>Feature sequence001 557 168 gene locus_tag LOCUS_00010 gene ansR 557 168 CDS product HTH-type transcriptional regulator AnsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893569.1 protein_id gnl|my_center|LOCUS_00010 728 967 gene locus_tag LOCUS_00020 728 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1020 1625 gene locus_tag LOCUS_00030 1020 1625 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925379.1 protein_id gnl|my_center|LOCUS_00030 1752 2708 gene locus_tag LOCUS_00040 1752 2708 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706367.1 protein_id gnl|my_center|LOCUS_00040 3369 2698 gene locus_tag LOCUS_00050 3369 2698 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814332.1 protein_id gnl|my_center|LOCUS_00050 3480 3962 gene locus_tag LOCUS_00060 gene folA 3480 3962 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_00060 3999 4346 gene locus_tag LOCUS_00070 3999 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4568 6301 gene locus_tag LOCUS_00080 4568 6301 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_00080 6381 6818 gene locus_tag LOCUS_00090 gene rnhA 6381 6818 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_00090 6904 8166 gene locus_tag LOCUS_00100 gene queG 6904 8166 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 protein_id gnl|my_center|LOCUS_00100 8163 8702 gene locus_tag LOCUS_00110 8163 8702 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464913.1 protein_id gnl|my_center|LOCUS_00110 8857 9291 gene locus_tag LOCUS_00120 8857 9291 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393982.1 protein_id gnl|my_center|LOCUS_00120 9432 9887 gene locus_tag LOCUS_00130 9432 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10022 11011 gene locus_tag LOCUS_00140 10022 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11782 11123 gene locus_tag LOCUS_00150 11782 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12843 11779 gene locus_tag LOCUS_00160 12843 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039079.1 protein_id gnl|my_center|LOCUS_00160 13308 12877 gene locus_tag LOCUS_00170 13308 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13883 13302 gene locus_tag LOCUS_00180 13883 13302 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071740389.1 protein_id gnl|my_center|LOCUS_00180 14081 14545 gene locus_tag LOCUS_00190 14081 14545 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941854.1 protein_id gnl|my_center|LOCUS_00190 14621 15484 gene locus_tag LOCUS_00200 14621 15484 CDS product MTAP family purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393347.1 protein_id gnl|my_center|LOCUS_00200 16287 15694 gene locus_tag LOCUS_00210 16287 15694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 16429 17223 gene locus_tag LOCUS_00220 16429 17223 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224884.1 protein_id gnl|my_center|LOCUS_00220 17323 18219 gene locus_tag LOCUS_00230 gene hpaI 17323 18219 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144460629.1 protein_id gnl|my_center|LOCUS_00230 18276 19043 gene locus_tag LOCUS_00240 18276 19043 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889485.1 protein_id gnl|my_center|LOCUS_00240 19040 20536 gene locus_tag LOCUS_00250 gene hpaE 19040 20536 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889479.1 protein_id gnl|my_center|LOCUS_00250 20551 22026 gene locus_tag LOCUS_00260 gene hpaB 20551 22026 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_00260 22097 23089 gene locus_tag LOCUS_00270 gene hpaD 22097 23089 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392282.1 protein_id gnl|my_center|LOCUS_00270 23062 24303 gene locus_tag LOCUS_00280 23062 24303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_00280 24392 25273 gene locus_tag LOCUS_00290 24392 25273 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_00290 25302 26300 gene locus_tag LOCUS_00300 25302 26300 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_00300 26284 27051 gene locus_tag LOCUS_00310 26284 27051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812446.1 protein_id gnl|my_center|LOCUS_00310 27053 27790 gene locus_tag LOCUS_00320 27053 27790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_00320 27971 29392 gene locus_tag LOCUS_00330 27971 29392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 29468 30238 gene locus_tag LOCUS_00340 29468 30238 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_00340 30332 30961 gene locus_tag LOCUS_00350 30332 30961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00350 30864 31784 gene locus_tag LOCUS_00360 30864 31784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00360 31955 32689 gene locus_tag LOCUS_00370 31955 32689 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815418.1 protein_id gnl|my_center|LOCUS_00370 32709 34169 gene locus_tag LOCUS_00380 32709 34169 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929761.1 protein_id gnl|my_center|LOCUS_00380 34223 34702 gene locus_tag LOCUS_00390 34223 34702 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815416.1 protein_id gnl|my_center|LOCUS_00390 34803 35165 gene locus_tag LOCUS_00400 34803 35165 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815425.1 protein_id gnl|my_center|LOCUS_00400 35329 37263 gene locus_tag LOCUS_00410 35329 37263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 37260 38186 gene locus_tag LOCUS_00420 37260 38186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330018.1 protein_id gnl|my_center|LOCUS_00420 38183 39016 gene locus_tag LOCUS_00430 38183 39016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 39826 39026 gene locus_tag LOCUS_00440 39826 39026 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112905.1 protein_id gnl|my_center|LOCUS_00440 40124 40831 gene locus_tag LOCUS_00450 40124 40831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 40860 41591 gene locus_tag LOCUS_00460 40860 41591 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393101.1 protein_id gnl|my_center|LOCUS_00460 41718 42353 gene locus_tag LOCUS_00470 gene chrB 41718 42353 CDS product chromate efflux transporter subunit ChrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227843.1 protein_id gnl|my_center|LOCUS_00470 42350 42880 gene locus_tag LOCUS_00480 gene chrA 42350 42880 CDS product chromate resistance efflux protein ChrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227840.1 protein_id gnl|my_center|LOCUS_00480 42962 43258 gene locus_tag LOCUS_00490 42962 43258 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815429.1 protein_id gnl|my_center|LOCUS_00490 43404 43916 gene locus_tag LOCUS_00500 gene rpoE 43404 43916 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_00500 43913 44212 gene locus_tag LOCUS_00510 43913 44212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 44233 45126 gene locus_tag LOCUS_00520 44233 45126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 45139 45387 gene locus_tag LOCUS_00530 45139 45387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 45534 46970 gene locus_tag LOCUS_00540 45534 46970 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265568.1 protein_id gnl|my_center|LOCUS_00540 48247 47051 gene locus_tag LOCUS_00550 gene rocD 48247 47051 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_00550 50212 48539 gene locus_tag LOCUS_00560 50212 48539 CDS product IS200/IS605 family accessory protein TnpB-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147776474.1 protein_id gnl|my_center|LOCUS_00560 51805 51188 gene locus_tag LOCUS_00570 gene leuD 51805 51188 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187882.1 protein_id gnl|my_center|LOCUS_00570 53231 51825 gene locus_tag LOCUS_00580 gene leuC 53231 51825 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 protein_id gnl|my_center|LOCUS_00580 53494 54441 gene locus_tag LOCUS_00590 53494 54441 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_00590 54486 55424 gene locus_tag LOCUS_00600 54486 55424 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_00600 55375 56340 gene locus_tag LOCUS_00610 55375 56340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00610 56301 56912 gene locus_tag LOCUS_00620 56301 56912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00620 56909 57829 gene locus_tag LOCUS_00630 56909 57829 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_00630 59623 58043 gene locus_tag LOCUS_00640 gene pckA 59623 58043 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_00640 61003 59816 gene locus_tag LOCUS_00650 61003 59816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503245.1 protein_id gnl|my_center|LOCUS_00650 61954 61277 gene locus_tag LOCUS_00660 gene wrbA 61954 61277 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970111.1 protein_id gnl|my_center|LOCUS_00660 62219 62692 gene locus_tag LOCUS_00670 62219 62692 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232536.1 protein_id gnl|my_center|LOCUS_00670 62702 63637 gene locus_tag LOCUS_00680 62702 63637 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_00680 63634 64059 gene locus_tag LOCUS_00690 gene folB 63634 64059 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391948.1 protein_id gnl|my_center|LOCUS_00690 64056 64898 gene locus_tag LOCUS_00700 64056 64898 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_00700 64895 65569 gene locus_tag LOCUS_00710 64895 65569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228944.1 protein_id gnl|my_center|LOCUS_00710 65688 67721 gene locus_tag LOCUS_00720 65688 67721 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022589.1 protein_id gnl|my_center|LOCUS_00720 69099 67681 gene locus_tag LOCUS_00730 gene rsmF 69099 67681 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_00730 69339 69533 gene locus_tag LOCUS_00740 69339 69533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 69669 70103 gene locus_tag LOCUS_00750 69669 70103 CDS product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228878.1 protein_id gnl|my_center|LOCUS_00750 70228 70821 gene locus_tag LOCUS_00760 70228 70821 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 protein_id gnl|my_center|LOCUS_00760 71012 71854 gene locus_tag LOCUS_00770 71012 71854 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158696.1 protein_id gnl|my_center|LOCUS_00770 72209 71871 gene locus_tag LOCUS_00780 72209 71871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 72356 73429 gene locus_tag LOCUS_00790 72356 73429 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031503.1 protein_id gnl|my_center|LOCUS_00790 73524 74597 gene locus_tag LOCUS_00800 gene spaC 73524 74597 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_00800 74713 75825 gene locus_tag LOCUS_00810 gene ugpC 74713 75825 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 protein_id gnl|my_center|LOCUS_00810 75842 76825 gene locus_tag LOCUS_00820 gene glcK 75842 76825 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_00820 77346 77170 gene locus_tag LOCUS_00830 77346 77170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 77517 78653 gene locus_tag LOCUS_00840 77517 78653 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092772473.1 protein_id gnl|my_center|LOCUS_00840 78787 79500 gene locus_tag LOCUS_00850 78787 79500 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228179.1 protein_id gnl|my_center|LOCUS_00850 80821 79685 gene locus_tag LOCUS_00860 80821 79685 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301163.1 protein_id gnl|my_center|LOCUS_00860 82152 80923 gene locus_tag LOCUS_00870 82152 80923 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286481.1 protein_id gnl|my_center|LOCUS_00870 82876 82166 gene locus_tag LOCUS_00880 gene dapD 82876 82166 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218680.1 protein_id gnl|my_center|LOCUS_00880 83117 83884 gene locus_tag LOCUS_00890 83117 83884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00890 83781 84173 gene locus_tag LOCUS_00900 83781 84173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00900 84312 85265 gene locus_tag LOCUS_00910 gene ctaA 84312 85265 CDS product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 protein_id gnl|my_center|LOCUS_00910 85605 85378 gene locus_tag LOCUS_00920 gene sspI 85605 85378 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 protein_id gnl|my_center|LOCUS_00920 85786 86439 gene locus_tag LOCUS_00930 85786 86439 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_00930 86436 87287 gene locus_tag LOCUS_00940 86436 87287 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721616.1 protein_id gnl|my_center|LOCUS_00940 88619 87375 gene locus_tag LOCUS_00950 88619 87375 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814809.1 protein_id gnl|my_center|LOCUS_00950 88858 89862 gene locus_tag LOCUS_00960 88858 89862 