my_center|LOCUS_24400 59555 58620 gene locus_tag LOCUS_24410 59555 58620 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_24410 59643 60110 gene locus_tag LOCUS_24420 59643 60110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 61013 60174 gene locus_tag LOCUS_24430 61013 60174 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088697.1 protein_id gnl|my_center|LOCUS_24430 65194 61025 gene locus_tag LOCUS_24440 65194 61025 CDS product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205569.1 protein_id gnl|my_center|LOCUS_24440 65728 65384 gene locus_tag LOCUS_24450 gene nirD 65728 65384 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_24450 68267 65739 gene locus_tag LOCUS_24460 gene nirB 68267 65739 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 protein_id gnl|my_center|LOCUS_24460 68633 69844 gene locus_tag LOCUS_24470 68633 69844 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530457.1 protein_id gnl|my_center|LOCUS_24470 69856 70680 gene locus_tag LOCUS_24480 gene ntrB 69856 70680 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096249.1 protein_id gnl|my_center|LOCUS_24480 70673 71476 gene locus_tag LOCUS_24490 70673 71476 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057194.1 protein_id gnl|my_center|LOCUS_24490 71686 72906 gene locus_tag LOCUS_24500 71686 72906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123927512.1 protein_id gnl|my_center|LOCUS_24500 73108 73923 gene locus_tag LOCUS_24510 73108 73923 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480273.1 protein_id gnl|my_center|LOCUS_24510 74473 74264 gene locus_tag LOCUS_24520 74473 74264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 74689 75552 gene locus_tag LOCUS_24530 74689 75552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 75662 76696 gene locus_tag LOCUS_24540 75662 76696 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229391.1 protein_id gnl|my_center|LOCUS_24540 77263 76712 gene locus_tag LOCUS_24550 77263 76712 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_24550 77775 77275 gene locus_tag LOCUS_24560 77775 77275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 78265 77840 gene locus_tag LOCUS_24570 78265 77840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 78678 78262 gene locus_tag LOCUS_24580 78678 78262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 78970 79446 gene locus_tag LOCUS_24590 78970 79446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 82171 79331 gene locus_tag LOCUS_24600 82171 79331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 82333 83421 gene locus_tag LOCUS_24610 82333 83421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 83505 84215 gene locus_tag LOCUS_24620 83505 84215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 85692 84496 gene locus_tag LOCUS_24630 gene tyrS 85692 84496 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480260.1 protein_id gnl|my_center|LOCUS_24630 86022 86492 gene locus_tag LOCUS_24640 86022 86492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 86531 87055 gene locus_tag LOCUS_24650 86531 87055 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350905.1 protein_id gnl|my_center|LOCUS_24650 87052 87939 gene locus_tag LOCUS_24660 87052 87939 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_24660 87936 88604 gene locus_tag LOCUS_24670 87936 88604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334317.1 protein_id gnl|my_center|LOCUS_24670 89105 88608 gene locus_tag LOCUS_24680 89105 88608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 89293 90105 gene locus_tag LOCUS_24690 89293 90105 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930314.1 protein_id gnl|my_center|LOCUS_24690 90172 90486 gene locus_tag LOCUS_24700 90172 90486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 91569 90652 gene locus_tag LOCUS_24710 91569 90652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 91646 92491 gene locus_tag LOCUS_24720 gene legP 91646 92491 CDS product Dot/Icm T4SS effector LegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948683.1 protein_id gnl|my_center|LOCUS_24720 94354 92579 gene locus_tag LOCUS_24730 gene pepF 94354 92579 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256129.1 protein_id gnl|my_center|LOCUS_24730 95871 94405 gene locus_tag LOCUS_24740 95871 94405 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200631.1 protein_id gnl|my_center|LOCUS_24740 95990 96607 gene locus_tag LOCUS_24750 95990 96607 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_24750 97002 96628 gene locus_tag LOCUS_24760 97002 96628 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_24760 97208 96999 gene locus_tag LOCUS_24770 97208 96999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 97470 98669 gene locus_tag LOCUS_24780 97470 98669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_24780 98747 100744 gene locus_tag LOCUS_24790 98747 100744 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479574.1 protein_id gnl|my_center|LOCUS_24790 100806 101273 gene locus_tag LOCUS_24800 100806 101273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 101276 102556 gene locus_tag LOCUS_24810 101276 102556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 102818 102483 gene locus_tag LOCUS_24820 gene rsfS 102818 102483 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889204.1 protein_id gnl|my_center|LOCUS_24820 104084 102834 gene locus_tag LOCUS_24830 104084 102834 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889205.1 protein_id gnl|my_center|LOCUS_24830 104747 104139 gene locus_tag LOCUS_24840 gene yqeK 104747 104139 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618898.1 protein_id gnl|my_center|LOCUS_24840 106117 104804 gene locus_tag LOCUS_24850 gene obgE 106117 104804 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886732.1 protein_id gnl|my_center|LOCUS_24850 107197 106121 gene locus_tag LOCUS_24860 107197 106121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 107594 107325 gene locus_tag LOCUS_24870 gene rpmA 107594 107325 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886733.1 protein_id gnl|my_center|LOCUS_24870 107907 107608 gene locus_tag LOCUS_24880 gene rplU 107907 107608 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480310.1 protein_id gnl|my_center|LOCUS_24880 108082 108765 gene locus_tag LOCUS_24890 108082 108765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 108762 109517 gene locus_tag LOCUS_24900 108762 109517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 111144 109690 gene locus_tag LOCUS_24910 gene gnd 111144 109690 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225759.1 protein_id gnl|my_center|LOCUS_24910 112577 111147 gene locus_tag LOCUS_24920 112577 111147 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732087.1 protein_id gnl|my_center|LOCUS_24920 112867 113238 gene locus_tag LOCUS_24930 112867 113238 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_24930 113235 113960 gene locus_tag LOCUS_24940 113235 113960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403437.1 protein_id gnl|my_center|LOCUS_24940 113960 114706 gene locus_tag LOCUS_24950 113960 114706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 114741 115034 gene locus_tag LOCUS_24960 gene rpoZ 114741 115034 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480122.1 protein_id gnl|my_center|LOCUS_24960 115523 115104 gene locus_tag LOCUS_24970 115523 115104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 116410 115520 gene locus_tag LOCUS_24980 116410 115520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 116477 117631 gene locus_tag LOCUS_24990 gene coaBC 116477 117631 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887224.1 protein_id gnl|my_center|LOCUS_24990 117756 118220 gene locus_tag LOCUS_25000 gene argR 117756 118220 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479994.1 protein_id gnl|my_center|LOCUS_25000 118407 119042 gene locus_tag LOCUS_25010 118407 119042 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888969.1 protein_id gnl|my_center|LOCUS_25010 119253 119756 gene locus_tag LOCUS_25020 119253 119756 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889035.1 protein_id gnl|my_center|LOCUS_25020 119919 120314 gene locus_tag LOCUS_25030 119919 120314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 120378 122168 gene locus_tag LOCUS_25040 120378 122168 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479596.1 protein_id gnl|my_center|LOCUS_25040 122546 122767 gene locus_tag LOCUS_25050 122546 122767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 122939 123577 gene locus_tag LOCUS_25060 122939 123577 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_25060 123739 123663 gene locus_tag LOCUS_t00330 123739 123663 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 124332 123823 gene locus_tag LOCUS_25070 124332 123823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 124532 124813 gene locus_tag LOCUS_25080 124532 124813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 124813 125421 gene locus_tag LOCUS_25090 gene clpP 124813 125421 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888605.1 protein_id gnl|my_center|LOCUS_25090 125421 126614 gene locus_tag LOCUS_25100 gene clpX 125421 126614 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888606.1 protein_id gnl|my_center|LOCUS_25100 127643 126672 gene locus_tag LOCUS_25110 127643 126672 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_25110 128023 127664 gene locus_tag LOCUS_25120 128023 127664 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222802.1 protein_id gnl|my_center|LOCUS_25120 128664 128224 gene locus_tag LOCUS_25130 gene ohrR 128664 128224 CDS product organic hydroperoxide resistance protein OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_25130 128968 130551 gene locus_tag LOCUS_25140 128968 130551 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480084.1 protein_id gnl|my_center|LOCUS_25140 130679 131110 gene locus_tag LOCUS_25150 130679 131110 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887755.1 protein_id gnl|my_center|LOCUS_25150 131107 131538 gene locus_tag LOCUS_25160 131107 131538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 131513 131989 gene locus_tag LOCUS_25170 131513 131989 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349584.1 protein_id gnl|my_center|LOCUS_25170 132039 132692 gene locus_tag LOCUS_25180 132039 132692 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567218.1 protein_id gnl|my_center|LOCUS_25180 132783 135449 gene locus_tag LOCUS_25190 132783 135449 CDS product G8 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257330.1 protein_id gnl|my_center|LOCUS_25190 136381 135650 gene locus_tag LOCUS_25200 136381 135650 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480361.1 protein_id gnl|my_center|LOCUS_25200 136608 137495 gene locus_tag LOCUS_25210 136608 137495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 137748 138635 gene locus_tag LOCUS_25220 137748 138635 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176728.1 protein_id gnl|my_center|LOCUS_25220 139153 138701 gene locus_tag LOCUS_25230 gene rplI 139153 138701 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886750.1 protein_id gnl|my_center|LOCUS_25230 139410 139150 gene locus_tag LOCUS_25240 gene rpsR 139410 139150 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886749.1 protein_id gnl|my_center|LOCUS_25240 140312 139449 gene locus_tag LOCUS_25250 140312 139449 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480308.1 protein_id gnl|my_center|LOCUS_25250 140772 140464 gene locus_tag LOCUS_25260 gene rpsF 140772 140464 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886746.1 protein_id gnl|my_center|LOCUS_25260 141178 142221 gene locus_tag LOCUS_25270 141178 142221 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889181.1 protein_id gnl|my_center|LOCUS_25270 142301 142642 gene locus_tag LOCUS_25280 142301 142642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 142681 143349 gene locus_tag LOCUS_25290 142681 143349 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887427.1 protein_id gnl|my_center|LOCUS_25290 143435 144730 gene locus_tag LOCUS_25300 143435 144730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 144782 145765 gene locus_tag LOCUS_25310 gene ada 144782 145765 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_25310 146176 145775 gene locus_tag LOCUS_25320 146176 145775 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174007.1 protein_id gnl|my_center|LOCUS_25320 146369 147541 gene locus_tag LOCUS_25330 gene xseA 146369 147541 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886832.1 protein_id gnl|my_center|LOCUS_25330 147538 147720 gene locus_tag LOCUS_25340 147538 147720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 147948 148886 gene locus_tag LOCUS_25350 147948 148886 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889088.1 protein_id gnl|my_center|LOCUS_25350 151511 148965 gene locus_tag LOCUS_25360 151511 148965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 152574 151513 gene locus_tag LOCUS_25370 152574 151513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 153316 152771 gene locus_tag LOCUS_25380 153316 152771 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871511.1 protein_id gnl|my_center|LOCUS_25380 153938 153291 gene locus_tag LOCUS_25390 gene cmk 153938 153291 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480105.1 protein_id gnl|my_center|LOCUS_25390 154012 154734 gene locus_tag LOCUS_25400 154012 154734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 155221 154844 gene locus_tag LOCUS_25410 155221 154844 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886757.1 protein_id gnl|my_center|LOCUS_25410 155503 156087 gene locus_tag LOCUS_25420 155503 156087 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177743.1 protein_id gnl|my_center|LOCUS_25420 157515 156166 gene locus_tag LOCUS_25430 157515 156166 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092263432.1 protein_id gnl|my_center|LOCUS_25430 159053 157620 gene locus_tag LOCUS_25440 159053 157620 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012695322.1 protein_id gnl|my_center|LOCUS_25440 160046 159081 gene locus_tag LOCUS_25450 160046 159081 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883990.1 protein_id gnl|my_center|LOCUS_25450 160921 160034 gene locus_tag LOCUS_25460 gene cbiB 160921 160034 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258432.1 protein_id gnl|my_center|LOCUS_25460 161256 160900 gene locus_tag LOCUS_25470 161256 160900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 161826 161260 gene locus_tag LOCUS_25480 gene cobO 161826 161260 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_25480 162461 161823 gene locus_tag LOCUS_25490 162461 161823 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249797.1 protein_id gnl|my_center|LOCUS_25490 162958 163545 gene locus_tag LOCUS_25500 162958 163545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 163518 164252 gene locus_tag LOCUS_25510 163518 164252 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889498.1 protein_id gnl|my_center|LOCUS_25510 164249 165328 gene locus_tag LOCUS_25520 164249 165328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 165362 166399 gene locus_tag LOCUS_25530 gene cobT 165362 166399 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889499.1 protein_id gnl|my_center|LOCUS_25530 166453 167352 gene locus_tag LOCUS_25540 166453 167352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392475.1 protein_id gnl|my_center|LOCUS_25540 167349 168212 gene locus_tag LOCUS_25550 167349 168212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 168475 169383 gene locus_tag LOCUS_25560 168475 169383 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256553.1 protein_id gnl|my_center|LOCUS_25560 169380 170978 gene locus_tag LOCUS_25570 169380 170978 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_25570 171108 172238 gene locus_tag LOCUS_25580 171108 172238 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398055.1 protein_id gnl|my_center|LOCUS_25580 173823 172402 gene locus_tag LOCUS_25590 gene pyk 173823 172402 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889259.1 protein_id gnl|my_center|LOCUS_25590 175081 173813 gene locus_tag LOCUS_25600 gene eno 175081 173813 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889260.1 protein_id gnl|my_center|LOCUS_25600 175282 175106 gene locus_tag LOCUS_25610 175282 175106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 176421 175339 gene locus_tag LOCUS_25620 gene dnaN 176421 175339 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480259.1 protein_id gnl|my_center|LOCUS_25620 178076 176718 gene locus_tag LOCUS_25630 gene dnaA 178076 176718 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480258.1 protein_id gnl|my_center|LOCUS_25630 178242 180020 gene locus_tag LOCUS_25640 gene mnmG 178242 180020 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886675.1 protein_id gnl|my_center|LOCUS_25640 180599 180063 gene locus_tag LOCUS_25650 180599 180063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 180647 181189 gene locus_tag LOCUS_25660 gene rsmG 180647 181189 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690016.1 protein_id gnl|my_center|LOCUS_25660 181217 181966 gene locus_tag LOCUS_25670 181217 181966 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480253.1 protein_id gnl|my_center|LOCUS_25670 181950 182801 gene locus_tag LOCUS_25680 gene parB 181950 182801 CDS product ParB/RepB/Spo0J family partition protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886660.1 protein_id gnl|my_center|LOCUS_25680 183744 182899 gene locus_tag LOCUS_25690 183744 182899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 185456 183816 gene locus_tag LOCUS_25700 185456 183816 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480060.1 protein_id gnl|my_center|LOCUS_25700 185692 186567 gene locus_tag LOCUS_25710 185692 186567 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887028.1 protein_id gnl|my_center|LOCUS_25710 187967 186543 gene locus_tag LOCUS_25720 187967 186543 CDS product FAD-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227361.1 protein_id gnl|my_center|LOCUS_25720 188251 188114 gene locus_tag LOCUS_25730 188251 188114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 188511 188435 gene locus_tag LOCUS_t00340 188511 188435 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 189737 188577 gene locus_tag LOCUS_25740 189737 188577 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189088205.1 protein_id gnl|my_center|LOCUS_25740 190774 189812 gene locus_tag LOCUS_25750 gene pfkA 190774 189812 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887280.1 protein_id gnl|my_center|LOCUS_25750 191635 190814 gene locus_tag LOCUS_25760 gene rsmI 191635 190814 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887281.1 protein_id gnl|my_center|LOCUS_25760 191908 191699 gene locus_tag LOCUS_25770 191908 191699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479506.1 protein_id gnl|my_center|LOCUS_25770 192318 191905 gene locus_tag LOCUS_25780 192318 191905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887283.1 protein_id gnl|my_center|LOCUS_25780 192431 192865 gene locus_tag LOCUS_25790 192431 192865 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887264.1 protein_id gnl|my_center|LOCUS_25790 192999 194666 gene locus_tag LOCUS_25800 192999 194666 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 protein_id gnl|my_center|LOCUS_25800 194776 195597 gene locus_tag LOCUS_25810 194776 195597 CDS product metalloenzyme domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480300.1 protein_id gnl|my_center|LOCUS_25810 195909 195577 gene locus_tag LOCUS_25820 195909 195577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence09 3286 527 gene locus_tag LOCUS_25830 3286 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4767 5267 gene locus_tag LOCUS_25840 4767 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 7470 5296 gene locus_tag LOCUS_25850 7470 5296 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_25850 8198 10720 gene locus_tag LOCUS_25860 8198 10720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 11650 11006 gene locus_tag LOCUS_25870 11650 11006 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530499.1 protein_id gnl|my_center|LOCUS_25870 13708 11756 gene locus_tag LOCUS_25880 13708 11756 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530253.1 protein_id gnl|my_center|LOCUS_25880 14527 13817 gene locus_tag LOCUS_25890 14527 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918147.1 protein_id gnl|my_center|LOCUS_25890 14961 14524 gene locus_tag LOCUS_25900 14961 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 15648 14977 gene locus_tag LOCUS_25910 15648 14977 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731501.1 protein_id gnl|my_center|LOCUS_25910 15759 16448 gene locus_tag LOCUS_25920 15759 16448 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887278.1 protein_id gnl|my_center|LOCUS_25920 16445 16741 gene locus_tag LOCUS_25930 16445 16741 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887279.1 protein_id gnl|my_center|LOCUS_25930 17332 16817 gene locus_tag LOCUS_25940 17332 16817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 17946 19154 gene locus_tag LOCUS_25950 17946 19154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 21630 19126 gene locus_tag LOCUS_25960 21630 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 22031 23110 gene locus_tag LOCUS_25970 22031 23110 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226192.1 protein_id gnl|my_center|LOCUS_25970 23380 25635 gene locus_tag LOCUS_25980 gene yicI 23380 25635 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703824.1 protein_id gnl|my_center|LOCUS_25980 25952 26896 gene locus_tag LOCUS_25990 25952 26896 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_25990 26893 27807 gene locus_tag LOCUS_26000 26893 27807 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_26000 27906 29537 gene locus_tag LOCUS_26010 27906 29537 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_26010 29637 31925 gene locus_tag LOCUS_26020 29637 31925 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_26020 32020 34071 gene locus_tag LOCUS_26030 32020 34071 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_26030 34134 34835 gene locus_tag LOCUS_26040 34134 34835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 35054 36031 gene locus_tag LOCUS_26050 35054 36031 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_26050 36152 36964 gene locus_tag LOCUS_26060 36152 36964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 37043 37933 gene locus_tag LOCUS_26070 37043 37933 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226961.1 protein_id gnl|my_center|LOCUS_26070 38051 39319 gene locus_tag LOCUS_26080 38051 39319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 40800 39382 gene locus_tag LOCUS_26090 40800 39382 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 protein_id gnl|my_center|LOCUS_26090 41260 42768 gene locus_tag LOCUS_26100 41260 42768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 42954 43712 gene locus_tag LOCUS_26110 42954 43712 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258808.1 protein_id gnl|my_center|LOCUS_26110 43717 46710 gene locus_tag LOCUS_26120 43717 46710 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015902.1 protein_id gnl|my_center|LOCUS_26120 46723 47073 gene locus_tag LOCUS_26130 46723 47073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 48771 47173 gene locus_tag LOCUS_26140 48771 47173 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886903.1 protein_id gnl|my_center|LOCUS_26140 49217 48768 gene locus_tag LOCUS_26150 49217 48768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 49259 49735 gene locus_tag LOCUS_26160 49259 49735 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207464.1 protein_id gnl|my_center|LOCUS_26160 50771 49812 gene locus_tag LOCUS_26170 50771 49812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222822.1 protein_id gnl|my_center|LOCUS_26170 50977 54045 gene locus_tag LOCUS_26180 50977 54045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 54100 55101 gene locus_tag LOCUS_26190 54100 55101 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618838.1 protein_id gnl|my_center|LOCUS_26190 56376 55147 gene locus_tag LOCUS_26200 56376 55147 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_26200 60031 56912 gene locus_tag LOCUS_26210 60031 56912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 60478 61170 gene locus_tag LOCUS_26220 60478 61170 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978037.1 protein_id gnl|my_center|LOCUS_26220 61145 62677 gene locus_tag LOCUS_26230 gene aceB 61145 62677 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889536.1 protein_id gnl|my_center|LOCUS_26230 62679 63902 gene locus_tag LOCUS_26240 62679 63902 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887797.1 protein_id gnl|my_center|LOCUS_26240 63906 64643 gene locus_tag LOCUS_26250 gene allE 63906 64643 CDS product (S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887795.1 protein_id gnl|my_center|LOCUS_26250 64948 66198 gene locus_tag LOCUS_26260 64948 66198 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 protein_id gnl|my_center|LOCUS_26260 66350 66853 gene locus_tag LOCUS_26270 gene uraD 66350 66853 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640536.1 protein_id gnl|my_center|LOCUS_26270 66840 68207 gene locus_tag LOCUS_26280 gene hpyO 66840 68207 CDS product FAD-dependent urate hydroxylase HpyO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035534.1 protein_id gnl|my_center|LOCUS_26280 68195 68536 gene locus_tag LOCUS_26290 gene uraH 68195 68536 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329197.1 protein_id gnl|my_center|LOCUS_26290 68537 69844 gene locus_tag LOCUS_26300 68537 69844 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_26300 69765 71147 gene locus_tag LOCUS_26310 69765 71147 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889437.1 protein_id gnl|my_center|LOCUS_26310 71144 73429 gene locus_tag LOCUS_26320 gene xdhB 71144 73429 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974005.1 protein_id gnl|my_center|LOCUS_26320 73416 74219 gene locus_tag LOCUS_26330 gene xdhC 73416 74219 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479762.1 protein_id gnl|my_center|LOCUS_26330 74258 74719 gene locus_tag LOCUS_26340 74258 74719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 74753 75445 gene locus_tag LOCUS_26350 74753 75445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 76277 75453 gene locus_tag LOCUS_26360 76277 75453 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_26360 78574 76304 gene locus_tag LOCUS_26370 78574 76304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 79293 78583 gene locus_tag LOCUS_26380 79293 78583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 81843 79306 gene locus_tag LOCUS_26390 81843 79306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 81971 83728 gene locus_tag LOCUS_26400 81971 83728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 83721 84359 gene locus_tag LOCUS_26410 83721 84359 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_26410 84365 85384 gene locus_tag LOCUS_26420 84365 85384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 87990 85387 gene locus_tag LOCUS_26430 87990 85387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 88156 89715 gene locus_tag LOCUS_26440 88156 89715 CDS product DUF4832 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704479.1 protein_id gnl|my_center|LOCUS_26440 94710 89779 gene locus_tag LOCUS_26450 94710 89779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 94769 95827 gene locus_tag LOCUS_26460 94769 95827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 96011 96694 gene locus_tag LOCUS_26470 96011 96694 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228939.1 protein_id gnl|my_center|LOCUS_26470 96988 96797 gene locus_tag LOCUS_26480 96988 96797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 97284 97457 gene locus_tag LOCUS_26490 97284 97457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 97476 99317 gene locus_tag LOCUS_26500 97476 99317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 99748 99452 gene locus_tag LOCUS_26510 99748 99452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 100015 100899 gene locus_tag LOCUS_26520 100015 100899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 100896 102986 gene locus_tag LOCUS_26530 100896 102986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 102983 103423 gene locus_tag LOCUS_26540 102983 103423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 103423 104742 gene locus_tag LOCUS_26550 103423 104742 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660540.1 protein_id gnl|my_center|LOCUS_26550 104739 105248 gene locus_tag LOCUS_26560 104739 105248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 105235 107358 gene locus_tag LOCUS_26570 105235 107358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 107363 109264 gene locus_tag LOCUS_26580 107363 109264 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257539.1 protein_id gnl|my_center|LOCUS_26580 109261 110277 gene locus_tag LOCUS_26590 gene cheB 109261 110277 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_26590 111587 110481 gene locus_tag LOCUS_26600 111587 110481 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349871.1 protein_id gnl|my_center|LOCUS_26600 112309 112746 gene locus_tag LOCUS_26610 112309 112746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 112921 113466 gene locus_tag LOCUS_26620 112921 113466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 113469 114470 gene locus_tag LOCUS_26630 113469 114470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 114585 114863 gene locus_tag LOCUS_26640 114585 114863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 115423 116001 gene locus_tag LOCUS_26650 115423 116001 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480360.1 protein_id gnl|my_center|LOCUS_26650 116047 117297 gene locus_tag LOCUS_26660 116047 117297 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888852.1 protein_id gnl|my_center|LOCUS_26660 117348 117923 gene locus_tag LOCUS_26670 117348 117923 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_26670 117999 118577 gene locus_tag LOCUS_26680 117999 118577 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_26680 118705 119748 gene locus_tag LOCUS_26690 118705 119748 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888855.1 protein_id gnl|my_center|LOCUS_26690 119883 120914 gene locus_tag LOCUS_26700 119883 120914 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888843.1 protein_id gnl|my_center|LOCUS_26700 120911 122059 gene locus_tag LOCUS_26710 120911 122059 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388656.1 protein_id gnl|my_center|LOCUS_26710 122067 122807 gene locus_tag LOCUS_26720 122067 122807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266641.1 protein_id gnl|my_center|LOCUS_26720 122824 123924 gene locus_tag LOCUS_26730 122824 123924 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388654.1 protein_id gnl|my_center|LOCUS_26730 123938 124393 gene locus_tag LOCUS_26740 123938 124393 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888850.1 protein_id gnl|my_center|LOCUS_26740 124415 125317 gene locus_tag LOCUS_26750 124415 125317 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388653.1 protein_id gnl|my_center|LOCUS_26750 125454 125876 gene locus_tag LOCUS_26760 125454 125876 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145171248.1 protein_id gnl|my_center|LOCUS_26760 126037 126555 gene locus_tag LOCUS_26770 126037 126555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 126982 126653 gene locus_tag LOCUS_26780 126982 126653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 127922 127086 gene locus_tag LOCUS_26790 127922 127086 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479707.1 protein_id gnl|my_center|LOCUS_26790 128461 128955 gene locus_tag LOCUS_26800 128461 128955 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_26800 129012 129206 gene locus_tag LOCUS_26810 129012 129206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 129291 131051 gene locus_tag LOCUS_26820 gene malZ 129291 131051 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818979.1 protein_id gnl|my_center|LOCUS_26820 131084 132553 gene locus_tag LOCUS_26830 131084 132553 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967946.1 protein_id gnl|my_center|LOCUS_26830 132708 133340 gene locus_tag LOCUS_26840 132708 133340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 133897 133418 gene locus_tag LOCUS_26850 133897 133418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 134053 134631 gene locus_tag LOCUS_26860 134053 134631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 135423 134770 gene locus_tag LOCUS_26870 135423 134770 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888515.1 protein_id gnl|my_center|LOCUS_26870 137220 135715 gene locus_tag LOCUS_26880 gene mmsA 137220 135715 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_26880 138570 137242 gene locus_tag LOCUS_26890 138570 137242 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_26890 139490 138732 gene locus_tag LOCUS_26900 139490 138732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 140737 139490 gene locus_tag LOCUS_26910 140737 139490 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811711.1 protein_id gnl|my_center|LOCUS_26910 141887 140832 gene locus_tag LOCUS_26920 141887 140832 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383812.1 protein_id gnl|my_center|LOCUS_26920 142929 141961 gene locus_tag LOCUS_26930 142929 141961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391202.1 protein_id gnl|my_center|LOCUS_26930 143774 142908 gene locus_tag LOCUS_26940 143774 142908 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394444.1 protein_id gnl|my_center|LOCUS_26940 144571 143771 gene locus_tag LOCUS_26950 144571 143771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 protein_id gnl|my_center|LOCUS_26950 145966 144584 gene locus_tag LOCUS_26960 gene hydA 145966 144584 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 protein_id gnl|my_center|LOCUS_26960 147646 146267 gene locus_tag LOCUS_26970 gene preA 147646 146267 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066584.1 protein_id gnl|my_center|LOCUS_26970 148961 147639 gene locus_tag LOCUS_26980 gene gltA 148961 147639 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_26980 150628 149477 gene locus_tag LOCUS_26990 150628 149477 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887733.1 protein_id gnl|my_center|LOCUS_26990 150887 152347 gene locus_tag LOCUS_27000 150887 152347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 152509 153285 gene locus_tag LOCUS_27010 152509 153285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 153932 153381 gene locus_tag LOCUS_27020 153932 153381 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029745.1 protein_id gnl|my_center|LOCUS_27020 154239 155681 gene locus_tag LOCUS_27030 154239 155681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 155678 156166 gene locus_tag LOCUS_27040 155678 156166 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143451.1 protein_id gnl|my_center|LOCUS_27040 156617 156183 gene locus_tag LOCUS_27050 156617 156183 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480199.1 protein_id gnl|my_center|LOCUS_27050 157137 156733 gene locus_tag LOCUS_27060 157137 156733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 157529 157134 gene locus_tag LOCUS_27070 157529 157134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 158501 157581 gene locus_tag LOCUS_27080 158501 157581 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461861.1 protein_id gnl|my_center|LOCUS_27080 158602 159603 gene locus_tag LOCUS_27090 158602 159603 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618773.1 protein_id gnl|my_center|LOCUS_27090 160399 159605 gene locus_tag LOCUS_27100 160399 159605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 160618 161943 gene locus_tag LOCUS_27110 160618 161943 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617954.1 protein_id gnl|my_center|LOCUS_27110 161940 162983 gene locus_tag LOCUS_27120 161940 162983 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479997.1 protein_id gnl|my_center|LOCUS_27120 162980 164344 gene locus_tag LOCUS_27130 162980 164344 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_27130 164341 165045 gene locus_tag LOCUS_27140 164341 165045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_27140 165105 166340 gene locus_tag LOCUS_27150 165105 166340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_27150 166369 167019 gene locus_tag LOCUS_27160 166369 167019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 167147 167956 gene locus_tag LOCUS_27170 167147 167956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 167982 168899 gene locus_tag LOCUS_27180 gene pdxY 167982 168899 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 protein_id gnl|my_center|LOCUS_27180 168991 171339 gene locus_tag LOCUS_27190 168991 171339 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404537.1 protein_id gnl|my_center|LOCUS_27190 171675 173165 gene locus_tag LOCUS_27200 gene glpK 171675 173165 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_27200 173506 174468 gene locus_tag LOCUS_27210 173506 174468 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_27210 175514 174537 gene locus_tag LOCUS_27220 175514 174537 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_27220 176325 175606 gene locus_tag LOCUS_27230 176325 175606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 176600 176337 gene locus_tag LOCUS_27240 176600 176337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 177758 177006 gene locus_tag LOCUS_27250 177758 177006 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_27250 177992 178615 gene locus_tag LOCUS_27260 177992 178615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 181277 178641 gene locus_tag LOCUS_27270 181277 178641 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence10 1005 2006 gene locus_tag LOCUS_27280 1005 2006 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_27280 2138 3376 gene locus_tag LOCUS_27290 2138 3376 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972798.1 protein_id gnl|my_center|LOCUS_27290 3537 4526 gene locus_tag LOCUS_27300 3537 4526 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_27300 4529 5398 gene locus_tag LOCUS_27310 4529 5398 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_27310 5410 6762 gene locus_tag LOCUS_27320 5410 6762 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_27320 6804 8375 gene locus_tag LOCUS_27330 6804 8375 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966722.1 protein_id gnl|my_center|LOCUS_27330 8916 9968 gene locus_tag LOCUS_27340 gene rodA 8916 9968 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228544.1 protein_id gnl|my_center|LOCUS_27340 10214 11173 gene locus_tag LOCUS_27350 10214 11173 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888945.1 protein_id gnl|my_center|LOCUS_27350 11720 11241 gene locus_tag LOCUS_27360 11720 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 12248 11772 gene locus_tag LOCUS_27370 12248 11772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 12321 12692 gene locus_tag LOCUS_27380 12321 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189144597.1 protein_id gnl|my_center|LOCUS_27380 12698 13024 gene locus_tag LOCUS_27390 12698 13024 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479796.1 protein_id gnl|my_center|LOCUS_27390 13167 15635 gene locus_tag LOCUS_27400 gene polA 13167 15635 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228405.1 protein_id gnl|my_center|LOCUS_27400 17470 15923 gene locus_tag LOCUS_27410 17470 15923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143411.1 protein_id gnl|my_center|LOCUS_27410 18210 17467 gene locus_tag LOCUS_27420 18210 17467 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143410.1 protein_id gnl|my_center|LOCUS_27420 18346 19779 gene locus_tag LOCUS_27430 18346 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 21812 19950 gene locus_tag LOCUS_27440 21812 19950 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886811.1 protein_id gnl|my_center|LOCUS_27440 22484 21933 gene locus_tag LOCUS_27450 22484 21933 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887290.1 protein_id gnl|my_center|LOCUS_27450 22614 22976 gene locus_tag LOCUS_27460 22614 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27460 23060 23524 gene locus_tag LOCUS_27470 23060 23524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27470 23638 24168 gene locus_tag LOCUS_27480 23638 24168 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479504.1 protein_id gnl|my_center|LOCUS_27480 24208 24711 gene locus_tag LOCUS_27490 gene coaD 24208 24711 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887287.1 protein_id gnl|my_center|LOCUS_27490 25592 24780 gene locus_tag LOCUS_27500 25592 24780 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887404.1 protein_id gnl|my_center|LOCUS_27500 26002 25595 gene locus_tag LOCUS_27510 26002 25595 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479599.1 protein_id gnl|my_center|LOCUS_27510 27370 26117 gene locus_tag LOCUS_27520 27370 26117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 27673 28455 gene locus_tag LOCUS_27530 gene hisF 27673 28455 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480000.1 protein_id gnl|my_center|LOCUS_27530 28452 29102 gene locus_tag LOCUS_27540 gene hisIE 28452 29102 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887378.1 protein_id gnl|my_center|LOCUS_27540 29799 29164 gene locus_tag LOCUS_27550 29799 29164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 30100 31071 gene locus_tag LOCUS_27560 gene glpX 30100 31071 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632957.1 protein_id gnl|my_center|LOCUS_27560 32190 31171 gene locus_tag LOCUS_27570 32190 31171 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886836.1 protein_id gnl|my_center|LOCUS_27570 33279 32194 gene locus_tag LOCUS_27580 33279 32194 CDS product DUF898 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869788.1 protein_id gnl|my_center|LOCUS_27580 33378 33782 gene locus_tag LOCUS_27590 33378 33782 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886893.1 protein_id gnl|my_center|LOCUS_27590 35041 33824 gene locus_tag LOCUS_27600 35041 33824 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480162.1 protein_id gnl|my_center|LOCUS_27600 35871 35044 gene locus_tag LOCUS_27610 35871 35044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 37967 36072 gene locus_tag LOCUS_27620 gene speA 37967 36072 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480160.1 protein_id gnl|my_center|LOCUS_27620 38570 38094 gene locus_tag LOCUS_27630 38570 38094 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173648.1 protein_id gnl|my_center|LOCUS_27630 40878 38677 gene locus_tag LOCUS_27640 40878 38677 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889506.1 protein_id gnl|my_center|LOCUS_27640 41342 40875 gene locus_tag LOCUS_27650 41342 40875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 43911 41704 gene locus_tag LOCUS_27660 43911 41704 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888410.1 protein_id gnl|my_center|LOCUS_27660 44056 44418 gene locus_tag LOCUS_27670 44056 44418 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888250.1 protein_id gnl|my_center|LOCUS_27670 44668 45135 gene locus_tag LOCUS_27680 44668 45135 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888831.1 protein_id gnl|my_center|LOCUS_27680 45337 45750 gene locus_tag LOCUS_27690 45337 45750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 45833 46801 gene locus_tag LOCUS_27700 45833 46801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479894.1 protein_id gnl|my_center|LOCUS_27700 46810 47757 gene locus_tag LOCUS_27710 46810 47757 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887920.1 protein_id gnl|my_center|LOCUS_27710 47758 48573 gene locus_tag LOCUS_27720 47758 48573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888827.1 protein_id gnl|my_center|LOCUS_27720 48570 49229 gene locus_tag LOCUS_27730 48570 49229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226153.1 protein_id gnl|my_center|LOCUS_27730 52192 49310 gene locus_tag LOCUS_27740 52192 