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925219.1 protein_id gnl|my_center|LOCUS_00960 89864 90901 gene locus_tag LOCUS_00970 89864 90901 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477924.1 protein_id gnl|my_center|LOCUS_00970 90916 91740 gene locus_tag LOCUS_00980 90916 91740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886609.1 protein_id gnl|my_center|LOCUS_00980 91919 92467 gene locus_tag LOCUS_00990 91919 92467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 93504 92518 gene locus_tag LOCUS_01000 93504 92518 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106346642.1 protein_id gnl|my_center|LOCUS_01000 94073 95098 gene locus_tag LOCUS_01010 gene pheS 94073 95098 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_01010 95141 97567 gene locus_tag LOCUS_01020 gene pheT 95141 97567 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498183.1 protein_id gnl|my_center|LOCUS_01020 98048 98323 gene locus_tag LOCUS_01030 98048 98323 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393250.1 protein_id gnl|my_center|LOCUS_01030 98320 98877 gene locus_tag LOCUS_01040 98320 98877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 98944 100662 gene locus_tag LOCUS_01050 gene polX 98944 100662 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867537.1 protein_id gnl|my_center|LOCUS_01050 101404 101030 gene locus_tag LOCUS_01060 101404 101030 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_01060 101576 103936 gene locus_tag LOCUS_01070 101576 103936 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893750.1 protein_id gnl|my_center|LOCUS_01070 104148 105386 gene locus_tag LOCUS_01080 104148 105386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 106546 105437 gene locus_tag LOCUS_01090 gene csaB 106546 105437 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181502.1 protein_id gnl|my_center|LOCUS_01090 106729 107796 gene locus_tag LOCUS_01100 106729 107796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 107800 109287 gene locus_tag LOCUS_01110 107800 109287 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_01110 109511 111220 gene locus_tag LOCUS_01120 109511 111220 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_01120 111723 111229 gene locus_tag LOCUS_01130 111723 111229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 112262 111762 gene locus_tag LOCUS_01140 112262 111762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 112797 112288 gene locus_tag LOCUS_01150 112797 112288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 114214 112826 gene locus_tag LOCUS_01160 gene ccoN 114214 112826 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_01160 114394 115005 gene locus_tag LOCUS_01170 114394 115005 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_01170 115002 115775 gene locus_tag LOCUS_01180 115002 115775 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229549.1 protein_id gnl|my_center|LOCUS_01180 115821 116591 gene locus_tag LOCUS_01190 gene etfB 115821 116591 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029028.1 protein_id gnl|my_center|LOCUS_01190 116622 117599 gene locus_tag LOCUS_01200 gene etfA 116622 117599 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_01200 117861 118658 gene locus_tag LOCUS_01210 117861 118658 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975752.1 protein_id gnl|my_center|LOCUS_01210 118722 119486 gene locus_tag LOCUS_01220 gene fadH 118722 119486 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660904.1 protein_id gnl|my_center|LOCUS_01220 120233 119595 gene locus_tag LOCUS_01230 120233 119595 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016771.1 protein_id gnl|my_center|LOCUS_01230 121649 120252 gene locus_tag LOCUS_01240 121649 120252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 122265 121660 gene locus_tag LOCUS_01250 122265 121660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 123324 122401 gene locus_tag LOCUS_01260 123324 122401 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_01260 124344 123340 gene locus_tag LOCUS_01270 124344 123340 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583224.1 protein_id gnl|my_center|LOCUS_01270 126113 124473 gene locus_tag LOCUS_01280 126113 124473 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_01280 127166 126192 gene locus_tag LOCUS_01290 127166 126192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_01290 127324 128448 gene locus_tag LOCUS_01300 gene menC 127324 128448 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_01300 128441 129241 gene locus_tag LOCUS_01310 128441 129241 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 protein_id gnl|my_center|LOCUS_01310 129242 130366 gene locus_tag LOCUS_01320 129242 130366 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_01320 130402 131058 gene locus_tag LOCUS_01330 130402 131058 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01330 131273 131587 gene locus_tag LOCUS_01340 gene trxA 131273 131587 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222500.1 protein_id gnl|my_center|LOCUS_01340 131668 133443 gene locus_tag LOCUS_01350 gene uvrC 131668 133443 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246045.1 protein_id gnl|my_center|LOCUS_01350 134159 133713 gene locus_tag LOCUS_01360 134159 133713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 134416 134222 gene locus_tag LOCUS_01370 134416 134222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 134969 136207 gene locus_tag LOCUS_01380 134969 136207 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 protein_id gnl|my_center|LOCUS_01380 137133 136285 gene locus_tag LOCUS_01390 137133 136285 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393248.1 protein_id gnl|my_center|LOCUS_01390 137376 137203 gene locus_tag LOCUS_01400 137376 137203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 138126 137389 gene locus_tag LOCUS_01410 138126 137389 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_01410 138336 138611 gene locus_tag LOCUS_01420 138336 138611 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813757.1 protein_id gnl|my_center|LOCUS_01420 138697 139164 gene locus_tag LOCUS_01430 138697 139164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 140111 139263 gene locus_tag LOCUS_01440 140111 139263 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881142.1 protein_id gnl|my_center|LOCUS_01440 140761 140159 gene locus_tag LOCUS_01450 140761 140159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 141740 141036 gene locus_tag LOCUS_01460 141740 141036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 142434 142640 gene locus_tag LOCUS_01470 142434 142640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 142733 143095 gene locus_tag LOCUS_01480 142733 143095 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888656.1 protein_id gnl|my_center|LOCUS_01480 143228 143581 gene locus_tag LOCUS_01490 143228 143581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 143625 144002 gene locus_tag LOCUS_01500 143625 144002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 144048 144182 gene locus_tag LOCUS_01510 144048 144182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 145365 144289 gene locus_tag LOCUS_01520 gene aksF 145365 144289 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_01520 145523 145756 gene locus_tag LOCUS_01530 145523 145756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 145781 146110 gene locus_tag LOCUS_01540 145781 146110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 146167 147243 gene locus_tag LOCUS_01550 146167 147243 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727368.1 protein_id gnl|my_center|LOCUS_01550 147314 147904 gene locus_tag LOCUS_01560 147314 147904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 148047 149072 gene locus_tag LOCUS_01570 gene ccpA 148047 149072 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 protein_id gnl|my_center|LOCUS_01570 149211 149930 gene locus_tag LOCUS_01580 149211 149930 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421518.1 protein_id gnl|my_center|LOCUS_01580 150102 149905 gene locus_tag LOCUS_01590 150102 149905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 151293 150142 gene locus_tag LOCUS_01600 gene acuC 151293 150142 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 protein_id gnl|my_center|LOCUS_01600 151946 151314 gene locus_tag LOCUS_01610 gene acuA 151946 151314 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 protein_id gnl|my_center|LOCUS_01610 152256 151966 gene locus_tag LOCUS_01620 152256 151966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 152814 153539 gene locus_tag LOCUS_01630 152814 153539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 154184 153924 gene locus_tag LOCUS_01640 154184 153924 CDS product DUF4176 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531355.1 protein_id gnl|my_center|LOCUS_01640 154432 154232 gene locus_tag LOCUS_01650 154432 154232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 154835 154458 gene locus_tag LOCUS_01660 154835 154458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 155414 156697 gene locus_tag LOCUS_01670 gene tyrS 155414 156697 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_01670 157658 156894 gene locus_tag LOCUS_01680 157658 156894 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258316.1 protein_id gnl|my_center|LOCUS_01680 158241 157642 gene locus_tag LOCUS_01690 158241 157642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence002 94 1317 gene locus_tag LOCUS_01700 94 1317 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_01700 2389 1322 gene locus_tag LOCUS_01710 gene ddcP 2389 1322 CDS product protease DdcP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245451.1 protein_id gnl|my_center|LOCUS_01710 3180 2386 gene locus_tag LOCUS_01720 3180 2386 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662590.1 protein_id gnl|my_center|LOCUS_01720 3287 4513 gene locus_tag LOCUS_01730 gene ylbJ 3287 4513 CDS product sporulation integral membrane protein YlbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392455.1 protein_id gnl|my_center|LOCUS_01730 5005 4463 gene locus_tag LOCUS_01740 gene coaD 5005 4463 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_01740 5619 5002 gene locus_tag LOCUS_01750 gene rsmD 5619 5002 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266972.1 protein_id gnl|my_center|LOCUS_01750 6986 5901 gene locus_tag LOCUS_01760 6986 5901 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228181.1 protein_id gnl|my_center|LOCUS_01760 9211 7043 gene locus_tag LOCUS_01770 9211 7043 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856405.1 protein_id gnl|my_center|LOCUS_01770 9619 9392 gene locus_tag LOCUS_01780 9619 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 10042 11349 gene locus_tag LOCUS_01790 10042 11349 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528603.1 protein_id gnl|my_center|LOCUS_01790 11938 11408 gene locus_tag LOCUS_01800 11938 11408 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_01800 12367 11969 gene locus_tag LOCUS_01810 12367 11969 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606863.1 protein_id gnl|my_center|LOCUS_01810 13623 12364 gene locus_tag LOCUS_01820 13623 12364 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086395963.1 protein_id gnl|my_center|LOCUS_01820 13832 13626 gene locus_tag LOCUS_01830 13832 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 14016 14471 gene locus_tag LOCUS_01840 14016 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 15140 14601 gene locus_tag LOCUS_01850 15140 14601 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242591.