49310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 54000 52321 gene locus_tag LOCUS_27750 54000 52321 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887436.1 protein_id gnl|my_center|LOCUS_27750 55170 54100 gene locus_tag LOCUS_27760 55170 54100 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177656.1 protein_id gnl|my_center|LOCUS_27760 55434 56183 gene locus_tag LOCUS_27770 55434 56183 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887968.1 protein_id gnl|my_center|LOCUS_27770 56194 56925 gene locus_tag LOCUS_27780 56194 56925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 57123 57551 gene locus_tag LOCUS_27790 gene rplM 57123 57551 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886820.1 protein_id gnl|my_center|LOCUS_27790 57551 57937 gene locus_tag LOCUS_27800 gene rpsI 57551 57937 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886821.1 protein_id gnl|my_center|LOCUS_27800 58537 58073 gene locus_tag LOCUS_27810 58537 58073 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142675.1 protein_id gnl|my_center|LOCUS_27810 58853 59146 gene locus_tag LOCUS_27820 58853 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 59175 59915 gene locus_tag LOCUS_27830 59175 59915 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399111.1 protein_id gnl|my_center|LOCUS_27830 61155 59932 gene locus_tag LOCUS_27840 61155 59932 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884033.1 protein_id gnl|my_center|LOCUS_27840 61781 61152 gene locus_tag LOCUS_27850 61781 61152 CDS product RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_27850 62796 61933 gene locus_tag LOCUS_27860 62796 61933 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975986.1 protein_id gnl|my_center|LOCUS_27860 62959 63720 gene locus_tag LOCUS_27870 62959 63720 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968971.1 protein_id gnl|my_center|LOCUS_27870 63773 64219 gene locus_tag LOCUS_27880 63773 64219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 64467 65237 gene locus_tag LOCUS_27890 64467 65237 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888493.1 protein_id gnl|my_center|LOCUS_27890 65262 65747 gene locus_tag LOCUS_27900 65262 65747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 65772 66407 gene locus_tag LOCUS_27910 65772 66407 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532366.1 protein_id gnl|my_center|LOCUS_27910 66860 66483 gene locus_tag LOCUS_27920 66860 66483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 67891 66857 gene locus_tag LOCUS_27930 67891 66857 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401213.1 protein_id gnl|my_center|LOCUS_27930 68498 67878 gene locus_tag LOCUS_27940 gene pnuC 68498 67878 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_27940 68770 69471 gene locus_tag LOCUS_27950 68770 69471 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886696.1 protein_id gnl|my_center|LOCUS_27950 72033 69604 gene locus_tag LOCUS_27960 gene leuS 72033 69604 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479923.1 protein_id gnl|my_center|LOCUS_27960 72372 72614 gene locus_tag LOCUS_27970 72372 72614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 72776 73558 gene locus_tag LOCUS_27980 72776 73558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 73638 74690 gene locus_tag LOCUS_27990 73638 74690 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887733.1 protein_id gnl|my_center|LOCUS_27990 76752 74992 gene locus_tag LOCUS_28000 76752 74992 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_28000 77151 76885 gene locus_tag LOCUS_28010 77151 76885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 77473 77327 gene locus_tag LOCUS_28020 77473 77327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 77660 79447 gene locus_tag LOCUS_28030 77660 79447 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349776.1 protein_id gnl|my_center|LOCUS_28030 79699 80511 gene locus_tag LOCUS_28040 79699 80511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479623.1 protein_id gnl|my_center|LOCUS_28040 80655 81695 gene locus_tag LOCUS_28050 gene fni 80655 81695 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870894.1 protein_id gnl|my_center|LOCUS_28050 81818 82462 gene locus_tag LOCUS_28060 81818 82462 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204186.1 protein_id gnl|my_center|LOCUS_28060 82540 83262 gene locus_tag LOCUS_28070 82540 83262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 protein_id gnl|my_center|LOCUS_28070 83303 83737 gene locus_tag LOCUS_28080 83303 83737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 86332 84038 gene locus_tag LOCUS_28090 86332 84038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 86544 86329 gene locus_tag LOCUS_28100 86544 86329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 86976 87284 gene locus_tag LOCUS_28110 86976 87284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 87444 88046 gene locus_tag LOCUS_28120 87444 88046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 88241 89362 gene locus_tag LOCUS_28130 gene mqnE 88241 89362 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_28130 89440 90273 gene locus_tag LOCUS_28140 89440 90273 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887015.1 protein_id gnl|my_center|LOCUS_28140 90513 91019 gene locus_tag LOCUS_28150 90513 91019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 91138 91659 gene locus_tag LOCUS_28160 91138 91659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 91679 91984 gene locus_tag LOCUS_28170 91679 91984 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371948.1 protein_id gnl|my_center|LOCUS_28170 92817 91981 gene locus_tag LOCUS_28180 gene prmC 92817 91981 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886891.1 protein_id gnl|my_center|LOCUS_28180 93406 92834 gene locus_tag LOCUS_28190 93406 92834 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886892.1 protein_id gnl|my_center|LOCUS_28190 96749 93534 gene locus_tag LOCUS_28200 96749 93534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 97202 97786 gene locus_tag LOCUS_28210 97202 97786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 99332 97851 gene locus_tag LOCUS_28220 99332 97851 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479933.1 protein_id gnl|my_center|LOCUS_28220 99932 99573 gene locus_tag LOCUS_28230 99932 99573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 100097 99963 gene locus_tag LOCUS_28240 gene rpmH 100097 99963 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_28240 100390 100235 gene locus_tag LOCUS_28250 100390 100235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 100503 102416 gene locus_tag LOCUS_28260 100503 102416 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887578.1 protein_id gnl|my_center|LOCUS_28260 104122 102527 gene locus_tag LOCUS_28270 104122 102527 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480032.1 protein_id gnl|my_center|LOCUS_28270 105313 104174 gene locus_tag LOCUS_28280 105313 104174 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888127.1 protein_id gnl|my_center|LOCUS_28280 107031 105382 gene locus_tag LOCUS_28290 107031 105382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 107133 107654 gene locus_tag LOCUS_28300 107133 107654 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479804.1 protein_id gnl|my_center|LOCUS_28300 107733 108995 gene locus_tag LOCUS_28310 107733 108995 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228267.1 protein_id gnl|my_center|LOCUS_28310 109675 109061 gene locus_tag LOCUS_28320 109675 109061 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259303.1 protein_id gnl|my_center|LOCUS_28320 111175 109862 gene locus_tag LOCUS_28330 gene hisD 111175 109862 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888771.1 protein_id gnl|my_center|LOCUS_28330 112008 111172 gene locus_tag LOCUS_28340 112008 111172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 112414 111998 gene locus_tag LOCUS_28350 112414 111998 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_28350 113961 112510 gene locus_tag LOCUS_28360 113961 112510 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887486.1 protein_id gnl|my_center|LOCUS_28360 114049 114498 gene locus_tag LOCUS_28370 114049 114498 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707487.1 protein_id gnl|my_center|LOCUS_28370 116490 114553 gene locus_tag LOCUS_28380 gene acs 116490 114553 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889096.1 protein_id gnl|my_center|LOCUS_28380 118018 116861 gene locus_tag LOCUS_28390 118018 116861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 118351 119718 gene locus_tag LOCUS_28400 118351 119718 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_28400 120550 119984 gene locus_tag LOCUS_28410 120550 119984 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_28410 120777 120550 gene locus_tag LOCUS_28420 120777 120550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 121156 120845 gene locus_tag LOCUS_28430 121156 120845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887000.1 protein_id gnl|my_center|LOCUS_28430 121220 121990 gene locus_tag LOCUS_28440 121220 121990 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349517.1 protein_id gnl|my_center|LOCUS_28440 122137 127308 gene locus_tag LOCUS_28450 122137 127308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 129328 127397 gene locus_tag LOCUS_28460 129328 127397 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350791.1 protein_id gnl|my_center|LOCUS_28460 129371 129447 gene locus_tag LOCUS_t00350 129371 129447 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 129920 130840 gene locus_tag LOCUS_28470 129920 130840 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350037.1 protein_id gnl|my_center|LOCUS_28470 130942 131556 gene locus_tag LOCUS_28480 130942 131556 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971535.1 protein_id gnl|my_center|LOCUS_28480 131599 131808 gene locus_tag LOCUS_28490 131599 131808 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786366.1 protein_id gnl|my_center|LOCUS_28490 132629 131997 gene locus_tag LOCUS_28500 gene hisG 132629 131997 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888084.1 protein_id gnl|my_center|LOCUS_28500 133314 132622 gene locus_tag LOCUS_28510 133314 132622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 134534 133434 gene locus_tag LOCUS_28520 134534 133434 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888083.1 protein_id gnl|my_center|LOCUS_28520 135002 134763 gene locus_tag LOCUS_28530 135002 134763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 136836 135028 gene locus_tag LOCUS_28540 136836 135028 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_28540 137844 137257 gene locus_tag LOCUS_28550 137844 137257 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 protein_id gnl|my_center|LOCUS_28550 138895 137852 gene locus_tag LOCUS_28560 138895 137852 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_28560 139468 138986 gene locus_tag LOCUS_28570 139468 138986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 139580 141049 gene locus_tag LOCUS_28580 gene proS 139580 141049 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887909.1 protein_id gnl|my_center|LOCUS_28580 141126 141956 gene locus_tag LOCUS_28590 141126 141956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 142773 142015 gene locus_tag LOCUS_28600 142773 142015 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240310.1 protein_id gnl|my_center|LOCUS_28600 143676 142792 gene locus_tag LOCUS_28610 143676 142792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_28610 145242 143914 gene locus_tag LOCUS_28620 145242 143914 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_28620 146367 145354 gene locus_tag LOCUS_28630 146367 145354 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_28630 147172 146423 gene locus_tag LOCUS_28640 147172 146423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 147297 148112 gene locus_tag LOCUS_28650 147297 148112 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707632.1 protein_id gnl|my_center|LOCUS_28650 148420 148166 gene locus_tag LOCUS_28660 148420 148166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 149411 148488 gene locus_tag LOCUS_28670 149411 148488 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888164.1 protein_id gnl|my_center|LOCUS_28670 150305 149493 gene locus_tag LOCUS_28680 gene rsmA 150305 149493 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618805.1 protein_id gnl|my_center|LOCUS_28680 150808 150308 gene locus_tag LOCUS_28690 150808 150308 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535785.1 protein_id gnl|my_center|LOCUS_28690 151440 151060 gene locus_tag LOCUS_28700 151440 151060 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940853.1 protein_id gnl|my_center|LOCUS_28700 151658 152284 gene locus_tag LOCUS_28710 gene azoR3 151658 152284 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_28710 152929 152339 gene locus_tag LOCUS_28720 152929 152339 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 protein_id gnl|my_center|LOCUS_28720 153041 153925 gene locus_tag LOCUS_28730 153041 153925 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_28730 154489 153941 gene locus_tag LOCUS_28740 154489 153941 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888661.1 protein_id gnl|my_center|LOCUS_28740 155724 154531 gene locus_tag LOCUS_28750 155724 154531 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244857.1 protein_id gnl|my_center|LOCUS_28750 156340 155717 gene locus_tag LOCUS_28760 156340 155717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 156451 157248 gene locus_tag LOCUS_28770 156451 157248 CDS product DUF2785 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006686.1 protein_id gnl|my_center|LOCUS_28770 159215 157251 gene locus_tag LOCUS_28780 159215 157251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 159283 160020 gene locus_tag LOCUS_28790 159283 160020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669374.1 protein_id gnl|my_center|LOCUS_28790 160004 161653 gene locus_tag LOCUS_28800 160004 161653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 161966 163291 gene locus_tag LOCUS_28810 161966 163291 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_28810 163368 163442 gene locus_tag LOCUS_t00360 163368 163442 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 164112 163492 gene locus_tag LOCUS_28820 164112 163492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence11 265 465 gene locus_tag LOCUS_28830 265 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 994 479 gene locus_tag LOCUS_28840 994 479 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479516.1 protein_id gnl|my_center|LOCUS_28840 1183 2076 gene locus_tag LOCUS_28850 1183 2076 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887299.1 protein_id gnl|my_center|LOCUS_28850 2742 2092 gene locus_tag LOCUS_28860 2742 2092 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888933.1 protein_id gnl|my_center|LOCUS_28860 3376 2744 gene locus_tag LOCUS_28870 3376 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 3430 4653 gene locus_tag LOCUS_28880 3430 4653 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214261.1 protein_id gnl|my_center|LOCUS_28880 5823 4864 gene locus_tag LOCUS_28890 5823 4864 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889245.1 protein_id gnl|my_center|LOCUS_28890 6580 5816 gene locus_tag LOCUS_28900 6580 5816 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889246.1 protein_id gnl|my_center|LOCUS_28900 7606 6806 gene locus_tag LOCUS_28910 7606 6806 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256233.1 protein_id gnl|my_center|LOCUS_28910 7744 8634 gene locus_tag LOCUS_28920 7744 8634 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888882.1 protein_id gnl|my_center|LOCUS_28920 8726 9526 gene locus_tag LOCUS_28930 8726 9526 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 protein_id gnl|my_center|LOCUS_28930 10065 9529 gene locus_tag LOCUS_28940 10065 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 10800 10240 gene locus_tag LOCUS_28950 10800 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 11096 10797 gene locus_tag LOCUS_28960 11096 10797 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_28960 11600 11235 gene locus_tag LOCUS_28970 11600 11235 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888811.1 protein_id gnl|my_center|LOCUS_28970 12176 11637 gene locus_tag LOCUS_28980 12176 11637 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888812.1 protein_id gnl|my_center|LOCUS_28980 12883 12176 gene locus_tag LOCUS_28990 12883 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 16158 13483 gene locus_tag LOCUS_29000 gene alaS 16158 13483 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888928.1 protein_id gnl|my_center|LOCUS_29000 16937 16257 gene locus_tag LOCUS_29010 16937 16257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 17794 17357 gene locus_tag LOCUS_29020 17794 17357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466698.1 protein_id gnl|my_center|LOCUS_29020 18588 17797 gene locus_tag LOCUS_29030 18588 17797 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027790.1 protein_id gnl|my_center|LOCUS_29030 19217 18585 gene locus_tag LOCUS_29040 19217 18585 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143625.1 protein_id gnl|my_center|LOCUS_29040 19554 20387 gene locus_tag LOCUS_29050 19554 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 20520 21737 gene locus_tag LOCUS_29060 20520 21737 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229160.1 protein_id gnl|my_center|LOCUS_29060 22358 21741 gene locus_tag LOCUS_29070 22358 21741 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 protein_id gnl|my_center|LOCUS_29070 22526 22451 gene locus_tag LOCUS_t00370 22526 22451 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23335 22565 gene locus_tag LOCUS_29080 23335 22565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 23888 23412 gene locus_tag LOCUS_29090 23888 23412 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229703.1 protein_id gnl|my_center|LOCUS_29090 24429 24004 gene locus_tag LOCUS_29100 24429 24004 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229702.1 protein_id gnl|my_center|LOCUS_29100 24527 25354 gene locus_tag LOCUS_29110 24527 25354 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228628.1 protein_id gnl|my_center|LOCUS_29110 25617 26429 gene locus_tag LOCUS_29120 gene lepB 25617 26429 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350452.1 protein_id gnl|my_center|LOCUS_29120 26796 26473 gene locus_tag LOCUS_29130 26796 26473 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888117.1 protein_id gnl|my_center|LOCUS_29130 27269 26796 gene locus_tag LOCUS_29140 27269 26796 CDS product DUF1999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887837.1 protein_id gnl|my_center|LOCUS_29140 27880 27296 gene locus_tag LOCUS_29150 27880 27296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 28024 28416 gene locus_tag LOCUS_29160 28024 28416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888999.1 protein_id gnl|my_center|LOCUS_29160 28419 29630 gene locus_tag LOCUS_29170 28419 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 31021 30092 gene locus_tag LOCUS_29180 31021 30092 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227789.1 protein_id gnl|my_center|LOCUS_29180 32103 31018 gene locus_tag LOCUS_29190 32103 31018 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480328.1 protein_id gnl|my_center|LOCUS_29190 33143 32100 gene locus_tag LOCUS_29200 33143 32100 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567746.1 protein_id gnl|my_center|LOCUS_29200 33426 34031 gene locus_tag LOCUS_29210 gene acuA 33426 34031 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581400.1 protein_id gnl|my_center|LOCUS_29210 34188 34808 gene locus_tag LOCUS_29220 34188 34808 CDS product acetoin utilization AcuB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172560.1 protein_id gnl|my_center|LOCUS_29220 34805 35959 gene locus_tag LOCUS_29230 34805 35959 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227961.1 protein_id gnl|my_center|LOCUS_29230 35960 36280 gene locus_tag LOCUS_29240 35960 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 36772 36287 gene locus_tag LOCUS_29250 36772 36287 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284381.1 protein_id gnl|my_center|LOCUS_29250 38382 36847 gene locus_tag LOCUS_29260 38382 36847 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887662.1 protein_id gnl|my_center|LOCUS_29260 38933 38574 gene locus_tag LOCUS_29270 38933 38574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 39212 39538 gene locus_tag LOCUS_29280 39212 39538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532546.1 protein_id gnl|my_center|LOCUS_29280 40261 39599 gene locus_tag LOCUS_29290 gene trmH 40261 39599 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888841.1 protein_id gnl|my_center|LOCUS_29290 41168 40335 gene locus_tag LOCUS_29300 41168 40335 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480324.1 protein_id gnl|my_center|LOCUS_29300 41357 42013 gene locus_tag LOCUS_29310 41357 42013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 43058 42069 gene locus_tag LOCUS_29320 gene mutY 43058 42069 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888913.1 protein_id gnl|my_center|LOCUS_29320 43166 43837 gene locus_tag LOCUS_29330 43166 43837 CDS product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480307.1 protein_id gnl|my_center|LOCUS_29330 44839 43844 gene locus_tag LOCUS_29340 44839 43844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 45198 46058 gene locus_tag LOCUS_29350 45198 46058 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480277.1 protein_id gnl|my_center|LOCUS_29350 46063 47067 gene locus_tag LOCUS_29360 46063 47067 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350864.1 protein_id gnl|my_center|LOCUS_29360 47064 47861 gene locus_tag LOCUS_29370 47064 47861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480276.1 protein_id gnl|my_center|LOCUS_29370 47854 48204 gene locus_tag LOCUS_29380 47854 48204 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889215.1 protein_id gnl|my_center|LOCUS_29380 48283 48600 gene locus_tag LOCUS_29390 48283 48600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 49150 48608 gene locus_tag LOCUS_29400 49150 48608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 49273 49731 gene locus_tag LOCUS_29410 49273 49731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 49876 50130 gene locus_tag LOCUS_29420 49876 50130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 50627 50941 gene locus_tag LOCUS_29430 50627 50941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 50994 51128 gene locus_tag LOCUS_29440 50994 51128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 51314 51544 gene locus_tag LOCUS_29450 51314 51544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 51640 52164 gene locus_tag LOCUS_29460 51640 52164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 52534 52175 gene locus_tag LOCUS_29470 52534 52175 CDS product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973339.1 protein_id gnl|my_center|LOCUS_29470 53127 52774 gene locus_tag LOCUS_29480 53127 52774 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241135.1 protein_id gnl|my_center|LOCUS_29480 53474 53154 gene locus_tag LOCUS_29490 53474 53154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29490 53955 53455 gene locus_tag LOCUS_29500 53955 53455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29500 54065 54244 gene locus_tag LOCUS_29510 54065 54244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 54288 54626 gene locus_tag LOCUS_29520 54288 54626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 54915 54685 gene locus_tag LOCUS_29530 54915 54685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 55097 55022 gene locus_tag LOCUS_t00380 55097 55022 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 55158 56717 gene locus_tag LOCUS_29540 55158 56717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 56870 57490 gene locus_tag LOCUS_29550 56870 57490 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 protein_id gnl|my_center|LOCUS_29550 57568 58038 gene locus_tag LOCUS_29560 57568 58038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 58883 58215 gene locus_tag LOCUS_29570 58883 58215 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887347.1 protein_id gnl|my_center|LOCUS_29570 60402 58990 gene locus_tag LOCUS_29580 60402 58990 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887346.1 protein_id gnl|my_center|LOCUS_29580 62160 60418 gene locus_tag LOCUS_29590 62160 60418 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887345.1 protein_id gnl|my_center|LOCUS_29590 62590 62264 gene locus_tag LOCUS_29600 62590 62264 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887344.1 protein_id gnl|my_center|LOCUS_29600 63560 62583 gene locus_tag LOCUS_29610 63560 62583 CDS product V-type ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480006.1 protein_id gnl|my_center|LOCUS_29610 64149 63571 gene locus_tag LOCUS_29620 64149 63571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 64447 64157 gene locus_tag LOCUS_29630 64447 64157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 66503 64464 gene locus_tag LOCUS_29640 66503 64464 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887340.1 protein_id gnl|my_center|LOCUS_29640 66820 66500 gene locus_tag LOCUS_29650 66820 66500 CDS product V-type ATPase subunit subunit G family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887339.1 protein_id gnl|my_center|LOCUS_29650 67785 67219 gene locus_tag LOCUS_29660 67785 67219 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391994.1 protein_id gnl|my_center|LOCUS_29660 68873 67866 gene locus_tag LOCUS_29670 68873 67866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 72024 69112 gene locus_tag LOCUS_29680 72024 69112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 72699 72343 gene locus_tag LOCUS_29690 72699 72343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 72937 76902 gene locus_tag LOCUS_29700 gene dnaE 72937 76902 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887152.1 protein_id gnl|my_center|LOCUS_29700 77559 77017 gene locus_tag LOCUS_29710 77559 77017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 78657 77776 gene locus_tag LOCUS_29720 78657 77776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 79285 78929 gene locus_tag LOCUS_29730 79285 78929 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258045.1 protein_id gnl|my_center|LOCUS_29730 79720 79514 gene locus_tag LOCUS_29740 79720 79514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 80121 79801 gene locus_tag LOCUS_29750 80121 79801 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229169.1 protein_id gnl|my_center|LOCUS_29750 80209 81294 gene locus_tag LOCUS_29760 gene solA 80209 81294 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_29760 82530 81352 gene locus_tag LOCUS_29770 82530 81352 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479765.1 protein_id gnl|my_center|LOCUS_29770 83000 82527 gene locus_tag LOCUS_29780 83000 82527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 83103 83621 gene locus_tag LOCUS_29790 83103 83621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 83663 84202 gene locus_tag LOCUS_29800 83663 84202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 84262 84705 gene locus_tag LOCUS_29810 84262 84705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 84702 85457 gene locus_tag LOCUS_29820 84702 85457 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_29820 86471 85473 gene locus_tag LOCUS_29830 86471 85473 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886915.1 protein_id gnl|my_center|LOCUS_29830 86640 87107 gene locus_tag LOCUS_29840 86640 87107 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224812.1 protein_id gnl|my_center|LOCUS_29840 87689 87270 gene locus_tag LOCUS_29850 87689 87270 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532393.1 protein_id gnl|my_center|LOCUS_29850 87920 88762 gene locus_tag LOCUS_29860 87920 88762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 88777 91275 gene locus_tag LOCUS_29870 88777 91275 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_29870 91272 92363 gene locus_tag LOCUS_29880 91272 92363 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969759.1 protein_id gnl|my_center|LOCUS_29880 92360 93652 gene locus_tag LOCUS_29890 92360 93652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 93649 94557 gene locus_tag LOCUS_29900 93649 94557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 94640 95962 gene locus_tag LOCUS_29910 94640 95962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 97473 96166 gene locus_tag LOCUS_29920 gene mnmE 97473 96166 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887659.1 protein_id gnl|my_center|LOCUS_29920 97804 97553 gene locus_tag LOCUS_29930 97804 97553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 98325 97804 gene locus_tag LOCUS_29940 98325 97804 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945913.1 protein_id gnl|my_center|LOCUS_29940 99006 98548 gene locus_tag LOCUS_29950 99006 98548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 99610 100476 gene locus_tag LOCUS_29960 99610 100476 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350701.1 protein_id gnl|my_center|LOCUS_29960 101345 100641 gene locus_tag LOCUS_29970 gene lepB 101345 100641 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350452.1 protein_id gnl|my_center|LOCUS_29970 102028 101342 gene locus_tag LOCUS_29980 102028 101342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 102351 102025 gene locus_tag LOCUS_29990 102351 102025 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_29990 102434 103330 gene locus_tag LOCUS_30000 gene ubiA 102434 103330 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479699.1 protein_id gnl|my_center|LOCUS_30000 105703 103340 gene locus_tag LOCUS_30010 105703 103340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 106037 106522 gene locus_tag LOCUS_30020 106037 106522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349654.1 protein_id gnl|my_center|LOCUS_30020 106519 107058 gene locus_tag LOCUS_30030 106519 107058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 107185 107862 gene locus_tag LOCUS_30040 107185 107862 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887388.1 protein_id gnl|my_center|LOCUS_30040 108183 109658 gene locus_tag LOCUS_30050 108183 109658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 109707 110372 gene locus_tag LOCUS_30060 109707 110372 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_30060 110383 111630 gene locus_tag LOCUS_30070 110383 111630 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888244.1 protein_id gnl|my_center|LOCUS_30070 111758 112723 gene locus_tag LOCUS_30080 gene ttcA 111758 112723 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693987.1 protein_id gnl|my_center|LOCUS_30080 113770 112901 gene locus_tag LOCUS_30090 113770 112901 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107136145.1 protein_id gnl|my_center|LOCUS_30090 114714 113947 gene locus_tag LOCUS_30100 gene tatC 114714 113947 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_30100 114950 114717 gene locus_tag LOCUS_30110 114950 114717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 115124 115720 gene locus_tag LOCUS_30120 115124 115720 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 protein_id gnl|my_center|LOCUS_30120 115717 116397 gene locus_tag LOCUS_30130 115717 116397 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229094.1 protein_id gnl|my_center|LOCUS_30130 117631 116447 gene locus_tag LOCUS_30140 117631 116447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 117787 118509 gene locus_tag LOCUS_30150 117787 118509 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350256.1 protein_id gnl|my_center|LOCUS_30150 118506 119450 gene locus_tag LOCUS_30160 118506 119450 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888315.1 protein_id gnl|my_center|LOCUS_30160 119510 121741 gene locus_tag LOCUS_30170 119510 121741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 121955 122302 gene locus_tag LOCUS_30180 121955 122302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 122804 122370 gene locus_tag LOCUS_30190 gene mscL 122804 122370 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889048.1 protein_id gnl|my_center|LOCUS_30190 122966 123376 gene locus_tag LOCUS_30200 122966 123376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 124825 123476 gene locus_tag LOCUS_30210 124825 123476 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092263432.1 protein_id gnl|my_center|LOCUS_30210 125211 124822 gene locus_tag LOCUS_30220 125211 124822 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480008.1 protein_id gnl|my_center|LOCUS_30220 125763 125578 gene locus_tag LOCUS_30230 125763 125578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 127247 126027 gene locus_tag LOCUS_30240 127247 126027 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888856.1 protein_id gnl|my_center|LOCUS_30240 128744 127395 gene locus_tag LOCUS_30250 gene der 128744 127395 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888936.1 protein_id gnl|my_center|LOCUS_30250 128982 129515 gene locus_tag LOCUS_30260 128982 129515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 130524 129577 gene locus_tag LOCUS_30270 130524 129577 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 protein_id gnl|my_center|LOCUS_30270 131787 130903 gene locus_tag LOCUS_30280 131787 130903 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350720.1 protein_id gnl|my_center|LOCUS_30280 133322 132165 gene locus_tag LOCUS_30290 133322 132165 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_30290 133955 133335 gene locus_tag LOCUS_30300 133955 133335 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_30300 134299 134063 gene locus_tag LOCUS_30310 134299 134063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 135363 134398 gene locus_tag LOCUS_30320 gene axeA 135363 134398 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_30320 136857 135559 gene locus_tag LOCUS_30330 136857 135559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 138140 137130 gene locus_tag LOCUS_30340 gene mltG 138140 137130 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889177.1 protein_id gnl|my_center|LOCUS_30340 >Feature sequence12 76 948 gene locus_tag LOCUS_30350 76 948 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_30350 1167 1847 gene locus_tag LOCUS_30360 1167 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1896 2534 gene locus_tag LOCUS_30370 1896 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 2537 3796 gene locus_tag LOCUS_30380 2537 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3867 6362 gene locus_tag LOCUS_30390 3867 6362 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_30390 6699 8072 gene locus_tag LOCUS_30400 6699 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 8183 10366 gene locus_tag LOCUS_30410 8183 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 11428 10430 gene locus_tag LOCUS_30420 11428 10430 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 protein_id gnl|my_center|LOCUS_30420 12205 11621 gene locus_tag LOCUS_30430 12205 11621 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082850.1 protein_id gnl|my_center|LOCUS_30430 12578 13792 gene locus_tag LOCUS_30440 gene urtA 12578 13792 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889579.1 protein_id gnl|my_center|LOCUS_30440 13896 14804 gene locus_tag LOCUS_30450 gene urtB 13896 14804 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889580.1 protein_id gnl|my_center|LOCUS_30450 14806 15849 gene locus_tag LOCUS_30460 gene urtC 14806 15849 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889581.1 protein_id gnl|my_center|LOCUS_30460 15842 16621 gene locus_tag LOCUS_30470 gene urtD 15842 16621 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889582.1 protein_id gnl|my_center|LOCUS_30470 16614 17303 gene locus_tag LOCUS_30480 gene urtE 16614 17303 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889583.1 protein_id gnl|my_center|LOCUS_30480 17464 17766 gene locus_tag LOCUS_30490 17464 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 17750 17959 gene locus_tag LOCUS_30500 17750 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 17956 18306 gene locus_tag LOCUS_30510 17956 18306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 18303 20003 gene locus_tag LOCUS_30520 gene ureC 18303 20003 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889577.1 protein_id gnl|my_center|LOCUS_30520 20023 20649 gene locus_tag LOCUS_30530 20023 20649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 20696 21322 gene locus_tag LOCUS_30540 gene ureG 20696 21322 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889571.1 protein_id gnl|my_center|LOCUS_30540 21326 22111 gene locus_tag LOCUS_30550 21326 22111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 22252 23571 gene locus_tag LOCUS_30560 22252 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 23680 24018 gene locus_tag LOCUS_30570 23680 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 24105 24965 gene locus_tag LOCUS_30580 24105 24965 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098657.1 protein_id gnl|my_center|LOCUS_30580 26791 25163 gene locus_tag LOCUS_30590 26791 25163 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918873.1 protein_id gnl|my_center|LOCUS_30590 27594 26803 gene locus_tag LOCUS_30600 27594 26803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 28013 28444 gene locus_tag LOCUS_30610 28013 28444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 28441 29577 gene locus_tag LOCUS_30620 28441 29577 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_30620 29574 30773 gene locus_tag LOCUS_30630 29574 30773 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398440.1 protein_id gnl|my_center|LOCUS_30630 30894 31604 gene locus_tag LOCUS_30640 30894 31604 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140947.1 protein_id gnl|my_center|LOCUS_30640 32359 31685 gene locus_tag LOCUS_30650 32359 31685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 33506 32562 gene locus_tag LOCUS_30660 33506 32562 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_30660 33628 34506 gene locus_tag LOCUS_30670 33628 34506 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971279.1 protein_id gnl|my_center|LOCUS_30670 35915 34587 gene locus_tag LOCUS_30680 35915 34587 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480393.1 protein_id gnl|my_center|LOCUS_30680 36832 35912 gene locus_tag LOCUS_30690 36832 35912 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215631.1 protein_id gnl|my_center|LOCUS_30690 38488 36854 gene locus_tag LOCUS_30700 38488 36854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 42654 38485 gene locus_tag LOCUS_30710 gene cobN 42654 38485 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258438.1 protein_id gnl|my_center|LOCUS_30710 44200 43046 gene locus_tag LOCUS_30720 44200 43046 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_30720 44898 44209 gene locus_tag LOCUS_30730 44898 44209 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228939.1 protein_id gnl|my_center|LOCUS_30730 44969 45712 gene locus_tag LOCUS_30740 44969 45712 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366305.1 protein_id gnl|my_center|LOCUS_30740 45824 47263 gene locus_tag LOCUS_30750 45824 47263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 47423 48793 gene locus_tag LOCUS_30760 47423 48793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_30760 49085 48861 gene locus_tag LOCUS_30770 49085 48861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 49468 51204 gene locus_tag LOCUS_30780 49468 51204 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944620.1 protein_id gnl|my_center|LOCUS_30780 52744 51281 gene locus_tag LOCUS_30790 52744 51281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 53873 52962 gene locus_tag LOCUS_30800 53873 52962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 54455 55456 gene locus_tag LOCUS_30810 gene rhaS 54455 55456 CDS product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974435.1 protein_id gnl|my_center|LOCUS_30810 55683 57191 gene locus_tag LOCUS_30820 55683 57191 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974436.1 protein_id gnl|my_center|LOCUS_30820 57188 58186 gene locus_tag LOCUS_30830 57188 58186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533601.1 protein_id gnl|my_center|LOCUS_30830 58183 59178 gene locus_tag LOCUS_30840 58183 59178 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974438.1 protein_id gnl|my_center|LOCUS_30840 59182 59496 gene locus_tag LOCUS_30850 gene rhaM 59182 59496 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533603.1 protein_id gnl|my_center|LOCUS_30850 60010 59612 gene locus_tag LOCUS_30860 60010 59612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 62743 60119 gene locus_tag LOCUS_30870 62743 60119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 62918 63682 gene locus_tag LOCUS_30880 62918 63682 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_30880 65431 63743 gene locus_tag LOCUS_30890 gene cbaA 65431 63743 CDS product ba3-type cytochrome C oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173204.1 protein_id gnl|my_center|LOCUS_30890 65922 65428 gene locus_tag LOCUS_30900 gene cbaB 65922 65428 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_30900 66394 66047 gene locus_tag LOCUS_30910 66394 66047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 66888 66430 gene locus_tag LOCUS_30920 66888 66430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 67365 68141 gene locus_tag LOCUS_30930 67365 68141 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_30930 68175 69359 gene locus_tag LOCUS_30940 gene rhaI 68175 69359 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_30940 69401 71461 gene locus_tag LOCUS_30950 69401 71461 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_30950 71451 72950 gene locus_tag LOCUS_30960 71451 72950 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978046.1 protein_id gnl|my_center|LOCUS_30960 73059 73802 gene locus_tag LOCUS_30970 73059 73802 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_30970 73799 75214 gene locus_tag LOCUS_30980 73799 75214 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_30980 75211 75822 gene locus_tag LOCUS_30990 75211 75822 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888544.1 protein_id gnl|my_center|LOCUS_30990 75880 76173 gene locus_tag LOCUS_31000 75880 76173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 76370 76591 gene locus_tag LOCUS_31010 76370 76591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 76939 77970 gene locus_tag LOCUS_31020 76939 77970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 78089 78664 gene locus_tag LOCUS_31030 78089 78664 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970789.1 protein_id gnl|my_center|LOCUS_31030 78729 79511 gene locus_tag LOCUS_31040 78729 79511 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972011.1 protein_id gnl|my_center|LOCUS_31040 79822 80622 gene locus_tag LOCUS_31050 79822 80622 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_31050 80555 80845 gene locus_tag LOCUS_31060 80555 80845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 80853 81191 gene locus_tag LOCUS_31070 80853 81191 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081309.1 protein_id gnl|my_center|LOCUS_31070 81188 81709 gene locus_tag LOCUS_31080 81188 81709 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081306.1 protein_id gnl|my_center|LOCUS_31080 82251 82724 gene locus_tag LOCUS_31090 82251 82724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 82965 85970 gene locus_tag LOCUS_31100 82965 85970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 86116 86454 gene locus_tag LOCUS_31110 86116 86454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 87299 86466 gene locus_tag LOCUS_31120 87299 86466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 87388 87738 gene locus_tag LOCUS_31130 87388 87738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 87995 88393 gene locus_tag LOCUS_31140 87995 88393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 88538 88858 gene locus_tag LOCUS_31150 88538 88858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 89990 88938 gene locus_tag LOCUS_31160 89990 88938 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767698.1 protein_id gnl|my_center|LOCUS_31160 91117 90401 gene locus_tag LOCUS_31170 91117 90401 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_31170 91219 91926 gene locus_tag LOCUS_31180 91219 91926 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_31180 91982 93424 gene locus_tag LOCUS_31190 91982 93424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 93464 94435 gene locus_tag LOCUS_31200 93464 94435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 94598 99556 gene locus_tag LOCUS_31210 94598 99556 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_31210 99939 99586 gene locus_tag LOCUS_31220 99939 99586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 101906 100431 gene locus_tag LOCUS_31230 101906 100431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 102227 103204 gene locus_tag LOCUS_31240 102227 103204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 103392 104417 gene locus_tag LOCUS_31250 103392 104417 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_31250 104637 105902 gene locus_tag LOCUS_31260 104637 105902 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396358.1 protein_id gnl|my_center|LOCUS_31260 105966 106895 gene locus_tag LOCUS_31270 105966 106895 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942201.1 protein_id gnl|my_center|LOCUS_31270 106903 107745 gene locus_tag LOCUS_31280 106903 107745 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396365.1 protein_id gnl|my_center|LOCUS_31280 107824 109272 gene locus_tag LOCUS_31290 107824 109272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 109739 117151 gene locus_tag LOCUS_31300 109739 117151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 117139 121311 gene locus_tag LOCUS_31310 117139 121311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 121326 125864 gene locus_tag LOCUS_31320 121326 125864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 125861 127438 gene locus_tag LOCUS_31330 125861 127438 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025106704.1 protein_id gnl|my_center|LOCUS_31330 127428 128993 gene locus_tag LOCUS_31340 gene mftG 127428 128993 CDS product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748187.1 protein_id gnl|my_center|LOCUS_31340 128993 129697 gene locus_tag LOCUS_31350 128993 129697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 129799 130263 gene locus_tag LOCUS_31360 129799 130263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 132830 130347 gene locus_tag LOCUS_31370 132830 130347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence13 <1 909 gene locus_tag LOCUS_31380 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888111.1:alpha-amylase family glycosyl hydrolase 1495 1022 gene locus_tag LOCUS_31390 1495 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 2775 1639 gene locus_tag LOCUS_31400 2775 1639 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_31400 2857 3927 gene locus_tag LOCUS_31410 2857 3927 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284156.1 protein_id gnl|my_center|LOCUS_31410 5042 4152 gene locus_tag LOCUS_31420 5042 4152 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258919.1 protein_id gnl|my_center|LOCUS_31420 5423 5821 gene locus_tag LOCUS_31430 5423 5821 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975073.1 protein_id gnl|my_center|LOCUS_31430 5818 6726 gene locus_tag LOCUS_31440 5818 6726 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_31440 6912 7874 gene locus_tag LOCUS_31450 gene cmrA 6912 7874 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_31450 7953 9197 gene locus_tag LOCUS_31460 7953 9197 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_31460 10342 9668 gene locus_tag LOCUS_31470 10342 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886752.1 protein_id gnl|my_center|LOCUS_31470 10474 11118 gene locus_tag LOCUS_31480 10474 11118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 11336 12352 gene locus_tag LOCUS_31490 gene nmoA 11336 12352 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114723.1 protein_id gnl|my_center|LOCUS_31490 13580 12363 gene locus_tag LOCUS_31500 13580 12363 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733138.1 protein_id gnl|my_center|LOCUS_31500 14014 15270 gene locus_tag LOCUS_31510 14014 15270 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256270.1 protein_id gnl|my_center|LOCUS_31510 15480 16364 gene locus_tag LOCUS_31520 15480 16364 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_31520 16366 17262 gene locus_tag LOCUS_31530 16366 17262 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_31530 17328 20150 gene locus_tag LOCUS_31540 17328 20150 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_31540 20614 21744 gene locus_tag LOCUS_31550 20614 21744 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091306554.1 protein_id gnl|my_center|LOCUS_31550 21855 23126 gene locus_tag LOCUS_31560 21855 23126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 protein_id gnl|my_center|LOCUS_31560 23170 24078 gene locus_tag LOCUS_31570 23170 24078 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528573.1 protein_id gnl|my_center|LOCUS_31570 24152 25036 gene locus_tag LOCUS_31580 24152 25036 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533465.1 protein_id gnl|my_center|LOCUS_31580 25036 26010 gene locus_tag LOCUS_31590 25036 26010 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_31590 26007 26990 gene locus_tag LOCUS_31600 26007 26990 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_31600 26987 28066 gene locus_tag LOCUS_31610 26987 28066 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889414.1 protein_id gnl|my_center|LOCUS_31610 28361 29041 gene locus_tag LOCUS_31620 28361 29041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 29981 29118 gene locus_tag LOCUS_31630 29981 29118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 29997 30236 gene locus_tag LOCUS_31640 29997 30236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 31729 30380 gene locus_tag LOCUS_31650 31729 30380 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928419.1 protein_id gnl|my_center|LOCUS_31650 32311 31937 gene locus_tag LOCUS_31660 32311 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 32877 32500 gene locus_tag LOCUS_31670 gene trxA 32877 32500 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 protein_id gnl|my_center|LOCUS_31670 33391 33098 gene locus_tag LOCUS_31680 33391 33098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 33712 34089 gene locus_tag LOCUS_31690 33712 34089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 34769 34101 gene locus_tag LOCUS_31700 34769 34101 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462100.1 protein_id gnl|my_center|LOCUS_31700 36420 34762 gene locus_tag LOCUS_31710 36420 34762 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669463.1 protein_id gnl|my_center|LOCUS_31710 37115 36417 gene locus_tag LOCUS_31720 37115 36417 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094941.1 protein_id gnl|my_center|LOCUS_31720 37974 37117 gene locus_tag LOCUS_31730 37974 37117 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014683564.1 protein_id gnl|my_center|LOCUS_31730 38869 37964 gene locus_tag LOCUS_31740 gene ugpA 38869 37964 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972830.1 protein_id gnl|my_center|LOCUS_31740 40233 38947 gene locus_tag LOCUS_31750 40233 38947 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080298.1 protein_id gnl|my_center|LOCUS_31750 43770 40537 gene locus_tag LOCUS_31760 43770 40537 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_31760 44269 43829 gene locus_tag LOCUS_31770 44269 43829 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861052.1 protein_id gnl|my_center|LOCUS_31770 44857 44300 gene locus_tag LOCUS_31780 44857 44300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 45306 44854 gene locus_tag LOCUS_31790 45306 44854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 46447 45392 gene locus_tag LOCUS_31800 46447 45392 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228623.1 protein_id gnl|my_center|LOCUS_31800 46926 46444 gene locus_tag LOCUS_31810 46926 46444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 50391 46930 gene locus_tag LOCUS_31820 50391 46930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 51455 52099 gene locus_tag LOCUS_31830 51455 52099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 54166 52988 gene locus_tag LOCUS_31840 54166 52988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530113.1 protein_id gnl|my_center|LOCUS_31840 54263 54832 gene locus_tag LOCUS_31850 54263 54832 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115373.1 protein_id gnl|my_center|LOCUS_31850 55675 54821 gene locus_tag LOCUS_31860 55675 54821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 57332 55803 gene locus_tag LOCUS_31870 57332 55803 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_31870 57592 58734 gene locus_tag LOCUS_31880 57592 58734 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_31880 59376 58756 gene locus_tag LOCUS_31890 59376 58756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 59487 60620 gene locus_tag LOCUS_31900 gene dpaL 59487 60620 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706020.1 protein_id gnl|my_center|LOCUS_31900 60717 61121 gene locus_tag LOCUS_31910 60717 61121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 61123 65877 gene locus_tag LOCUS_31920 61123 65877 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889426.1 protein_id gnl|my_center|LOCUS_31920 66676 66209 gene locus_tag LOCUS_31930 66676 66209 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616176.1 protein_id gnl|my_center|LOCUS_31930 67185 67655 gene locus_tag LOCUS_31940 67185 67655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 68621 67698 gene locus_tag LOCUS_31950 68621 67698 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026819.1 protein_id gnl|my_center|LOCUS_31950 69967 68618 gene locus_tag LOCUS_31960 69967 68618 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_31960 71321 70041 gene locus_tag LOCUS_31970 71321 70041 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_31970 72331 71429 gene locus_tag LOCUS_31980 72331 71429 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_31980 73288 72344 gene locus_tag LOCUS_31990 73288 72344 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 protein_id gnl|my_center|LOCUS_31990 73775 73578 gene locus_tag LOCUS_32000 73775 73578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 73727 74797 gene locus_tag LOCUS_32010 73727 74797 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223494.1 protein_id gnl|my_center|LOCUS_32010 75040 76557 gene locus_tag LOCUS_32020 75040 76557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 76561 77556 gene locus_tag LOCUS_32030 76561 77556 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989566.1 protein_id gnl|my_center|LOCUS_32030 78444 77575 gene locus_tag LOCUS_32040 78444 77575 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229550.1 protein_id gnl|my_center|LOCUS_32040 78676 79104 gene locus_tag LOCUS_32050 78676 79104 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929224.1 protein_id gnl|my_center|LOCUS_32050 79298 79729 gene locus_tag LOCUS_32060 79298 79729 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222802.1 protein_id gnl|my_center|LOCUS_32060 80662 79859 gene locus_tag LOCUS_32070 80662 79859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 81700 80702 gene locus_tag LOCUS_32080 81700 80702 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228214.1 protein_id gnl|my_center|LOCUS_32080 82141 81728 gene locus_tag LOCUS_32090 gene msrB 82141 81728 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193880.1 protein_id gnl|my_center|LOCUS_32090 82479 82817 gene locus_tag LOCUS_32100 82479 82817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 83724 82825 gene locus_tag LOCUS_32110 83724 82825 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109834.1 protein_id gnl|my_center|LOCUS_32110 85105 83915 gene locus_tag LOCUS_32120 85105 83915 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974049.1 protein_id gnl|my_center|LOCUS_32120 86658 85228 gene locus_tag LOCUS_32130 86658 85228 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258585.1 protein_id gnl|my_center|LOCUS_32130 87575 86661 gene locus_tag LOCUS_32140 87575 86661 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974523.1 protein_id gnl|my_center|LOCUS_32140 88687 87572 gene locus_tag LOCUS_32150 88687 87572 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315886.1 protein_id gnl|my_center|LOCUS_32150 90021 88771 gene locus_tag LOCUS_32160 90021 88771 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974524.1 protein_id gnl|my_center|LOCUS_32160 91137 90124 gene locus_tag LOCUS_32170 91137 90124 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_32170 93405 91366 gene locus_tag LOCUS_32180 93405 91366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 94579 93947 gene locus_tag LOCUS_32190 94579 93947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 96658 94610 gene locus_tag LOCUS_32200 96658 94610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 97800 97342 gene locus_tag LOCUS_32210 97800 97342 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061563.1 protein_id gnl|my_center|LOCUS_32210 98800 97805 gene locus_tag LOCUS_32220 98800 97805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 protein_id gnl|my_center|LOCUS_32220 99902 98931 gene locus_tag LOCUS_32230 99902 98931 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 protein_id gnl|my_center|LOCUS_32230 100440 102026 gene locus_tag LOCUS_32240 100440 102026 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529339.1 protein_id gnl|my_center|LOCUS_32240 102438 103364 gene locus_tag LOCUS_32250 102438 103364 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_32250 103809 103585 gene locus_tag LOCUS_32260 103809 103585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 103871 105391 gene locus_tag LOCUS_32270 103871 105391 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089388.1 protein_id gnl|my_center|LOCUS_32270 105668 106192 gene locus_tag LOCUS_32280 105668 106192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 108603 106246 gene locus_tag LOCUS_32290 108603 106246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 109197 110843 gene locus_tag LOCUS_32300 109197 110843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 112350 110914 gene locus_tag LOCUS_32310 112350 110914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 113174 112347 gene locus_tag LOCUS_32320 113174 112347 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539808.1 protein_id gnl|my_center|LOCUS_32320 114117 113185 gene locus_tag LOCUS_32330 114117 113185 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082985.1 protein_id gnl|my_center|LOCUS_32330 115376 114117 gene locus_tag LOCUS_32340 115376 114117 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582870.1 protein_id gnl|my_center|LOCUS_32340 115366 115518 gene locus_tag LOCUS_32350 115366 115518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 115608 116729 gene locus_tag LOCUS_32360 115608 116729 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975127.1 protein_id gnl|my_center|LOCUS_32360 117113 118156 gene locus_tag LOCUS_32370 117113 118156 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258589.1 protein_id gnl|my_center|LOCUS_32370 118612 118160 gene locus_tag LOCUS_32380 118612 118160 CDS product peroxiredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225036.1 protein_id gnl|my_center|LOCUS_32380 119550 118609 gene locus_tag LOCUS_32390 gene trxB 119550 118609 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_32390 119678 120556 gene locus_tag LOCUS_32400 119678 120556 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_32400 120863 121402 gene locus_tag LOCUS_32410 120863 121402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 122346 121567 gene locus_tag LOCUS_32420 122346 121567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 122912 123505 gene locus_tag LOCUS_32430 122912 123505 CDS product LiaF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888448.1 protein_id gnl|my_center|LOCUS_32430 124102 125070 gene locus_tag LOCUS_32440 gene tal 124102 125070 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389111.1 protein_id gnl|my_center|LOCUS_32440 125953 125135 gene locus_tag LOCUS_32450 125953 125135 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029656.1 protein_id gnl|my_center|LOCUS_32450 126376 125987 gene locus_tag LOCUS_32460 126376 125987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 126649 129609 gene locus_tag LOCUS_32470 126649 129609 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258122.1 protein_id gnl|my_center|LOCUS_32470 129795 129595 gene locus_tag LOCUS_32480 129795 129595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 130560 129847 gene locus_tag LOCUS_32490 130560 129847 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887846.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence14 8204 8806 gene locus_tag LOCUS_32500 8204 8806 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_32500 9355 9179 gene locus_tag LOCUS_32510 9355 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 10209 9379 gene locus_tag LOCUS_32520 10209 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 11433 10222 gene locus_tag LOCUS_32530 11433 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 13016 11622 gene locus_tag LOCUS_32540 13016 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 13587 13823 gene locus_tag LOCUS_32550 13587 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 13820 14221 gene locus_tag LOCUS_32560 13820 14221 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_32560 14721 15872 gene locus_tag LOCUS_32570 14721 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 15895 16272 gene locus_tag LOCUS_32580 15895 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 16227 16529 gene locus_tag LOCUS_32590 16227 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 16516 16944 gene locus_tag LOCUS_32600 16516 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 16941 17546 gene locus_tag LOCUS_32610 16941 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 17575 17988 gene locus_tag LOCUS_32620 17575 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 17999 18622 gene locus_tag LOCUS_32630 17999 18622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 18609 19010 gene locus_tag LOCUS_32640 18609 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 19877 19095 gene locus_tag LOCUS_32650 19877 19095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 20688 20059 gene locus_tag LOCUS_32660 20688 20059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 21491 20781 gene locus_tag LOCUS_32670 21491 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 22591 21653 gene locus_tag LOCUS_32680 22591 21653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 23060 23941 gene locus_tag LOCUS_32690 23060 23941 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226695.1 protein_id gnl|my_center|LOCUS_32690 23938 24993 gene locus_tag LOCUS_32700 23938 24993 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532261.1 protein_id gnl|my_center|LOCUS_32700 25137 26039 gene locus_tag LOCUS_32710 25137 26039 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_32710 26671 26210 gene locus_tag LOCUS_32720 26671 26210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 27670 27248 gene locus_tag LOCUS_32730 27670 27248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 27816 28742 gene locus_tag LOCUS_32740 27816 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 28729 31512 gene locus_tag LOCUS_32750 28729 31512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 32167 32724 gene locus_tag LOCUS_32760 32167 32724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 32714 35029 gene locus_tag LOCUS_32770 32714 35029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 35090 36025 gene locus_tag LOCUS_32780 35090 36025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 36449 36054 gene locus_tag LOCUS_32790 36449 36054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 36776 37207 gene locus_tag LOCUS_32800 36776 37207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 37253 38266 gene locus_tag LOCUS_32810 37253 38266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 38257 38784 gene locus_tag LOCUS_32820 38257 38784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 38795 40069 gene locus_tag LOCUS_32830 38795 40069 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103359.1 protein_id gnl|my_center|LOCUS_32830 40157 40642 gene locus_tag LOCUS_32840 40157 40642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 40862 41119 gene locus_tag LOCUS_32850 40862 41119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 42670 41267 gene locus_tag LOCUS_32860 42670 41267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 42871 43113 gene locus_tag LOCUS_32870 42871 43113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 43367 43182 gene locus_tag LOCUS_32880 43367 43182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 43366 47139 gene locus_tag LOCUS_32890 43366 47139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 47378 47178 gene locus_tag LOCUS_32900 47378 47178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 48054 47488 gene locus_tag LOCUS_32910 48054 47488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 48221 48613 gene locus_tag LOCUS_32920 48221 48613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 48728 49660 gene locus_tag LOCUS_32930 48728 49660 CDS product nuclease-related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888392.1 protein_id gnl|my_center|LOCUS_32930 49703 51937 gene locus_tag LOCUS_32940 49703 51937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 52006 52260 gene locus_tag LOCUS_32950 52006 52260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 52314 53147 gene locus_tag LOCUS_32960 52314 53147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 53447 53151 gene locus_tag LOCUS_32970 53447 53151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 53623 54282 gene locus_tag LOCUS_32980 53623 54282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 54379 54945 gene locus_tag LOCUS_32990 54379 54945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 55617 54961 gene locus_tag LOCUS_33000 55617 54961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 55756 57516 gene locus_tag LOCUS_33010 55756 57516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 58002 57568 gene locus_tag LOCUS_33020 58002 57568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 60047 58599 gene locus_tag LOCUS_33030 60047 58599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 61804 60251 gene locus_tag LOCUS_33040 61804 60251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 64819 61940 gene locus_tag LOCUS_33050 64819 61940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 66256 64823 gene locus_tag LOCUS_33060 66256 64823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 67877 66324 gene locus_tag LOCUS_33070 67877 66324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 68289 69338 gene locus_tag LOCUS_33080 68289 69338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 69721 69431 gene locus_tag LOCUS_33090 69721 69431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 69852 70268 gene locus_tag LOCUS_33100 69852 70268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 70438 71085 gene locus_tag LOCUS_33110 70438 71085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 71119 71430 gene locus_tag LOCUS_33120 71119 71430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 71788 71483 gene locus_tag LOCUS_33130 71788 71483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 71890 72882 gene locus_tag LOCUS_33140 71890 72882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 74211 73108 gene locus_tag LOCUS_33150 74211 73108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 76260 75241 gene locus_tag LOCUS_33160 76260 75241 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_33160 76808 76257 gene locus_tag LOCUS_33170 76808 76257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 77568 76873 gene locus_tag LOCUS_33180 77568 76873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 78357 77782 gene locus_tag LOCUS_33190 78357 77782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 79783 78359 gene locus_tag LOCUS_33200 gene lnt 79783 78359 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853085.1 protein_id gnl|my_center|LOCUS_33200 80399 79830 gene locus_tag LOCUS_33210 80399 79830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 81821 80445 gene locus_tag LOCUS_33220 81821 80445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 83188 81836 gene locus_tag LOCUS_33230 83188 81836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 83789 83211 gene locus_tag LOCUS_33240 83789 83211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 84338 83985 gene locus_tag LOCUS_33250 84338 83985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 84775 84335 gene locus_tag LOCUS_33260 84775 84335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 86675 84957 gene locus_tag LOCUS_33270 86675 84957 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479585.1 protein_id gnl|my_center|LOCUS_33270 87590 86916 gene locus_tag LOCUS_33280 87590 86916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 87713 88162 gene locus_tag LOCUS_33290 87713 88162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 88159 88572 gene locus_tag LOCUS_33300 88159 88572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 89042 88563 gene locus_tag LOCUS_33310 89042 88563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 91239 89029 gene locus_tag LOCUS_33320 91239 89029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 91588 91872 gene locus_tag LOCUS_33330 91588 91872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 92009 92752 gene locus_tag LOCUS_33340 92009 92752 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_33340 92745 93164 gene locus_tag LOCUS_33350 92745 93164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 93157 94056 gene locus_tag LOCUS_33360 93157 94056 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229174.1 protein_id gnl|my_center|LOCUS_33360 94323 94159 gene locus_tag LOCUS_33370 94323 94159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 94718 94371 gene locus_tag LOCUS_33380 94718 94371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 96335 94935 gene locus_tag LOCUS_33390 96335 94935 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267012.1 protein_id gnl|my_center|LOCUS_33390 96933 96490 gene locus_tag LOCUS_33400 96933 96490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 97127 96930 gene locus_tag LOCUS_33410 97127 96930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 97322 98383 gene locus_tag LOCUS_33420 97322 98383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 99087 100298 gene locus_tag LOCUS_33430 99087 100298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 100348 100611 gene locus_tag LOCUS_33440 100348 100611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 100796 101233 gene locus_tag LOCUS_33450 100796 101233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 101230 101559 gene locus_tag LOCUS_33460 101230 101559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 101655 102206 gene locus_tag LOCUS_33470 101655 102206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 102821 102378 gene locus_tag LOCUS_33480 102821 102378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 103348 102932 gene locus_tag LOCUS_33490 103348 102932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 104862 103474 gene locus_tag LOCUS_33500 104862 103474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 106424 104781 gene locus_tag LOCUS_33510 106424 104781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 106892 106503 gene locus_tag LOCUS_33520 106892 106503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 107513 106893 gene locus_tag LOCUS_33530 107513 106893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 108332 107523 gene locus_tag LOCUS_33540 108332 107523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 109024 108329 gene locus_tag LOCUS_33550 109024 108329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 109777 109160 gene locus_tag LOCUS_33560 109777 109160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 110321 109926 gene locus_tag LOCUS_33570 110321 109926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 111385 110471 gene locus_tag LOCUS_33580 111385 110471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 111592 111798 gene locus_tag LOCUS_33590 111592 111798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 111866 112351 gene locus_tag LOCUS_33600 111866 112351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 112525 113796 gene locus_tag LOCUS_33610 112525 113796 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870846.1 protein_id gnl|my_center|LOCUS_33610 113793 115124 gene locus_tag LOCUS_33620 113793 115124 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_33620 116982 115531 gene locus_tag LOCUS_33630 116982 115531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 117655 116984 gene locus_tag LOCUS_33640 117655 116984 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063392.1 protein_id gnl|my_center|LOCUS_33640 117790 118230 gene locus_tag LOCUS_33650 117790 118230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 118230 119417 gene locus_tag LOCUS_33660 gene bshA 118230 119417 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618804.1 protein_id gnl|my_center|LOCUS_33660 119414 119716 gene locus_tag LOCUS_33670 119414 119716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 119762 120088 gene locus_tag LOCUS_33680 119762 120088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 120501 120217 gene locus_tag LOCUS_33690 120501 120217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 120698 120877 gene locus_tag LOCUS_33700 120698 120877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 120890 121507 gene locus_tag LOCUS_33710 120890 121507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 121705 122130 gene locus_tag LOCUS_33720 121705 122130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 122454 122134 gene locus_tag LOCUS_33730 122454 122134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 122862 122512 gene locus_tag LOCUS_33740 122862 122512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 123200 122937 gene locus_tag LOCUS_33750 123200 122937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 123372 123584 gene locus_tag LOCUS_33760 123372 123584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 123603 123872 gene locus_tag LOCUS_33770 123603 123872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 124302 124664 gene locus_tag LOCUS_33780 124302 124664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 124842 125537 gene locus_tag LOCUS_33790 124842 125537 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140947.1 protein_id gnl|my_center|LOCUS_33790 127611 125773 gene locus_tag LOCUS_33800 127611 125773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 127850 127999 gene locus_tag LOCUS_33810 127850 127999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence15 372 806 gene locus_tag LOCUS_33820 372 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 1007 1441 gene locus_tag LOCUS_33830 1007 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 1743 1510 gene locus_tag LOCUS_33840 1743 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2359 1781 gene locus_tag LOCUS_33850 gene alkA 2359 1781 CDS product 3-methyladenine DNA glycosylase AlkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889208.1 protein_id gnl|my_center|LOCUS_33850 3786 2452 gene locus_tag LOCUS_33860 gene ffh 3786 2452 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888471.1 protein_id gnl|my_center|LOCUS_33860 4065 4151 gene locus_tag LOCUS_t00390 4065 4151 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4285 4371 gene locus_tag LOCUS_t00400 4285 4371 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4876 4484 gene locus_tag LOCUS_33870 4876 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 5402 5046 gene locus_tag LOCUS_33880 5402 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 5864 5403 gene locus_tag LOCUS_33890 5864 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 5924 6649 gene locus_tag LOCUS_33900 gene hisA 5924 6649 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889120.1 protein_id gnl|my_center|LOCUS_33900 6785 7231 gene locus_tag LOCUS_33910 6785 7231 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246529.1 protein_id gnl|my_center|LOCUS_33910 8485 7190 gene locus_tag LOCUS_33920 8485 7190 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064070.1 protein_id gnl|my_center|LOCUS_33920 8615 9079 gene locus_tag LOCUS_33930 8615 9079 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_33930 9725 9144 gene locus_tag LOCUS_33940 9725 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 10945 9773 gene locus_tag LOCUS_33950 gene nspC 10945 9773 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056484.1 protein_id gnl|my_center|LOCUS_33950 12314 10998 gene locus_tag LOCUS_33960 12314 10998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 13924 12713 gene locus_tag LOCUS_33970 13924 12713 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887895.1 protein_id gnl|my_center|LOCUS_33970 17821 14075 gene locus_tag LOCUS_33980 17821 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 18021 18761 gene locus_tag LOCUS_33990 18021 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 19300 18824 gene locus_tag LOCUS_34000 19300 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 19938 19393 gene locus_tag LOCUS_34010 19938 19393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 20527 20105 gene locus_tag LOCUS_34020 20527 20105 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973223.1 protein_id gnl|my_center|LOCUS_34020 21307 20579 gene locus_tag LOCUS_34030 21307 20579 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486596.1 protein_id gnl|my_center|LOCUS_34030 21837 21367 gene locus_tag LOCUS_34040 21837 21367 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_34040 23471 21921 gene locus_tag LOCUS_34050 23471 21921 CDS product 3'3'-cGAMP-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109472.1 protein_id gnl|my_center|LOCUS_34050 24554 23487 gene locus_tag LOCUS_34060 24554 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 25188 24727 gene locus_tag LOCUS_34070 25188 24727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 25867 25160 gene locus_tag LOCUS_34080 gene thyX 25867 25160 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 protein_id gnl|my_center|LOCUS_34080 26438 25968 gene locus_tag LOCUS_34090 26438 25968 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887211.1 protein_id gnl|my_center|LOCUS_34090 26677 27624 gene locus_tag LOCUS_34100 26677 27624 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479600.1 protein_id gnl|my_center|LOCUS_34100 27697 28005 gene locus_tag LOCUS_34110 27697 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039267.1 protein_id gnl|my_center|LOCUS_34110 28631 28098 gene locus_tag LOCUS_34120 28631 28098 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070579.1 protein_id gnl|my_center|LOCUS_34120 29168 28644 gene locus_tag LOCUS_34130 29168 28644 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_34130 29700 29179 gene locus_tag LOCUS_34140 29700 29179 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_34140 30226 29729 gene locus_tag LOCUS_34150 30226 29729 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_34150 37679 30378 gene locus_tag LOCUS_34160 37679 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 37866 37687 gene locus_tag LOCUS_34170 37866 37687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 38711 38325 gene locus_tag LOCUS_34180 38711 38325 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480008.1 protein_id gnl|my_center|LOCUS_34180 39639 38857 gene locus_tag LOCUS_34190 39639 38857 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_34190 40483 39851 gene locus_tag LOCUS_34200 40483 39851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 41636 40596 gene locus_tag LOCUS_34210 41636 40596 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_34210 41888 42286 gene locus_tag LOCUS_34220 41888 42286 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888330.1 protein_id gnl|my_center|LOCUS_34220 43362 42229 gene locus_tag LOCUS_34230 43362 42229 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480158.1 protein_id gnl|my_center|LOCUS_34230 44560 43433 gene locus_tag LOCUS_34240 44560 43433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 45620 44709 gene locus_tag LOCUS_34250 45620 44709 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480159.1 protein_id gnl|my_center|LOCUS_34250 47473 45617 gene locus_tag LOCUS_34260 47473 45617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177742.1 protein_id gnl|my_center|LOCUS_34260 47595 48008 gene locus_tag LOCUS_34270 gene ndk 47595 48008 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480121.1 protein_id gnl|my_center|LOCUS_34270 48941 48069 gene locus_tag LOCUS_34280 gene aguB 48941 48069 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889160.1 protein_id gnl|my_center|LOCUS_34280 50126 49077 gene locus_tag LOCUS_34290 50126 49077 CDS product agmatine/peptidylarginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618851.1 protein_id gnl|my_center|LOCUS_34290 50349 51089 gene locus_tag LOCUS_34300 50349 51089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 51217 51525 gene locus_tag LOCUS_34310 51217 51525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 51621 52505 gene locus_tag LOCUS_34320 51621 52505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_34320 52976 52518 gene locus_tag LOCUS_34330 52976 52518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 54532 53246 gene locus_tag LOCUS_34340 gene aceA 54532 53246 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479968.1 protein_id gnl|my_center|LOCUS_34340 56251 54653 gene locus_tag LOCUS_34350 gene aceB 56251 54653 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889536.1 protein_id gnl|my_center|LOCUS_34350 56752 58071 gene locus_tag LOCUS_34360 56752 58071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 58206 58964 gene locus_tag LOCUS_34370 58206 58964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480335.1 protein_id gnl|my_center|LOCUS_34370 59287 60915 gene locus_tag LOCUS_34380 59287 60915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918241.1 protein_id gnl|my_center|LOCUS_34380 61402 61034 gene locus_tag LOCUS_34390 61402 61034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 62307 61483 gene locus_tag LOCUS_34400 62307 61483 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_34400 64398 62455 gene locus_tag LOCUS_34410 64398 62455 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887551.1 protein_id gnl|my_center|LOCUS_34410 65004 64705 gene locus_tag LOCUS_34420 65004 64705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887764.1 protein_id gnl|my_center|LOCUS_34420 66212 65145 gene locus_tag LOCUS_34430 66212 65145 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349597.1 protein_id gnl|my_center|LOCUS_34430 66963 66427 gene locus_tag LOCUS_34440 66963 66427 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618916.1 protein_id gnl|my_center|LOCUS_34440 68020 66983 gene locus_tag LOCUS_34450 68020 66983 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177684.1 protein_id gnl|my_center|LOCUS_34450 68823 68017 gene locus_tag LOCUS_34460 68823 68017 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887914.1 protein_id gnl|my_center|LOCUS_34460 69138 68833 gene locus_tag LOCUS_34470 69138 68833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 69264 69734 gene locus_tag LOCUS_34480 69264 69734 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175557.1 protein_id gnl|my_center|LOCUS_34480 69822 70388 gene locus_tag LOCUS_34490 69822 70388 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 protein_id gnl|my_center|LOCUS_34490 71573 70515 gene locus_tag LOCUS_34500 gene dprA 71573 70515 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886768.1 protein_id gnl|my_center|LOCUS_34500 71692 72067 gene locus_tag LOCUS_tm00010 71692 72067 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 72137 72691 gene locus_tag LOCUS_34510 72137 72691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 73104 72634 gene locus_tag LOCUS_34520 73104 72634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 73706 73101 gene locus_tag LOCUS_34530 73706 73101 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_34530 74192 73731 gene locus_tag LOCUS_34540 74192 73731 CDS product DUF6194 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480128.1 protein_id gnl|my_center|LOCUS_34540 74409 75323 gene locus_tag LOCUS_34550 74409 75323 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_34550 75391 75477 gene locus_tag LOCUS_t00410 75391 75477 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77430 75598 gene locus_tag LOCUS_34560 77430 75598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 77570 78601 gene locus_tag LOCUS_34570 77570 78601 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_34570 78804 79415 gene locus_tag LOCUS_34580 78804 79415 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_34580 79468 79544 gene locus_tag LOCUS_t00420 79468 79544 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 79629 79850 gene locus_tag LOCUS_34590 79629 79850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 79975 82074 gene locus_tag LOCUS_34600 gene pnp 79975 82074 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479957.1 protein_id gnl|my_center|LOCUS_34600 82189 82509 gene locus_tag LOCUS_34610 82189 82509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480244.1 protein_id gnl|my_center|LOCUS_34610 82771 85014 gene locus_tag LOCUS_34620 82771 85014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 85008 86588 gene locus_tag LOCUS_34630 85008 86588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 86766 87638 gene locus_tag LOCUS_34640 86766 87638 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967589.1 protein_id gnl|my_center|LOCUS_34640 88381 90042 gene locus_tag LOCUS_34650 gene ilvB 88381 90042 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177759.1 protein_id gnl|my_center|LOCUS_34650 90198 90794 gene locus_tag LOCUS_34660 gene ilvN 90198 90794 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480219.1 protein_id gnl|my_center|LOCUS_34660 90894 91901 gene locus_tag LOCUS_34670 gene ilvC 90894 91901 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480217.1 protein_id gnl|my_center|LOCUS_34670 92176 92472 gene locus_tag LOCUS_34680 92176 92472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 92476 92760 gene locus_tag LOCUS_34690 92476 92760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 92870 94303 gene locus_tag LOCUS_34700 92870 94303 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889146.1 protein_id gnl|my_center|LOCUS_34700 94334 94852 gene locus_tag LOCUS_34710 94334 94852 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618862.1 protein_id gnl|my_center|LOCUS_34710 95343 94927 gene locus_tag LOCUS_34720 95343 94927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 96180 95578 gene locus_tag LOCUS_34730 96180 95578 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480309.1 protein_id gnl|my_center|LOCUS_34730 96371 97396 gene locus_tag LOCUS_34740 96371 97396 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888641.1 protein_id gnl|my_center|LOCUS_34740 97566 98669 gene locus_tag LOCUS_34750 97566 98669 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_34750 98964 98671 gene locus_tag LOCUS_34760 98964 98671 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583590.1 protein_id gnl|my_center|LOCUS_34760 99079 99405 gene locus_tag LOCUS_34770 99079 99405 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_34770 99402 100475 gene locus_tag LOCUS_34780 99402 100475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 101150 100479 gene locus_tag LOCUS_34790 101150 100479 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552750.1 protein_id gnl|my_center|LOCUS_34790 102313 101150 gene locus_tag LOCUS_34800 