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01850 18777 15520 gene locus_tag LOCUS_01860 18777 15520 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028469.1 protein_id gnl|my_center|LOCUS_01860 20984 18924 gene locus_tag LOCUS_01870 gene recG 20984 18924 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006884.1 protein_id gnl|my_center|LOCUS_01870 21925 21014 gene locus_tag LOCUS_01880 gene sdaAA 21925 21014 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 protein_id gnl|my_center|LOCUS_01880 22615 21950 gene locus_tag LOCUS_01890 gene sdaAB 22615 21950 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 protein_id gnl|my_center|LOCUS_01890 23577 22714 gene locus_tag LOCUS_01900 23577 22714 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_01900 24100 23627 gene locus_tag LOCUS_01910 24100 23627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 25109 24000 gene locus_tag LOCUS_01920 25109 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 25320 25508 gene locus_tag LOCUS_01930 gene rpmB 25320 25508 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517908.1 protein_id gnl|my_center|LOCUS_01930 25606 26847 gene locus_tag LOCUS_01940 gene yedE 25606 26847 CDS product selenium metabolism membrane protein YedE/FdhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096289.1 protein_id gnl|my_center|LOCUS_01940 26931 27113 gene locus_tag LOCUS_01950 26931 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 28084 27401 gene locus_tag LOCUS_01960 gene rpe 28084 27401 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_01960 28968 28087 gene locus_tag LOCUS_01970 gene rsgA 28968 28087 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_01970 30989 29010 gene locus_tag LOCUS_01980 gene pknB 30989 29010 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904747.1 protein_id gnl|my_center|LOCUS_01980 31741 30986 gene locus_tag LOCUS_01990 gene prpC 31741 30986 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_01990 32818 31748 gene locus_tag LOCUS_02000 gene rlmN 32818 31748 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_02000 34194 32815 gene locus_tag LOCUS_02010 gene rsmB 34194 32815 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_02010 35227 34268 gene locus_tag LOCUS_02020 gene fmt 35227 34268 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_02020 35728 35231 gene locus_tag LOCUS_02030 gene def 35728 35231 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_02030 38201 35757 gene locus_tag LOCUS_02040 gene priA 38201 35757 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_02040 39418 38198 gene locus_tag LOCUS_02050 gene coaBC 39418 38198 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 protein_id gnl|my_center|LOCUS_02050 39652 39446 gene locus_tag LOCUS_02060 gene rpoZ 39652 39446 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221520.1 protein_id gnl|my_center|LOCUS_02060 40272 39655 gene locus_tag LOCUS_02070 gene gmk 40272 39655 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232083.1 protein_id gnl|my_center|LOCUS_02070 40605 40333 gene locus_tag LOCUS_02080 40605 40333 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_02080 41503 40625 gene locus_tag LOCUS_02090 41503 40625 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_02090 42464 41601 gene locus_tag LOCUS_02100 gene dapF 42464 41601 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_02100 43009 42563 gene locus_tag LOCUS_02110 43009 42563 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096713.1 protein_id gnl|my_center|LOCUS_02110 43730 43140 gene locus_tag LOCUS_02120 43730 43140 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 protein_id gnl|my_center|LOCUS_02120 43982 45721 gene locus_tag LOCUS_02130 gene rqcH 43982 45721 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_02130 46229 45768 gene locus_tag LOCUS_02140 46229 45768 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_02140 46610 46266 gene locus_tag LOCUS_02150 46610 46266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 47369 46896 gene locus_tag LOCUS_02160 47369 46896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 48088 47366 gene locus_tag LOCUS_02170 48088 47366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 48323 50095 gene locus_tag LOCUS_02180 48323 50095 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_02180 50860 50195 gene locus_tag LOCUS_02190 gene pyrE 50860 50195 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288884.1 protein_id gnl|my_center|LOCUS_02190 51789 50917 gene locus_tag LOCUS_02200 51789 50917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 55010 51786 gene locus_tag LOCUS_02210 gene carB 55010 51786 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_02210 56094 54994 gene locus_tag LOCUS_02220 56094 54994 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_02220 57431 56139 gene locus_tag LOCUS_02230 57431 56139 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245035.1 protein_id gnl|my_center|LOCUS_02230 58438 57419 gene locus_tag LOCUS_02240 58438 57419 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245123.1 protein_id gnl|my_center|LOCUS_02240 59799 58465 gene locus_tag LOCUS_02250 gene uraA 59799 58465 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435928.1 protein_id gnl|my_center|LOCUS_02250 60563 60021 gene locus_tag LOCUS_02260 gene pyrR 60563 60021 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156487.1 protein_id gnl|my_center|LOCUS_02260 61727 60807 gene locus_tag LOCUS_02270 61727 60807 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_02270 62237 61785 gene locus_tag LOCUS_02280 gene lspA 62237 61785 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245047.1 protein_id gnl|my_center|LOCUS_02280 63069 62314 gene locus_tag LOCUS_02290 63069 62314 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957385.1 protein_id gnl|my_center|LOCUS_02290 63107 63514 gene locus_tag LOCUS_02300 63107 63514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 63898 63521 gene locus_tag LOCUS_02310 63898 63521 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_02310 66870 64084 gene locus_tag LOCUS_02320 gene ileS2 66870 64084 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455951.1 protein_id gnl|my_center|LOCUS_02320 67834 67358 gene locus_tag LOCUS_02330 gene divIVA 67834 67358 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_02330 68688 67912 gene locus_tag LOCUS_02340 68688 67912 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_02340 68963 68685 gene locus_tag LOCUS_02350 68963 68685 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214233.1 protein_id gnl|my_center|LOCUS_02350 69423 68986 gene locus_tag LOCUS_02360 gene sepF 69423 68986 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_02360 70161 69427 gene locus_tag LOCUS_02370 70161 69427 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 protein_id gnl|my_center|LOCUS_02370 71028 70216 gene locus_tag LOCUS_02380 gene pgeF 71028 70216 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209009.1 protein_id gnl|my_center|LOCUS_02380 71430 71149 gene locus_tag LOCUS_02390 71430 71149 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_02390 72337 71561 gene locus_tag LOCUS_02400 gene sigG 72337 71561 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_02400 73126 72404 gene locus_tag LOCUS_02410 gene sigE 73126 72404 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_02410 74019 73105 gene locus_tag LOCUS_02420 gene spoIIGA 74019 73105 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_02420 75264 74185 gene locus_tag LOCUS_02430 gene ftsZ 75264 74185 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_02430 76512 75277 gene locus_tag LOCUS_02440 gene ftsA 76512 75277 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087558.1 protein_id gnl|my_center|LOCUS_02440 77400 76657 gene locus_tag LOCUS_02450 77400 76657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 78425 77505 gene locus_tag LOCUS_02460 gene murB 78425 77505 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437038.1 protein_id gnl|my_center|LOCUS_02460 79624 78512 gene locus_tag LOCUS_02470 gene murG 79624 78512 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_02470 80762 79668 gene locus_tag LOCUS_02480 gene spoVE 80762 79668 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_02480 82197 80818 gene locus_tag LOCUS_02490 gene murD 82197 80818 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860115.1 protein_id gnl|my_center|LOCUS_02490 83159 82194 gene locus_tag LOCUS_02500 gene mraY 83159 82194 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_02500 84539 83172 gene locus_tag LOCUS_02510 84539 83172 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_02510 86002 84533 gene locus_tag LOCUS_02520 gene murE 86002 84533 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_02520 88107 86143 gene locus_tag LOCUS_02530 88107 86143 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_02530 90298 88208 gene locus_tag LOCUS_02540 90298 88208 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_02540 90685 90314 gene locus_tag LOCUS_02550 90685 90314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 91656 90682 gene locus_tag LOCUS_02560 gene rsmH 91656 90682 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355891.1 protein_id gnl|my_center|LOCUS_02560 92125 91694 gene locus_tag LOCUS_02570 gene mraZ 92125 91694 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221402.1 protein_id gnl|my_center|LOCUS_02570 93170 92406 gene locus_tag LOCUS_02580 93170 92406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 94791 93547 gene locus_tag LOCUS_02590 94791 93547 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_02590 96448 94829 gene locus_tag LOCUS_02600 gene bshC 96448 94829 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403059.1 protein_id gnl|my_center|LOCUS_02600 97596 96589 gene locus_tag LOCUS_02610 97596 96589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 99347 97782 gene locus_tag LOCUS_02620 99347 97782 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566963.1 protein_id gnl|my_center|LOCUS_02620 100307 99405 gene locus_tag LOCUS_02630 gene ldeG 100307 99405 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 protein_id gnl|my_center|LOCUS_02630 100506 100312 gene locus_tag LOCUS_02640 100506 100312 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985297.1 protein_id gnl|my_center|LOCUS_02640 101897 100524 gene locus_tag LOCUS_02650 101897 100524 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231523.1 protein_id gnl|my_center|LOCUS_02650 102657 102061 gene locus_tag LOCUS_02660 102657 102061 CDS product RsfA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868358.1 protein_id gnl|my_center|LOCUS_02660 102897 103181 gene locus_tag LOCUS_02670 102897 103181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 104332 103178 gene locus_tag LOCUS_02680 104332 103178 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941144.1 protein_id gnl|my_center|LOCUS_02680 104637 104485 gene locus_tag LOCUS_02690 104637 104485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 105356 104724 gene locus_tag LOCUS_02700 105356 104724 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_02700 105486 106130 gene locus_tag LOCUS_02710 105486 106130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 106127 106903 gene locus_tag LOCUS_02720 106127 106903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 108247 106916 gene locus_tag LOCUS_02730 108247 106916 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 protein_id gnl|my_center|LOCUS_02730 108451 109023 gene locus_tag LOCUS_02740 108451 109023 CDS product YhcN/YlaJ family sporulation lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232269.1 protein_id gnl|my_center|LOCUS_02740 109534 109082 gene locus_tag LOCUS_02750 109534 109082 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024593.1 protein_id gnl|my_center|LOCUS_02750 110686 109622 gene locus_tag LOCUS_02760 110686 109622 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582789.1 protein_id gnl|my_center|LOCUS_02760 110790 111149 gene locus_tag LOCUS_02770 110790 111149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 111227 111427 gene locus_tag LOCUS_02780 111227 111427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 111756 111481 gene locus_tag LOCUS_02790 111756 111481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258143.1 protein_id gnl|my_center|LOCUS_02790 112043 111753 gene locus_tag LOCUS_02800 112043 111753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 112890 112051 gene locus_tag LOCUS_02810 112890 112051 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence003 1113 841 gene locus_tag LOCUS_02820 1113 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 1484 1278 gene locus_tag LOCUS_02830 1484 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2473 2108 gene locus_tag LOCUS_02840 2473 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4622 2700 gene locus_tag LOCUS_02850 gene selB 4622 2700 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_02850 5845 4619 gene locus_tag LOCUS_02860 5845 4619 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179295.1 protein_id gnl|my_center|LOCUS_02860 6054 6150 gene locus_tag LOCUS_t00010 6054 6150 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 7549 6278 gene locus_tag LOCUS_02870 7549 6278 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_02870 9100 7676 gene locus_tag LOCUS_02880 gene selA 9100 7676 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_02880 9672 9238 gene locus_tag LOCUS_02890 9672 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 9909 10355 gene locus_tag LOCUS_02900 gene queF 9909 10355 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080885.1 protein_id gnl|my_center|LOCUS_02900 10374 10649 gene locus_tag LOCUS_02910 10374 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10646 11239 gene locus_tag LOCUS_02920 10646 11239 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228739.1 protein_id gnl|my_center|LOCUS_02920 11748 12113 gene locus_tag LOCUS_02930 11748 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 12337 12501 gene locus_tag LOCUS_02940 12337 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 12524 13855 gene locus_tag LOCUS_02950 12524 13855 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015312606.1 protein_id gnl|my_center|LOCUS_02950 13981 14160 gene locus_tag LOCUS_02960 13981 14160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 14133 14507 gene locus_tag LOCUS_02970 14133 14507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 14419 15702 gene locus_tag LOCUS_02980 14419 15702 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867672.1 protein_id gnl|my_center|LOCUS_02980 15718 17127 gene locus_tag LOCUS_02990 15718 17127 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_02990 18095 17178 gene locus_tag LOCUS_03000 18095 17178 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_03000 19612 18137 gene locus_tag LOCUS_03010 gene murJ 19612 18137 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391760.1 protein_id gnl|my_center|LOCUS_03010 19842 20336 gene locus_tag LOCUS_03020 19842 20336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 20358 20834 gene locus_tag LOCUS_03030 20358 20834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 21000 22328 gene locus_tag LOCUS_03040 21000 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 22318 23352 gene locus_tag LOCUS_03050 22318 23352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 23626 24789 gene locus_tag LOCUS_03060 23626 24789 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_03060 24928 25710 gene locus_tag LOCUS_03070 24928 25710 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_03070 25836 27170 gene locus_tag LOCUS_03080 25836 27170 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173427597.1 protein_id gnl|my_center|LOCUS_03080 27281 28597 gene locus_tag LOCUS_03090 27281 28597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 28837 30735 gene locus_tag LOCUS_03100 28837 30735 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353273.1 protein_id gnl|my_center|LOCUS_03100 30772 31911 gene locus_tag LOCUS_03110 gene yhbH 30772 31911 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 protein_id gnl|my_center|LOCUS_03110 31939 33366 gene locus_tag LOCUS_03120 gene spoVR 31939 33366 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202693.1 protein_id gnl|my_center|LOCUS_03120 33497 33688 gene locus_tag LOCUS_03130 33497 33688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 34015 34740 gene locus_tag LOCUS_03140 34015 34740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 35331 34855 gene locus_tag LOCUS_03150 35331 34855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 36623 35328 gene locus_tag LOCUS_03160 36623 35328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 38022 36670 gene locus_tag LOCUS_03170 38022 36670 CDS product YheC/YheD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658112.1 protein_id gnl|my_center|LOCUS_03170 39137 38019 gene locus_tag LOCUS_03180 gene spaC 39137 38019 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_03180 40537 39116 gene locus_tag LOCUS_03190 40537 39116 CDS product YheC/YheD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658112.1 protein_id gnl|my_center|LOCUS_03190 40636 41787 gene locus_tag LOCUS_03200 40636 41787 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082738.1 protein_id gnl|my_center|LOCUS_03200 41935 42624 gene locus_tag LOCUS_03210 41935 42624 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_03210 42673 43335 gene locus_tag LOCUS_03220 42673 43335 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976466.1 protein_id gnl|my_center|LOCUS_03220 43727 43413 gene locus_tag LOCUS_03230 43727 43413 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807927.1 protein_id gnl|my_center|LOCUS_03230 44476 43724 gene locus_tag LOCUS_03240 44476 43724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 44626 45180 gene locus_tag LOCUS_03250 44626 45180 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391311.1 protein_id gnl|my_center|LOCUS_03250 45294 46604 gene locus_tag LOCUS_03260 45294 46604 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201587.1 protein_id gnl|my_center|LOCUS_03260 46870 46682 gene locus_tag LOCUS_03270 46870 46682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 47449 46955 gene locus_tag LOCUS_03280 47449 46955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 47781 47449 gene locus_tag LOCUS_03290 47781 47449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 47915 51502 gene locus_tag LOCUS_03300 47915 51502 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_03300 51581 52840 gene locus_tag LOCUS_03310 gene maeB 51581 52840 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_03310 52959 53144 gene locus_tag LOCUS_03320 52959 53144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393369.1 protein_id gnl|my_center|LOCUS_03320 53177 54079 gene locus_tag LOCUS_03330 gene accD 53177 54079 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 protein_id gnl|my_center|LOCUS_03330 54076 55050 gene locus_tag LOCUS_03340 54076 55050 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 protein_id gnl|my_center|LOCUS_03340 55181 56140 gene locus_tag LOCUS_03350 gene pfkA 55181 56140 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821163.1 protein_id gnl|my_center|LOCUS_03350 56155 57909 gene locus_tag LOCUS_03360 gene pyk 56155 57909 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_03360 57958 58413 gene locus_tag LOCUS_03370 57958 58413 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_03370 58424 58879 gene locus_tag LOCUS_03380 58424 58879 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941471.1 protein_id gnl|my_center|LOCUS_03380 58915 59574 gene locus_tag LOCUS_03390 58915 59574 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831017.1 protein_id gnl|my_center|LOCUS_03390 60708 59587 gene locus_tag LOCUS_03400 gene ytvI 60708 59587 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081398.1 protein_id gnl|my_center|LOCUS_03400 60962 62077 gene locus_tag LOCUS_03410 gene citZ 60962 62077 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_03410 62130 63428 gene locus_tag LOCUS_03420 gene icd 62130 63428 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_03420 63441 64382 gene locus_tag LOCUS_03430 gene mdh 63441 64382 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153230.1 protein_id gnl|my_center|LOCUS_03430 64763 66415 gene locus_tag LOCUS_03440 gene oppA 64763 66415 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232957.1 protein_id gnl|my_center|LOCUS_03440 66550 67482 gene locus_tag LOCUS_03450 gene dppB 66550 67482 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245446.1 protein_id gnl|my_center|LOCUS_03450 67485 68426 gene locus_tag LOCUS_03460 gene dppC 67485 68426 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 protein_id gnl|my_center|LOCUS_03460 68440 69453 gene locus_tag LOCUS_03470 68440 69453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966892.1 protein_id gnl|my_center|LOCUS_03470 69450 70448 gene locus_tag LOCUS_03480 69450 70448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_03480 70900 70505 gene locus_tag LOCUS_03490 70900 70505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 71037 71741 gene locus_tag LOCUS_03500 71037 71741 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 protein_id gnl|my_center|LOCUS_03500 71738 73063 gene locus_tag LOCUS_03510 71738 73063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 73218 75890 gene locus_tag LOCUS_03520 gene polA 73218 75890 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_03520 75938 76762 gene locus_tag LOCUS_03530 gene mutM 75938 76762 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_03530 76779 77375 gene locus_tag LOCUS_03540 gene coaE 76779 77375 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_03540 77372 77962 gene locus_tag LOCUS_03550 77372 77962 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_03550 78143 79174 gene locus_tag LOCUS_03560 78143 79174 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 protein_id gnl|my_center|LOCUS_03560 79316 80152 gene locus_tag LOCUS_03570 gene speE 79316 80152 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393316.1 protein_id gnl|my_center|LOCUS_03570 80405 80809 gene locus_tag LOCUS_03580 gene speD 80405 80809 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223584.1 protein_id gnl|my_center|LOCUS_03580 80962 81432 gene locus_tag LOCUS_03590 gene nrdR 80962 81432 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 protein_id gnl|my_center|LOCUS_03590 81497 82975 gene locus_tag LOCUS_03600 81497 82975 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415039.1 protein_id gnl|my_center|LOCUS_03600 82976 83923 gene locus_tag LOCUS_03610 gene dnaI 82976 83923 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808621.1 protein_id gnl|my_center|LOCUS_03610 84041 84116 gene locus_tag LOCUS_t00020 84041 84116 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 84123 84199 gene locus_tag LOCUS_t00030 84123 84199 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 84208 84283 gene locus_tag LOCUS_t00040 84208 84283 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 84297 84371 gene locus_tag LOCUS_t00050 84297 84371 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 84617 85729 gene locus_tag LOCUS_03620 gene mqnC 84617 85729 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_03620 85823 86785 gene locus_tag LOCUS_03630 85823 86785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence004 184 1335 gene locus_tag LOCUS_03640 184 1335 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158673.1 protein_id gnl|my_center|LOCUS_03640 1436 2782 gene locus_tag LOCUS_03650 1436 2782 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_03650 2938 3771 gene locus_tag LOCUS_03660 gene lipM 2938 3771 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398586.1 protein_id gnl|my_center|LOCUS_03660 3845 6124 gene locus_tag LOCUS_03670 gene mrfA 3845 6124 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_03670 6108 7418 gene locus_tag LOCUS_03680 gene mrfB 6108 7418 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_03680 8310 7459 gene locus_tag LOCUS_03690 gene dat 8310 7459 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233305.1 protein_id gnl|my_center|LOCUS_03690 8619 12293 gene locus_tag LOCUS_03700 8619 12293 CDS product ribonucleotide reductase N-terminal alpha domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459011.1 protein_id gnl|my_center|LOCUS_03700 12433 13218 gene locus_tag LOCUS_03710 gene codY 12433 13218 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 protein_id gnl|my_center|LOCUS_03710 13337 13897 gene locus_tag LOCUS_03720 13337 13897 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391683.1 protein_id gnl|my_center|LOCUS_03720 14070 14537 gene locus_tag LOCUS_03730 gene mntR 14070 14537 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143076.1 protein_id gnl|my_center|LOCUS_03730 14567 15487 gene locus_tag LOCUS_03740 14567 15487 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686827.1 protein_id gnl|my_center|LOCUS_03740 15865 15560 gene locus_tag LOCUS_03750 15865 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 16762 15872 gene locus_tag LOCUS_03760 16762 15872 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807121.1 protein_id gnl|my_center|LOCUS_03760 16981 17484 gene locus_tag LOCUS_03770 16981 17484 CDS product YqhR family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230222.1 protein_id gnl|my_center|LOCUS_03770 17605 18063 gene locus_tag LOCUS_03780 gene aroQ 17605 18063 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_03780 18060 19148 gene locus_tag LOCUS_03790 gene pepQ 18060 19148 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_03790 19183 19740 gene locus_tag LOCUS_03800 gene efp 19183 19740 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226377.1 protein_id gnl|my_center|LOCUS_03800 20301 19858 gene locus_tag LOCUS_03810 20301 19858 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_03810 21725 20928 gene locus_tag LOCUS_03820 gene thiG 21725 20928 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931981.1 protein_id gnl|my_center|LOCUS_03820 21934 21731 gene locus_tag LOCUS_03830 21934 21731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03830 23100 21931 gene locus_tag LOCUS_03840 gene thiO 23100 21931 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335173.1 protein_id gnl|my_center|LOCUS_03840 23788 23120 gene locus_tag LOCUS_03850 gene thiE 23788 