102313 101150 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705504.1 protein_id gnl|my_center|LOCUS_34800 103404 102526 gene locus_tag LOCUS_34810 103404 102526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 105403 103508 gene locus_tag LOCUS_34820 gene cpdB 105403 103508 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480317.1 protein_id gnl|my_center|LOCUS_34820 107187 105796 gene locus_tag LOCUS_34830 gene lpdA 107187 105796 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888996.1 protein_id gnl|my_center|LOCUS_34830 107638 107411 gene locus_tag LOCUS_34840 107638 107411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350508.1 protein_id gnl|my_center|LOCUS_34840 108689 107718 gene locus_tag LOCUS_34850 108689 107718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 108991 108686 gene locus_tag LOCUS_34860 108991 108686 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140688.1 protein_id gnl|my_center|LOCUS_34860 109200 109700 gene locus_tag LOCUS_34870 109200 109700 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889089.1 protein_id gnl|my_center|LOCUS_34870 110083 109763 gene locus_tag LOCUS_34880 110083 109763 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926073.1 protein_id gnl|my_center|LOCUS_34880 110411 110995 gene locus_tag LOCUS_34890 110411 110995 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480180.1 protein_id gnl|my_center|LOCUS_34890 111112 113253 gene locus_tag LOCUS_34900 111112 113253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 113995 113318 gene locus_tag LOCUS_34910 113995 113318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 114642 114064 gene locus_tag LOCUS_34920 114642 114064 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940880.1 protein_id gnl|my_center|LOCUS_34920 115671 114769 gene locus_tag LOCUS_34930 115671 114769 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189262.1 protein_id gnl|my_center|LOCUS_34930 115994 115668 gene locus_tag LOCUS_34940 115994 115668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 116294 117613 gene locus_tag LOCUS_34950 116294 117613 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_34950 118184 117675 gene locus_tag LOCUS_34960 118184 117675 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887664.1 protein_id gnl|my_center|LOCUS_34960 119329 118268 gene locus_tag LOCUS_34970 119329 118268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence16 805 293 gene locus_tag LOCUS_34980 805 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 1283 816 gene locus_tag LOCUS_34990 1283 816 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480069.1 protein_id gnl|my_center|LOCUS_34990 1412 1915 gene locus_tag LOCUS_35000 gene lspA 1412 1915 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889014.1 protein_id gnl|my_center|LOCUS_35000 1999 2499 gene locus_tag LOCUS_35010 gene lspA 1999 2499 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889014.1 protein_id gnl|my_center|LOCUS_35010 2872 2558 gene locus_tag LOCUS_35020 2872 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 4280 3549 gene locus_tag LOCUS_35030 4280 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 4652 4431 gene locus_tag LOCUS_35040 4652 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 4950 6365 gene locus_tag LOCUS_35050 4950 6365 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152524824.1 protein_id gnl|my_center|LOCUS_35050 7742 6438 gene locus_tag LOCUS_35060 7742 6438 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888815.1 protein_id gnl|my_center|LOCUS_35060 8157 7879 gene locus_tag LOCUS_35070 gene rpsO 8157 7879 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886986.1 protein_id gnl|my_center|LOCUS_35070 8871 8395 gene locus_tag LOCUS_35080 8871 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 8996 9082 gene locus_tag LOCUS_t00430 8996 9082 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9204 9815 gene locus_tag LOCUS_35090 9204 9815 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 protein_id gnl|my_center|LOCUS_35090 11209 9812 gene locus_tag LOCUS_35100 11209 9812 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888650.1 protein_id gnl|my_center|LOCUS_35100 11939 11226 gene locus_tag LOCUS_35110 11939 11226 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479583.1 protein_id gnl|my_center|LOCUS_35110 12022 12759 gene locus_tag LOCUS_35120 12022 12759 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124783.1 protein_id gnl|my_center|LOCUS_35120 14922 12904 gene locus_tag LOCUS_35130 14922 12904 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 protein_id gnl|my_center|LOCUS_35130 16311 14998 gene locus_tag LOCUS_35140 16311 14998 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082727.1 protein_id gnl|my_center|LOCUS_35140 16639 17331 gene locus_tag LOCUS_35150 16639 17331 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029905.1 protein_id gnl|my_center|LOCUS_35150 17384 17776 gene locus_tag LOCUS_35160 17384 17776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974119.1 protein_id gnl|my_center|LOCUS_35160 17788 18225 gene locus_tag LOCUS_35170 17788 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 18306 18836 gene locus_tag LOCUS_35180 18306 18836 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876664.1 protein_id gnl|my_center|LOCUS_35180 18878 19369 gene locus_tag LOCUS_35190 18878 19369 CDS product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229503.1 protein_id gnl|my_center|LOCUS_35190 19366 19749 gene locus_tag LOCUS_35200 19366 19749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 20585 19869 gene locus_tag LOCUS_35210 20585 19869 CDS product lantibiotic immunity ABC transporter MutG family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860831.1 protein_id gnl|my_center|LOCUS_35210 21472 20582 gene locus_tag LOCUS_35220 21472 20582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 protein_id gnl|my_center|LOCUS_35220 21613 22452 gene locus_tag LOCUS_35230 21613 22452 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403967.1 protein_id gnl|my_center|LOCUS_35230 22512 23024 gene locus_tag LOCUS_35240 22512 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480275.1 protein_id gnl|my_center|LOCUS_35240 23536 23039 gene locus_tag LOCUS_35250 23536 23039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 23648 24031 gene locus_tag LOCUS_35260 23648 24031 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888838.1 protein_id gnl|my_center|LOCUS_35260 25891 24245 gene locus_tag LOCUS_35270 25891 24245 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228601.1 protein_id gnl|my_center|LOCUS_35270 27353 26172 gene locus_tag LOCUS_35280 27353 26172 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173365.1 protein_id gnl|my_center|LOCUS_35280 27425 29761 gene locus_tag LOCUS_35290 27425 29761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 29767 31815 gene locus_tag LOCUS_35300 29767 31815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 31849 32622 gene locus_tag LOCUS_35310 gene truA 31849 32622 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888918.1 protein_id gnl|my_center|LOCUS_35310 32686 33399 gene locus_tag LOCUS_35320 32686 33399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 33980 33396 gene locus_tag LOCUS_35330 33980 33396 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889068.1 protein_id gnl|my_center|LOCUS_35330 35616 34105 gene locus_tag LOCUS_35340 gene ilvA 35616 34105 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258444.1 protein_id gnl|my_center|LOCUS_35340 35953 36849 gene locus_tag LOCUS_35350 35953 36849 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871202.1 protein_id gnl|my_center|LOCUS_35350 37147 38610 gene locus_tag LOCUS_35360 37147 38610 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887156.1 protein_id gnl|my_center|LOCUS_35360 38802 41789 gene locus_tag LOCUS_35370 38802 41789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 41819 42766 gene locus_tag LOCUS_35380 41819 42766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886913.1 protein_id gnl|my_center|LOCUS_35380 43506 42853 gene locus_tag LOCUS_35390 43506 42853 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083618.1 protein_id gnl|my_center|LOCUS_35390 45061 43580 gene locus_tag LOCUS_35400 45061 43580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 45777 45088 gene locus_tag LOCUS_35410 gene regX 45777 45088 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_35410 45912 47057 gene locus_tag LOCUS_35420 45912 47057 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225411.1 protein_id gnl|my_center|LOCUS_35420 47128 47445 gene locus_tag LOCUS_35430 47128 47445 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811819.1 protein_id gnl|my_center|LOCUS_35430 48550 47687 gene locus_tag LOCUS_35440 48550 47687 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886863.1 protein_id gnl|my_center|LOCUS_35440 48669 49088 gene locus_tag LOCUS_35450 48669 49088 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886862.1 protein_id gnl|my_center|LOCUS_35450 49519 51261 gene locus_tag LOCUS_35460 49519 51261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 51958 51302 gene locus_tag LOCUS_35470 51958 51302 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857631.1 protein_id gnl|my_center|LOCUS_35470 53558 51948 gene locus_tag LOCUS_35480 53558 51948 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669463.1 protein_id gnl|my_center|LOCUS_35480 54760 53702 gene locus_tag LOCUS_35490 54760 53702 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065252.1 protein_id gnl|my_center|LOCUS_35490 56471 54762 gene locus_tag LOCUS_35500 56471 54762 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229128.1 protein_id gnl|my_center|LOCUS_35500 57574 56495 gene locus_tag LOCUS_35510 57574 56495 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229127.1 protein_id gnl|my_center|LOCUS_35510 59372 57888 gene locus_tag LOCUS_35520 59372 57888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 60061 59369 gene locus_tag LOCUS_35530 60061 59369 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_35530 60300 61160 gene locus_tag LOCUS_35540 60300 61160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 61440 61264 gene locus_tag LOCUS_35550 61440 61264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 63350 61836 gene locus_tag LOCUS_35560 63350 61836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 63709 63419 gene locus_tag LOCUS_35570 63709 63419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 64395 63781 gene locus_tag LOCUS_35580 gene gmk 64395 63781 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480091.1 protein_id gnl|my_center|LOCUS_35580 64524 64745 gene locus_tag LOCUS_35590 64524 64745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 64742 65353 gene locus_tag LOCUS_35600 gene def 64742 65353 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889059.1 protein_id gnl|my_center|LOCUS_35600 65528 66400 gene locus_tag LOCUS_35610 65528 66400 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641995.1 protein_id gnl|my_center|LOCUS_35610 66421 66894 gene locus_tag LOCUS_35620 66421 66894 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630611.1 protein_id gnl|my_center|LOCUS_35620 67388 66882 gene locus_tag LOCUS_35630 gene pyrE 67388 66882 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417034.1 protein_id gnl|my_center|LOCUS_35630 67842 67516 gene locus_tag LOCUS_35640 67842 67516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 68217 69020 gene locus_tag LOCUS_35650 68217 69020 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027106.1 protein_id gnl|my_center|LOCUS_35650 69021 69593 gene locus_tag LOCUS_35660 69021 69593 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074910.1 protein_id gnl|my_center|LOCUS_35660 69595 69930 gene locus_tag LOCUS_35670 69595 69930 CDS product YrdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258995.1 protein_id gnl|my_center|LOCUS_35670 70264 69932 gene locus_tag LOCUS_35680 70264 69932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 70524 71357 gene locus_tag LOCUS_35690 70524 71357 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_35690 73473 71503 gene locus_tag LOCUS_35700 gene tkt 73473 71503 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_35700 74268 73738 gene locus_tag LOCUS_35710 74268 73738 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027547661.1 protein_id gnl|my_center|LOCUS_35710 74511 75710 gene locus_tag LOCUS_35720 74511 75710 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886724.1 protein_id gnl|my_center|LOCUS_35720 77061 75712 gene locus_tag LOCUS_35730 77061 75712 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871916.1 protein_id gnl|my_center|LOCUS_35730 78286 77222 gene locus_tag LOCUS_35740 78286 77222 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886737.1 protein_id gnl|my_center|LOCUS_35740 78936 78283 gene locus_tag LOCUS_35750 78936 78283 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886738.1 protein_id gnl|my_center|LOCUS_35750 80357 78885 gene locus_tag LOCUS_35760 80357 78885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 81911 80370 gene locus_tag LOCUS_35770 81911 80370 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886741.1 protein_id gnl|my_center|LOCUS_35770 82243 83862 gene locus_tag LOCUS_35780 82243 83862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 84168 83935 gene locus_tag LOCUS_35790 84168 83935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 85042 84221 gene locus_tag LOCUS_35800 85042 84221 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888311.1 protein_id gnl|my_center|LOCUS_35800 85177 86775 gene locus_tag LOCUS_35810 85177 86775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 87048 88244 gene locus_tag LOCUS_35820 gene metK 87048 88244 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887285.1 protein_id gnl|my_center|LOCUS_35820 88733 88323 gene locus_tag LOCUS_35830 88733 88323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 89224 88778 gene locus_tag LOCUS_35840 gene slyA 89224 88778 CDS product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705156.1 protein_id gnl|my_center|LOCUS_35840 89326 89901 gene locus_tag LOCUS_35850 89326 89901 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_35850 90816 89905 gene locus_tag LOCUS_35860 gene uvsE 90816 89905 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350019.1 protein_id gnl|my_center|LOCUS_35860 91888 90908 gene locus_tag LOCUS_35870 91888 90908 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_35870 92433 92038 gene locus_tag LOCUS_35880 gene rplS 92433 92038 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887401.1 protein_id gnl|my_center|LOCUS_35880 93129 92587 gene locus_tag LOCUS_35890 93129 92587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 96684 93400 gene locus_tag LOCUS_35900 96684 93400 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228151.1 protein_id gnl|my_center|LOCUS_35900 97907 96681 gene locus_tag LOCUS_35910 97907 96681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 98905 97907 gene locus_tag LOCUS_35920 98905 97907 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172827.1 protein_id gnl|my_center|LOCUS_35920 100191 98902 gene locus_tag LOCUS_35930 100191 98902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 100685 100188 gene locus_tag LOCUS_35940 100685 100188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 101527 100811 gene locus_tag LOCUS_35950 101527 100811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 105160 101654 gene locus_tag LOCUS_35960 105160 101654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 106638 105487 gene locus_tag LOCUS_35970 gene tgt 106638 105487 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350581.1 protein_id gnl|my_center|LOCUS_35970 106730 107521 gene locus_tag LOCUS_35980 gene paaX 106730 107521 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813301.1 protein_id gnl|my_center|LOCUS_35980 108428 107535 gene locus_tag LOCUS_35990 108428 107535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083149.1 protein_id gnl|my_center|LOCUS_35990 108736 108867 gene locus_tag LOCUS_36000 108736 108867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 111541 108944 gene locus_tag LOCUS_36010 111541 108944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 111654 111579 gene locus_tag LOCUS_t00440 111654 111579 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 1636 98 gene locus_tag LOCUS_36020 1636 98 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_36020 1788 2066 gene locus_tag LOCUS_36030 1788 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 2672 1986 gene locus_tag LOCUS_36040 2672 1986 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179719124.1 protein_id gnl|my_center|LOCUS_36040 2829 3527 gene locus_tag LOCUS_36050 2829 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3627 4274 gene locus_tag LOCUS_36060 3627 4274 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479800.1 protein_id gnl|my_center|LOCUS_36060 4988 4347 gene locus_tag LOCUS_36070 4988 4347 CDS product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730220.1 protein_id gnl|my_center|LOCUS_36070 5771 5169 gene locus_tag LOCUS_36080 5771 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 6117 6968 gene locus_tag LOCUS_36090 6117 6968 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061666.1 protein_id gnl|my_center|LOCUS_36090 7841 7023 gene locus_tag LOCUS_36100 7841 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 8141 7893 gene locus_tag LOCUS_36110 8141 7893 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312329.1 protein_id gnl|my_center|LOCUS_36110 8250 9416 gene locus_tag LOCUS_36120 8250 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_36120 9400 9705 gene locus_tag LOCUS_36130 9400 9705 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229161.1 protein_id gnl|my_center|LOCUS_36130 9708 10100 gene locus_tag LOCUS_36140 9708 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 10461 10745 gene locus_tag LOCUS_36150 10461 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 11656 10961 gene locus_tag LOCUS_36160 11656 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 13230 11854 gene locus_tag LOCUS_36170 13230 11854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 13686 13252 gene locus_tag LOCUS_36180 13686 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 14210 13986 gene locus_tag LOCUS_36190 14210 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 14103 14441 gene locus_tag LOCUS_36200 14103 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 16391 14451 gene locus_tag LOCUS_36210 16391 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 19357 16388 gene locus_tag LOCUS_36220 19357 16388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 20485 19472 gene locus_tag LOCUS_36230 20485 19472 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_36230 20716 22050 gene locus_tag LOCUS_36240 20716 22050 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_36240 22293 23210 gene locus_tag LOCUS_36250 22293 23210 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066580.1 protein_id gnl|my_center|LOCUS_36250 23207 24073 gene locus_tag LOCUS_36260 23207 24073 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369336.1 protein_id gnl|my_center|LOCUS_36260 24070 25110 gene locus_tag LOCUS_36270 24070 25110 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892758.1 protein_id gnl|my_center|LOCUS_36270 25873 29778 gene locus_tag LOCUS_36280 25873 29778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 30127 31209 gene locus_tag LOCUS_36290 30127 31209 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031759.1 protein_id gnl|my_center|LOCUS_36290 31563 33059 gene locus_tag LOCUS_36300 31563 33059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 33535 33155 gene locus_tag LOCUS_36310 33535 33155 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886445.1 protein_id gnl|my_center|LOCUS_36310 33759 33505 gene locus_tag LOCUS_36320 33759 33505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 33949 33752 gene locus_tag LOCUS_36330 33949 33752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 34370 33969 gene locus_tag LOCUS_36340 34370 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 34464 34763 gene locus_tag LOCUS_36350 34464 34763 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088517.1 protein_id gnl|my_center|LOCUS_36350 34812 35882 gene locus_tag LOCUS_36360 34812 35882 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653868.1 protein_id gnl|my_center|LOCUS_36360 35914 36267 gene locus_tag LOCUS_36370 35914 36267 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112711.1 protein_id gnl|my_center|LOCUS_36370 36333 36869 gene locus_tag LOCUS_36380 36333 36869 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398911.1 protein_id gnl|my_center|LOCUS_36380 36863 38104 gene locus_tag LOCUS_36390 36863 38104 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727468.1 protein_id gnl|my_center|LOCUS_36390 38772 38107 gene locus_tag LOCUS_36400 gene aqpZ 38772 38107 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969745.1 protein_id gnl|my_center|LOCUS_36400 39230 38769 gene locus_tag LOCUS_36410 39230 38769 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479743.1 protein_id gnl|my_center|LOCUS_36410 39530 39240 gene locus_tag LOCUS_36420 39530 39240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 39411 39809 gene locus_tag LOCUS_36430 39411 39809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 39981 41372 gene locus_tag LOCUS_36440 39981 41372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 42779 41445 gene locus_tag LOCUS_36450 42779 41445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 45138 42859 gene locus_tag LOCUS_36460 45138 42859 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_36460 45899 45492 gene locus_tag LOCUS_36470 45899 45492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 46927 46337 gene locus_tag LOCUS_36480 46927 46337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 47249 48697 gene locus_tag LOCUS_36490 47249 48697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 48993 48733 gene locus_tag LOCUS_36500 48993 48733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 51150 49006 gene locus_tag LOCUS_36510 51150 49006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 51753 53117 gene locus_tag LOCUS_36520 51753 53117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 53690 53178 gene locus_tag LOCUS_36530 53690 53178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 54073 55416 gene locus_tag LOCUS_36540 54073 55416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 58340 55494 gene locus_tag LOCUS_36550 58340 55494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 60747 58468 gene locus_tag LOCUS_36560 60747 58468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 61950 61120 gene locus_tag LOCUS_36570 61950 61120 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434537.1 protein_id gnl|my_center|LOCUS_36570 62843 61947 gene locus_tag LOCUS_36580 62843 61947 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975883.1 protein_id gnl|my_center|LOCUS_36580 64212 62911 gene locus_tag LOCUS_36590 64212 62911 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975884.1 protein_id gnl|my_center|LOCUS_36590 66212 64380 gene locus_tag LOCUS_36600 66212 64380 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229244.1 protein_id gnl|my_center|LOCUS_36600 66767 68743 gene locus_tag LOCUS_36610 66767 68743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 68730 69866 gene locus_tag LOCUS_36620 68730 69866 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222508.1 protein_id gnl|my_center|LOCUS_36620 70557 70246 gene locus_tag LOCUS_36630 70557 70246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 71024 71224 gene locus_tag LOCUS_36640 71024 71224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 72210 71245 gene locus_tag LOCUS_36650 72210 71245 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_36650 72909 72418 gene locus_tag LOCUS_36660 72909 72418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 73159 72923 gene locus_tag LOCUS_36670 73159 72923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 73573 74136 gene locus_tag LOCUS_36680 73573 74136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 77697 74197 gene locus_tag LOCUS_36690 77697 74197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 78431 79177 gene locus_tag LOCUS_36700 78431 79177 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115022.1 protein_id gnl|my_center|LOCUS_36700 79844 79260 gene locus_tag LOCUS_36710 79844 79260 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 protein_id gnl|my_center|LOCUS_36710 81115 80027 gene locus_tag LOCUS_36720 81115 80027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 82795 81116 gene locus_tag LOCUS_36730 82795 81116 CDS product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 protein_id gnl|my_center|LOCUS_36730 83655 82792 gene locus_tag LOCUS_36740 83655 82792 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_36740 84563 83655 gene locus_tag LOCUS_36750 84563 83655 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_36750 85847 84615 gene locus_tag LOCUS_36760 85847 84615 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105221568.1 protein_id gnl|my_center|LOCUS_36760 87764 85902 gene locus_tag LOCUS_36770 87764 85902 CDS product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 protein_id gnl|my_center|LOCUS_36770 88198 89370 gene locus_tag LOCUS_36780 88198 89370 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528101.1 protein_id gnl|my_center|LOCUS_36780 89693 91537 gene locus_tag LOCUS_36790 89693 91537 CDS product glycoside hydrolase family 66 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108626.1 protein_id gnl|my_center|LOCUS_36790 92555 91617 gene locus_tag LOCUS_36800 92555 91617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 93439 93056 gene locus_tag LOCUS_36810 93439 93056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 95429 93558 gene locus_tag LOCUS_36820 95429 93558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 96073 96924 gene locus_tag LOCUS_36830 96073 96924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 96921 98957 gene locus_tag LOCUS_36840 96921 98957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 99451 99101 gene locus_tag LOCUS_36850 99451 99101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 99833 99543 gene locus_tag LOCUS_36860 99833 99543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 99994 101847 gene locus_tag LOCUS_36870 99994 101847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 103838 101997 gene locus_tag LOCUS_36880 103838 101997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 104607 103957 gene locus_tag LOCUS_36890 104607 103957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 105814 104720 gene locus_tag LOCUS_36900 105814 104720 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428856.1 protein_id gnl|my_center|LOCUS_36900 105886 106779 gene locus_tag LOCUS_36910 105886 106779 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814552.1 protein_id gnl|my_center|LOCUS_36910 108936 106774 gene locus_tag LOCUS_36920 108936 106774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 109669 109022 gene locus_tag LOCUS_36930 109669 109022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 >Feature sequence18 859 236 gene locus_tag LOCUS_36940 859 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 9771 868 gene locus_tag LOCUS_36950 9771 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 9952 11964 gene locus_tag LOCUS_36960 9952 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36960 12067 12924 gene locus_tag LOCUS_36970 12067 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36970 13596 12994 gene locus_tag LOCUS_36980 13596 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 14357 14118 gene locus_tag LOCUS_36990 14357 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 14361 15308 gene locus_tag LOCUS_37000 14361 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37000 15805 15278 gene locus_tag LOCUS_37010 15805 15278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 17387 16239 gene locus_tag LOCUS_37020 17387 16239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 17833 17405 gene locus_tag LOCUS_37030 17833 17405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 18208 17861 gene locus_tag LOCUS_37040 18208 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 18441 18217 gene locus_tag LOCUS_37050 18441 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 18710 18877 gene locus_tag LOCUS_37060 18710 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 19114 20181 gene locus_tag LOCUS_37070 19114 20181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 20794 20186 gene locus_tag LOCUS_37080 20794 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 21219 20791 gene locus_tag LOCUS_37090 21219 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 21811 21212 gene locus_tag LOCUS_37100 21811 21212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 22488 22763 gene locus_tag LOCUS_37110 22488 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 23056 22820 gene locus_tag LOCUS_37120 23056 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 23135 23518 gene locus_tag LOCUS_37130 23135 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 23515 23784 gene locus_tag LOCUS_37140 23515 23784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 24542 23913 gene locus_tag LOCUS_37150 24542 23913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 24680 28513 gene locus_tag LOCUS_37160 24680 28513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 28609 28684 gene locus_tag LOCUS_t00450 28609 28684 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29646 31049 gene locus_tag LOCUS_37170 29646 31049 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480407.1 protein_id gnl|my_center|LOCUS_37170 31514 31161 gene locus_tag LOCUS_37180 31514 31161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 31675 32346 gene locus_tag LOCUS_37190 31675 32346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 32644 32369 gene locus_tag LOCUS_37200 32644 32369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 33084 32641 gene locus_tag LOCUS_37210 33084 32641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 33664 35046 gene locus_tag LOCUS_37220 33664 35046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 35091 35492 gene locus_tag LOCUS_37230 35091 35492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 35529 39173 gene locus_tag LOCUS_37240 35529 39173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221109609.1 protein_id gnl|my_center|LOCUS_37240 39253 39822 gene locus_tag LOCUS_37250 39253 39822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 40188 39937 gene locus_tag LOCUS_37260 40188 39937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 40529 40230 gene locus_tag LOCUS_37270 40529 40230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 41155 40529 gene locus_tag LOCUS_37280 41155 40529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 41283 41924 gene locus_tag LOCUS_37290 gene lexA 41283 41924 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479703.1 protein_id gnl|my_center|LOCUS_37290 42004 43107 gene locus_tag LOCUS_37300 42004 43107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 43109 43345 gene locus_tag LOCUS_37310 43109 43345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 43318 46461 gene locus_tag LOCUS_37320 43318 46461 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284781.1 protein_id gnl|my_center|LOCUS_37320 46802 46581 gene locus_tag LOCUS_37330 46802 46581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 47262 47744 gene locus_tag LOCUS_37340 47262 47744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 48020 47784 gene locus_tag LOCUS_37350 48020 47784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 48136 50298 gene locus_tag LOCUS_37360 48136 50298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 50295 51125 gene locus_tag LOCUS_37370 50295 51125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 51549 52103 gene locus_tag LOCUS_37380 51549 52103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 52174 53205 gene locus_tag LOCUS_37390 52174 53205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 53265 53555 gene locus_tag LOCUS_37400 53265 53555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 53796 54224 gene locus_tag LOCUS_37410 53796 54224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 55051 54305 gene locus_tag LOCUS_37420 55051 54305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 55193 55789 gene locus_tag LOCUS_37430 55193 55789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 55912 56385 gene locus_tag LOCUS_37440 55912 56385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 56426 56710 gene locus_tag LOCUS_37450 56426 56710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 56707 56970 gene locus_tag LOCUS_37460 56707 56970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 56989 58848 gene locus_tag LOCUS_37470 56989 58848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 59458 58874 gene locus_tag LOCUS_37480 59458 58874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 62027 59748 gene locus_tag LOCUS_37490 62027 59748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 62508 62047 gene locus_tag LOCUS_37500 62508 62047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 62605 63672 gene locus_tag LOCUS_37510 62605 63672 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_37510 63662 64129 gene locus_tag LOCUS_37520 63662 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 64134 65834 gene locus_tag LOCUS_37530 gene dnaG 64134 65834 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887246.1 protein_id gnl|my_center|LOCUS_37530 65881 66114 gene locus_tag LOCUS_37540 65881 66114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 66231 66758 gene locus_tag LOCUS_37550 66231 66758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 66742 67398 gene locus_tag LOCUS_37560 66742 67398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 67391 67894 gene locus_tag LOCUS_37570 67391 67894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 68000 68461 gene locus_tag LOCUS_37580 68000 68461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 68462 68764 gene locus_tag LOCUS_37590 68462 68764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 68761 70086 gene locus_tag LOCUS_37600 gene dnaB 68761 70086 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073663.1 protein_id gnl|my_center|LOCUS_37600 70352 70870 gene locus_tag LOCUS_37610 70352 70870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 72130 70949 gene locus_tag LOCUS_37620 72130 70949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 72511 73470 gene locus_tag LOCUS_37630 72511 73470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 73508 74023 gene locus_tag LOCUS_37640 73508 74023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 74184 75155 gene locus_tag LOCUS_37650 74184 75155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 75196 76755 gene locus_tag LOCUS_37660 75196 76755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 76767 77282 gene locus_tag LOCUS_37670 76767 77282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 77284 77952 gene locus_tag LOCUS_37680 77284 77952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 78508 77921 gene locus_tag LOCUS_37690 78508 77921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 80782 78518 gene locus_tag LOCUS_37700 80782 78518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 80876 81232 gene locus_tag LOCUS_37710 80876 81232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 81308 81682 gene locus_tag LOCUS_37720 81308 81682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 81721 84252 gene locus_tag LOCUS_37730 81721 84252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 84249 85322 gene locus_tag LOCUS_37740 84249 85322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 85307 86749 gene locus_tag LOCUS_37750 85307 86749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 87063 87623 gene locus_tag LOCUS_37760 87063 87623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 87826 90405 gene locus_tag LOCUS_37770 87826 90405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 90398 91138 gene locus_tag LOCUS_37780 90398 91138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 91340 91606 gene locus_tag LOCUS_37790 91340 91606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 91587 92057 gene locus_tag LOCUS_37800 91587 92057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 92054 93100 gene locus_tag LOCUS_37810 92054 93100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 93467 93616 gene locus_tag LOCUS_37820 93467 93616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 94145 94333 gene locus_tag LOCUS_37830 94145 94333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 94433 94567 gene locus_tag LOCUS_37840 94433 94567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 94814 95014 gene locus_tag LOCUS_37850 94814 95014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 95491 95345 gene locus_tag LOCUS_37860 95491 95345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 96384 95488 gene locus_tag LOCUS_37870 96384 95488 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842205.1 protein_id gnl|my_center|LOCUS_37870 100147 97166 gene locus_tag LOCUS_37880 100147 97166 CDS product Tn3-like element TnAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138014.1 protein_id gnl|my_center|LOCUS_37880 105397 100322 gene locus_tag LOCUS_37890 105397 100322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence19 546 2210 gene locus_tag LOCUS_37900 546 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 2216 3160 gene locus_tag LOCUS_37910 2216 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 3218 3550 gene locus_tag LOCUS_37920 3218 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 3547 3936 gene locus_tag LOCUS_37930 3547 3936 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 protein_id gnl|my_center|LOCUS_37930 4338 4865 gene locus_tag LOCUS_37940 4338 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 6671 4995 gene locus_tag LOCUS_37950 gene ilvD 6671 4995 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_37950 7175 6885 gene locus_tag LOCUS_37960 7175 6885 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_37960 8796 7255 gene locus_tag LOCUS_37970 8796 7255 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480228.1 protein_id gnl|my_center|LOCUS_37970 9128 9523 gene locus_tag LOCUS_37980 9128 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 9721 11247 gene locus_tag LOCUS_37990 9721 11247 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 protein_id gnl|my_center|LOCUS_37990 11466 12551 gene locus_tag LOCUS_38000 gene hemE 11466 12551 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567889.1 protein_id gnl|my_center|LOCUS_38000 12548 13480 gene locus_tag LOCUS_38010 gene hemH 12548 13480 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887774.1 protein_id gnl|my_center|LOCUS_38010 13477 14832 gene locus_tag LOCUS_38020 gene hemG 13477 14832 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618786.1 protein_id gnl|my_center|LOCUS_38020 15112 16671 gene locus_tag LOCUS_38030 15112 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 17488 16664 gene locus_tag LOCUS_38040 gene fdhD 17488 16664 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229108.1 protein_id gnl|my_center|LOCUS_38040 19682 17463 gene locus_tag LOCUS_38050 19682 17463 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229107.1 protein_id gnl|my_center|LOCUS_38050 19753 20421 gene locus_tag LOCUS_38060 19753 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887853.1 protein_id gnl|my_center|LOCUS_38060 21303 20440 gene locus_tag LOCUS_38070 21303 20440 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_38070 21322 21993 gene locus_tag LOCUS_38080 21322 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 23230 21998 gene locus_tag LOCUS_38090 23230 21998 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_38090 23567 24688 gene locus_tag LOCUS_38100 23567 24688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_38100 24219 24228 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24819 25742 gene locus_tag LOCUS_38110 24819 25742 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618829.1 protein_id gnl|my_center|LOCUS_38110 25749 26624 gene locus_tag LOCUS_38120 25749 26624 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 protein_id gnl|my_center|LOCUS_38120 27213 26695 gene locus_tag LOCUS_38130 27213 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531186.1 protein_id gnl|my_center|LOCUS_38130 27508 28749 gene locus_tag LOCUS_38140 27508 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 29783 28809 gene locus_tag LOCUS_38150 gene lipA 29783 28809 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887411.1 protein_id gnl|my_center|LOCUS_38150 30461 29796 gene locus_tag LOCUS_38160 gene lipB 30461 29796 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_38160 30718 31068 gene locus_tag LOCUS_38170 30718 31068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 31133 31669 gene locus_tag LOCUS_38180 gene ddrB 31133 31669 CDS product single-stranded DNA-binding protein DdrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480237.1 protein_id gnl|my_center|LOCUS_38180 31920 32711 gene locus_tag LOCUS_38190 31920 32711 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161617863.1 protein_id gnl|my_center|LOCUS_38190 32713 33519 gene locus_tag LOCUS_38200 32713 33519 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886850.1 protein_id gnl|my_center|LOCUS_38200 33529 34515 gene locus_tag LOCUS_38210 33529 34515 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350706.1 protein_id gnl|my_center|LOCUS_38210 34569 35447 gene locus_tag LOCUS_38220 34569 35447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 35607 36590 gene locus_tag LOCUS_38230 35607 36590 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_38230 36919 37743 gene locus_tag LOCUS_38240 36919 37743 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227952.1 protein_id gnl|my_center|LOCUS_38240 37775 38179 gene locus_tag LOCUS_38250 37775 38179 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172548.1 protein_id gnl|my_center|LOCUS_38250 38176 38895 gene locus_tag LOCUS_38260 gene tmpR 38176 38895 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_38260 38978 39598 gene locus_tag LOCUS_38270 38978 39598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 40227 39772 gene locus_tag LOCUS_38280 40227 39772 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886877.1 protein_id gnl|my_center|LOCUS_38280 40703 40224 gene locus_tag LOCUS_38290 gene ispF 40703 40224 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886876.1 protein_id gnl|my_center|LOCUS_38290 40813 41718 gene locus_tag LOCUS_38300 40813 41718 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889019.1 protein_id gnl|my_center|LOCUS_38300 42249 41722 gene locus_tag LOCUS_38310 42249 41722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 43067 42246 gene locus_tag LOCUS_38320 43067 42246 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888971.1 protein_id gnl|my_center|LOCUS_38320 43231 44763 gene locus_tag LOCUS_38330 43231 44763 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889165.1 protein_id gnl|my_center|LOCUS_38330 44953 44825 gene locus_tag LOCUS_38340 44953 44825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 45037 45528 gene locus_tag LOCUS_38350 45037 45528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 45676 46713 gene locus_tag LOCUS_38360 45676 46713 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887591.1 protein_id gnl|my_center|LOCUS_38360 48728 46710 gene locus_tag LOCUS_38370 48728 46710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 48909 48721 gene locus_tag LOCUS_38380 48909 48721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 48908 50104 gene locus_tag LOCUS_38390 48908 50104 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889163.1 protein_id gnl|my_center|LOCUS_38390 50150 50749 gene locus_tag LOCUS_38400 50150 50749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 51639 50740 gene locus_tag LOCUS_38410 51639 50740 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532582.1 protein_id gnl|my_center|LOCUS_38410 52522 51671 gene locus_tag LOCUS_38420 52522 51671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 52724 53740 gene locus_tag LOCUS_38430 gene galR 52724 53740 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201041.1 protein_id gnl|my_center|LOCUS_38430 53914 53681 gene locus_tag LOCUS_38440 53914 53681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 53841 56615 gene locus_tag LOCUS_38450 53841 56615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 56830 57264 gene locus_tag LOCUS_38460 56830 57264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 58665 57316 gene locus_tag LOCUS_38470 58665 57316 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_38470 59659 58658 gene locus_tag LOCUS_38480 59659 58658 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_38480 61524 59656 gene locus_tag LOCUS_38490 61524 59656 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225594.1 protein_id gnl|my_center|LOCUS_38490 62512 61526 gene locus_tag LOCUS_38500 62512 61526 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776034.1 protein_id gnl|my_center|LOCUS_38500 64412 62769 gene locus_tag LOCUS_38510 64412 62769 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467774.1 protein_id gnl|my_center|LOCUS_38510 65606 64593 gene locus_tag LOCUS_38520 65606 64593 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921545.1 protein_id gnl|my_center|LOCUS_38520 65605 65778 gene locus_tag LOCUS_38530 65605 65778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 68208 65977 gene locus_tag LOCUS_38540 68208 65977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 68705 68403 gene locus_tag LOCUS_38550 68705 68403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479691.1 protein_id gnl|my_center|LOCUS_38550 69019 71034 gene locus_tag LOCUS_38560 gene uvrB 69019 71034 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480336.1 protein_id gnl|my_center|LOCUS_38560 71174 72196 gene locus_tag LOCUS_38570 71174 72196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 72320 73672 gene locus_tag LOCUS_38580 72320 73672 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222037.1 protein_id gnl|my_center|LOCUS_38580 76170 73942 gene locus_tag LOCUS_38590 76170 73942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 76478 76254 gene locus_tag LOCUS_38600 76478 76254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 76739 77281 gene locus_tag LOCUS_38610 76739 77281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 78744 77347 gene locus_tag LOCUS_38620 gene fumC 78744 77347 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889251.1 protein_id gnl|my_center|LOCUS_38620 78958 80145 gene locus_tag LOCUS_38630 78958 80145 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423537.1 protein_id gnl|my_center|LOCUS_38630 81505 80132 gene locus_tag LOCUS_38640 81505 80132 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871009.1 protein_id gnl|my_center|LOCUS_38640 81657 82949 gene locus_tag LOCUS_38650 81657 82949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 83299 84279 gene locus_tag LOCUS_38660 83299 84279 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889247.1 protein_id gnl|my_center|LOCUS_38660 84419 84814 gene locus_tag LOCUS_38670 84419 84814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 84926 85405 gene locus_tag LOCUS_38680 84926 85405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 86314 85484 gene locus_tag LOCUS_38690 86314 85484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 86607 86311 gene locus_tag LOCUS_38700 86607 86311 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887019.1 protein_id gnl|my_center|LOCUS_38700 86730 86987 gene locus_tag LOCUS_38710 86730 86987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 87300 87025 gene locus_tag LOCUS_38720 87300 87025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 88804 87329 gene locus_tag LOCUS_38730 gene gatB 88804 87329 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480100.1 protein_id gnl|my_center|LOCUS_38730 88851 89273 gene locus_tag LOCUS_38740 88851 89273 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_38740 89591 89515 gene locus_tag LOCUS_t00460 89591 89515 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 89910 92150 gene locus_tag LOCUS_38750 89910 92150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 92798 92154 gene locus_tag LOCUS_38760 92798 92154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 93766 92777 gene locus_tag LOCUS_38770 93766 92777 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_38770 94199 95251 gene locus_tag LOCUS_38780 gene thrC 94199 95251 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255461.1 protein_id gnl|my_center|LOCUS_38780 95473 96387 gene locus_tag LOCUS_38790 gene thrB 95473 96387 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_38790 96542 97444 gene locus_tag LOCUS_38800 gene hemC 96542 97444 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888978.1 protein_id gnl|my_center|LOCUS_38800 97669 98586 gene locus_tag LOCUS_38810 gene fba 97669 98586 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888228.1 protein_id gnl|my_center|LOCUS_38810 99141 98866 gene locus_tag LOCUS_38820 99141 98866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 99470 99222 gene locus_tag LOCUS_38830 99470 99222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 99611 101161 gene locus_tag LOCUS_38840 99611 101161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence20 3 2504 gene locus_tag LOCUS_38850 3 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 3476 2556 gene locus_tag LOCUS_38860 3476 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 3928 3503 gene locus_tag LOCUS_38870 3928 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4578 4105 gene locus_tag LOCUS_38880 4578 4105 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228225.1 protein_id gnl|my_center|LOCUS_38880 5075 4578 gene locus_tag LOCUS_38890 5075 4578 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228225.1 protein_id gnl|my_center|LOCUS_38890 5194 5817 gene locus_tag LOCUS_38900 5194 5817 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887633.1 protein_id gnl|my_center|LOCUS_38900 6044 6343 gene locus_tag LOCUS_38910 6044 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 6567 7220 gene locus_tag LOCUS_38920 gene nth 6567 7220 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886934.1 protein_id gnl|my_center|LOCUS_38920 7246 7944 gene locus_tag LOCUS_38930 7246 7944 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480283.1 protein_id gnl|my_center|LOCUS_38930 7951 8412 gene locus_tag LOCUS_38940 7951 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 8487 8909 gene locus_tag LOCUS_38950 8487 8909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 9160 9606 gene locus_tag LOCUS_38960 9160 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 10019 9684 gene locus_tag LOCUS_38970 10019 9684 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887618.1 protein_id gnl|my_center|LOCUS_38970 10435 10016 gene locus_tag LOCUS_38980 10435 10016 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_38980 10561 11550 gene locus_tag LOCUS_38990 gene trpS 10561 11550 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887203.1 protein_id gnl|my_center|LOCUS_38990 11550 12344 gene locus_tag LOCUS_39000 11550 12344 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887202.1 protein_id gnl|my_center|LOCUS_39000 14352 12385 gene locus_tag LOCUS_39010 14352 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 15705 14356 gene locus_tag LOCUS_39020 15705 14356 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328044.1 protein_id gnl|my_center|LOCUS_39020 15875 17059 gene locus_tag LOCUS_39030 15875 17059 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479813.1 protein_id gnl|my_center|LOCUS_39030 17056 19812 gene locus_tag LOCUS_39040 gene sbcC 17056 19812 CDS product exonuclease SbcCD subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888557.1 protein_id gnl|my_center|LOCUS_39040 20545 20009 gene locus_tag LOCUS_39050 20545 20009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480346.1 protein_id gnl|my_center|LOCUS_39050 20767 20555 gene locus_tag LOCUS_39060 20767 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 20721 22100 gene locus_tag LOCUS_39070 20721 22100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 22343 22104 gene locus_tag LOCUS_39080 22343 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 24590 22422 gene locus_tag LOCUS_39090 gene glgB 24590 22422 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_39090 25412 24783 gene locus_tag LOCUS_39100 gene hisH 25412 24783 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887071.1 protein_id gnl|my_center|LOCUS_39100 26020 25409 gene locus_tag LOCUS_39110 gene hisB 26020 25409 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479567.1 protein_id gnl|my_center|LOCUS_39110 27144 26476 gene locus_tag LOCUS_39120 gene phoU 27144 26476 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888872.1 protein_id gnl|my_center|LOCUS_39120 27917 27159 gene locus_tag LOCUS_39130 gene pstB 27917 27159 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889420.1 protein_id gnl|my_center|LOCUS_39130 28832 27957 gene locus_tag LOCUS_39140 gene pstA 28832 27957 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889419.1 protein_id gnl|my_center|LOCUS_39140 29764 28829 gene locus_tag LOCUS_39150 gene pstC 29764 28829 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479754.1 protein_id gnl|my_center|LOCUS_39150 29950 29768 gene locus_tag LOCUS_39160 29950 29768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 29986 30957 gene locus_tag LOCUS_39170 29986 30957 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350308.1 protein_id gnl|my_center|LOCUS_39170 32088 31048 gene locus_tag LOCUS_39180 gene pstS 32088 31048 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_39180 32391 32867 gene locus_tag LOCUS_39190 32391 32867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 34040 32985 gene locus_tag LOCUS_39200 34040 32985 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258491.1 protein_id gnl|my_center|LOCUS_39200 34200 35360 gene locus_tag LOCUS_39210 34200 35360 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051056494.1 protein_id gnl|my_center|LOCUS_39210 35335 36492 gene locus_tag LOCUS_39220 35335 36492 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889596.1 protein_id gnl|my_center|LOCUS_39220 36545 36874 gene locus_tag LOCUS_39230 36545 36874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 36877 37974 gene locus_tag LOCUS_39240 36877 37974 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084987.1 protein_id gnl|my_center|LOCUS_39240 38065 38463 gene locus_tag LOCUS_39250 38065 38463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 39554 38475 gene locus_tag LOCUS_39260 39554 38475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 40889 39753 gene locus_tag LOCUS_39270 40889 39753 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479989.1 protein_id gnl|my_center|LOCUS_39270 42630 41203 gene locus_tag LOCUS_39280 42630 41203 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350448.1 protein_id gnl|my_center|LOCUS_39280 43174 42815 gene locus_tag LOCUS_39290 43174 42815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 43246 43791 gene locus_tag LOCUS_39300 43246 43791 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_39300 43876 44634 gene locus_tag LOCUS_39310 43876 44634 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888247.1 protein_id gnl|my_center|LOCUS_39310 45051 44794 gene locus_tag LOCUS_39320 45051 44794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 45375 46757 gene locus_tag LOCUS_39330 45375 46757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135229709.1 protein_id gnl|my_center|LOCUS_39330 47032 46754 gene locus_tag LOCUS_39340 47032 46754 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257693.1 protein_id gnl|my_center|LOCUS_39340 47449 47057 gene locus_tag LOCUS_39350 47449 47057 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522196.1 protein_id gnl|my_center|LOCUS_39350 47708 50035 gene locus_tag LOCUS_39360 47708 50035 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480129.1 protein_id gnl|my_center|LOCUS_39360 50079 50486 gene locus_tag LOCUS_39370 50079 50486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 50502 51674 gene locus_tag LOCUS_39380 50502 51674 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889105.1 protein_id gnl|my_center|LOCUS_39380 52551 51808 gene locus_tag LOCUS_39390 52551 51808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 53190 52612 gene locus_tag LOCUS_39400 gene pfpI 53190 52612 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867593.1 protein_id gnl|my_center|LOCUS_39400 54034 53282 gene locus_tag LOCUS_39410 54034 53282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 55391 54426 gene locus_tag LOCUS_39420 55391 54426 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_39420 56537 55686 gene locus_tag LOCUS_39430 56537 55686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 57489 56803 gene locus_tag LOCUS_39440 57489 56803 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_39440 57704 58597 gene locus_tag LOCUS_39450 57704 58597 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_39450 59383 58583 gene locus_tag LOCUS_39460 59383 58583 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_39460 60451 59426 gene locus_tag LOCUS_39470 60451 59426 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887482.1 protein_id gnl|my_center|LOCUS_39470 60700 61380 gene locus_tag LOCUS_39480 60700 61380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 62918 61512 gene locus_tag LOCUS_39490 62918 61512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 63507 62908 gene locus_tag LOCUS_39500 63507 62908 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_39500 63650 64393 gene locus_tag LOCUS_39510 gene map 63650 64393 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233698.1 protein_id gnl|my_center|LOCUS_39510 65258 64401 gene locus_tag LOCUS_39520 65258 64401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 65894 65349 gene locus_tag LOCUS_39530 65894 65349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 66193 66660 gene locus_tag LOCUS_39540 66193 66660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 66710 67114 gene locus_tag LOCUS_39550 66710 67114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 67288 68055 gene locus_tag LOCUS_39560 67288 68055 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887533.1 protein_id gnl|my_center|LOCUS_39560 70198 68105 gene locus_tag LOCUS_39570 70198 68105 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888537.1 protein_id gnl|my_center|LOCUS_39570 70512 70790 gene locus_tag LOCUS_39580 70512 70790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 71944 70805 gene locus_tag LOCUS_39590 71944 70805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388935.1 protein_id gnl|my_center|LOCUS_39590 72008 72253 gene locus_tag LOCUS_39600 72008 72253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 73482 72250 gene locus_tag LOCUS_39610 73482 72250 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_39610 74715 73726 gene locus_tag LOCUS_39620 gene prfB 74715 73726 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149357985.1 protein_id gnl|my_center|LOCUS_39620 76160 75078 gene locus_tag LOCUS_39630 76160 75078 CDS product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027255.1 protein_id gnl|my_center|LOCUS_39630 76138 77013 gene locus_tag LOCUS_39640 76138 77013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 77472 77017 gene locus_tag LOCUS_39650 77472 77017 CDS product DUF5680 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972658.1 protein_id gnl|my_center|LOCUS_39650 77620 78696 gene locus_tag LOCUS_39660 77620 78696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 79215 78706 gene locus_tag LOCUS_39670 79215 78706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 79535 80749 gene locus_tag LOCUS_39680 79535 80749 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927940.1 protein_id gnl|my_center|LOCUS_39680 81888 80959 gene locus_tag LOCUS_39690 81888 80959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_39690 82328 84169 gene locus_tag LOCUS_39700 gene rqkA 82328 84169 CDS product DNA damage-responsive serine/threonine-protein kinase RqkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889143.1 protein_id gnl|my_center|LOCUS_39700 84243 85694 gene locus_tag LOCUS_39710 84243 85694 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479895.1 protein_id gnl|my_center|LOCUS_39710 85716 86417 gene locus_tag LOCUS_39720 85716 86417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 86496 86720 gene locus_tag LOCUS_39730 86496 86720 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226600.1 protein_id gnl|my_center|LOCUS_39730 86887 88317 gene locus_tag LOCUS_39740 86887 88317 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814899.1 protein_id gnl|my_center|LOCUS_39740 <89290 88385 gene locus_tag LOCUS_39750 <89290 88385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486784.1:pullulanase-type alpha-1,6-glucosidase >Feature sequence21 1012 89 gene locus_tag LOCUS_39760 1012 89 CDS product DNA polymerase III subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888958.1 protein_id gnl|my_center|LOCUS_39760 1790 1023 gene locus_tag LOCUS_39770 1790 1023 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888957.1 protein_id gnl|my_center|LOCUS_39770 1888 2598 gene locus_tag LOCUS_39780 1888 2598 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948140.1 protein_id gnl|my_center|LOCUS_39780 2600 3109 gene locus_tag LOCUS_39790 2600 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 3138 4286 gene locus_tag LOCUS_39800 gene hemW 3138 4286 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886778.1 protein_id gnl|my_center|LOCUS_39800 4296 4877 gene locus_tag LOCUS_39810 4296 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 4978 5514 gene locus_tag LOCUS_39820 4978 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 5498 5845 gene locus_tag LOCUS_39830 5498 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 5989 6480 gene locus_tag LOCUS_39840 5989 6480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 6490 6939 gene locus_tag LOCUS_39850 6490 6939 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061684.1 protein_id gnl|my_center|LOCUS_39850 6936 7793 gene locus_tag LOCUS_39860 6936 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 9099 7855 gene locus_tag LOCUS_39870 9099 7855 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346353.1 protein_id gnl|my_center|LOCUS_39870 10281 9250 gene locus_tag LOCUS_39880 10281 9250 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227137.1 protein_id gnl|my_center|LOCUS_39880 10337 10972 gene locus_tag LOCUS_39890 10337 10972 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693800.1 protein_id gnl|my_center|LOCUS_39890 11279 12514 gene locus_tag LOCUS_39900 11279 12514 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_39900 13388 12609 gene locus_tag LOCUS_39910 13388 12609 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704761.1 protein_id gnl|my_center|LOCUS_39910 13668 13985 gene locus_tag LOCUS_39920 13668 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 14388 14053 gene locus_tag LOCUS_39930 14388 14053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 14761 15021 gene locus_tag LOCUS_39940 14761 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 15355 15663 gene locus_tag LOCUS_39950 15355 15663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 16555 15902 gene locus_tag LOCUS_39960 16555 15902 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926013.1 protein_id gnl|my_center|LOCUS_39960 17521 16619 gene locus_tag LOCUS_39970 17521 16619 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480339.1 protein_id gnl|my_center|LOCUS_39970 18233 17514 gene locus_tag LOCUS_39980 18233 17514 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886940.1 protein_id gnl|my_center|LOCUS_39980 19499 18294 gene locus_tag LOCUS_39990 19499 18294 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228553.1 protein_id gnl|my_center|LOCUS_39990 20715 19489 gene locus_tag LOCUS_40000 20715 19489 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480115.1 protein_id gnl|my_center|LOCUS_40000 24087 20926 gene locus_tag LOCUS_40010 24087 20926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 24701 24384 gene locus_tag LOCUS_40020 24701 24384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 26082 24835 gene locus_tag LOCUS_40030 26082 24835 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350111.1 protein_id gnl|my_center|LOCUS_40030 28897 26228 gene locus_tag LOCUS_40040 28897 26228 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479822.1 protein_id gnl|my_center|LOCUS_40040 29403 28894 gene locus_tag LOCUS_40050 29403 28894 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_40050 30044 29400 gene locus_tag LOCUS_40060 gene pgeF 30044 29400 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888599.1 protein_id gnl|my_center|LOCUS_40060 30263 31045 gene locus_tag LOCUS_40070 30263 31045 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227843.1 protein_id gnl|my_center|LOCUS_40070 31240 31452 gene locus_tag LOCUS_40080 31240 31452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 31873 31607 gene locus_tag LOCUS_40090 31873 31607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 32271 33725 gene locus_tag LOCUS_40100 32271 33725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 34060 33740 gene locus_tag LOCUS_40110 34060 33740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 34059 34265 gene locus_tag LOCUS_40120 34059 34265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 35224 34397 gene locus_tag LOCUS_40130 35224 34397 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_40130 35752 35300 gene locus_tag LOCUS_40140 35752 35300 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096834.1 protein_id gnl|my_center|LOCUS_40140 36991 35807 gene locus_tag LOCUS_40150 36991 35807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 38029 37109 gene locus_tag LOCUS_40160 gene folE2 38029 37109 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246378.1 protein_id gnl|my_center|LOCUS_40160 39481 38270 gene locus_tag LOCUS_40170 39481 38270 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886683.1 protein_id gnl|my_center|LOCUS_40170 40917 39670 gene locus_tag LOCUS_40180 40917 39670 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887950.1 protein_id gnl|my_center|LOCUS_40180 42134 40914 gene locus_tag LOCUS_40190 42134 40914 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887950.1 protein_id gnl|my_center|LOCUS_40190 42546 43166 gene locus_tag LOCUS_40200 gene udk 42546 43166 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886805.1 protein_id gnl|my_center|LOCUS_40200 43328 45109 gene locus_tag LOCUS_40210 43328 45109 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871314.1 protein_id gnl|my_center|LOCUS_40210 45106 46092 gene locus_tag LOCUS_40220 gene csaB 45106 46092 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886807.1 protein_id gnl|my_center|LOCUS_40220 47234 46194 gene locus_tag LOCUS_40230 47234 46194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 48275 47388 gene locus_tag LOCUS_40240 48275 47388 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888924.1 protein_id gnl|my_center|LOCUS_40240 48685 48275 gene locus_tag LOCUS_40250 48685 48275 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350530.1 protein_id gnl|my_center|LOCUS_40250 48975 49280 gene locus_tag LOCUS_40260 48975 49280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 49326 50390 gene locus_tag LOCUS_40270 49326 50390 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480363.1 protein_id gnl|my_center|LOCUS_40270 50483 50938 gene locus_tag LOCUS_40280 50483 50938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 51188 51715 gene locus_tag LOCUS_40290 51188 51715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 54078 51865 gene locus_tag LOCUS_40300 54078 51865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 55360 54182 gene locus_tag LOCUS_40310 55360 54182 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888696.1 protein_id gnl|my_center|LOCUS_40310 57169 55427 gene locus_tag LOCUS_40320 57169 55427 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081506.1 protein_id gnl|my_center|LOCUS_40320 57434 58096 gene locus_tag LOCUS_40330 57434 58096 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870755.1 protein_id gnl|my_center|LOCUS_40330 58330 58833 gene locus_tag LOCUS_40340 58330 58833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 58830 59504 gene locus_tag LOCUS_40350 58830 59504 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_40350 59580 59927 gene locus_tag LOCUS_40360 59580 59927 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888910.1 protein_id gnl|my_center|LOCUS_40360 59962 60159 gene locus_tag LOCUS_40370 59962 60159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 60233 60625 gene locus_tag LOCUS_40380 60233 60625 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035635.1 protein_id gnl|my_center|LOCUS_40380 60622 61209 gene locus_tag LOCUS_40390 60622 61209 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 protein_id gnl|my_center|LOCUS_40390 61265 62143 gene locus_tag LOCUS_40400 61265 62143 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351062.1 protein_id gnl|my_center|LOCUS_40400 62140 63486 gene locus_tag LOCUS_40410 62140 63486 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_40410 63657 65411 gene locus_tag LOCUS_40420 63657 65411 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_40420 65417 67201 gene locus_tag LOCUS_40430 65417 67201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886743.1 protein_id gnl|my_center|LOCUS_40430 67960 70356 gene locus_tag LOCUS_40440 gene lon 67960 70356 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888607.1 protein_id gnl|my_center|LOCUS_40440 70484 70840 gene locus_tag LOCUS_40450 70484 70840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 71638 71018 gene locus_tag LOCUS_40460 71638 71018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 72178 73497 gene locus_tag LOCUS_40470 72178 73497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 73980 73507 gene locus_tag LOCUS_40480 73980 73507 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_40480 74073 74972 gene locus_tag LOCUS_40490 gene yedA 74073 74972 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_40490 75046 75519 gene locus_tag LOCUS_40500 75046 75519 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020866.1 protein_id gnl|my_center|LOCUS_40500 76091 75537 gene locus_tag LOCUS_40510 76091 75537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 76794 76093 gene locus_tag LOCUS_40520 76794 76093 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_40520 76987 77667 gene locus_tag LOCUS_40530 76987 77667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 77864 79705 gene locus_tag LOCUS_40540 77864 79705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 79876 80124 gene locus_tag LOCUS_40550 79876 80124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 80260 80472 gene locus_tag LOCUS_40560 80260 80472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 80974 80552 gene locus_tag LOCUS_40570 80974 80552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 81119 82015 gene locus_tag LOCUS_40580 81119 82015 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926866.1 protein_id gnl|my_center|LOCUS_40580 82145 82069 gene locus_tag LOCUS_t00470 82145 82069 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 82273 82183 gene locus_tag LOCUS_t00480 82273 82183 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 82382 82295 gene locus_tag LOCUS_t00490 82382 82295 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 83280 82705 gene locus_tag LOCUS_40590 83280 82705 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888450.1 protein_id gnl|my_center|LOCUS_40590 83556 84101 gene locus_tag LOCUS_40600 gene purE 83556 84101 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886671.1 protein_id gnl|my_center|LOCUS_40600 84098 85228 gene locus_tag LOCUS_40610 gene purK 84098 85228 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886672.1 protein_id gnl|my_center|LOCUS_40610 85354 86328 gene locus_tag LOCUS_40620 85354 86328 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889178.1 protein_id gnl|my_center|LOCUS_40620 >Feature sequence22 95 418 gene locus_tag LOCUS_40630 gene rpsJ 95 418 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886955.1 protein_id gnl|my_center|LOCUS_40630 415 1041 gene locus_tag LOCUS_40640 gene rplC 415 1041 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886956.1 protein_id gnl|my_center|LOCUS_40640 1038 1634 gene locus_tag LOCUS_40650 gene rplD 1038 1634 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886957.1 protein_id gnl|my_center|LOCUS_40650 1631 1918 gene locus_tag LOCUS_40660 1631 1918 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886958.1 protein_id gnl|my_center|LOCUS_40660 1930 2757 gene locus_tag LOCUS_40670 gene rplB 1930 2757 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886959.1 protein_id gnl|my_center|LOCUS_40670 2770 3057 gene locus_tag LOCUS_40680 gene rpsS 2770 3057 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886960.1 protein_id gnl|my_center|LOCUS_40680 3067 3405 gene locus_tag LOCUS_40690 gene rplV 3067 3405 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886961.1 protein_id gnl|my_center|LOCUS_40690 3398 4141 gene locus_tag LOCUS_40700 gene rpsC 3398 4141 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886962.1 protein_id gnl|my_center|LOCUS_40700 4141 4566 gene locus_tag LOCUS_40710 gene rplP 4141 4566 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567820.1 protein_id gnl|my_center|LOCUS_40710 4553 4744 gene locus_tag LOCUS_40720 gene rpmC 4553 4744 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886964.1 protein_id gnl|my_center|LOCUS_40720 4757 5011 gene locus_tag LOCUS_40730 gene rpsQ 4757 5011 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886965.1 protein_id gnl|my_center|LOCUS_40730 5008 5412 gene locus_tag LOCUS_40740 gene rplN 5008 5412 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886966.1 protein_id gnl|my_center|LOCUS_40740 5412 5726 gene locus_tag LOCUS_40750 gene rplX 5412 5726 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871863.1 protein_id gnl|my_center|LOCUS_40750 5737 6276 gene locus_tag LOCUS_40760 gene rplE 5737 6276 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886968.1 protein_id gnl|my_center|LOCUS_40760 6289 6471 gene locus_tag LOCUS_40770 6289 6471 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_40770 6602 6997 gene locus_tag LOCUS_40780 gene rpsH 6602 6997 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888741.1 protein_id gnl|my_center|LOCUS_40780 7012 7569 gene locus_tag LOCUS_40790 gene rplF 7012 7569 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888742.1 protein_id gnl|my_center|LOCUS_40790 7569 7910 gene locus_tag LOCUS_40800 gene rplR 7569 7910 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633391.1 protein_id gnl|my_center|LOCUS_40800 7900 8406 gene locus_tag LOCUS_40810 gene rpsE 7900 8406 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350334.1 protein_id gnl|my_center|LOCUS_40810 8403 8570 gene locus_tag LOCUS_40820 gene rpmD 8403 8570 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888745.1 protein_id gnl|my_center|LOCUS_40820 8567 9010 gene locus_tag LOCUS_40830 gene rplO 8567 9010 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888746.1 protein_id gnl|my_center|LOCUS_40830 9010 10335 gene locus_tag LOCUS_40840 gene secY 9010 10335 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888747.1 protein_id gnl|my_center|LOCUS_40840 10565 11134 gene locus_tag LOCUS_40850 10565 11134 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888748.1 protein_id gnl|my_center|LOCUS_40850 11552 11809 gene locus_tag LOCUS_40860 gene infA 11552 11809 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479941.1 protein_id gnl|my_center|LOCUS_40860 12123 12503 gene locus_tag LOCUS_40870 gene rpsM 12123 12503 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_40870 12516 12908 gene locus_tag LOCUS_40880 gene rpsK 12516 12908 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888757.1 protein_id gnl|my_center|LOCUS_40880 12914 13528 gene locus_tag LOCUS_40890 gene rpsD 12914 13528 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888758.1 protein_id gnl|my_center|LOCUS_40890 13540 14529 gene locus_tag LOCUS_40900 13540 14529 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888759.1 protein_id gnl|my_center|LOCUS_40900 14540 14890 gene locus_tag LOCUS_40910 gene rplQ 14540 14890 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888760.1 protein_id gnl|my_center|LOCUS_40910 16153 15161 gene locus_tag LOCUS_40920 16153 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 16207 16446 gene locus_tag LOCUS_40930 16207 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 16409 16954 gene locus_tag LOCUS_40940 16409 16954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887590.1 protein_id gnl|my_center|LOCUS_40940 17214 18179 gene locus_tag LOCUS_40950 17214 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 18834 18502 gene locus_tag LOCUS_40960 gene trxA 18834 18502 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479673.1 protein_id gnl|my_center|LOCUS_40960 18928 19245 gene locus_tag LOCUS_40970 18928 19245 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479674.1 protein_id gnl|my_center|LOCUS_40970 19350 19934 gene locus_tag LOCUS_40980 19350 19934 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888630.1 protein_id gnl|my_center|LOCUS_40980 20060 21049 gene locus_tag LOCUS_40990 gene plsX 20060 21049 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479836.1 protein_id gnl|my_center|LOCUS_40990 21089 22315 gene locus_tag LOCUS_41000 21089 22315 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888628.1 protein_id gnl|my_center|LOCUS_41000 22552 23784 gene locus_tag LOCUS_41010 gene fabF 22552 23784 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479818.1 protein_id gnl|my_center|LOCUS_41010 23901 24311 gene locus_tag LOCUS_41020 23901 24311 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_41020 24399 26462 gene locus_tag LOCUS_41030 gene ppk1 24399 26462 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479817.1 protein_id gnl|my_center|LOCUS_41030 27248 26547 gene locus_tag LOCUS_41040 27248 26547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 30098 27561 gene locus_tag LOCUS_41050 30098 27561 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888825.1 protein_id gnl|my_center|LOCUS_41050 32513 30618 gene locus_tag LOCUS_41060 gene dxs 32513 30618 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888114.1 protein_id gnl|my_center|LOCUS_41060 33177 32500 gene locus_tag LOCUS_41070 33177 32500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 33396 34232 gene locus_tag LOCUS_41080 gene rapZ 33396 34232 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888073.1 protein_id gnl|my_center|LOCUS_41080 34540 35880 gene locus_tag LOCUS_41090 34540 35880 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888074.1 protein_id gnl|my_center|LOCUS_41090 36058 36822 gene locus_tag LOCUS_41100 36058 36822 CDS product glucodextranase DOMON-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227856.1 protein_id gnl|my_center|LOCUS_41100 36824 37666 gene locus_tag LOCUS_41110 36824 37666 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_41110 39014 37761 gene locus_tag LOCUS_41120 39014 37761 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480316.1 protein_id gnl|my_center|LOCUS_41120 39174 40061 gene locus_tag LOCUS_41130 39174 40061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 40510 40109 gene locus_tag LOCUS_41140 40510 40109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 40601 41716 gene locus_tag LOCUS_41150 40601 41716 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_41150 41794 42267 gene locus_tag LOCUS_41160 41794 42267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 42398 44191 gene locus_tag LOCUS_41170 gene lepA 42398 44191 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887788.1 protein_id gnl|my_center|LOCUS_41170 45162 44422 gene locus_tag LOCUS_41180 45162 44422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 45944 45159 gene locus_tag LOCUS_41190 45944 45159 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 protein_id gnl|my_center|LOCUS_41190 46726 45998 gene locus_tag LOCUS_41200 46726 45998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 46959 46747 gene locus_tag LOCUS_41210 46959 46747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 47251 46952 gene locus_tag LOCUS_41220 47251 46952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 48168 47248 gene locus_tag LOCUS_41230 48168 47248 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161618023.1 protein_id gnl|my_center|LOCUS_41230 48437 48165 gene locus_tag LOCUS_41240 48437 48165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 48480 48974 gene locus_tag LOCUS_41250 48480 48974 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_41250 49096 50013 gene locus_tag LOCUS_41260 49096 50013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 51290 50097 gene locus_tag LOCUS_41270 51290 50097 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350363.1 protein_id gnl|my_center|LOCUS_41270 52004 51420 gene locus_tag LOCUS_41280 52004 51420 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_41280 52579 52001 gene locus_tag LOCUS_41290 52579 52001 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_41290 53079 52642 gene locus_tag LOCUS_41300 53079 52642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 54008 53184 gene locus_tag LOCUS_41310 54008 53184 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_41310 54485 54213 gene locus_tag LOCUS_41320 54485 54213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 54742 55770 gene locus_tag LOCUS_41330 54742 55770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 55776 57239 gene locus_tag LOCUS_41340 55776 57239 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887486.1 protein_id gnl|my_center|LOCUS_41340 57612 57223 gene locus_tag LOCUS_41350 57612 57223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 58342 57623 gene locus_tag LOCUS_41360 58342 57623 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_41360 58723 59712 gene locus_tag LOCUS_41370 58723 59712 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383270.1 protein_id gnl|my_center|LOCUS_41370 60431 59832 gene locus_tag LOCUS_41380 60431 59832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 61697 60660 gene locus_tag LOCUS_41390 gene argC 61697 60660 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887608.1 protein_id gnl|my_center|LOCUS_41390 62310 61723 gene locus_tag LOCUS_41400 62310 61723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 63203 62361 gene locus_tag LOCUS_41410 gene lysX 63203 62361 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479919.1 protein_id gnl|my_center|LOCUS_41410 63504 63340 gene locus_tag LOCUS_41420 63504 63340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 63823 63650 gene locus_tag LOCUS_41430 gene lysW 63823 63650 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_41430 64145 63867 gene locus_tag LOCUS_41440 64145 63867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 64660 64163 gene locus_tag LOCUS_41450 64660 64163 CDS product 3-isopropylmalate dehydratase small subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888252.1 protein_id gnl|my_center|LOCUS_41450 64825 64661 gene locus_tag LOCUS_41460 64825 64661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 65249 64818 gene locus_tag LOCUS_41470 65249 64818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 66516 65266 gene locus_tag LOCUS_41480 66516 65266 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888248.1 protein_id gnl|my_center|LOCUS_41480 67395 66529 gene locus_tag LOCUS_41490 67395 66529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 68657 67488 gene locus_tag LOCUS_41500 gene lysS 68657 67488 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480200.1 protein_id gnl|my_center|LOCUS_41500 69524 68781 gene locus_tag LOCUS_41510 69524 68781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 70267 69521 gene locus_tag LOCUS_41520 70267 69521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 71425 70508 gene locus_tag LOCUS_41530 71425 70508 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887392.1 protein_id gnl|my_center|LOCUS_41530 72288 71557 gene locus_tag LOCUS_41540 72288 71557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 73242 72433 gene locus_tag LOCUS_41550 73242 72433 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887095.1 protein_id gnl|my_center|LOCUS_41550 73355 75472 gene locus_tag LOCUS_41560 73355 75472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 75571 76185 gene locus_tag LOCUS_41570 75571 76185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480327.1 protein_id gnl|my_center|LOCUS_41570 76281 77453 gene locus_tag LOCUS_41580 76281 77453 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349482.1 protein_id gnl|my_center|LOCUS_41580 77450 78658 gene locus_tag LOCUS_41590 77450 78658 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888817.1 protein_id gnl|my_center|LOCUS_41590 78810 79613 gene locus_tag LOCUS_41600 78810 79613 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_41600 79734 80708 gene locus_tag LOCUS_41610 79734 80708 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257393.1 protein_id gnl|my_center|LOCUS_41610 80913 81722 gene locus_tag LOCUS_41620 80913 81722 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257393.1 protein_id gnl|my_center|LOCUS_41620 82105 82530 gene locus_tag LOCUS_41630 82105 82530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 83319 82609 gene locus_tag LOCUS_41640 83319 82609 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_41640 83620 83360 gene locus_tag LOCUS_41650 83620 83360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 83946 83788 gene locus_tag LOCUS_41660 83946 83788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 84283 85380 gene locus_tag LOCUS_41670 gene ychF 84283 85380 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888025.1 protein_id gnl|my_center|LOCUS_41670 >Feature sequence23 206 10831 gene locus_tag LOCUS_41680 206 10831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 10841 11221 gene locus_tag LOCUS_41690 10841 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 11675 13951 gene locus_tag LOCUS_41700 11675 13951 CDS product cellulose binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227003.1 protein_id gnl|my_center|LOCUS_41700 14946 14005 gene locus_tag LOCUS_41710 14946 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065581.1 protein_id gnl|my_center|LOCUS_41710 15498 14974 gene locus_tag LOCUS_41720 15498 14974 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921635.1 protein_id gnl|my_center|LOCUS_41720 15611 16231 gene locus_tag LOCUS_41730 15611 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 17271 16264 gene locus_tag LOCUS_41740 17271 16264 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225276.1 protein_id gnl|my_center|LOCUS_41740 19014 17461 gene locus_tag LOCUS_41750 19014 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 20091 19021 gene locus_tag LOCUS_41760 20091 19021 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256964.1 protein_id gnl|my_center|LOCUS_41760 20981 20091 gene locus_tag LOCUS_41770 20981 20091 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256965.1 protein_id gnl|my_center|LOCUS_41770 22330 20993 gene locus_tag LOCUS_41780 22330 20993 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256966.1 protein_id gnl|my_center|LOCUS_41780 23486 22569 gene locus_tag LOCUS_41790 23486 22569 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061486.1 protein_id gnl|my_center|LOCUS_41790 23568 25247 gene locus_tag LOCUS_41800 23568 25247 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706887.1 protein_id gnl|my_center|LOCUS_41800 26241 25264 gene locus_tag LOCUS_41810 26241 25264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 26445 27407 gene locus_tag LOCUS_41820 26445 27407 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_41820 27404 28567 gene locus_tag LOCUS_41830 27404 28567 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_41830 28667 29527 gene locus_tag LOCUS_41840 28667 29527 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_41840 29524 30453 gene locus_tag LOCUS_41850 29524 30453 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_41850 30450 31172 gene locus_tag LOCUS_41860 30450 31172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_41860 31169 31879 gene locus_tag LOCUS_41870 31169 31879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103312601.1 protein_id gnl|my_center|LOCUS_41870 32139 33506 gene locus_tag LOCUS_41880 32139 33506 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_41880 33609 34859 gene locus_tag LOCUS_41890 33609 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 35128 35565 gene locus_tag LOCUS_41900 35128 35565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 35706 37049 gene locus_tag LOCUS_41910 35706 37049 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883977.1 protein_id gnl|my_center|LOCUS_41910 37049 38128 gene locus_tag LOCUS_41920 37049 38128 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883976.1 protein_id gnl|my_center|LOCUS_41920 39504 38302 gene locus_tag LOCUS_41930 39504 38302 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108952.1 protein_id gnl|my_center|LOCUS_41930 39702 40166 gene locus_tag LOCUS_41940 39702 40166 CDS product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113661.1 protein_id gnl|my_center|LOCUS_41940 40377 40589 gene locus_tag LOCUS_41950 40377 40589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 40808 41674 gene locus_tag LOCUS_41960 40808 41674 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382858.1 protein_id gnl|my_center|LOCUS_41960 42779 41736 gene locus_tag LOCUS_41970 42779 41736 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 protein_id gnl|my_center|LOCUS_41970 42999 43376 gene locus_tag LOCUS_41980 gene hypR 42999 43376 CDS product transcriptional regulator HypR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242487.1 protein_id gnl|my_center|LOCUS_41980 43594 43806 gene locus_tag LOCUS_41990 43594 43806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 44837 43824 gene locus_tag LOCUS_42000 44837 43824 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_42000 45061 46395 gene locus_tag LOCUS_42010 45061 46395 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_42010 46603 47517 gene locus_tag LOCUS_42020 46603 47517 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969940.1 protein_id gnl|my_center|LOCUS_42020 47514 48377 gene locus_tag LOCUS_42030 47514 48377 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530860.1 protein_id gnl|my_center|LOCUS_42030 48374 49420 gene locus_tag LOCUS_42040 48374 49420 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_42040 49417 50166 gene locus_tag LOCUS_42050 49417 50166 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 protein_id gnl|my_center|LOCUS_42050 50242 51744 gene locus_tag LOCUS_42060 50242 51744 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_42060 51995 51825 gene locus_tag LOCUS_42070 51995 51825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 52437 52009 gene locus_tag LOCUS_42080 52437 52009 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028286.1 protein_id gnl|my_center|LOCUS_42080 52547 53350 gene locus_tag LOCUS_42090 52547 53350 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226654.1 protein_id gnl|my_center|LOCUS_42090 53653 53489 gene locus_tag LOCUS_42100 53653 53489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 54073 53858 gene locus_tag LOCUS_42110 54073 53858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42110 54399 54058 gene locus_tag LOCUS_42120 54399 54058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 55458 55090 gene locus_tag LOCUS_42130 55458 55090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 55786 56145 gene locus_tag LOCUS_42140 55786 56145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_42140 56302 57306 gene locus_tag LOCUS_42150 56302 57306 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479751.1 protein_id gnl|my_center|LOCUS_42150 57868 58713 gene locus_tag LOCUS_42160 57868 58713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 58888 59334 gene locus_tag LOCUS_42170 58888 59334 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889032.1 protein_id gnl|my_center|LOCUS_42170 59430 59705 gene locus_tag LOCUS_42180 59430 59705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 61357 59906 gene locus_tag LOCUS_42190 61357 59906 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_42190 62030 63400 gene locus_tag LOCUS_42200 62030 63400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 64092 63586 gene locus_tag LOCUS_42210 64092 63586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 64539 65621 gene locus_tag LOCUS_42220 gene galT 64539 65621 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_42220 65618 66667 gene locus_tag LOCUS_42230 gene galK 65618 66667 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381253.1 protein_id gnl|my_center|LOCUS_42230 67298 66753 gene locus_tag LOCUS_42240 67298 66753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 67845 68531 gene locus_tag LOCUS_42250 67845 68531 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463915.1 protein_id gnl|my_center|LOCUS_42250 68938 68615 gene locus_tag LOCUS_42260 68938 68615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 69132 70097 gene locus_tag LOCUS_42270 69132 70097 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176736.1 protein_id gnl|my_center|LOCUS_42270 70208 70441 gene locus_tag LOCUS_42280 70208 70441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 70739 70527 gene locus_tag LOCUS_42290 70739 70527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 71697 71095 gene locus_tag LOCUS_42300 71697 71095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 73312 71690 gene locus_tag LOCUS_42310 73312 71690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 73619 73380 gene locus_tag LOCUS_42320 73619 73380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 73893 74294 gene locus_tag LOCUS_42330 73893 74294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 74291 77218 gene locus_tag LOCUS_42340 74291 77218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 77673 77215 gene locus_tag LOCUS_42350 77673 77215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 77857 78768 gene locus_tag LOCUS_42360 77857 78768 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704826.