23120 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276331.1 protein_id gnl|my_center|LOCUS_03850 24904 24077 gene locus_tag LOCUS_03860 24904 24077 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245342.1 protein_id gnl|my_center|LOCUS_03860 25106 26839 gene locus_tag LOCUS_03870 gene acsA 25106 26839 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_03870 26992 27228 gene locus_tag LOCUS_03880 26992 27228 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831262.1 protein_id gnl|my_center|LOCUS_03880 28464 27334 gene locus_tag LOCUS_03890 28464 27334 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832881.1 protein_id gnl|my_center|LOCUS_03890 29548 28433 gene locus_tag LOCUS_03900 29548 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 31057 29615 gene locus_tag LOCUS_03910 31057 29615 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802302.1 protein_id gnl|my_center|LOCUS_03910 31545 32225 gene locus_tag LOCUS_03920 31545 32225 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526210.1 protein_id gnl|my_center|LOCUS_03920 32342 32983 gene locus_tag LOCUS_03930 32342 32983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 33086 33463 gene locus_tag LOCUS_03940 33086 33463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 34106 33543 gene locus_tag LOCUS_03950 34106 33543 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880077.1 protein_id gnl|my_center|LOCUS_03950 34781 34287 gene locus_tag LOCUS_03960 34781 34287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 35103 35384 gene locus_tag LOCUS_03970 gene groES 35103 35384 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_03970 35434 37050 gene locus_tag LOCUS_03980 gene groEL 35434 37050 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029999.1 protein_id gnl|my_center|LOCUS_03980 37456 37139 gene locus_tag LOCUS_03990 37456 37139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 37789 38904 gene locus_tag LOCUS_04000 37789 38904 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_04000 38906 40285 gene locus_tag LOCUS_04010 38906 40285 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868152.1 protein_id gnl|my_center|LOCUS_04010 40340 41527 gene locus_tag LOCUS_04020 40340 41527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 protein_id gnl|my_center|LOCUS_04020 42225 41569 gene locus_tag LOCUS_04030 42225 41569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 42424 43134 gene locus_tag LOCUS_04040 gene cwlD 42424 43134 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_04040 43168 44601 gene locus_tag LOCUS_04050 gene rsmF 43168 44601 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_04050 44864 45193 gene locus_tag LOCUS_04060 44864 45193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 45223 47730 gene locus_tag LOCUS_04070 45223 47730 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 protein_id gnl|my_center|LOCUS_04070 48301 48990 gene locus_tag LOCUS_04080 48301 48990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 49020 50693 gene locus_tag LOCUS_04090 49020 50693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 50733 51818 gene locus_tag LOCUS_04100 50733 51818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 51815 52639 gene locus_tag LOCUS_04110 gene cobK 51815 52639 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 protein_id gnl|my_center|LOCUS_04110 52602 53249 gene locus_tag LOCUS_04120 52602 53249 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_04120 53246 54334 gene locus_tag LOCUS_04130 53246 54334 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258428.1 protein_id gnl|my_center|LOCUS_04130 54321 55670 gene locus_tag LOCUS_04140 54321 55670 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_04140 55667 56380 gene locus_tag LOCUS_04150 gene cobI 55667 56380 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 protein_id gnl|my_center|LOCUS_04150 56377 57189 gene locus_tag LOCUS_04160 gene cobM 56377 57189 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258425.1 protein_id gnl|my_center|LOCUS_04160 57186 58391 gene locus_tag LOCUS_04170 57186 58391 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828196.1 protein_id gnl|my_center|LOCUS_04170 58388 59851 gene locus_tag LOCUS_04180 58388 59851 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_04180 60015 60848 gene locus_tag LOCUS_04190 60015 60848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_04190 62116 61427 gene locus_tag LOCUS_04200 62116 61427 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393114.1 protein_id gnl|my_center|LOCUS_04200 62335 62739 gene locus_tag LOCUS_04210 62335 62739 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_04210 62856 64088 gene locus_tag LOCUS_04220 62856 64088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04220 64016 64723 gene locus_tag LOCUS_04230 64016 64723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 65451 64882 gene locus_tag LOCUS_04240 gene cotJC 65451 64882 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_04240 65812 65528 gene locus_tag LOCUS_04250 gene cotJB 65812 65528 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_04250 66095 65793 gene locus_tag LOCUS_04260 66095 65793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 66058 66291 gene locus_tag LOCUS_04270 66058 66291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 66733 66341 gene locus_tag LOCUS_04280 66733 66341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 68478 67258 gene locus_tag LOCUS_04290 gene dinB 68478 67258 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_04290 69348 68674 gene locus_tag LOCUS_04300 69348 68674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 69450 70049 gene locus_tag LOCUS_04310 69450 70049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 70483 70100 gene locus_tag LOCUS_04320 70483 70100 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092321.1 protein_id gnl|my_center|LOCUS_04320 70828 70511 gene locus_tag LOCUS_04330 gene trxA 70828 70511 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007598398.1 protein_id gnl|my_center|LOCUS_04330 71041 71817 gene locus_tag LOCUS_04340 71041 71817 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 protein_id gnl|my_center|LOCUS_04340 71848 72456 gene locus_tag LOCUS_04350 71848 72456 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041261.1 protein_id gnl|my_center|LOCUS_04350 73773 72436 gene locus_tag LOCUS_04360 73773 72436 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234126.1 protein_id gnl|my_center|LOCUS_04360 74010 74336 gene locus_tag LOCUS_04370 74010 74336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 74336 74908 gene locus_tag LOCUS_04380 74336 74908 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023951.1 protein_id gnl|my_center|LOCUS_04380 74972 75376 gene locus_tag LOCUS_04390 74972 75376 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437722.1 protein_id gnl|my_center|LOCUS_04390 75403 76548 gene locus_tag LOCUS_04400 75403 76548 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101329.1 protein_id gnl|my_center|LOCUS_04400 76573 76797 gene locus_tag LOCUS_04410 76573 76797 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182462.1 protein_id gnl|my_center|LOCUS_04410 76950 77345 gene locus_tag LOCUS_04420 76950 77345 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014828146.1 protein_id gnl|my_center|LOCUS_04420 77418 77891 gene locus_tag LOCUS_04430 77418 77891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 77976 78245 gene locus_tag LOCUS_04440 77976 78245 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456206.1 protein_id gnl|my_center|LOCUS_04440 78790 78311 gene locus_tag LOCUS_04450 78790 78311 CDS product DUF1885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163307.1 protein_id gnl|my_center|LOCUS_04450 79883 78858 gene locus_tag LOCUS_04460 79883 78858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 80078 80374 gene locus_tag LOCUS_04470 80078 80374 CDS product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462038.1 protein_id gnl|my_center|LOCUS_04470 80517 80645 gene locus_tag LOCUS_04480 80517 80645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 82280 80808 gene locus_tag LOCUS_04490 gene speA 82280 80808 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084882.1 protein_id gnl|my_center|LOCUS_04490 82424 83017 gene locus_tag LOCUS_04500 82424 83017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 83136 84104 gene locus_tag LOCUS_04510 gene xerD 83136 84104 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965366.1 protein_id gnl|my_center|LOCUS_04510 84168 84413 gene locus_tag LOCUS_04520 84168 84413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 85539 85111 gene locus_tag LOCUS_04530 85539 85111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence005 1023 58 gene locus_tag LOCUS_04540 gene hepT 1023 58 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 protein_id gnl|my_center|LOCUS_04540 1931 1059 gene locus_tag LOCUS_04550 1931 1059 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393345.1 protein_id gnl|my_center|LOCUS_04550 2533 1928 gene locus_tag LOCUS_04560 2533 1928 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_04560 3414 2530 gene locus_tag LOCUS_04570 gene ubiA 3414 2530 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_04570 4858 3401 gene locus_tag LOCUS_04580 4858 3401 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_04580 5638 4898 gene locus_tag LOCUS_04590 gene menG 5638 4898 CDS product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187674.1 protein_id gnl|my_center|LOCUS_04590 6531 5677 gene locus_tag LOCUS_04600 6531 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7100 6588 gene locus_tag LOCUS_04610 7100 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 7454 7215 gene locus_tag LOCUS_04620 gene mtrB 7454 7215 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_04620 7791 7715 gene locus_tag LOCUS_t00060 7791 7715 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8536 7943 gene locus_tag LOCUS_04630 gene folE 8536 7943 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_04630 8926 8654 gene locus_tag LOCUS_04640 8926 8654 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_04640 10545 9067 gene locus_tag LOCUS_04650 gene spoIVA 10545 9067 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_04650 11427 10585 gene locus_tag LOCUS_04660 11427 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 protein_id gnl|my_center|LOCUS_04660 11619 11440 gene locus_tag LOCUS_04670 11619 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 11803 11642 gene locus_tag LOCUS_04680 11803 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 11911 12306 gene locus_tag LOCUS_04690 11911 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 12749 12471 gene locus_tag LOCUS_04700 12749 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13850 12813 gene locus_tag LOCUS_04710 gene gpsA 13850 12813 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_04710 14468 13863 gene locus_tag LOCUS_04720 gene plsY 14468 13863 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_04720 15795 14482 gene locus_tag LOCUS_04730 gene der 15795 14482 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_04730 16375 15890 gene locus_tag LOCUS_04740 16375 15890 CDS product DUF3189 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392838.1 protein_id gnl|my_center|LOCUS_04740 16628 16353 gene locus_tag LOCUS_04750 16628 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 16828 16634 gene locus_tag LOCUS_04760 16828 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 17753 16860 gene locus_tag LOCUS_04770 17753 16860 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141596.1 protein_id gnl|my_center|LOCUS_04770 18361 17735 gene locus_tag LOCUS_04780 18361 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 19467 18412 gene locus_tag LOCUS_04790 19467 18412 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251056.1 protein_id gnl|my_center|LOCUS_04790 20636 19488 gene locus_tag LOCUS_04800 gene rpsA 20636 19488 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230556.1 protein_id gnl|my_center|LOCUS_04800 21488 20835 gene locus_tag LOCUS_04810 21488 20835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 22170 21490 gene locus_tag LOCUS_04820 gene cmk 22170 21490 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_04820 22609 22364 gene locus_tag LOCUS_04830 22609 22364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 23341 22673 gene locus_tag LOCUS_04840 gene dgrA 23341 22673 CDS product cyclic di-GMP receptor DgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230551.1 protein_id gnl|my_center|LOCUS_04840 24916 23555 gene locus_tag LOCUS_04850 gene ypeB 24916 23555 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943704.1 protein_id gnl|my_center|LOCUS_04850 25365 25123 gene locus_tag LOCUS_04860 25365 25123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 25453 26430 gene locus_tag LOCUS_04870 gene ansA 25453 26430 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822018.1 protein_id gnl|my_center|LOCUS_04870 27254 26433 gene locus_tag LOCUS_04880 27254 26433 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_04880 27439 30174 gene locus_tag LOCUS_04890 gene acnA 27439 30174 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228149.1 protein_id gnl|my_center|LOCUS_04890 31602 30298 gene locus_tag LOCUS_04900 gene gudB 31602 30298 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225172.1 protein_id gnl|my_center|LOCUS_04900 32083 31709 gene locus_tag LOCUS_04910 32083 31709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 33036 32089 gene locus_tag LOCUS_04920 33036 32089 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 protein_id gnl|my_center|LOCUS_04920 33162 33980 gene locus_tag LOCUS_04930 33162 33980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 34505 33924 gene locus_tag LOCUS_04940 34505 33924 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235392.1 protein_id gnl|my_center|LOCUS_04940 34916 34629 gene locus_tag LOCUS_04950 34916 34629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 35465 35031 gene locus_tag LOCUS_04960 35465 35031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 37065 35626 gene locus_tag LOCUS_04970 37065 35626 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257259.1 protein_id gnl|my_center|LOCUS_04970 38708 37182 gene locus_tag LOCUS_04980 38708 37182 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_04980 39852 38731 gene locus_tag LOCUS_04990 39852 38731 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167004.1 protein_id gnl|my_center|LOCUS_04990 39994 41589 gene locus_tag LOCUS_05000 39994 41589 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541476.1 protein_id gnl|my_center|LOCUS_05000 41586 42758 gene locus_tag LOCUS_05010 41586 42758 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231622.1 protein_id gnl|my_center|LOCUS_05010 42776 44266 gene locus_tag LOCUS_05020 42776 44266 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393514.1 protein_id gnl|my_center|LOCUS_05020 44297 45478 gene locus_tag LOCUS_05030 gene gerBB 44297 45478 CDS product spore germination protein GerBB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244581.1 protein_id gnl|my_center|LOCUS_05030 45475 46623 gene locus_tag LOCUS_05040 45475 46623 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_05040 46713 47210 gene locus_tag LOCUS_05050 46713 47210 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_05050 47561 47328 gene locus_tag LOCUS_05060 47561 47328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 48261 49442 gene locus_tag LOCUS_05070 48261 49442 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_05070 49408 50991 gene locus_tag LOCUS_05080 gene serA 49408 50991 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391569.1 protein_id gnl|my_center|LOCUS_05080 51398 51042 gene locus_tag LOCUS_05090 51398 51042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 53306 51441 gene locus_tag LOCUS_05100 gene resE 53306 51441 CDS product sensor histidine kinase ResE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230520.1 protein_id gnl|my_center|LOCUS_05100 54031 53303 gene locus_tag LOCUS_05110 gene resD 54031 53303 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246107.1 protein_id gnl|my_center|LOCUS_05110 55280 54045 gene locus_tag LOCUS_05120 gene resC 55280 54045 CDS product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250084.1 protein_id gnl|my_center|LOCUS_05120 56899 55277 gene locus_tag LOCUS_05130 gene resB 56899 55277 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 protein_id gnl|my_center|LOCUS_05130 57976 57023 gene locus_tag LOCUS_05140 57976 57023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 58614 58060 gene locus_tag LOCUS_05150 58614 58060 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_05150 59257 58679 gene locus_tag LOCUS_05160 gene spmA 59257 58679 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 protein_id gnl|my_center|LOCUS_05160 60381 59254 gene locus_tag LOCUS_05170 gene dacB 60381 59254 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230505.1 protein_id gnl|my_center|LOCUS_05170 61012 60434 gene locus_tag LOCUS_05180 gene scpB 61012 60434 CDS product segregation/condensation protein ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375167.1 protein_id gnl|my_center|LOCUS_05180 61772 60981 gene locus_tag LOCUS_05190 gene scpA 61772 60981 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_05190 62465 61818 gene locus_tag LOCUS_05200 62465 61818 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811062.1 protein_id gnl|my_center|LOCUS_05200 62945 62478 gene locus_tag LOCUS_05210 gene ribH 62945 62478 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_05210 64212 63016 gene locus_tag LOCUS_05220 gene ribBA 64212 63016 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469013.1 protein_id gnl|my_center|LOCUS_05220 65013 64336 gene locus_tag LOCUS_05230 gene ribE 65013 64336 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493908.1 protein_id gnl|my_center|LOCUS_05230 66166 64994 gene locus_tag LOCUS_05240 gene ribD 66166 64994 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741110.1 protein_id gnl|my_center|LOCUS_05240 70229 66696 gene locus_tag LOCUS_05250 70229 66696 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_05250 71680 70310 gene locus_tag LOCUS_05260 71680 70310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202946090.1 protein_id gnl|my_center|LOCUS_05260 73842 71677 gene locus_tag LOCUS_05270 73842 71677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 >Feature sequence006 <1 1088 gene locus_tag LOCUS_05280 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541080.1:helicase-related protein 1345 1899 gene locus_tag LOCUS_05290 1345 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392199.1 protein_id gnl|my_center|LOCUS_05290 1896 2153 gene locus_tag LOCUS_05300 1896 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2169 2585 gene locus_tag LOCUS_05310 2169 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2846 3469 gene locus_tag LOCUS_05320 2846 3469 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_05320 3482 3955 gene locus_tag LOCUS_05330 3482 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4128 4469 gene locus_tag LOCUS_05340 4128 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4503 4997 gene locus_tag LOCUS_05350 4503 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 5049 6596 gene locus_tag LOCUS_05360 gene flgK 5049 6596 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_05360 6611 7507 gene locus_tag LOCUS_05370 gene flgL 6611 7507 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_05370 7520 8095 gene locus_tag LOCUS_05380 7520 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8164 8619 gene locus_tag LOCUS_05390 gene fliW 8164 8619 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228007.1 protein_id gnl|my_center|LOCUS_05390 8619 8888 gene locus_tag LOCUS_05400 8619 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 9071 10687 gene locus_tag LOCUS_05410 9071 10687 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337967.1 protein_id gnl|my_center|LOCUS_05410 10829 11203 gene locus_tag LOCUS_05420 10829 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11222 12751 gene locus_tag LOCUS_05430 11222 12751 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242960.1 protein_id gnl|my_center|LOCUS_05430 12748 13149 gene locus_tag LOCUS_05440 gene fliS 12748 13149 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392287.1 protein_id gnl|my_center|LOCUS_05440 13146 13580 gene locus_tag LOCUS_05450 13146 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 13692 14279 gene locus_tag LOCUS_05460 13692 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 14646 15452 gene locus_tag LOCUS_05470 14646 15452 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222181.1 protein_id gnl|my_center|LOCUS_05470 15606 16262 gene locus_tag LOCUS_05480 15606 16262 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705158.1 protein_id gnl|my_center|LOCUS_05480 16722 17522 gene locus_tag LOCUS_05490 16722 17522 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689749.1 protein_id gnl|my_center|LOCUS_05490 17713 17913 gene locus_tag LOCUS_05500 17713 17913 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_05500 18100 18654 gene locus_tag LOCUS_05510 gene raiA 18100 18654 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357293.1 protein_id gnl|my_center|LOCUS_05510 18825 21344 gene locus_tag LOCUS_05520 gene secA 18825 21344 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_05520 21591 22601 gene locus_tag LOCUS_05530 gene prfB 21591 22601 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 protein_id gnl|my_center|LOCUS_05530 22677 23570 gene locus_tag LOCUS_05540 22677 23570 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_05540 23583 24476 gene locus_tag LOCUS_05550 23583 24476 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_05550 24520 24879 gene locus_tag LOCUS_05560 24520 24879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 25115 26149 gene locus_tag LOCUS_05570 gene argC 25115 26149 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598482.1 protein_id gnl|my_center|LOCUS_05570 26166 27461 gene locus_tag LOCUS_05580 gene argJ 26166 27461 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163580248.1 protein_id gnl|my_center|LOCUS_05580 27478 28308 gene locus_tag LOCUS_05590 gene argB 27478 28308 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082330.1 protein_id gnl|my_center|LOCUS_05590 28295 29485 gene locus_tag LOCUS_05600 28295 29485 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_05600 29526 30602 gene locus_tag LOCUS_05610 29526 30602 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723080.1 protein_id gnl|my_center|LOCUS_05610 30595 33855 gene locus_tag LOCUS_05620 gene carB 30595 33855 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392401.1 protein_id gnl|my_center|LOCUS_05620 33852 34835 gene locus_tag LOCUS_05630 gene argF 33852 34835 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_05630 35042 36316 gene locus_tag LOCUS_05640 35042 36316 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057897531.1 protein_id gnl|my_center|LOCUS_05640 36313 37734 gene locus_tag LOCUS_05650 gene argH 36313 37734 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041296.1 protein_id gnl|my_center|LOCUS_05650 37908 38033 gene locus_tag LOCUS_05660 37908 38033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 38086 38469 gene locus_tag LOCUS_05670 38086 38469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 38584 39564 gene locus_tag LOCUS_05680 38584 39564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 39639 40334 gene locus_tag LOCUS_05690 39639 40334 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_05690 41438 40470 gene locus_tag LOCUS_05700 41438 40470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05700 42250 41435 gene locus_tag LOCUS_05710 42250 41435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 44024 42204 gene locus_tag LOCUS_05720 44024 42204 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 protein_id gnl|my_center|LOCUS_05720 44286 44834 gene locus_tag LOCUS_05730 44286 44834 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816782.1 protein_id gnl|my_center|LOCUS_05730 45144 45830 gene locus_tag LOCUS_05740 gene ftsE 45144 45830 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_05740 45820 46713 gene locus_tag LOCUS_05750 gene ftsX 45820 46713 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 protein_id gnl|my_center|LOCUS_05750 46790 48028 gene locus_tag LOCUS_05760 46790 48028 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_05760 48141 49634 gene locus_tag LOCUS_05770 48141 49634 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002037436.1 protein_id gnl|my_center|LOCUS_05770 49843 51129 gene locus_tag LOCUS_05780 49843 51129 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261266.1 protein_id gnl|my_center|LOCUS_05780 51217 52167 gene locus_tag LOCUS_05790 51217 52167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 52312 53445 gene locus_tag LOCUS_05800 52312 53445 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056143.1 protein_id gnl|my_center|LOCUS_05800 53507 55513 gene locus_tag LOCUS_05810 gene uvrB 53507 55513 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_05810 55510 58398 gene locus_tag LOCUS_05820 gene uvrA 55510 58398 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 protein_id gnl|my_center|LOCUS_05820 58413 59351 gene locus_tag LOCUS_05830 gene hprK 58413 59351 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 protein_id gnl|my_center|LOCUS_05830 59393 60208 gene locus_tag LOCUS_05840 gene lgt 59393 60208 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242661.1 protein_id gnl|my_center|LOCUS_05840 60220 61182 gene locus_tag LOCUS_05850 60220 61182 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_05850 61194 61733 gene locus_tag LOCUS_05860 61194 61733 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 protein_id gnl|my_center|LOCUS_05860 61790 62254 gene locus_tag LOCUS_05870 61790 62254 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208553.1 protein_id gnl|my_center|LOCUS_05870 62258 63544 gene locus_tag LOCUS_05880 62258 63544 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063975.