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42360 <79747 78873 gene locus_tag LOCUS_42370 <79747 78873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256963.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence24 111 530 gene locus_tag LOCUS_42380 111 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 1523 507 gene locus_tag LOCUS_42390 1523 507 CDS product IS630-like element ISDra3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480514.1 protein_id gnl|my_center|LOCUS_42390 1571 1927 gene locus_tag LOCUS_42400 1571 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 2313 4493 gene locus_tag LOCUS_42410 2313 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 4900 4469 gene locus_tag LOCUS_42420 4900 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 5086 6399 gene locus_tag LOCUS_42430 5086 6399 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065240.1 protein_id gnl|my_center|LOCUS_42430 6396 7439 gene locus_tag LOCUS_42440 6396 7439 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479997.1 protein_id gnl|my_center|LOCUS_42440 7436 8797 gene locus_tag LOCUS_42450 7436 8797 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228370.1 protein_id gnl|my_center|LOCUS_42450 8794 9489 gene locus_tag LOCUS_42460 8794 9489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_42460 9486 10781 gene locus_tag LOCUS_42470 9486 10781 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_42470 10810 11421 gene locus_tag LOCUS_42480 10810 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 12085 11564 gene locus_tag LOCUS_42490 12085 11564 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252527.1 protein_id gnl|my_center|LOCUS_42490 12422 12054 gene locus_tag LOCUS_42500 12422 12054 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969808.1 protein_id gnl|my_center|LOCUS_42500 12924 12736 gene locus_tag LOCUS_42510 12924 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 13270 13851 gene locus_tag LOCUS_42520 13270 13851 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807705.1 protein_id gnl|my_center|LOCUS_42520 14306 15253 gene locus_tag LOCUS_42530 14306 15253 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_42530 15250 17871 gene locus_tag LOCUS_42540 15250 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 20488 18143 gene locus_tag LOCUS_42550 20488 18143 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403487.1 protein_id gnl|my_center|LOCUS_42550 21717 20614 gene locus_tag LOCUS_42560 gene alr 21717 20614 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479629.1 protein_id gnl|my_center|LOCUS_42560 22893 21721 gene locus_tag LOCUS_42570 22893 21721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 24249 22921 gene locus_tag LOCUS_42580 24249 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 24989 24246 gene locus_tag LOCUS_42590 24989 24246 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_42590 25378 24992 gene locus_tag LOCUS_42600 25378 24992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 26266 25514 gene locus_tag LOCUS_42610 26266 25514 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_42610 27520 26276 gene locus_tag LOCUS_42620 27520 26276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 27953 27510 gene locus_tag LOCUS_42630 27953 27510 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871913.1 protein_id gnl|my_center|LOCUS_42630 28347 28024 gene locus_tag LOCUS_42640 28347 28024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 30802 28412 gene locus_tag LOCUS_42650 gene glgX 30802 28412 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_42650 31131 30799 gene locus_tag LOCUS_42660 31131 30799 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883149.1 protein_id gnl|my_center|LOCUS_42660 33034 31172 gene locus_tag LOCUS_42670 33034 31172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 33522 33124 gene locus_tag LOCUS_42680 33522 33124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 34097 33519 gene locus_tag LOCUS_42690 34097 33519 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703592.1 protein_id gnl|my_center|LOCUS_42690 35617 34094 gene locus_tag LOCUS_42700 35617 34094 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970552.1 protein_id gnl|my_center|LOCUS_42700 36006 35614 gene locus_tag LOCUS_42710 36006 35614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 36884 36048 gene locus_tag LOCUS_42720 36884 36048 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970774.1 protein_id gnl|my_center|LOCUS_42720 37649 36891 gene locus_tag LOCUS_42730 37649 36891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 38076 37660 gene locus_tag LOCUS_42740 38076 37660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 38921 38073 gene locus_tag LOCUS_42750 38921 38073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 39437 39015 gene locus_tag LOCUS_42760 39437 39015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 41141 39444 gene locus_tag LOCUS_42770 41141 39444 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_42770 41973 41146 gene locus_tag LOCUS_42780 41973 41146 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_42780 43574 42483 gene locus_tag LOCUS_42790 43574 42483 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921545.1 protein_id gnl|my_center|LOCUS_42790 44309 43944 gene locus_tag LOCUS_42800 44309 43944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 44928 45590 gene locus_tag LOCUS_42810 44928 45590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 45647 47974 gene locus_tag LOCUS_42820 45647 47974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 48122 48595 gene locus_tag LOCUS_42830 48122 48595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 49010 48612 gene locus_tag LOCUS_42840 49010 48612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 51021 49741 gene locus_tag LOCUS_42850 51021 49741 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082727.1 protein_id gnl|my_center|LOCUS_42850 51315 51476 gene locus_tag LOCUS_42860 51315 51476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 51581 51901 gene locus_tag LOCUS_42870 51581 51901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 52155 53156 gene locus_tag LOCUS_42880 52155 53156 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889261.1 protein_id gnl|my_center|LOCUS_42880 53149 54045 gene locus_tag LOCUS_42890 53149 54045 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143340.1 protein_id gnl|my_center|LOCUS_42890 55651 57015 gene locus_tag LOCUS_42900 55651 57015 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229172.1 protein_id gnl|my_center|LOCUS_42900 57826 57191 gene locus_tag LOCUS_42910 57826 57191 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_42910 58392 57880 gene locus_tag LOCUS_42920 58392 57880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 60731 58410 gene locus_tag LOCUS_42930 gene topA 60731 58410 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480031.1 protein_id gnl|my_center|LOCUS_42930 61062 63671 gene locus_tag LOCUS_42940 61062 63671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 63821 63991 gene locus_tag LOCUS_42950 63821 63991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 64229 65332 gene locus_tag LOCUS_42960 64229 65332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 65662 65339 gene locus_tag LOCUS_42970 65662 65339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 66281 66000 gene locus_tag LOCUS_42980 66281 66000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 66509 66835 gene locus_tag LOCUS_42990 66509 66835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 67879 66884 gene locus_tag LOCUS_43000 67879 66884 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228214.1 protein_id gnl|my_center|LOCUS_43000 68520 70346 gene locus_tag LOCUS_43010 68520 70346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 70480 70890 gene locus_tag LOCUS_43020 70480 70890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 71420 70932 gene locus_tag LOCUS_43030 71420 70932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 72395 71505 gene locus_tag LOCUS_43040 72395 71505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889428.1 protein_id gnl|my_center|LOCUS_43040 73166 72405 gene locus_tag LOCUS_43050 gene modA 73166 72405 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889429.1 protein_id gnl|my_center|LOCUS_43050 74281 73163 gene locus_tag LOCUS_43060 74281 73163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 75248 74421 gene locus_tag LOCUS_43070 75248 74421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 >Feature sequence25 526 266 gene locus_tag LOCUS_43080 gene pprM 526 266 CDS product DNA damage response modulator PprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869024.1 protein_id gnl|my_center|LOCUS_43080 875 1351 gene locus_tag LOCUS_43090 875 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 1544 1783 gene locus_tag LOCUS_43100 1544 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 3571 2684 gene locus_tag LOCUS_43110 3571 2684 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226050.1 protein_id gnl|my_center|LOCUS_43110 3780 5606 gene locus_tag LOCUS_43120 3780 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 7029 5689 gene locus_tag LOCUS_43130 7029 5689 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021843.1 protein_id gnl|my_center|LOCUS_43130 8013 7036 gene locus_tag LOCUS_43140 8013 7036 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256284.1 protein_id gnl|my_center|LOCUS_43140 9564 8461 gene locus_tag LOCUS_43150 9564 8461 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 protein_id gnl|my_center|LOCUS_43150 9700 12174 gene locus_tag LOCUS_43160 9700 12174 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040114033.1 protein_id gnl|my_center|LOCUS_43160 12326 12652 gene locus_tag LOCUS_43170 12326 12652 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888251.1 protein_id gnl|my_center|LOCUS_43170 12741 12965 gene locus_tag LOCUS_43180 12741 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 13641 13988 gene locus_tag LOCUS_43190 13641 13988 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888251.1 protein_id gnl|my_center|LOCUS_43190 13985 15673 gene locus_tag LOCUS_43200 13985 15673 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858443.1 protein_id gnl|my_center|LOCUS_43200 16506 17114 gene locus_tag LOCUS_43210 16506 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 17456 17292 gene locus_tag LOCUS_43220 17456 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 17734 17423 gene locus_tag LOCUS_43230 17734 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 18033 17818 gene locus_tag LOCUS_43240 18033 17818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 19038 18184 gene locus_tag LOCUS_43250 19038 18184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 19309 19953 gene locus_tag LOCUS_43260 19309 19953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 21029 20049 gene locus_tag LOCUS_43270 21029 20049 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_43270 21541 21362 gene locus_tag LOCUS_43280 21541 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 21941 21606 gene locus_tag LOCUS_43290 21941 21606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 22190 21954 gene locus_tag LOCUS_43300 22190 21954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 22183 22374 gene locus_tag LOCUS_43310 22183 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 22585 23091 gene locus_tag LOCUS_43320 22585 23091 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167131.1 protein_id gnl|my_center|LOCUS_43320 23818 23231 gene locus_tag LOCUS_43330 23818 23231 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771176.1 protein_id gnl|my_center|LOCUS_43330 23944 24777 gene locus_tag LOCUS_43340 23944 24777 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351059.1 protein_id gnl|my_center|LOCUS_43340 24880 25125 gene locus_tag LOCUS_43350 24880 25125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 25166 27832 gene locus_tag LOCUS_43360 25166 27832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 30332 27999 gene locus_tag LOCUS_43370 30332 27999 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_43370 30994 30317 gene locus_tag LOCUS_43380 30994 30317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 31647 30991 gene locus_tag LOCUS_43390 31647 30991 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_43390 32780 31731 gene locus_tag LOCUS_43400 gene sbnB 32780 31731 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226628.1 protein_id gnl|my_center|LOCUS_43400 33814 32780 gene locus_tag LOCUS_43410 33814 32780 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425603.1 protein_id gnl|my_center|LOCUS_43410 34971 33811 gene locus_tag LOCUS_43420 34971 33811 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225912.1 protein_id gnl|my_center|LOCUS_43420 35242 34982 gene locus_tag LOCUS_43430 35242 34982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 36166 35273 gene locus_tag LOCUS_43440 36166 35273 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226597.1 protein_id gnl|my_center|LOCUS_43440 37386 36163 gene locus_tag LOCUS_43450 37386 36163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226634.1 protein_id gnl|my_center|LOCUS_43450 39907 37370 gene locus_tag LOCUS_43460 39907 37370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 40940 39969 gene locus_tag LOCUS_43470 gene sbnA 40940 39969 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570808.1 protein_id gnl|my_center|LOCUS_43470 45143 40965 gene locus_tag LOCUS_43480 45143 40965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 51568 45140 gene locus_tag LOCUS_43490 51568 45140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 57919 51593 gene locus_tag LOCUS_43500 57919 51593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 59143 58334 gene locus_tag LOCUS_43510 59143 58334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 59514 60770 gene locus_tag LOCUS_43520 59514 60770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 62366 60951 gene locus_tag LOCUS_43530 62366 60951 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942100.1 protein_id gnl|my_center|LOCUS_43530 63568 62417 gene locus_tag LOCUS_43540 63568 62417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 63993 63637 gene locus_tag LOCUS_43550 63993 63637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 64430 63990 gene locus_tag LOCUS_43560 64430 63990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43560 64882 64427 gene locus_tag LOCUS_43570 64882 64427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 65156 65344 gene locus_tag LOCUS_43580 65156 65344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 66286 65411 gene locus_tag LOCUS_43590 66286 65411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 66750 66316 gene locus_tag LOCUS_43600 66750 66316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 67014 66841 gene locus_tag LOCUS_43610 67014 66841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 67822 67433 gene locus_tag LOCUS_43620 67822 67433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 68458 68754 gene locus_tag LOCUS_43630 68458 68754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 68975 69199 gene locus_tag LOCUS_43640 68975 69199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 69446 69162 gene locus_tag LOCUS_43650 69446 69162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 70036 70416 gene locus_tag LOCUS_43660 70036 70416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 70420 71172 gene locus_tag LOCUS_43670 70420 71172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 71384 71752 gene locus_tag LOCUS_43680 71384 71752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 72436 71957 gene locus_tag LOCUS_43690 72436 71957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 72736 73416 gene locus_tag LOCUS_43700 72736 73416 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086341.1 protein_id gnl|my_center|LOCUS_43700 73413 74639 gene locus_tag LOCUS_43710 73413 74639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 >Feature sequence26 3208 239 gene locus_tag LOCUS_43720 3208 239 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259651.1 protein_id gnl|my_center|LOCUS_43720 3974 3255 gene locus_tag LOCUS_43730 3974 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 4369 6405 gene locus_tag LOCUS_43740 4369 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 7507 6443 gene locus_tag LOCUS_43750 7507 6443 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_43750 7742 7879 gene locus_tag LOCUS_43760 7742 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 9199 7946 gene locus_tag LOCUS_43770 9199 7946 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009922704.1 protein_id gnl|my_center|LOCUS_43770 9498 9743 gene locus_tag LOCUS_43780 9498 9743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 9744 11051 gene locus_tag LOCUS_43790 9744 11051 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775728.1 protein_id gnl|my_center|LOCUS_43790 11214 11333 gene locus_tag LOCUS_43800 11214 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 11659 11781 gene locus_tag LOCUS_43810 11659 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 12127 13617 gene locus_tag LOCUS_43820 12127 13617 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546469.1 protein_id gnl|my_center|LOCUS_43820 13722 14036 gene locus_tag LOCUS_43830 13722 14036 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_43830 14094 14510 gene locus_tag LOCUS_43840 14094 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 15292 14522 gene locus_tag LOCUS_43850 15292 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 15433 15843 gene locus_tag LOCUS_43860 gene ruvX 15433 15843 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889134.1 protein_id gnl|my_center|LOCUS_43860 15894 17078 gene locus_tag LOCUS_43870 gene kynU 15894 17078 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276298.1 protein_id gnl|my_center|LOCUS_43870 17438 18568 gene locus_tag LOCUS_43880 17438 18568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 18734 21121 gene locus_tag LOCUS_43890 18734 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 23526 21199 gene locus_tag LOCUS_43900 23526 21199 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_43900 24092 27064 gene locus_tag LOCUS_43910 24092 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 27220 28836 gene locus_tag LOCUS_43920 27220 28836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 29263 28907 gene locus_tag LOCUS_43930 29263 28907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 29757 29272 gene locus_tag LOCUS_43940 29757 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 30431 29937 gene locus_tag LOCUS_43950 30431 29937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 30566 30808 gene locus_tag LOCUS_43960 30566 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 31353 30820 gene locus_tag LOCUS_43970 31353 30820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 31455 31676 gene locus_tag LOCUS_43980 31455 31676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 31666 31977 gene locus_tag LOCUS_43990 31666 31977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 32203 33171 gene locus_tag LOCUS_44000 32203 33171 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065221.1 protein_id gnl|my_center|LOCUS_44000 33376 33451 gene locus_tag LOCUS_t00500 33376 33451 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 33867 33791 gene locus_tag LOCUS_t00510 33867 33791 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34274 34189 gene locus_tag LOCUS_t00520 34274 34189 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34614 34420 gene locus_tag LOCUS_44010 34614 34420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 34986 36683 gene locus_tag LOCUS_44020 34986 36683 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_44020 36831 37730 gene locus_tag LOCUS_44030 36831 37730 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870317.1 protein_id gnl|my_center|LOCUS_44030 37852 38433 gene locus_tag LOCUS_44040 37852 38433 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889003.1 protein_id gnl|my_center|LOCUS_44040 38426 39544 gene locus_tag LOCUS_44050 38426 39544 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227840.1 protein_id gnl|my_center|LOCUS_44050 39745 40614 gene locus_tag LOCUS_44060 39745 40614 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_44060 41392 40646 gene locus_tag LOCUS_44070 41392 40646 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350521.1 protein_id gnl|my_center|LOCUS_44070 42730 41588 gene locus_tag LOCUS_44080 42730 41588 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888896.1 protein_id gnl|my_center|LOCUS_44080 43255 42812 gene locus_tag LOCUS_44090 43255 42812 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 protein_id gnl|my_center|LOCUS_44090 44204 43260 gene locus_tag LOCUS_44100 44204 43260 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 protein_id gnl|my_center|LOCUS_44100 44458 44958 gene locus_tag LOCUS_44110 44458 44958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 45289 45053 gene locus_tag LOCUS_44120 45289 45053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 46144 45857 gene locus_tag LOCUS_44130 46144 45857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722968.1 protein_id gnl|my_center|LOCUS_44130 46532 46456 gene locus_tag LOCUS_t00530 46532 46456 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 46648 46575 gene locus_tag LOCUS_t00540 46648 46575 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46769 46693 gene locus_tag LOCUS_t00550 46769 46693 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 49385 46947 gene locus_tag LOCUS_44140 49385 46947 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888983.1 protein_id gnl|my_center|LOCUS_44140 50698 49409 gene locus_tag LOCUS_44150 50698 49409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 51740 50721 gene locus_tag LOCUS_44160 gene pheS 51740 50721 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888980.1 protein_id gnl|my_center|LOCUS_44160 53526 52027 gene locus_tag LOCUS_44170 53526 52027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 55094 53550 gene locus_tag LOCUS_44180 55094 53550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 55381 56271 gene locus_tag LOCUS_44190 55381 56271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 56554 56429 gene locus_tag LOCUS_44200 56554 56429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 56906 59542 gene locus_tag LOCUS_44210 gene ppdK 56906 59542 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460835.1 protein_id gnl|my_center|LOCUS_44210 60569 59688 gene locus_tag LOCUS_44220 60569 59688 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479524.1 protein_id gnl|my_center|LOCUS_44220 61029 61199 gene locus_tag LOCUS_44230 61029 61199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 62358 61192 gene locus_tag LOCUS_44240 62358 61192 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479553.1 protein_id gnl|my_center|LOCUS_44240 62517 62900 gene locus_tag LOCUS_44250 62517 62900 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887084.1 protein_id gnl|my_center|LOCUS_44250 63316 65088 gene locus_tag LOCUS_44260 63316 65088 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888210.1 protein_id gnl|my_center|LOCUS_44260 65176 66159 gene locus_tag LOCUS_44270 65176 66159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479864.1 protein_id gnl|my_center|LOCUS_44270 66168 67313 gene locus_tag LOCUS_44280 66168 67313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888208.1 protein_id gnl|my_center|LOCUS_44280 67377 68039 gene locus_tag LOCUS_44290 67377 68039 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479560.1 protein_id gnl|my_center|LOCUS_44290 68719 68036 gene locus_tag LOCUS_44300 gene moaD 68719 68036 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889231.1 protein_id gnl|my_center|LOCUS_44300 >Feature sequence27 1239 1003 gene locus_tag LOCUS_44310 1239 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 1592 1239 gene locus_tag LOCUS_44320 1592 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 1563 1748 gene locus_tag LOCUS_44330 1563 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 4119 1831 gene locus_tag LOCUS_44340 4119 1831 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256532.1 protein_id gnl|my_center|LOCUS_44340 5135 4116 gene locus_tag LOCUS_44350 5135 4116 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256531.1 protein_id gnl|my_center|LOCUS_44350 5594 6361 gene locus_tag LOCUS_44360 5594 6361 CDS product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 protein_id gnl|my_center|LOCUS_44360 7478 6369 gene locus_tag LOCUS_44370 gene pqsH 7478 6369 CDS product 2-heptyl-3-hydroxy-4(1H)-quinolone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090354.1 protein_id gnl|my_center|LOCUS_44370 8092 7475 gene locus_tag LOCUS_44380 8092 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 9437 8166 gene locus_tag LOCUS_44390 9437 8166 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_44390 10534 9434 gene locus_tag LOCUS_44400 10534 9434 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770127.1 protein_id gnl|my_center|LOCUS_44400 12154 10652 gene locus_tag LOCUS_44410 12154 10652 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446585.1 protein_id gnl|my_center|LOCUS_44410 13829 12378 gene locus_tag LOCUS_44420 13829 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 14021 14260 gene locus_tag LOCUS_44430 14021 14260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 15210 14155 gene locus_tag LOCUS_44440 15210 14155 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_44440 16226 15207 gene locus_tag LOCUS_44450 16226 15207 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_44450 17728 16238 gene locus_tag LOCUS_44460 17728 16238 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_44460 18766 17912 gene locus_tag LOCUS_44470 18766 17912 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_44470 19718 18768 gene locus_tag LOCUS_44480 19718 18768 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257155.1 protein_id gnl|my_center|LOCUS_44480 21095 19788 gene locus_tag LOCUS_44490 21095 19788 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546372.1 protein_id gnl|my_center|LOCUS_44490 21691 22734 gene locus_tag LOCUS_44500 21691 22734 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226230.1 protein_id gnl|my_center|LOCUS_44500 22854 23192 gene locus_tag LOCUS_44510 22854 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 23372 23995 gene locus_tag LOCUS_44520 23372 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44520 24028 25050 gene locus_tag LOCUS_44530 24028 25050 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942027.1 protein_id gnl|my_center|LOCUS_44530 25764 25147 gene locus_tag LOCUS_44540 25764 25147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44540 26114 28483 gene locus_tag LOCUS_44550 26114 28483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 28593 28760 gene locus_tag LOCUS_44560 28593 28760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 30445 28775 gene locus_tag LOCUS_44570 30445 28775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44570 31266 30754 gene locus_tag LOCUS_44580 31266 30754 CDS product arsinothricin resistance N-acetyltransferase ArsN1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258843.1 protein_id gnl|my_center|LOCUS_44580 32141 31263 gene locus_tag LOCUS_44590 32141 31263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 33307 32297 gene locus_tag LOCUS_44600 33307 32297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 34588 33758 gene locus_tag LOCUS_44610 34588 33758 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259004.1 protein_id gnl|my_center|LOCUS_44610 35514 34585 gene locus_tag LOCUS_44620 35514 34585 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256399.1 protein_id gnl|my_center|LOCUS_44620 36732 35563 gene locus_tag LOCUS_44630 gene malE 36732 35563 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583082.1 protein_id gnl|my_center|LOCUS_44630 38385 37099 gene locus_tag LOCUS_44640 38385 37099 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641774.1 protein_id gnl|my_center|LOCUS_44640 40139 38382 gene locus_tag LOCUS_44650 gene malZ 40139 38382 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818979.1 protein_id gnl|my_center|LOCUS_44650 41155 40154 gene locus_tag LOCUS_44660 41155 40154 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228214.1 protein_id gnl|my_center|LOCUS_44660 41530 42111 gene locus_tag LOCUS_44670 41530 42111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 42868 42131 gene locus_tag LOCUS_44680 42868 42131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 43243 42938 gene locus_tag LOCUS_44690 43243 42938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 43397 43783 gene locus_tag LOCUS_44700 43397 43783 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_44700 45919 43838 gene locus_tag LOCUS_44710 45919 43838 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223744.1 protein_id gnl|my_center|LOCUS_44710 47080 46079 gene locus_tag LOCUS_44720 gene mgrA 47080 46079 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640297.1 protein_id gnl|my_center|LOCUS_44720 47533 48777 gene locus_tag LOCUS_44730 47533 48777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 48875 50680 gene locus_tag LOCUS_44740 48875 50680 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175611800.1 protein_id gnl|my_center|LOCUS_44740 51591 54083 gene locus_tag LOCUS_44750 51591 54083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 54107 54607 gene locus_tag LOCUS_44760 54107 54607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 54667 55170 gene locus_tag LOCUS_44770 54667 55170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 55401 55180 gene locus_tag LOCUS_44780 55401 55180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 55303 55998 gene locus_tag LOCUS_44790 55303 55998 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884054.1 protein_id gnl|my_center|LOCUS_44790 55995 58157 gene locus_tag LOCUS_44800 55995 58157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44800 58358 59467 gene locus_tag LOCUS_44810 58358 59467 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_44810 59482 60234 gene locus_tag LOCUS_44820 59482 60234 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_44820 60379 61257 gene locus_tag LOCUS_44830 60379 61257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 >Feature sequence28 596 243 gene locus_tag LOCUS_44840 596 243 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618816.1 protein_id gnl|my_center|LOCUS_44840 1522 620 gene locus_tag LOCUS_44850 1522 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 2304 1519 gene locus_tag LOCUS_44860 2304 1519 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350289.1 protein_id gnl|my_center|LOCUS_44860 3167 2346 gene locus_tag LOCUS_44870 3167 2346 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786111.1 protein_id gnl|my_center|LOCUS_44870 3940 3164 gene locus_tag LOCUS_44880 3940 3164 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350289.1 protein_id gnl|my_center|LOCUS_44880 5183 4035 gene locus_tag LOCUS_44890 5183 4035 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887268.1 protein_id gnl|my_center|LOCUS_44890 6502 5312 gene locus_tag LOCUS_44900 6502 5312 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027551.1 protein_id gnl|my_center|LOCUS_44900 8097 6664 gene locus_tag LOCUS_44910 gene xylB 8097 6664 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_44910 9448 8276 gene locus_tag LOCUS_44920 gene xylA 9448 8276 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977662.1 protein_id gnl|my_center|LOCUS_44920 10175 11215 gene locus_tag LOCUS_44930 gene xylF 10175 11215 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535546.1 protein_id gnl|my_center|LOCUS_44930 11437 12651 gene locus_tag LOCUS_44940 11437 12651 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315596.1 protein_id gnl|my_center|LOCUS_44940 12654 13400 gene locus_tag LOCUS_44950 12654 13400 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529276.1 protein_id gnl|my_center|LOCUS_44950 14073 13444 gene locus_tag LOCUS_44960 14073 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 15053 14121 gene locus_tag LOCUS_44970 15053 14121 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523300.1 protein_id gnl|my_center|LOCUS_44970 15245 16681 gene locus_tag LOCUS_44980 15245 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 18213 16924 gene locus_tag LOCUS_44990 18213 16924 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095195.1 protein_id gnl|my_center|LOCUS_44990 18283 18516 gene locus_tag LOCUS_45000 18283 18516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 18579 20315 gene locus_tag LOCUS_45010 18579 20315 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618866.1 protein_id gnl|my_center|LOCUS_45010 20482 21879 gene locus_tag LOCUS_45020 20482 21879 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889272.1 protein_id gnl|my_center|LOCUS_45020 21946 22419 gene locus_tag LOCUS_45030 21946 22419 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480322.1 protein_id gnl|my_center|LOCUS_45030 22601 23116 gene locus_tag LOCUS_45040 22601 23116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 23330 25579 gene locus_tag LOCUS_45050 23330 25579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 25576 26004 gene locus_tag LOCUS_45060 25576 26004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 26001 26465 gene locus_tag LOCUS_45070 26001 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 26462 27268 gene locus_tag LOCUS_45080 26462 27268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 27361 28803 gene locus_tag LOCUS_45090 27361 28803 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889218.1 protein_id gnl|my_center|LOCUS_45090 28931 29710 gene locus_tag LOCUS_45100 28931 29710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 29775 30980 gene locus_tag LOCUS_45110 29775 30980 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889017.1 protein_id gnl|my_center|LOCUS_45110 31312 32859 gene locus_tag LOCUS_45120 31312 32859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_45120 32856 33974 gene locus_tag LOCUS_45130 32856 33974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228581.1 protein_id gnl|my_center|LOCUS_45130 33964 34890 gene locus_tag LOCUS_45140 33964 34890 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_45140 35080 36222 gene locus_tag LOCUS_45150 35080 36222 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_45150 36466 37035 gene locus_tag LOCUS_45160 gene xpt 36466 37035 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_45160 37090 38088 gene locus_tag LOCUS_45170 37090 38088 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_45170 38085 38969 gene locus_tag LOCUS_45180 38085 38969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 39015 39809 gene locus_tag LOCUS_45190 39015 39809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 40120 40824 gene locus_tag LOCUS_45200 40120 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 41340 40891 gene locus_tag LOCUS_45210 41340 40891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45210 42458 41571 gene locus_tag LOCUS_45220 42458 41571 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528984.1 protein_id gnl|my_center|LOCUS_45220 43335 42451 gene locus_tag LOCUS_45230 43335 42451 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_45230 44775 43558 gene locus_tag LOCUS_45240 44775 43558 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_45240 45506 46924 gene locus_tag LOCUS_45250 gene rimO 45506 46924 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889448.1 protein_id gnl|my_center|LOCUS_45250 47026 47526 gene locus_tag LOCUS_45260 47026 47526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 47772 47999 gene locus_tag LOCUS_45270 47772 47999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 48289 49215 gene locus_tag LOCUS_45280 48289 49215 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889201.1 protein_id gnl|my_center|LOCUS_45280 50412 49279 gene locus_tag LOCUS_45290 50412 49279 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228602.1 protein_id gnl|my_center|LOCUS_45290 51784 50606 gene locus_tag LOCUS_45300 51784 50606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 53156 51825 gene locus_tag LOCUS_45310 53156 51825 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_45310 >Feature sequence29 499 1605 gene locus_tag LOCUS_45320 gene menC 499 1605 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_45320 1602 2378 gene locus_tag LOCUS_45330 1602 2378 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 protein_id gnl|my_center|LOCUS_45330 2469 2972 gene locus_tag LOCUS_45340 2469 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 3081 3926 gene locus_tag LOCUS_45350 3081 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45350 3983 5146 gene locus_tag LOCUS_45360 3983 5146 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_45360 5318 8092 gene locus_tag LOCUS_45370 5318 8092 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886932.1 protein_id gnl|my_center|LOCUS_45370 8188 9417 gene locus_tag LOCUS_45380 gene odhB 8188 9417 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886731.1 protein_id gnl|my_center|LOCUS_45380 9558 10964 gene locus_tag LOCUS_45390 gene lpdA 9558 10964 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480111.1 protein_id gnl|my_center|LOCUS_45390 11389 11060 gene locus_tag LOCUS_45400 11389 11060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45400 11463 11987 gene locus_tag LOCUS_45410 11463 11987 CDS product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888792.1 protein_id gnl|my_center|LOCUS_45410 12547 12041 gene locus_tag LOCUS_45420 12547 12041 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_45420 12939 13430 