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence007 524 3001 gene locus_tag LOCUS_05890 gene leuS 524 3001 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_05890 3094 3345 gene locus_tag LOCUS_05900 3094 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3561 4076 gene locus_tag LOCUS_05910 3561 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4184 6997 gene locus_tag LOCUS_05920 4184 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 7012 9420 gene locus_tag LOCUS_05930 7012 9420 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393425.1 protein_id gnl|my_center|LOCUS_05930 9503 11416 gene locus_tag LOCUS_05940 9503 11416 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_05940 11417 12853 gene locus_tag LOCUS_05950 11417 12853 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_05950 13841 12984 gene locus_tag LOCUS_05960 gene comER 13841 12984 CDS product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020554.1 protein_id gnl|my_center|LOCUS_05960 13965 14636 gene locus_tag LOCUS_05970 13965 14636 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392107.1 protein_id gnl|my_center|LOCUS_05970 15072 16373 gene locus_tag LOCUS_05980 15072 16373 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_05980 16721 16533 gene locus_tag LOCUS_05990 16721 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16825 17055 gene locus_tag LOCUS_06000 16825 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 17195 17671 gene locus_tag LOCUS_06010 17195 17671 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393866.1 protein_id gnl|my_center|LOCUS_06010 17668 20106 gene locus_tag LOCUS_06020 17668 20106 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879844.1 protein_id gnl|my_center|LOCUS_06020 20176 20724 gene locus_tag LOCUS_06030 20176 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 20721 21797 gene locus_tag LOCUS_06040 20721 21797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 21850 22911 gene locus_tag LOCUS_06050 gene holA 21850 22911 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_06050 22908 23396 gene locus_tag LOCUS_06060 22908 23396 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392153.1 protein_id gnl|my_center|LOCUS_06060 23775 23479 gene locus_tag LOCUS_06070 gene rpsT 23775 23479 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774009.1 protein_id gnl|my_center|LOCUS_06070 23919 25028 gene locus_tag LOCUS_06080 gene gpr 23919 25028 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_06080 25104 26330 gene locus_tag LOCUS_06090 gene spoIIP 25104 26330 CDS product spore autolysin SpoIIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229993.1 protein_id gnl|my_center|LOCUS_06090 26327 26689 gene locus_tag LOCUS_06100 26327 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 26822 28648 gene locus_tag LOCUS_06110 gene lepA 26822 28648 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_06110 28717 29943 gene locus_tag LOCUS_06120 gene hemW 28717 29943 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 protein_id gnl|my_center|LOCUS_06120 30024 31058 gene locus_tag LOCUS_06130 gene hrcA 30024 31058 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_06130 31151 32701 gene locus_tag LOCUS_06140 31151 32701 CDS product TCP-1/cpn60 chaperonin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143737.1 protein_id gnl|my_center|LOCUS_06140 32714 33472 gene locus_tag LOCUS_06150 32714 33472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 33573 35402 gene locus_tag LOCUS_06160 gene dnaK 33573 35402 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_06160 35526 36680 gene locus_tag LOCUS_06170 gene dnaJ 35526 36680 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990134.1 protein_id gnl|my_center|LOCUS_06170 36983 37840 gene locus_tag LOCUS_06180 36983 37840 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_06180 38064 39473 gene locus_tag LOCUS_06190 38064 39473 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083271.1 protein_id gnl|my_center|LOCUS_06190 39470 40402 gene locus_tag LOCUS_06200 39470 40402 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083273.1 protein_id gnl|my_center|LOCUS_06200 40463 41299 gene locus_tag LOCUS_06210 40463 41299 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015918758.1 protein_id gnl|my_center|LOCUS_06210 41296 41712 gene locus_tag LOCUS_06220 41296 41712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 41724 42362 gene locus_tag LOCUS_06230 41724 42362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06230 42462 43397 gene locus_tag LOCUS_06240 gene prmA 42462 43397 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398884.1 protein_id gnl|my_center|LOCUS_06240 43443 44183 gene locus_tag LOCUS_06250 43443 44183 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190154.1 protein_id gnl|my_center|LOCUS_06250 44226 45572 gene locus_tag LOCUS_06260 gene mtaB 44226 45572 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_06260 45678 46160 gene locus_tag LOCUS_06270 45678 46160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 46141 46284 gene locus_tag LOCUS_06280 46141 46284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 46753 48888 gene locus_tag LOCUS_06290 46753 48888 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650637.1 protein_id gnl|my_center|LOCUS_06290 48920 51241 gene locus_tag LOCUS_06300 48920 51241 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285084.1 protein_id gnl|my_center|LOCUS_06300 51311 51826 gene locus_tag LOCUS_06310 51311 51826 CDS product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001877024.1 protein_id gnl|my_center|LOCUS_06310 53943 51940 gene locus_tag LOCUS_06320 53943 51940 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337798.1 protein_id gnl|my_center|LOCUS_06320 53992 54237 gene locus_tag LOCUS_06330 53992 54237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 54911 54336 gene locus_tag LOCUS_06340 54911 54336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 56094 57281 gene locus_tag LOCUS_06350 56094 57281 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_06350 57400 59337 gene locus_tag LOCUS_06360 57400 59337 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806472.1 protein_id gnl|my_center|LOCUS_06360 59638 60075 gene locus_tag LOCUS_06370 59638 60075 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227729.1 protein_id gnl|my_center|LOCUS_06370 60076 60747 gene locus_tag LOCUS_06380 gene deoC 60076 60747 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_06380 61693 60770 gene locus_tag LOCUS_06390 61693 60770 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945015.1 protein_id gnl|my_center|LOCUS_06390 61772 62980 gene locus_tag LOCUS_06400 61772 62980 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_06400 63060 63392 gene locus_tag LOCUS_06410 63060 63392 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392126.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence008 230 1771 gene locus_tag LOCUS_06420 gene rny 230 1771 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204912.1 protein_id gnl|my_center|LOCUS_06420 1841 2638 gene locus_tag LOCUS_06430 1841 2638 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221095.1 protein_id gnl|my_center|LOCUS_06430 2745 3005 gene locus_tag LOCUS_06440 gene spoVS 2745 3005 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_06440 3099 4049 gene locus_tag LOCUS_06450 3099 4049 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688045.1 protein_id gnl|my_center|LOCUS_06450 4135 5898 gene locus_tag LOCUS_06460 4135 5898 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 protein_id gnl|my_center|LOCUS_06460 5873 6739 gene locus_tag LOCUS_06470 5873 6739 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190154.1 protein_id gnl|my_center|LOCUS_06470 6833 7570 gene locus_tag LOCUS_06480 6833 7570 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233185.1 protein_id gnl|my_center|LOCUS_06480 7670 8710 gene locus_tag LOCUS_06490 gene tdh 7670 8710 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_06490 8723 9898 gene locus_tag LOCUS_06500 8723 9898 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_06500 9995 10390 gene locus_tag LOCUS_06510 9995 10390 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_06510 11926 10925 gene locus_tag LOCUS_06520 11926 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 12787 12179 gene locus_tag LOCUS_06530 12787 12179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 12893 13168 gene locus_tag LOCUS_06540 12893 13168 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422948.1 protein_id gnl|my_center|LOCUS_06540 13302 14540 gene locus_tag LOCUS_06550 13302 14540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 15845 15162 gene locus_tag LOCUS_06560 15845 15162 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231596.1 protein_id gnl|my_center|LOCUS_06560 16219 15998 gene locus_tag LOCUS_06570 16219 15998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 16379 16996 gene locus_tag LOCUS_06580 gene lexA 16379 16996 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_06580 17556 17068 gene locus_tag LOCUS_06590 17556 17068 CDS product DUF456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217339.1 protein_id gnl|my_center|LOCUS_06590 19020 17686 gene locus_tag LOCUS_06600 gene glnA 19020 17686 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231737.1 protein_id gnl|my_center|LOCUS_06600 20533 19079 gene locus_tag LOCUS_06610 gene glnA 20533 19079 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_06610 21238 20828 gene locus_tag LOCUS_06620 gene glnR 21238 20828 CDS product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 protein_id gnl|my_center|LOCUS_06620 22677 21316 gene locus_tag LOCUS_06630 22677 21316 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_06630 23947 22670 gene locus_tag LOCUS_06640 gene hflX 23947 22670 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048525537.1 protein_id gnl|my_center|LOCUS_06640 24924 23977 gene locus_tag LOCUS_06650 gene spoVK 24924 23977 CDS product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 protein_id gnl|my_center|LOCUS_06650 25231 24980 gene locus_tag LOCUS_06660 25231 24980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 25678 25400 gene locus_tag LOCUS_06670 gene hfq 25678 25400 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_06670 26715 25711 gene locus_tag LOCUS_06680 gene miaA 26715 25711 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_06680 27497 26712 gene locus_tag LOCUS_06690 27497 26712 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_06690 29418 27499 gene locus_tag LOCUS_06700 gene mutL 29418 27499 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101707.1 protein_id gnl|my_center|LOCUS_06700 32091 29452 gene locus_tag LOCUS_06710 gene mutS 32091 29452 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 protein_id gnl|my_center|LOCUS_06710 33600 32167 gene locus_tag LOCUS_06720 33600 32167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 34242 33667 gene locus_tag LOCUS_06730 gene cotE 34242 33667 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288800.1 protein_id gnl|my_center|LOCUS_06730 34810 34424 gene locus_tag LOCUS_06740 34810 34424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 36281 34815 gene locus_tag LOCUS_06750 gene miaB 36281 34815 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_06750 36841 36368 gene locus_tag LOCUS_06760 36841 36368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 37623 36838 gene locus_tag LOCUS_06770 37623 36838 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_06770 39278 37797 gene locus_tag LOCUS_06780 39278 37797 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_06780 40322 39486 gene locus_tag LOCUS_06790 40322 39486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 43756 40382 gene locus_tag LOCUS_06800 43756 40382 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_06800 