gene locus_tag LOCUS_45430 12939 13430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119628.1 protein_id gnl|my_center|LOCUS_45430 13439 16195 gene locus_tag LOCUS_45440 13439 16195 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229124.1 protein_id gnl|my_center|LOCUS_45440 16276 19026 gene locus_tag LOCUS_45450 16276 19026 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093006538.1 protein_id gnl|my_center|LOCUS_45450 19023 24143 gene locus_tag LOCUS_45460 19023 24143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 24140 29077 gene locus_tag LOCUS_45470 24140 29077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 30270 29272 gene locus_tag LOCUS_45480 30270 29272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 30438 31055 gene locus_tag LOCUS_45490 30438 31055 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173744.1 protein_id gnl|my_center|LOCUS_45490 31819 31076 gene locus_tag LOCUS_45500 gene irrE 31819 31076 CDS product metallo-endopeptidase IrrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886813.1 protein_id gnl|my_center|LOCUS_45500 33253 31820 gene locus_tag LOCUS_45510 33253 31820 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869246.1 protein_id gnl|my_center|LOCUS_45510 34023 33256 gene locus_tag LOCUS_45520 34023 33256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45520 34748 34134 gene locus_tag LOCUS_45530 34748 34134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 35659 34943 gene locus_tag LOCUS_45540 35659 34943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 35928 38930 gene locus_tag LOCUS_45550 35928 38930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887844.1 protein_id gnl|my_center|LOCUS_45550 39050 39493 gene locus_tag LOCUS_45560 39050 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 39490 41304 gene locus_tag LOCUS_45570 39490 41304 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909408.1 protein_id gnl|my_center|LOCUS_45570 41721 41377 gene locus_tag LOCUS_45580 41721 41377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 42416 41790 gene locus_tag LOCUS_45590 gene sodA 42416 41790 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_45590 43155 42631 gene locus_tag LOCUS_45600 43155 42631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 44214 43270 gene locus_tag LOCUS_45610 44214 43270 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351104.1 protein_id gnl|my_center|LOCUS_45610 45081 44215 gene locus_tag LOCUS_45620 gene hslO 45081 44215 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479663.1 protein_id gnl|my_center|LOCUS_45620 45545 48136 gene locus_tag LOCUS_45630 45545 48136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45630 50676 48307 gene locus_tag LOCUS_45640 gene glgX 50676 48307 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224463.1 protein_id gnl|my_center|LOCUS_45640 >Feature sequence30 1526 771 gene locus_tag LOCUS_45650 1526 771 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027419.1 protein_id gnl|my_center|LOCUS_45650 1657 2274 gene locus_tag LOCUS_45660 1657 2274 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974024.1 protein_id gnl|my_center|LOCUS_45660 3218 2358 gene locus_tag LOCUS_45670 3218 2358 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 protein_id gnl|my_center|LOCUS_45670 4153 3233 gene locus_tag LOCUS_45680 4153 3233 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618829.1 protein_id gnl|my_center|LOCUS_45680 5512 4223 gene locus_tag LOCUS_45690 5512 4223 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888077.1 protein_id gnl|my_center|LOCUS_45690 5806 8094 gene locus_tag LOCUS_45700 5806 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 8444 10072 gene locus_tag LOCUS_45710 8444 10072 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146756.1 protein_id gnl|my_center|LOCUS_45710 10211 11200 gene locus_tag LOCUS_45720 10211 11200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230099.1 protein_id gnl|my_center|LOCUS_45720 11197 13077 gene locus_tag LOCUS_45730 11197 13077 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225594.1 protein_id gnl|my_center|LOCUS_45730 13055 14074 gene locus_tag LOCUS_45740 13055 14074 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706886.1 protein_id gnl|my_center|LOCUS_45740 14322 15521 gene locus_tag LOCUS_45750 14322 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45750 15669 15887 gene locus_tag LOCUS_45760 15669 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 16382 15798 gene locus_tag LOCUS_45770 16382 15798 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973718.1 protein_id gnl|my_center|LOCUS_45770 16453 17037 gene locus_tag LOCUS_45780 16453 17037 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224147.1 protein_id gnl|my_center|LOCUS_45780 17750 17127 gene locus_tag LOCUS_45790 17750 17127 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_45790 18133 20382 gene locus_tag LOCUS_45800 gene pflB 18133 20382 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390748.1 protein_id gnl|my_center|LOCUS_45800 20398 21138 gene locus_tag LOCUS_45810 gene pflA 20398 21138 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390747.1 protein_id gnl|my_center|LOCUS_45810 21353 22327 gene locus_tag LOCUS_45820 21353 22327 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_45820 22782 24248 gene locus_tag LOCUS_45830 22782 24248 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889170.1 protein_id gnl|my_center|LOCUS_45830 26393 24330 gene locus_tag LOCUS_45840 gene glyS 26393 24330 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_45840 27298 26390 gene locus_tag LOCUS_45850 gene glyQ 27298 26390 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460838.1 protein_id gnl|my_center|LOCUS_45850 27854 27603 gene locus_tag LOCUS_45860 27854 27603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 28394 28125 gene locus_tag LOCUS_45870 28394 28125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 28910 28491 gene locus_tag LOCUS_45880 28910 28491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 29434 28910 gene locus_tag LOCUS_45890 29434 28910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 29848 30783 gene locus_tag LOCUS_45900 29848 30783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 30895 31410 gene locus_tag LOCUS_45910 30895 31410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 31504 31890 gene locus_tag LOCUS_45920 31504 31890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 32146 32589 gene locus_tag LOCUS_45930 32146 32589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 33777 32707 gene locus_tag LOCUS_45940 33777 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 34568 33882 gene locus_tag LOCUS_45950 34568 33882 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705233.1 protein_id gnl|my_center|LOCUS_45950 34596 35765 gene locus_tag LOCUS_45960 34596 35765 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223768.1 protein_id gnl|my_center|LOCUS_45960 36253 35780 gene locus_tag LOCUS_45970 36253 35780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 36575 37999 gene locus_tag LOCUS_45980 36575 37999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 38156 38377 gene locus_tag LOCUS_45990 38156 38377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 38468 41104 gene locus_tag LOCUS_46000 38468 41104 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141113.1 protein_id gnl|my_center|LOCUS_46000 42372 41164 gene locus_tag LOCUS_46010 42372 41164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 42660 44915 gene locus_tag LOCUS_46020 42660 44915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 47223 45013 gene locus_tag LOCUS_46030 47223 45013 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227076.1 protein_id gnl|my_center|LOCUS_46030 47588 48631 gene locus_tag LOCUS_46040 47588 48631 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920175.1 protein_id gnl|my_center|LOCUS_46040 49217 48939 gene locus_tag LOCUS_46050 49217 48939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 >Feature sequence31 978 2867 gene locus_tag LOCUS_46060 gene dnaK 978 2867 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886777.1 protein_id gnl|my_center|LOCUS_46060 2976 3557 gene locus_tag LOCUS_46070 2976 3557 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138697.1 protein_id gnl|my_center|LOCUS_46070 3671 4567 gene locus_tag LOCUS_46080 3671 4567 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886774.1 protein_id gnl|my_center|LOCUS_46080 4763 5599 gene locus_tag LOCUS_46090 4763 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 6468 5854 gene locus_tag LOCUS_46100 6468 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 7948 6482 gene locus_tag LOCUS_46110 7948 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140440.1 protein_id gnl|my_center|LOCUS_46110 8822 7920 gene locus_tag LOCUS_46120 8822 7920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837952.1 protein_id gnl|my_center|LOCUS_46120 9487 8798 gene locus_tag LOCUS_46130 9487 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 10289 9480 gene locus_tag LOCUS_46140 10289 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 11206 10286 gene locus_tag LOCUS_46150 11206 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 13913 11190 gene locus_tag LOCUS_46160 13913 11190 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479509.1 protein_id gnl|my_center|LOCUS_46160 14861 14091 gene locus_tag LOCUS_46170 14861 14091 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074964179.1 protein_id gnl|my_center|LOCUS_46170 15777 14854 gene locus_tag LOCUS_46180 15777 14854 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173018.1 protein_id gnl|my_center|LOCUS_46180 16062 15907 gene locus_tag LOCUS_46190 16062 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 16304 16149 gene locus_tag LOCUS_46200 16304 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 16536 16381 gene locus_tag LOCUS_46210 16536 16381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 16717 16556 gene locus_tag LOCUS_46220 16717 16556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 17477 20314 gene locus_tag LOCUS_46230 17477 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 20768 20463 gene locus_tag LOCUS_46240 20768 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 20937 20776 gene locus_tag LOCUS_46250 20937 20776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 22196 21021 gene locus_tag LOCUS_46260 22196 21021 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_46260 22502 23269 gene locus_tag LOCUS_46270 22502 23269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46270 23262 23915 gene locus_tag LOCUS_46280 23262 23915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 23925 24677 gene locus_tag LOCUS_46290 23925 24677 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_46290 24674 25921 gene locus_tag LOCUS_46300 24674 25921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229018.1 protein_id gnl|my_center|LOCUS_46300 26735 25959 gene locus_tag LOCUS_46310 26735 25959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 27415 26735 gene locus_tag LOCUS_46320 27415 26735 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887334.1 protein_id gnl|my_center|LOCUS_46320 27933 27493 gene locus_tag LOCUS_46330 27933 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 30137 27930 gene locus_tag LOCUS_46340 30137 27930 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_46340 30802 30140 gene locus_tag LOCUS_46350 30802 30140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 31332 30880 gene locus_tag LOCUS_46360 31332 30880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 31728 31360 gene locus_tag LOCUS_46370 31728 31360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 32807 31728 gene locus_tag LOCUS_46380 32807 31728 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_46380 34272 32809 gene locus_tag LOCUS_46390 34272 32809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 35582 34269 gene locus_tag LOCUS_46400 35582 34269 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086850841.1 protein_id gnl|my_center|LOCUS_46400 35681 36622 gene locus_tag LOCUS_46410 35681 36622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 36820 39375 gene locus_tag LOCUS_46420 gene clpB 36820 39375 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479647.1 protein_id gnl|my_center|LOCUS_46420 39673 40857 gene locus_tag LOCUS_46430 39673 40857 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869357.1 protein_id gnl|my_center|LOCUS_46430 41676 40972 gene locus_tag LOCUS_46440 41676 40972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46440 43851 41833 gene locus_tag LOCUS_46450 43851 41833 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349512.1 protein_id gnl|my_center|LOCUS_46450 44323 44523 gene locus_tag LOCUS_46460 44323 44523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46460 44984 44574 gene locus_tag LOCUS_46470 44984 44574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 45202 45867 gene locus_tag LOCUS_46480 45202 45867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46480 45894 46355 gene locus_tag LOCUS_46490 45894 46355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 >Feature sequence32 679 1665 gene locus_tag LOCUS_46500 679 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 1680 2057 gene locus_tag LOCUS_46510 1680 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 4131 2110 gene locus_tag LOCUS_46520 gene brxL 4131 2110 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_46520 6692 4152 gene locus_tag LOCUS_46530 gene pglZ 6692 4152 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_46530 7232 6711 gene locus_tag LOCUS_46540 7232 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038870.1 protein_id gnl|my_center|LOCUS_46540 7863 7210 gene locus_tag LOCUS_46550 7863 7210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 8506 8249 gene locus_tag LOCUS_46560 8506 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 9163 8681 gene locus_tag LOCUS_46570 9163 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46570 9701 9165 gene locus_tag LOCUS_46580 9701 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46580 10183 9698 gene locus_tag LOCUS_46590 10183 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 14027 10383 gene locus_tag LOCUS_46600 gene pglX 14027 10383 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_46600 17751 14191 gene locus_tag LOCUS_46610 gene brxC 17751 14191 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_46610 18438 17854 gene locus_tag LOCUS_46620 18438 17854 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_46620 18995 18435 gene locus_tag LOCUS_46630 18995 18435 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_46630 19662 19096 gene locus_tag LOCUS_46640 19662 19096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 20315 20025 gene locus_tag LOCUS_46650 20315 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 20223 21095 gene locus_tag LOCUS_46660 20223 21095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 21528 21989 gene locus_tag LOCUS_46670 21528 21989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 23396 23557 gene locus_tag LOCUS_46680 23396 23557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 24248 23910 gene locus_tag LOCUS_46690 24248 23910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 24305 25948 gene locus_tag LOCUS_46700 24305 25948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 26568 26233 gene locus_tag LOCUS_46710 26568 26233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 27028 27207 gene locus_tag LOCUS_46720 27028 27207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 27286 27648 gene locus_tag LOCUS_46730 27286 27648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 27712 27933 gene locus_tag LOCUS_46740 27712 27933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 28686 28294 gene locus_tag LOCUS_46750 28686 28294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 29703 28783 gene locus_tag LOCUS_46760 29703 28783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46760 29961 30338 gene locus_tag LOCUS_46770 29961 30338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46770 30331 30639 gene locus_tag LOCUS_46780 30331 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 30792 30935 gene locus_tag LOCUS_46790 30792 30935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 31302 30922 gene locus_tag LOCUS_46800 31302 30922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 31467 31315 gene locus_tag LOCUS_46810 31467 31315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 31526 31783 gene locus_tag LOCUS_46820 31526 31783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 33016 32264 gene locus_tag LOCUS_46830 33016 32264 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112560.1 protein_id gnl|my_center|LOCUS_46830 33288 33091 gene locus_tag LOCUS_46840 33288 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46840 33256 33492 gene locus_tag LOCUS_46850 33256 33492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 33630 33448 gene locus_tag LOCUS_46860 33630 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 33856 35535 gene locus_tag LOCUS_46870 33856 35535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 39080 35850 gene locus_tag LOCUS_46880 39080 35850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 40246 39077 gene locus_tag LOCUS_46890 40246 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 41712 40138 gene locus_tag LOCUS_46900 41712 40138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 43737 41731 gene locus_tag LOCUS_46910 43737 41731 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036269.1 protein_id gnl|my_center|LOCUS_46910 45260 43734 gene locus_tag LOCUS_46920 45260 43734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 45286 45648 gene locus_tag LOCUS_46930 45286 45648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46930 >Feature sequence33 676 978 gene locus_tag LOCUS_46940 676 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 1285 941 gene locus_tag LOCUS_46950 1285 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 1172 1462 gene locus_tag LOCUS_46960 1172 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 1450 1605 gene locus_tag LOCUS_46970 1450 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 2382 1708 gene locus_tag LOCUS_46980 2382 1708 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_46980 3094 2570 gene locus_tag LOCUS_46990 gene bcrC 3094 2570 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_46990 3661 3269 gene locus_tag LOCUS_47000 3661 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 4008 3751 gene locus_tag LOCUS_47010 4008 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 4516 5637 gene locus_tag LOCUS_47020 4516 5637 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887733.1 protein_id gnl|my_center|LOCUS_47020 6112 5756 gene locus_tag LOCUS_47030 6112 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47030 6216 6512 gene locus_tag LOCUS_47040 6216 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 6904 8682 gene locus_tag LOCUS_47050 6904 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47050 8598 9818 gene locus_tag LOCUS_47060 8598 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 10241 11092 gene locus_tag LOCUS_47070 10241 11092 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_47070 11257 12216 gene locus_tag LOCUS_47080 11257 12216 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958087.1 protein_id gnl|my_center|LOCUS_47080 12618 12250 gene locus_tag LOCUS_47090 12618 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 13235 12849 gene locus_tag LOCUS_47100 13235 12849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 13377 13592 gene locus_tag LOCUS_47110 13377 13592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 13596 13892 gene locus_tag LOCUS_47120 13596 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 13934 14326 gene locus_tag LOCUS_47130 13934 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_47130 14947 14600 gene locus_tag LOCUS_47140 14947 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 15029 15166 gene locus_tag LOCUS_47150 15029 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 15242 15751 gene locus_tag LOCUS_47160 15242 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 17136 16204 gene locus_tag LOCUS_47170 17136 16204 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 protein_id gnl|my_center|LOCUS_47170 17255 17980 gene locus_tag LOCUS_47180 17255 17980 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223216.1 protein_id gnl|my_center|LOCUS_47180 17977 18855 gene locus_tag LOCUS_47190 17977 18855 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_47190 19036 20868 gene locus_tag LOCUS_47200 19036 20868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47200 20881 22056 gene locus_tag LOCUS_47210 20881 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47210 22612 22109 gene locus_tag LOCUS_47220 22612 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47220 22833 22609 gene locus_tag LOCUS_47230 22833 22609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 22917 23351 gene locus_tag LOCUS_47240 22917 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 23783 23526 gene locus_tag LOCUS_47250 23783 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 24145 23876 gene locus_tag LOCUS_47260 24145 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47260 24654 24334 gene locus_tag LOCUS_47270 24654 24334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47270 25264 24890 gene locus_tag LOCUS_47280 25264 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 25768 25388 gene locus_tag LOCUS_47290 25768 25388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 26134 25889 gene locus_tag LOCUS_47300 26134 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 28291 26543 gene locus_tag LOCUS_47310 28291 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 29286 28369 gene locus_tag LOCUS_47320 29286 28369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 29489 29283 gene locus_tag LOCUS_47330 29489 29283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 31045 30149 gene locus_tag LOCUS_47340 31045 30149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 31521 31105 gene locus_tag LOCUS_47350 31521 31105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 32131 31880 gene locus_tag LOCUS_47360 32131 31880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 32469 32128 gene locus_tag LOCUS_47370 32469 32128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 33078 32533 gene locus_tag LOCUS_47380 33078 32533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 33837 33445 gene locus_tag LOCUS_47390 33837 33445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47390 34859 33954 gene locus_tag LOCUS_47400 34859 33954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 35990 35511 gene locus_tag LOCUS_47410 35990 35511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 36381 35974 gene locus_tag LOCUS_47420 36381 35974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 37500 37069 gene locus_tag LOCUS_47430 37500 37069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 38425 37559 gene locus_tag LOCUS_47440 38425 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 39297 38854 gene locus_tag LOCUS_47450 39297 38854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 39589 39350 gene locus_tag LOCUS_47460 39589 39350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 40050 39676 gene locus_tag LOCUS_47470 40050 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 40217 40047 gene locus_tag LOCUS_47480 40217 40047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 41418 40882 gene locus_tag LOCUS_47490 41418 40882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 42119 41538 gene locus_tag LOCUS_47500 42119 41538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 42736 42116 gene locus_tag LOCUS_47510 42736 42116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47510 43239 42733 gene locus_tag LOCUS_47520 43239 42733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 43709 43236 gene locus_tag LOCUS_47530 43709 43236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47530 44048 43716 gene locus_tag LOCUS_47540 44048 43716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 44418 44089 gene locus_tag LOCUS_47550 44418 44089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 44834 44643 gene locus_tag LOCUS_47560 44834 44643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 45508 44909 gene locus_tag LOCUS_47570 45508 44909 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_47570 >Feature sequence34 253 71 gene locus_tag LOCUS_47580 253 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 316 1392 gene locus_tag LOCUS_47590 316 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 1385 1957 gene locus_tag LOCUS_47600 1385 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 1933 2238 gene locus_tag LOCUS_47610 1933 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 2214 2465 gene locus_tag LOCUS_47620 2214 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 2589 3836 gene locus_tag LOCUS_47630 2589 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47630 3833 4381 gene locus_tag LOCUS_47640 3833 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 4378 6336 gene locus_tag LOCUS_47650 4378 6336 CDS product DUF3732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461946.1 protein_id gnl|my_center|LOCUS_47650 7288 6470 gene locus_tag LOCUS_47660 gene rhaD 7288 6470 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_47660 8182 7412 gene locus_tag LOCUS_47670 8182 7412 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_47670 8389 9192 gene locus_tag LOCUS_47680 8389 9192 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355560.1 protein_id gnl|my_center|LOCUS_47680 9205 10389 gene locus_tag LOCUS_47690 gene rhaI 9205 10389 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027369.1 protein_id gnl|my_center|LOCUS_47690 10440 12500 gene locus_tag LOCUS_47700 10440 12500 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_47700 12490 13905 gene locus_tag LOCUS_47710 12490 13905 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_47710 13968 14711 gene locus_tag LOCUS_47720 13968 14711 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_47720 14708 16123 gene locus_tag LOCUS_47730 14708 16123 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_47730 16120 16731 gene locus_tag LOCUS_47740 16120 16731 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888544.1 protein_id gnl|my_center|LOCUS_47740 18544 16862 gene locus_tag LOCUS_47750 18544 16862 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383260.1 protein_id gnl|my_center|LOCUS_47750 21432 18574 gene locus_tag LOCUS_47760 21432 18574 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_47760 22321 21455 gene locus_tag LOCUS_47770 22321 21455 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_47770 23259 22318 gene locus_tag LOCUS_47780 23259 22318 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582771.1 protein_id gnl|my_center|LOCUS_47780 24737 23307 gene locus_tag LOCUS_47790 24737 23307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 25973 24774 gene locus_tag LOCUS_47800 25973 24774 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528101.1 protein_id gnl|my_center|LOCUS_47800 28067 26175 gene locus_tag LOCUS_47810 28067 26175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 29399 28182 gene locus_tag LOCUS_47820 29399 28182 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733138.1 protein_id gnl|my_center|LOCUS_47820 29756 31012 gene locus_tag LOCUS_47830 29756 31012 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256270.1 protein_id gnl|my_center|LOCUS_47830 31100 31984 gene locus_tag LOCUS_47840 31100 31984 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_47840 31987 32886 gene locus_tag LOCUS_47850 31987 32886 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_47850 32898 35711 gene locus_tag LOCUS_47860 32898 35711 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_47860 35876 36442 gene locus_tag LOCUS_47870 35876 36442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 41962 36965 gene locus_tag LOCUS_47880 41962 36965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 43074 42274 gene locus_tag LOCUS_47890 43074 42274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 43859 43071 gene locus_tag LOCUS_47900 43859 43071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence35 3425 318 gene locus_tag LOCUS_47910 3425 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47910 5981 3741 gene locus_tag LOCUS_47920 5981 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 6817 5978 gene locus_tag LOCUS_47930 6817 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 7109 9664 gene locus_tag LOCUS_47940 7109 9664 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886713.1 protein_id gnl|my_center|LOCUS_47940 9746 13591 gene locus_tag LOCUS_47950 9746 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47950 13723 14466 gene locus_tag LOCUS_47960 13723 14466 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350944.1 protein_id gnl|my_center|LOCUS_47960 14463 14906 gene locus_tag LOCUS_47970 gene nrdR 14463 14906 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886735.1 protein_id gnl|my_center|LOCUS_47970 15005 15190 gene locus_tag LOCUS_47980 15005 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 15311 16465 gene locus_tag LOCUS_47990 15311 16465 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228566.1 protein_id gnl|my_center|LOCUS_47990 16650 16883 gene locus_tag LOCUS_48000 16650 16883 CDS product DUF3248 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888640.1 protein_id gnl|my_center|LOCUS_48000 16967 17431 gene locus_tag LOCUS_48010 16967 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 17648 20407 gene locus_tag LOCUS_48020 17648 20407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48020 20683 21609 gene locus_tag LOCUS_48030 20683 21609 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026138770.1 protein_id gnl|my_center|LOCUS_48030 22230 21586 gene locus_tag LOCUS_48040 22230 21586 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480266.1 protein_id gnl|my_center|LOCUS_48040 22521 24038 gene locus_tag LOCUS_48050 22521 24038 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889445.1 protein_id gnl|my_center|LOCUS_48050 24058 24393 gene locus_tag LOCUS_48060 24058 24393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 26590 24425 gene locus_tag LOCUS_48070 26590 24425 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889593.1 protein_id gnl|my_center|LOCUS_48070 27387 26593 gene locus_tag LOCUS_48080 27387 26593 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889592.1 protein_id gnl|my_center|LOCUS_48080 28686 27538 gene locus_tag LOCUS_48090 28686 27538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 30160 28781 gene locus_tag LOCUS_48100 30160 28781 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480136.1 protein_id gnl|my_center|LOCUS_48100 31034 30324 gene locus_tag LOCUS_48110 31034 30324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 31192 31512 gene locus_tag LOCUS_48120 31192 31512 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888587.1 protein_id gnl|my_center|LOCUS_48120 31516 32538 gene locus_tag LOCUS_48130 31516 32538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 32643 33692 gene locus_tag LOCUS_48140 32643 33692 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538117.1 protein_id gnl|my_center|LOCUS_48140 34950 33748 gene locus_tag LOCUS_48150 34950 33748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 36543 35377 gene locus_tag LOCUS_48160 36543 35377 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479659.1 protein_id gnl|my_center|LOCUS_48160 37841 36798 gene locus_tag LOCUS_48170 37841 36798 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525183.1 protein_id gnl|my_center|LOCUS_48170 37961 38593 gene locus_tag LOCUS_48180 37961 38593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48180 40295 38730 gene locus_tag LOCUS_48190 gene serA 40295 38730 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887934.1 protein_id gnl|my_center|LOCUS_48190 >Feature sequence36 212 75 gene locus_tag LOCUS_48200 212 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 1590 376 gene locus_tag LOCUS_48210 1590 376 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_48210 1800 2837 gene locus_tag LOCUS_48220 1800 2837 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100703.1 protein_id gnl|my_center|LOCUS_48220 3902 2847 gene locus_tag LOCUS_48230 3902 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016656.1 protein_id gnl|my_center|LOCUS_48230 5379 3889 gene locus_tag LOCUS_48240 5379 3889 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138556.1 protein_id gnl|my_center|LOCUS_48240 6364 5609 gene locus_tag LOCUS_48250 6364 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48250 6607 6900 gene locus_tag LOCUS_48260 6607 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48260 6900 7241 gene locus_tag LOCUS_48270 6900 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 7248 7484 gene locus_tag LOCUS_48280 7248 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48280 7533 8819 gene locus_tag LOCUS_48290 7533 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 8816 9091 gene locus_tag LOCUS_48300 8816 9091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48300 9088 9288 gene locus_tag LOCUS_48310 9088 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 9447 9857 gene locus_tag LOCUS_48320 9447 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 9854 10225 gene locus_tag LOCUS_48330 9854 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 10276 10620 gene locus_tag LOCUS_48340 10276 10620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 11349 10645 gene locus_tag LOCUS_48350 11349 10645 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819716.1 protein_id gnl|my_center|LOCUS_48350 11503 11799 gene locus_tag LOCUS_48360 11503 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 11800 12276 gene locus_tag LOCUS_48370 11800 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 12273 12638 gene locus_tag LOCUS_48380 12273 12638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 12631 13143 gene locus_tag LOCUS_48390 12631 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 13157 13735 gene locus_tag LOCUS_48400 13157 13735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 13732 13878 gene locus_tag LOCUS_48410 13732 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 13878 14621 gene locus_tag LOCUS_48420 13878 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 14633 14770 gene locus_tag LOCUS_48430 14633 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 14780 15178 gene locus_tag LOCUS_48440 14780 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 15193 15681 gene locus_tag LOCUS_48450 15193 15681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48450 15696 16469 gene locus_tag LOCUS_48460 15696 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 16481 16720 gene locus_tag LOCUS_48470 16481 16720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 16720 16989 gene locus_tag LOCUS_48480 16720 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 16991 17815 gene locus_tag LOCUS_48490 16991 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 17826 18242 gene locus_tag LOCUS_48500 17826 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48500 18245 18415 gene locus_tag LOCUS_48510 18245 18415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 18415 18603 gene locus_tag LOCUS_48520 18415 18603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 18603 19088 gene locus_tag LOCUS_48530 18603 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 19100 20068 gene locus_tag LOCUS_48540 19100 20068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 20059 21048 gene locus_tag LOCUS_48550 20059 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 21048 21299 gene locus_tag LOCUS_48560 21048 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 21296 21565 gene locus_tag LOCUS_48570 21296 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 21547 22263 gene locus_tag LOCUS_48580 21547 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48580 23057 22455 gene locus_tag LOCUS_48590 23057 22455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48590 23316 23241 gene locus_tag LOCUS_t00560 23316 23241 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 23670 23813 gene locus_tag LOCUS_48600 23670 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48600 23991 24299 gene locus_tag LOCUS_48610 23991 24299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 24341 24688 gene locus_tag LOCUS_48620 24341 24688 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480298.1 protein_id gnl|my_center|LOCUS_48620 25973 24705 gene locus_tag LOCUS_48630 25973 24705 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729439.1 protein_id gnl|my_center|LOCUS_48630 26752 26081 gene locus_tag LOCUS_48640 26752 26081 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888011.1 protein_id gnl|my_center|LOCUS_48640 27726 26809 gene locus_tag LOCUS_48650 27726 26809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 29845 27944 gene locus_tag LOCUS_48660 29845 27944 CDS product DUF4900 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229178.1 protein_id gnl|my_center|LOCUS_48660 30720 29842 gene locus_tag LOCUS_48670 30720 29842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 31157 30720 gene locus_tag LOCUS_48680 31157 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 31558 31157 gene locus_tag LOCUS_48690 31558 31157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 32258 32701 gene locus_tag LOCUS_48700 32258 32701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 32765 33916 gene locus_tag LOCUS_48710 32765 33916 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480033.1 protein_id gnl|my_center|LOCUS_48710 35415 34024 gene locus_tag LOCUS_48720 35415 34024 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_48720 36585 35443 gene locus_tag LOCUS_48730 36585 35443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 36980 36597 gene locus_tag LOCUS_48740 36980 36597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 38460 37108 gene locus_tag LOCUS_48750 gene miaB 38460 37108 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479611.1 protein_id gnl|my_center|LOCUS_48750 39044 38568 gene locus_tag LOCUS_48760 39044 38568 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903451.1 protein_id gnl|my_center|LOCUS_48760 >Feature sequence37 161 1678 gene locus_tag LOCUS_48770 161 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 2428 1736 gene locus_tag LOCUS_48780 2428 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48780 2691 2422 gene locus_tag LOCUS_48790 2691 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_48790 2781 2936 gene locus_tag LOCUS_48800 2781 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 3477 5129 gene locus_tag LOCUS_48810 gene ltrA 3477 5129 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_48810 5137 5358 gene locus_tag LOCUS_48820 5137 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 5361 6215 gene locus_tag LOCUS_48830 5361 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 6849 6523 gene locus_tag LOCUS_48840 6849 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48840 7959 7267 gene locus_tag LOCUS_48850 7959 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 9008 9412 gene locus_tag LOCUS_48860 9008 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 11322 9862 gene locus_tag LOCUS_48870 11322 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 11770 16572 gene locus_tag LOCUS_48880 11770 16572 CDS product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889426.1 protein_id gnl|my_center|LOCUS_48880 17733 17933 gene locus_tag LOCUS_48890 17733 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 18163 18366 gene locus_tag LOCUS_48900 18163 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 19505 18579 gene locus_tag LOCUS_48910 19505 18579 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_48910 19587 20024 gene locus_tag LOCUS_48920 19587 20024 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504168.1 protein_id gnl|my_center|LOCUS_48920 22276 20054 gene locus_tag LOCUS_48930 22276 20054 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731969.1 protein_id gnl|my_center|LOCUS_48930 23209 22352 gene locus_tag LOCUS_48940 23209 22352 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227372.1 protein_id gnl|my_center|LOCUS_48940 23497 24483 gene locus_tag LOCUS_48950 23497 24483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 24480 25304 gene locus_tag LOCUS_48960 24480 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 25426 26439 gene locus_tag LOCUS_48970 25426 26439 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921545.1 protein_id gnl|my_center|LOCUS_48970 26742 28634 gene locus_tag LOCUS_48980 26742 28634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 28768 30972 gene locus_tag LOCUS_48990 28768 30972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 32928 31045 gene locus_tag LOCUS_49000 32928 31045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 33062 33241 gene locus_tag LOCUS_49010 33062 33241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 34389 33301 gene locus_tag LOCUS_49020 34389 33301 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 protein_id gnl|my_center|LOCUS_49020 35973 34627 gene locus_tag LOCUS_49030 35973 34627 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457391.1 protein_id gnl|my_center|LOCUS_49030 >Feature sequence38 1172 171 gene locus_tag LOCUS_49040 gene gap 1172 171 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228284.1 protein_id gnl|my_center|LOCUS_49040 1918 1169 gene locus_tag LOCUS_49050 1918 1169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029963.1 protein_id gnl|my_center|LOCUS_49050 1868 2032 gene locus_tag LOCUS_49060 1868 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49060 2097 2693 gene locus_tag LOCUS_49070 2097 2693 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222344.1 protein_id gnl|my_center|LOCUS_49070 3072 3284 gene locus_tag LOCUS_49080 3072 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 4821 3415 gene locus_tag LOCUS_49090 4821 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 5095 5664 gene locus_tag LOCUS_49100 5095 5664 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_49100 5863 5684 gene locus_tag LOCUS_49110 5863 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 6005 6193 gene locus_tag LOCUS_49120 6005 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 7179 6199 gene locus_tag LOCUS_49130 gene axeA 7179 6199 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_49130 8351 7248 gene locus_tag LOCUS_49140 8351 7248 CDS product twin-arginine translocation signal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027255.1 protein_id gnl|my_center|LOCUS_49140 8785 9786 gene locus_tag LOCUS_49150 8785 9786 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_49150 9893 11170 gene locus_tag LOCUS_49160 9893 11170 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_49160 11206 12123 gene locus_tag LOCUS_49170 11206 12123 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973684.1 protein_id gnl|my_center|LOCUS_49170 12113 12976 gene locus_tag LOCUS_49180 12113 12976 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973683.1 protein_id gnl|my_center|LOCUS_49180 13160 14773 gene locus_tag LOCUS_49190 13160 14773 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_49190 14896 15447 gene locus_tag LOCUS_49200 14896 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 17554 15860 gene locus_tag LOCUS_49210 17554 15860 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_49210 18396 17626 gene locus_tag LOCUS_49220 18396 17626 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909235.1 protein_id gnl|my_center|LOCUS_49220 18531 19547 gene locus_tag LOCUS_49230 18531 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 20881 19559 gene locus_tag LOCUS_49240 20881 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 21115 23073 gene locus_tag LOCUS_49250 21115 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 23605 25218 gene locus_tag LOCUS_49260 23605 25218 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_49260 25223 25600 gene locus_tag LOCUS_49270 25223 25600 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804105.1 protein_id gnl|my_center|LOCUS_49270 25593 26663 gene locus_tag LOCUS_49280 25593 26663 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_49280 27294 26740 gene locus_tag LOCUS_49290 27294 26740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 27389 27883 gene locus_tag LOCUS_49300 27389 27883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 27884 28117 gene locus_tag LOCUS_49310 27884 28117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 28222 28043 gene locus_tag LOCUS_49320 28222 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 28509 28390 gene locus_tag LOCUS_49330 28509 28390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 29107 30132 gene locus_tag LOCUS_49340 29107 30132 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_49340 31058 30186 gene locus_tag LOCUS_49350 31058 30186 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_49350 >Feature sequence39 297 458 gene locus_tag LOCUS_49360 297 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 3654 661 gene locus_tag LOCUS_49370 3654 661 CDS product Tn3-like element ISSod9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074356.1 protein_id gnl|my_center|LOCUS_49370 5097 3844 gene locus_tag LOCUS_49380 5097 3844 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_49380 6127 5165 gene locus_tag LOCUS_49390 6127 5165 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039809.1 protein_id gnl|my_center|LOCUS_49390 7223 6312 gene locus_tag LOCUS_49400 7223 6312 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464003.1 protein_id gnl|my_center|LOCUS_49400 7608 7255 gene locus_tag LOCUS_49410 7608 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49410 8046 7663 gene locus_tag LOCUS_49420 8046 7663 CDS product DUF2255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845058.1 protein_id gnl|my_center|LOCUS_49420 8256 8059 gene locus_tag LOCUS_49430 8256 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49430 8458 8240 gene locus_tag LOCUS_49440 8458 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49440 9547 8639 gene locus_tag LOCUS_49450 9547 8639 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777086.1 protein_id gnl|my_center|LOCUS_49450 10426 9584 gene locus_tag LOCUS_49460 10426 9584 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870364.1 protein_id gnl|my_center|LOCUS_49460 11256 10513 gene locus_tag LOCUS_49470 11256 10513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931125.1 protein_id gnl|my_center|LOCUS_49470 12932 11940 gene locus_tag LOCUS_49480 12932 11940 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_49480 14637 13540 gene locus_tag LOCUS_49490 gene gutB 14637 13540 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_49490 15625 14762 gene locus_tag LOCUS_49500 15625 14762 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530860.1 protein_id gnl|my_center|LOCUS_49500 16536 15622 gene locus_tag LOCUS_49510 16536 15622 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896978.1 protein_id gnl|my_center|LOCUS_49510 18139 16808 gene locus_tag LOCUS_49520 18139 16808 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197580.1 protein_id gnl|my_center|LOCUS_49520 18036 18269 gene locus_tag LOCUS_49530 18036 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49530 18354 19358 gene locus_tag LOCUS_49540 18354 19358 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_49540 20000 20836 gene locus_tag LOCUS_49550 20000 20836 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_49550 21063 21983 gene locus_tag LOCUS_49560 21063 21983 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_49560 22641 22090 gene locus_tag LOCUS_49570 22641 22090 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_49570 23706 22804 gene locus_tag LOCUS_49580 23706 22804 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_49580 24526 23741 gene locus_tag LOCUS_49590 24526 23741 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 protein_id gnl|my_center|LOCUS_49590 25552 24746 gene locus_tag LOCUS_49600 25552 24746 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887099.1 protein_id gnl|my_center|LOCUS_49600 26850 25546 gene locus_tag LOCUS_49610 26850 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 27515 26847 gene locus_tag LOCUS_49620 27515 26847 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479875.1 protein_id gnl|my_center|LOCUS_49620 27814 27659 gene locus_tag LOCUS_49630 27814 27659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49630 28179 28030 gene locus_tag LOCUS_49640 28179 28030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49640 29181 28486 gene locus_tag LOCUS_49650 29181 28486 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 protein_id gnl|my_center|LOCUS_49650 29361 30158 gene locus_tag LOCUS_49660 29361 30158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_49660 30274 30594 gene locus_tag LOCUS_49670 30274 30594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 >Feature sequence40 201 395 gene locus_tag LOCUS_49680 201 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 649 1434 gene locus_tag LOCUS_49690 649 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49690 1427 1723 gene locus_tag LOCUS_49700 1427 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 2682 1816 gene locus_tag LOCUS_49710 2682 1816 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530185.1 protein_id gnl|my_center|LOCUS_49710 3542 2679 gene locus_tag LOCUS_49720 3542 2679 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530184.1 protein_id gnl|my_center|LOCUS_49720 4871 3606 gene locus_tag LOCUS_49730 4871 3606 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530183.1 protein_id gnl|my_center|LOCUS_49730 6995 4956 gene locus_tag LOCUS_49740 6995 4956 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_49740 7482 8507 gene locus_tag LOCUS_49750 7482 8507 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263241.1 protein_id gnl|my_center|LOCUS_49750 8979 8557 gene locus_tag LOCUS_49760 8979 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 12282 9043 gene locus_tag LOCUS_49770 gene pulA 12282 9043 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082389.1 protein_id gnl|my_center|LOCUS_49770 14924 12561 gene locus_tag LOCUS_49780 gene glgX 14924 12561 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978922.1 protein_id gnl|my_center|LOCUS_49780 15533 15366 gene locus_tag LOCUS_49790 15533 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 17961 17392 gene locus_tag LOCUS_49800 17961 17392 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_49800 18567 18157 gene locus_tag LOCUS_49810 18567 18157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 19257 18886 gene locus_tag LOCUS_49820 19257 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 20763 19351 gene locus_tag LOCUS_49830 20763 19351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 20662 20859 gene locus_tag LOCUS_49840 20662 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 20878 21459 gene locus_tag LOCUS_49850 20878 21459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 22509 21655 gene locus_tag LOCUS_49860 22509 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49860 22799 22512 gene locus_tag LOCUS_49870 22799 22512 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546760.1 protein_id gnl|my_center|LOCUS_49870 22907 23341 gene locus_tag LOCUS_49880 22907 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 23338 23589 gene locus_tag LOCUS_49890 23338 23589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 24579 23842 gene locus_tag LOCUS_49900 24579 23842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 24685 24978 gene locus_tag LOCUS_49910 24685 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 27357 25159 gene locus_tag LOCUS_49920 27357 25159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 27700 27476 gene locus_tag LOCUS_49930 27700 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 27973 29085 gene locus_tag LOCUS_49940 27973 29085 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_49940 >Feature sequence41 204 130 gene locus_tag LOCUS_t00570 204 130 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 282 210 gene locus_tag LOCUS_t00580 282 210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 616 2001 gene locus_tag LOCUS_49950 616 2001 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479518.1 protein_id gnl|my_center|LOCUS_49950 2559 2059 gene locus_tag LOCUS_49960 2559 2059 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_49960 3427 2717 gene locus_tag LOCUS_49970 3427 2717 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887238.1 protein_id gnl|my_center|LOCUS_49970 3561 4301 gene locus_tag LOCUS_49980 3561 4301 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887221.1 protein_id gnl|my_center|LOCUS_49980 4446 6200 gene locus_tag LOCUS_49990 4446 6200 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025567123.1 protein_id gnl|my_center|LOCUS_49990 6262 7305 gene locus_tag LOCUS_50000 6262 7305 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480164.1 protein_id gnl|my_center|LOCUS_50000 7348 8070 gene locus_tag LOCUS_50010 gene ubiE 7348 8070 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_50010 8208 8738 gene locus_tag LOCUS_50020 8208 8738 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 protein_id gnl|my_center|LOCUS_50020 8850 9914 gene locus_tag LOCUS_50030 8850 9914 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889086.1 protein_id gnl|my_center|LOCUS_50030 10862 10101 gene locus_tag LOCUS_50040 10862 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50040 10960 11253 gene locus_tag LOCUS_50050 gene gatC 10960 11253 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887918.1 protein_id gnl|my_center|LOCUS_50050 11330 12595 gene locus_tag LOCUS_50060 gene serS 11330 12595 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_50060 12738 13337 gene locus_tag LOCUS_50070 12738 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50070 14705 13401 gene locus_tag LOCUS_50080 14705 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 16013 15003 gene locus_tag LOCUS_50090 16013 15003 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887335.1 protein_id gnl|my_center|LOCUS_50090 16253 17266 gene locus_tag LOCUS_50100 16253 17266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530990.1 protein_id gnl|my_center|LOCUS_50100 17512 18825 gene locus_tag LOCUS_50110 gene rsmF 17512 18825 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_50110 19792 18806 gene locus_tag LOCUS_50120 19792 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887741.1 protein_id gnl|my_center|LOCUS_50120 19952 20623 gene locus_tag LOCUS_50130 19952 20623 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401651.1 protein_id gnl|my_center|LOCUS_50130 20765 22210 gene locus_tag LOCUS_50140 20765 22210 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479935.1 protein_id gnl|my_center|LOCUS_50140 22812 22207 gene locus_tag LOCUS_50150 22812 22207 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697198.1 protein_id gnl|my_center|LOCUS_50150 23424 22825 gene locus_tag LOCUS_50160 23424 22825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350603.1 protein_id gnl|my_center|LOCUS_50160 23596 25401 gene locus_tag LOCUS_50170 23596 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 25391 26035 gene locus_tag LOCUS_50180 25391 26035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971405.1 protein_id gnl|my_center|LOCUS_50180 26117 26599 gene locus_tag LOCUS_50190 26117 26599 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096939.1 protein_id gnl|my_center|LOCUS_50190 >Feature sequence42 635 162 gene locus_tag LOCUS_50200 635 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888930.1 protein_id gnl|my_center|LOCUS_50200 1276 695 gene locus_tag LOCUS_50210 gene aat 1276 695 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_50210 2354 1326 gene locus_tag LOCUS_50220 2354 1326 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887494.1 protein_id gnl|my_center|LOCUS_50220 2800 2351 gene locus_tag LOCUS_50230 gene dtd 2800 2351 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_50230 3064 2801 gene locus_tag LOCUS_50240 3064 2801 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479690.1 protein_id gnl|my_center|LOCUS_50240 3124 3873 gene locus_tag LOCUS_50250 3124 3873 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022579.1 protein_id gnl|my_center|LOCUS_50250 4524 3874 gene locus_tag LOCUS_50260 4524 3874 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_50260 5236 4868 gene locus_tag LOCUS_50270 5236 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632112.1 protein_id gnl|my_center|LOCUS_50270 5535 6152 gene locus_tag LOCUS_50280 5535 6152 CDS product peptidoglycan endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888384.1 protein_id gnl|my_center|LOCUS_50280 7166 6282 gene locus_tag LOCUS_50290 7166 6282 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423235.1 protein_id gnl|my_center|LOCUS_50290 7353 8546 gene locus_tag LOCUS_50300 7353 8546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887040.1 protein_id gnl|my_center|LOCUS_50300 9438 8590 gene locus_tag LOCUS_50310 9438 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 10365 9496 gene locus_tag LOCUS_50320 10365 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 11204 10362 gene locus_tag LOCUS_50330 11204 10362 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_50330 11667 11488 gene locus_tag LOCUS_50340 11667 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 11621 12940 gene locus_tag LOCUS_50350 11621 12940 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089230.1 protein_id gnl|my_center|LOCUS_50350 13143 13655 gene locus_tag LOCUS_50360 13143 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 13708 14523 gene locus_tag LOCUS_50370 13708 14523 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228942.1 protein_id gnl|my_center|LOCUS_50370 14520 15290 gene locus_tag LOCUS_50380 14520 15290 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173899.1 protein_id gnl|my_center|LOCUS_50380 15287 16501 gene locus_tag LOCUS_50390 15287 16501 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229029.1 protein_id gnl|my_center|LOCUS_50390 16645 17436 gene locus_tag LOCUS_50400 16645 17436 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926101.1 protein_id gnl|my_center|LOCUS_50400 17433 17921 gene locus_tag LOCUS_50410 17433 17921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 19292 17928 gene locus_tag LOCUS_50420 19292 17928 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887669.1 protein_id gnl|my_center|LOCUS_50420 19483 20118 gene locus_tag LOCUS_50430 19483 20118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 20141 21763 gene locus_tag LOCUS_50440 20141 21763 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_50440 22426 21776 gene locus_tag LOCUS_50450 22426 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 22365 23009 gene locus_tag LOCUS_50460 22365 23009 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_50460 23746 23006 gene locus_tag LOCUS_50470 23746 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 24763 23756 gene locus_tag LOCUS_50480 24763 23756 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886915.1 protein_id gnl|my_center|LOCUS_50480 25400 24768 gene locus_tag LOCUS_50490 25400 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 25564 25489 gene locus_tag LOCUS_t00590 25564 25489 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence43 142 315 gene locus_tag LOCUS_50500 142 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50500 475 774 gene locus_tag LOCUS_50510 475 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 1073 1648 gene locus_tag LOCUS_50520 1073 1648 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_50520 1696 2340 gene locus_tag LOCUS_50530 1696 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 2979 2626 gene locus_tag LOCUS_50540 2979 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50540 3542 2976 gene locus_tag LOCUS_50550 3542 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 4001 4795 gene locus_tag LOCUS_50560 4001 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50560 4852 5196 gene locus_tag LOCUS_50570 4852 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 5843 5343 gene locus_tag LOCUS_50580 gene ureE 5843 5343 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889573.1 protein_id gnl|my_center|LOCUS_50580 6492 5824 gene locus_tag LOCUS_50590 gene hypB 6492 5824 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889574.1 protein_id gnl|my_center|LOCUS_50590 6836 6489 gene locus_tag LOCUS_50600 6836 6489 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889575.1 protein_id gnl|my_center|LOCUS_50600 7066 6836 gene locus_tag LOCUS_50610 7066 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 7453 7169 gene locus_tag LOCUS_50620 7453 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 7781 8095 gene locus_tag LOCUS_50630 7781 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 9466 8366 gene locus_tag LOCUS_50640 9466 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 10833 9655 gene locus_tag LOCUS_50650 10833 9655 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125692940.1 protein_id gnl|my_center|LOCUS_50650 11621 10866 gene locus_tag LOCUS_50660 11621 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 14142 11893 gene locus_tag LOCUS_50670 14142 11893 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085486134.1 protein_id gnl|my_center|LOCUS_50670 14051 14242 gene locus_tag LOCUS_50680 14051 14242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 14581 15336 gene locus_tag LOCUS_50690 14581 15336 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_50690 15350 16051 gene locus_tag LOCUS_50700 15350 16051 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_50700 16052 16699 gene locus_tag LOCUS_50710 16052 16699 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_50710 16696 17874 gene locus_tag LOCUS_50720 16696 17874 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888593.1 protein_id gnl|my_center|LOCUS_50720 19237 18050 gene locus_tag LOCUS_50730 19237 18050 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921526.1 protein_id gnl|my_center|LOCUS_50730 20240 19239 gene locus_tag LOCUS_50740 20240 19239 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 protein_id gnl|my_center|LOCUS_50740 20901 20257 gene locus_tag LOCUS_50750 20901 20257 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 protein_id gnl|my_center|LOCUS_50750 22127 21000 gene locus_tag LOCUS_50760 22127 21000 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226918.1 protein_id gnl|my_center|LOCUS_50760 23145 22141 gene locus_tag LOCUS_50770 23145 22141 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086600.1 protein_id gnl|my_center|LOCUS_50770 23405 24616 gene locus_tag LOCUS_50780 23405 24616 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528101.1 protein_id gnl|my_center|LOCUS_50780 >Feature sequence44 556 829 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagggatacctttgtgtggtt 929 2332 gene locus_tag LOCUS_50790 929 2332 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480407.1 protein_id gnl|my_center|LOCUS_50790 4009 2348 gene locus_tag LOCUS_50800 4009 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50800 7312 4166 gene locus_tag LOCUS_50810 7312 4166 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082402.1 protein_id gnl|my_center|LOCUS_50810 8433 7492 gene locus_tag LOCUS_50820 8433 7492 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527149.1 protein_id gnl|my_center|LOCUS_50820 8649 9488 gene locus_tag LOCUS_50830 8649 9488 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029656.1 protein_id gnl|my_center|LOCUS_50830 9727 10788 gene locus_tag LOCUS_50840 9727 10788 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349871.1 protein_id gnl|my_center|LOCUS_50840 13292 10785 gene locus_tag LOCUS_50850 13292 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 13784 13425 gene locus_tag LOCUS_50860 13784 13425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 14419 14156 gene locus_tag LOCUS_50870 14419 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 14418 14606 gene locus_tag LOCUS_50880 14418 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 14854 15012 gene locus_tag LOCUS_50890 14854 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 15006 17264 gene locus_tag LOCUS_50900 15006 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 18261 17344 gene locus_tag LOCUS_50910 18261 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 18705 19319 gene locus_tag LOCUS_50920 18705 19319 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_50920 19319 19687 gene locus_tag LOCUS_50930 19319 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 >Feature sequence45 43 2814 gene locus_tag LOCUS_50940 43 2814 CDS product Tn3-like element Tn3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143760.1 protein_id gnl|my_center|LOCUS_50940 2963 3148 gene locus_tag LOCUS_50950 2963 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 3213 3617 gene locus_tag LOCUS_50960 3213 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 3971 4549 gene locus_tag LOCUS_50970 3971 4549 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_50970 4569 4715 gene locus_tag LOCUS_50980 4569 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 5456 4854 gene locus_tag LOCUS_50990 5456 4854 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036411.1 protein_id gnl|my_center|LOCUS_50990 5642 7111 gene locus_tag LOCUS_51000 5642 7111 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486261.1 protein_id gnl|my_center|LOCUS_51000 7529 7723 gene locus_tag LOCUS_51010 7529 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 8784 7774 gene locus_tag LOCUS_51020 8784 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 11625 8845 gene locus_tag LOCUS_51030 11625 8845 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797787.1 protein_id gnl|my_center|LOCUS_51030 14999 11622 gene locus_tag LOCUS_51040 14999 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 15353 17107 gene locus_tag LOCUS_51050 15353 17107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 17126 19891 gene locus_tag LOCUS_51060 17126 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 >Feature sequence46 156 650 gene locus_tag LOCUS_51070 156 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 1398 619 gene locus_tag LOCUS_51080 gene surE 1398 619 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889023.1 protein_id gnl|my_center|LOCUS_51080 1502 1909 gene locus_tag LOCUS_51090 1502 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 2142 1981 gene locus_tag LOCUS_51100 2142 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 2804 2265 gene locus_tag LOCUS_51110 2804 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 4317 2929 gene locus_tag LOCUS_51120 4317 2929 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888366.1 protein_id gnl|my_center|LOCUS_51120 5670 4327 gene locus_tag LOCUS_51130 5670 4327 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942269.1 protein_id gnl|my_center|LOCUS_51130 6803 6114 gene locus_tag LOCUS_51140 6803 6114 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889164.1 protein_id gnl|my_center|LOCUS_51140 7112 7188 gene locus_tag LOCUS_t00600 7112 7188 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7207 7291 gene locus_tag LOCUS_t00610 7207 7291 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7396 8772 gene locus_tag LOCUS_51150 gene tig 7396 8772 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888581.1 protein_id gnl|my_center|LOCUS_51150 8960 9139 gene locus_tag LOCUS_51160 8960 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 9211 10683 gene locus_tag LOCUS_51170 gene cobA 9211 10683 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349821.1 protein_id gnl|my_center|LOCUS_51170 10779 12560 gene locus_tag LOCUS_51180 10779 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 12756 13040 gene locus_tag LOCUS_51190 12756 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 13163 13609 gene locus_tag LOCUS_51200 13163 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228841.1 protein_id gnl|my_center|LOCUS_51200 13663 14508 gene locus_tag LOCUS_51210 gene accD 13663 14508 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887858.1 protein_id gnl|my_center|LOCUS_51210 14505 15437 gene locus_tag LOCUS_51220 14505 15437 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887857.1 protein_id gnl|my_center|LOCUS_51220 16771 15521 gene locus_tag LOCUS_51230 16771 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 17428 16847 gene locus_tag LOCUS_51240 17428 16847 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_51240 17885 17959 gene locus_tag LOCUS_t00620 17885 17959 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 19229 18030 gene locus_tag LOCUS_51250 19229 18030 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887950.1 protein_id gnl|my_center|LOCUS_51250 >Feature sequence47 397 32 gene locus_tag LOCUS_51260 397 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51260 720 394 gene locus_tag LOCUS_51270 720 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 1043 849 gene locus_tag LOCUS_51280 1043 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 2516 1599 gene locus_tag LOCUS_51290 2516 1599 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229174.1 protein_id gnl|my_center|LOCUS_51290 3496 2513 gene locus_tag LOCUS_51300 3496 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 6994 3635 gene locus_tag LOCUS_51310 6994 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 9020 7650 gene locus_tag LOCUS_51320 9020 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 10340 9897 gene locus_tag LOCUS_51330 10340 9897 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391482.1 protein_id gnl|my_center|LOCUS_51330 11300 10629 gene locus_tag LOCUS_51340 11300 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 11490 12134 gene locus_tag LOCUS_51350 gene lexA 11490 12134 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296572.1 protein_id gnl|my_center|LOCUS_51350 12301 13374 gene locus_tag LOCUS_51360 12301 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 13379 13615 gene locus_tag LOCUS_51370 13379 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 13628 16762 gene locus_tag LOCUS_51380 13628 16762 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805173.1 protein_id gnl|my_center|LOCUS_51380 17033 18103 gene locus_tag LOCUS_51390 17033 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 18754 18149 gene locus_tag LOCUS_51400 18754 18149 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_51400 19601 19434 gene locus_tag LOCUS_51410 19601 19434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 >Feature sequence48 422 811 gene locus_tag LOCUS_51420 422 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 1954 884 gene locus_tag LOCUS_51430 1954 884 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887087.1 protein_id gnl|my_center|LOCUS_51430 2518 2853 gene locus_tag LOCUS_51440 2518 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 3306 2986 gene locus_tag LOCUS_51450 3306 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51450 3432 4325 gene locus_tag LOCUS_51460 3432 4325 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538553.1 protein_id gnl|my_center|LOCUS_51460 4505 5044 gene locus_tag LOCUS_51470 4505 5044 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247931.1 protein_id gnl|my_center|LOCUS_51470 6872 5085 gene locus_tag LOCUS_51480 6872 5085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027306.1 protein_id gnl|my_center|LOCUS_51480 8282 7275 gene locus_tag LOCUS_51490 8282 7275 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_51490 10654 8312 gene locus_tag LOCUS_51500 10654 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 11560 10658 gene locus_tag LOCUS_51510 11560 10658 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_51510 12532 11573 gene locus_tag LOCUS_51520 12532 11573 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_51520 13860 12631 gene locus_tag LOCUS_51530 13860 12631 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383844.1 protein_id gnl|my_center|LOCUS_51530 15350 14337 gene locus_tag LOCUS_51540 15350 14337 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 protein_id gnl|my_center|LOCUS_51540 15522 18014 gene locus_tag LOCUS_51550 15522 18014 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_51550 18011 18913 gene locus_tag LOCUS_51560 18011 18913 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026819.1 protein_id gnl|my_center|LOCUS_51560 >Feature sequence49 508 1689 gene locus_tag LOCUS_51570 508 1689 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_51570 1771 2460 gene locus_tag LOCUS_51580 1771 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 2468 3070 gene locus_tag LOCUS_51590 2468 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 4751 3213 gene locus_tag LOCUS_51600 4751 3213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055295205.1 protein_id gnl|my_center|LOCUS_51600 5054 6007 gene locus_tag LOCUS_51610 5054 6007 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_51610 6723 6136 gene locus_tag LOCUS_51620 6723 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 7214 6738 gene locus_tag LOCUS_51630 7214 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 7864 7367 gene locus_tag LOCUS_51640 7864 7367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51640 7965 9158 gene locus_tag LOCUS_51650 7965 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 9252 11027 gene locus_tag LOCUS_51660 9252 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51660 13482 11134 gene locus_tag LOCUS_51670 gene glgX 13482 11134 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978922.1 protein_id gnl|my_center|LOCUS_51670 13801 13619 gene locus_tag LOCUS_51680 13801 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51680 13849 14847 gene locus_tag LOCUS_51690 13849 14847 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869626.1 protein_id gnl|my_center|LOCUS_51690 14941 16347 gene locus_tag LOCUS_51700 14941 16347 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_51700 16469 16678 gene locus_tag LOCUS_51710 16469 16678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 >Feature sequence50 753 82 gene locus_tag LOCUS_51720 753 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 1025 831 gene locus_tag LOCUS_51730 1025 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 2233 1601 gene locus_tag LOCUS_51740 2233 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 2907 2734 gene locus_tag LOCUS_51750 2907 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 3014 3202 gene locus_tag LOCUS_51760 3014 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51760 3244 3450 gene locus_tag LOCUS_51770 3244 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 3524 6331 gene locus_tag LOCUS_51780 3524 6331 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011114777.1 protein_id gnl|my_center|LOCUS_51780 7477 6572 gene locus_tag LOCUS_51790 7477 6572 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_51790 7934 7461 gene locus_tag LOCUS_51800 7934 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 7827 8126 gene locus_tag LOCUS_51810 7827 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51810 8264 8842 gene locus_tag LOCUS_51820 8264 8842 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_51820 8915 9253 gene locus_tag LOCUS_51830 8915 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 9403 9663 gene locus_tag LOCUS_51840 9403 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 9657 10004 gene locus_tag LOCUS_51850 9657 10004 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887307.1 protein_id gnl|my_center|LOCUS_51850 10213 11754 gene locus_tag LOCUS_51860 10213 11754 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_51860 13557 11899 gene locus_tag LOCUS_51870 gene ltrA 13557 11899 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_51870 13617 13904 gene locus_tag LOCUS_51880 13617 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 >Feature sequence51 977 9 gene locus_tag LOCUS_51890 977 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51890 1325 1900 gene locus_tag LOCUS_51900 1325 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 2071 2559 gene locus_tag LOCUS_51910 2071 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51910 2685 3365 gene locus_tag LOCUS_51920 2685 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 3411 3956 gene locus_tag LOCUS_51930 3411 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 4026 4247 gene locus_tag LOCUS_51940 4026 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 6242 4251 gene locus_tag LOCUS_51950 6242 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51950 6358 6594 gene locus_tag LOCUS_51960 6358 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 6540 7853 gene locus_tag LOCUS_51970 6540 7853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 8545 7859 gene locus_tag LOCUS_51980 8545 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51980 10517 8622 gene locus_tag LOCUS_51990 10517 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51990 11074 11622 gene locus_tag LOCUS_52000 11074 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 11606 12973 gene locus_tag LOCUS_52010 11606 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 >Feature sequence52 765 556 gene locus_tag LOCUS_52020 765 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 1135 902 gene locus_tag LOCUS_52030 1135 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 1752 1979 gene locus_tag LOCUS_52040 1752 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 2059 2349 gene locus_tag LOCUS_52050 2059 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52050 2333 2929 gene locus_tag LOCUS_52060 2333 2929 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259303.1 protein_id gnl|my_center|LOCUS_52060 2997 3590 gene locus_tag LOCUS_52070 2997 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 3818 4057 gene locus_tag LOCUS_52080 3818 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 4229 6688 gene locus_tag LOCUS_52090 4229 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52090 6859 7167 gene locus_tag LOCUS_52100 6859 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 7197 7565 gene locus_tag LOCUS_52110 7197 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 7495 7830 gene locus_tag LOCUS_52120 7495 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 8875 11043 gene locus_tag LOCUS_52130 8875 11043 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889332.1 protein_id gnl|my_center|LOCUS_52130 11110 11472 gene locus_tag LOCUS_52140 11110 11472 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_52140 >Feature sequence53 509 1690 gene locus_tag LOCUS_52150 509 1690 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_52150 1772 2320 gene locus_tag LOCUS_52160 1772 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 2311 2607 gene locus_tag LOCUS_52170 2311 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52170 3117 2932 gene locus_tag LOCUS_52180 3117 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 3088 3504 gene locus_tag LOCUS_52190 3088 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52190 3495 3755 gene locus_tag LOCUS_52200 3495 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 4615 3986 gene locus_tag LOCUS_52210 4615 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 5003 4827 gene locus_tag LOCUS_52220 5003 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52220 5042 6181 gene locus_tag LOCUS_52230 5042 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52230 6178 8277 gene locus_tag LOCUS_52240 6178 8277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 8274 9581 gene locus_tag LOCUS_52250 8274 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 9578 10033 gene locus_tag LOCUS_52260 9578 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 >Feature sequence54 934 74 gene locus_tag LOCUS_52270 934 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52270 2992 1346 gene locus_tag LOCUS_52280 2992 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52280 3599 3444 gene locus_tag LOCUS_52290 3599 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 4258 3596 gene locus_tag LOCUS_52300 4258 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 4878 4258 gene locus_tag LOCUS_52310 4878 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 5229 5026 gene locus_tag LOCUS_52320 5229 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 5524 5126 gene locus_tag LOCUS_52330 5524 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 6402 5599 gene locus_tag LOCUS_52340 6402 5599 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480308.1 protein_id gnl|my_center|LOCUS_52340 6653 6444 gene locus_tag LOCUS_52350 6653 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 7893 6772 gene locus_tag LOCUS_52360 7893 6772 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_52360 9755 8166 gene locus_tag LOCUS_52370 9755 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 >Feature sequence55 1154 2155 gene locus_tag LOCUS_52380 1154 2155 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228214.1 protein_id gnl|my_center|LOCUS_52380 2173 4932 gene locus_tag LOCUS_52390 2173 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 7323 5200 gene locus_tag LOCUS_52400 7323 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 7339 7857 gene locus_tag LOCUS_52410 7339 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52410 >Feature sequence56 <1 878 gene locus_tag LOCUS_52420 <1 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256963.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1667 1026 gene locus_tag LOCUS_52430 1667 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 2056 1664 gene locus_tag LOCUS_52440 2056 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 3794 2142 gene locus_tag LOCUS_52450 3794 2142 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728497.1 protein_id gnl|my_center|LOCUS_52450 3828 3998 gene locus_tag LOCUS_52460 3828 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 4785 3979 gene locus_tag LOCUS_52470 4785 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 protein_id gnl|my_center|LOCUS_52470 5726 4782 gene locus_tag LOCUS_52480 5726 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 >Feature sequence57 1794 1297 gene locus_tag LOCUS_52490 1794 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 2672 1869 gene locus_tag LOCUS_52500 2672 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 3164 3355 gene locus_tag LOCUS_52510 3164 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 3771 4388 gene locus_tag LOCUS_52520 3771 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 5008 4415 gene locus_tag LOCUS_52530 5008 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 >Feature sequence58 3513 2509 gene locus_tag LOCUS_52540 3513 2509 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921545.1 protein_id gnl|my_center|LOCUS_52540 3759 4994 gene locus_tag LOCUS_52550 3759 4994 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152423784.1 protein_id gnl|my_center|LOCUS_52550 >Feature sequence59 460 807 gene locus_tag LOCUS_52560 460 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 1340 2374 gene locus_tag LOCUS_52570 1340 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 3032 2565 gene locus_tag LOCUS_52580 3032 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52580 4664 3042 gene locus_tag LOCUS_52590 4664 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52590 >Feature sequence60 130 399 gene locus_tag LOCUS_52600 130 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52600 528 1232 gene locus_tag LOCUS_52610 528 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52610 1623 3074 gene locus_tag LOCUS_52620 1623 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52620 3369 3067 gene locus_tag LOCUS_52630 3369 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52630 >Feature sequence61 552 1256 gene locus_tag LOCUS_52640 552 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 2795 3286 gene locus_tag LOCUS_52650 2795 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 >Feature sequence62 1203 298 gene locus_tag LOCUS_52660 1203 298 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026819.1 protein_id gnl|my_center|LOCUS_52660 2212 1217 gene locus_tag LOCUS_52670 2212 1217 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189263.1 protein_id gnl|my_center|LOCUS_52670 >Feature sequence63 245 775 gene locus_tag LOCUS_52680 245 775 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 protein_id gnl|my_center|LOCUS_52680 772 1419 gene locus_tag LOCUS_52690 772 1419 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229094.1 protein_id gnl|my_center|LOCUS_52690 1467 2180 gene locus_tag LOCUS_52700 1467 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 >Feature sequence64 1734 76 gene locus_tag LOCUS_52710 gene ltrA 1734 76 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235893157.1 protein_id gnl|my_center|LOCUS_52710 >Feature sequence65 951 2177 gene locus_tag LOCUS_52720 951 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 >Feature sequence66 383 1426 gene locus_tag LOCUS_52730 383 1426 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_52730 1485 1931 gene locus_tag LOCUS_52740 1485 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 >Feature sequence67 <1 740 gene locus_tag LOCUS_52750 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_135260909.1:transposase 1886 708 gene locus_tag LOCUS_52760 1886 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 >Feature sequence68 >Feature sequence69 95 532 gene locus_tag LOCUS_52770 95 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52770 >Feature sequence70 403 53 gene locus_tag LOCUS_52780 403 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 546 1577 gene locus_tag LOCUS_52790 546 1577 CDS product IS4-like element ISLpn9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946555.1 protein_id gnl|my_center|LOCUS_52790 >Feature sequence71 1463 159 gene locus_tag LOCUS_52800 1463 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 >Feature sequence72 120 21 gene locus_tag LOCUS_r00020 120 21 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence73 1387 20 gene locus_tag LOCUS_52810 1387 20 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024749659.1 protein_id gnl|my_center|LOCUS_52810 >Feature sequence74 55 399 gene locus_tag LOCUS_52820 55 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 492 1013 gene locus_tag LOCUS_52830 492 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52830 >Feature sequence75 316 1251 gene locus_tag LOCUS_52840 316 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52840 >Feature sequence76 229 1254 gene locus_tag LOCUS_52850 229 1254 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 protein_id gnl|my_center|LOCUS_52850 >Feature sequence77 1038 28 gene locus_tag LOCUS_52860 1038 28 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096831545.1 protein_id gnl|my_center|LOCUS_52860 >Feature sequence78 55 369 gene locus_tag LOCUS_52870 55 369 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139205698.1 protein_id gnl|my_center|LOCUS_52870 366 1226 gene locus_tag LOCUS_52880 366 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52880 >Feature sequence79 958 713 gene locus_tag LOCUS_52890 958 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52890 >Feature sequence80 189 1172 gene locus_tag LOCUS_52900 189 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52900 >Feature sequence81 <1184 2 gene locus_tag LOCUS_52910 <1184 2 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286788.1:ABC transporter substrate-binding protein >Feature sequence82 >Feature sequence83 >Feature sequence84 >Feature sequence85 >Feature sequence86 >Feature sequence87 768 544 gene locus_tag LOCUS_52920 768 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 >Feature sequence88 >Feature sequence89 >Feature sequence90 >Feature sequence91 <747 8 gene locus_tag LOCUS_52930 <747 8 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_135260909.1:transposase >Feature sequence92 >Feature sequence93 >Feature sequence94 >Feature sequence95 473 165 gene locus_tag LOCUS_52940 473 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 >Feature sequence96 446 72 gene locus_tag LOCUS_52950 446 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52950 >Feature sequence97 >Feature sequence98 381 136 gene locus_tag LOCUS_52960 381 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 >Feature sequence99