46686 43834 gene locus_tag LOCUS_06810 46686 43834 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_06810 50201 46665 gene locus_tag LOCUS_06820 50201 46665 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_06820 51023 50361 gene locus_tag LOCUS_06830 gene pcp 51023 50361 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859710.1 protein_id gnl|my_center|LOCUS_06830 52729 51086 gene locus_tag LOCUS_06840 gene dppE 52729 51086 CDS product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 protein_id gnl|my_center|LOCUS_06840 53472 52753 gene locus_tag LOCUS_06850 53472 52753 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_06850 54753 53569 gene locus_tag LOCUS_06860 54753 53569 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_06860 55629 54865 gene locus_tag LOCUS_06870 gene pxpA 55629 54865 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_06870 <56186 55660 gene locus_tag LOCUS_06880 <56186 55660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234419.1:5-oxoprolinase subunit PxpC >Feature sequence009 489 4 gene locus_tag LOCUS_06890 489 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1082 489 gene locus_tag LOCUS_06900 1082 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3568 1535 gene locus_tag LOCUS_06910 3568 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3876 3565 gene locus_tag LOCUS_06920 3876 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06920 4383 5024 gene locus_tag LOCUS_06930 4383 5024 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926669.1 protein_id gnl|my_center|LOCUS_06930 9059 5187 gene locus_tag LOCUS_06940 9059 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 10304 9192 gene locus_tag LOCUS_06950 10304 9192 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_06950 11128 10397 gene locus_tag LOCUS_06960 11128 10397 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101055.1 protein_id gnl|my_center|LOCUS_06960 11346 12977 gene locus_tag LOCUS_06970 11346 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 14183 13143 gene locus_tag LOCUS_06980 14183 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 14975 14298 gene locus_tag LOCUS_06990 14975 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 15583 15140 gene locus_tag LOCUS_07000 15583 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 16728 15814 gene locus_tag LOCUS_07010 16728 15814 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003729005.1 protein_id gnl|my_center|LOCUS_07010 17530 16754 gene locus_tag LOCUS_07020 17530 16754 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099684015.1 protein_id gnl|my_center|LOCUS_07020 18321 17593 gene locus_tag LOCUS_07030 18321 17593 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207193.1 protein_id gnl|my_center|LOCUS_07030 19116 18328 gene locus_tag LOCUS_07040 19116 18328 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_07040 20308 19211 gene locus_tag LOCUS_07050 gene galE 20308 19211 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272534.1 protein_id gnl|my_center|LOCUS_07050 21002 20325 gene locus_tag LOCUS_07060 21002 20325 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_07060 21955 21026 gene locus_tag LOCUS_07070 gene manA 21955 21026 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989899.1 protein_id gnl|my_center|LOCUS_07070 23051 21975 gene locus_tag LOCUS_07080 23051 21975 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_07080 24852 23119 gene locus_tag LOCUS_07090 24852 23119 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_07090 26000 24891 gene locus_tag LOCUS_07100 26000 24891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 27070 26045 gene locus_tag LOCUS_07110 27070 26045 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889299.1 protein_id gnl|my_center|LOCUS_07110 28479 27178 gene locus_tag LOCUS_07120 28479 27178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 29105 28974 gene locus_tag LOCUS_07130 29105 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 31637 30291 gene locus_tag LOCUS_07140 31637 30291 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730933.1 protein_id gnl|my_center|LOCUS_07140 32722 31727 gene locus_tag LOCUS_07150 32722 31727 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_07150 34169 32808 gene locus_tag LOCUS_07160 34169 32808 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_07160 35087 34188 gene locus_tag LOCUS_07170 gene galU 35087 34188 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937189.1 protein_id gnl|my_center|LOCUS_07170 36175 35741 gene locus_tag LOCUS_07180 gene fabZ 36175 35741 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_07180 36911 36396 gene locus_tag LOCUS_07190 gene pgsA 36911 36396 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_07190 37987 37079 gene locus_tag LOCUS_07200 gene flgG 37987 37079 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_07200 38957 38004 gene locus_tag LOCUS_07210 gene flgF 38957 38004 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392318.1 protein_id gnl|my_center|LOCUS_07210 39769 39275 gene locus_tag LOCUS_07220 39769 39275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 39992 39795 gene locus_tag LOCUS_07230 39992 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 40553 40092 gene locus_tag LOCUS_07240 40553 40092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 40746 40525 gene locus_tag LOCUS_07250 40746 40525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 41611 40874 gene locus_tag LOCUS_07260 41611 40874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 42909 41707 gene locus_tag LOCUS_07270 gene spoIID 42909 41707 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_07270 43387 43037 gene locus_tag LOCUS_07280 43387 43037 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 protein_id gnl|my_center|LOCUS_07280 43674 43384 gene locus_tag LOCUS_07290 43674 43384 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921003.1 protein_id gnl|my_center|LOCUS_07290 45102 43798 gene locus_tag LOCUS_07300 gene murA 45102 43798 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411265.1 protein_id gnl|my_center|LOCUS_07300 45896 45144 gene locus_tag LOCUS_07310 45896 45144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 46212 45976 gene locus_tag LOCUS_07320 46212 45976 CDS product DUF1146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227691.1 protein_id gnl|my_center|LOCUS_07320 47989 46442 gene locus_tag LOCUS_07330 gene nuoN 47989 46442 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367506.1 protein_id gnl|my_center|LOCUS_07330 49504 47996 gene locus_tag LOCUS_07340 49504 47996 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998901.1 protein_id gnl|my_center|LOCUS_07340 51357 49501 gene locus_tag LOCUS_07350 gene nuoL 51357 49501 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568230.1 protein_id gnl|my_center|LOCUS_07350 51673 51362 gene locus_tag LOCUS_07360 gene nuoK 51673 51362 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100078.1 protein_id gnl|my_center|LOCUS_07360 52185 51670 gene locus_tag LOCUS_07370 52185 51670 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012801.1 protein_id gnl|my_center|LOCUS_07370 52628 52182 gene locus_tag LOCUS_07380 gene nuoI 52628 52182 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677191.1 protein_id gnl|my_center|LOCUS_07380 53728 52721 gene locus_tag LOCUS_07390 gene nuoH 53728 52721 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573431.1 protein_id gnl|my_center|LOCUS_07390 54831 53728 gene locus_tag LOCUS_07400 gene nuoD 54831 53728 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_07400 <55401 54836 gene locus_tag LOCUS_07410 <55401 54836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000070263.1:NADH-quinone oxidoreductase subunit C >Feature sequence010 153 596 gene locus_tag LOCUS_07420 gene ndk 153 596 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415883.1 protein_id gnl|my_center|LOCUS_07420 699 1487 gene locus_tag LOCUS_07430 gene cheR 699 1487 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_07430 1540 1677 gene locus_tag LOCUS_07440 1540 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1838 3001 gene locus_tag LOCUS_07450 gene aroC 1838 3001 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269372.1 protein_id gnl|my_center|LOCUS_07450 3003 4103 gene locus_tag LOCUS_07460 gene aroB 3003 4103 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_07460 4358 4164 gene locus_tag LOCUS_07470 4358 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4318 6027 gene locus_tag LOCUS_07480 gene trpE 4318 6027 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392855.1 protein_id gnl|my_center|LOCUS_07480 5996 6871 gene locus_tag LOCUS_07490 gene trpD 5996 6871 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 6859 7020 gene locus_tag LOCUS_07500 6859 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7010 7801 gene locus_tag LOCUS_07510 gene trpC 7010 7801 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_07510 7798 8595 gene locus_tag LOCUS_07520 7798 8595 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_07520 8576 9769 gene locus_tag LOCUS_07530 gene trpB 8576 9769 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_07530 9769 10566 gene locus_tag LOCUS_07540 gene trpA 9769 10566 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230608.1 protein_id gnl|my_center|LOCUS_07540 10659 11747 gene locus_tag LOCUS_07550 gene hisC 10659 11747 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_07550 11752 12876 gene locus_tag LOCUS_07560 11752 12876 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989842.1 protein_id gnl|my_center|LOCUS_07560 12878 14155 gene locus_tag LOCUS_07570 gene aroA 12878 14155 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_07570 14531 15646 gene locus_tag LOCUS_07580 14531 15646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 15781 16779 gene locus_tag LOCUS_07590 15781 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 16900 18009 gene locus_tag LOCUS_07600 16900 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 18253 18450 gene locus_tag LOCUS_07610 18253 18450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 18596 19003 gene locus_tag LOCUS_07620 18596 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 19149 19664 gene locus_tag LOCUS_07630 gene qcrA 19149 19664 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290418.1 protein_id gnl|my_center|LOCUS_07630 19668 20339 gene locus_tag LOCUS_07640 gene qcrB 19668 20339 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 protein_id gnl|my_center|LOCUS_07640 20376 21161 gene locus_tag LOCUS_07650 gene qcrC 20376 21161 CDS product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554603.1 protein_id gnl|my_center|LOCUS_07650 21246 21860 gene locus_tag LOCUS_07660 21246 21860 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025709269.1 protein_id gnl|my_center|LOCUS_07660 21949 22740 gene locus_tag LOCUS_07670 21949 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 23607 22750 gene locus_tag LOCUS_07680 23607 22750 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203305.1 protein_id gnl|my_center|LOCUS_07680 23838 24185 gene locus_tag LOCUS_07690 23838 24185 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 protein_id gnl|my_center|LOCUS_07690 24182 24988 gene locus_tag LOCUS_07700 gene dapB 24182 24988 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661724.1 protein_id gnl|my_center|LOCUS_07700 25014 25466 gene locus_tag LOCUS_07710 gene mgsA 25014 25466 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_07710 25463 26173 gene locus_tag LOCUS_07720 gene bshB1 25463 26173 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015673.1 protein_id gnl|my_center|LOCUS_07720 26189 27328 gene locus_tag LOCUS_07730 gene bshA 26189 27328 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_07730 27697 27443 gene locus_tag LOCUS_07740 27697 27443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 27578 28828 gene locus_tag LOCUS_07750 27578 28828 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262894.1 protein_id gnl|my_center|LOCUS_07750 28825 29793 gene locus_tag LOCUS_07760 28825 29793 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 protein_id gnl|my_center|LOCUS_07760 30046 30891 gene locus_tag LOCUS_07770 gene panB 30046 30891 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212979991.1 protein_id gnl|my_center|LOCUS_07770 30888 31739 gene locus_tag LOCUS_07780 gene panC 30888 31739 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706997.1 protein_id gnl|my_center|LOCUS_07780 31762 32145 gene locus_tag LOCUS_07790 gene panD 31762 32145 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 protein_id gnl|my_center|LOCUS_07790 32220 33698 gene locus_tag LOCUS_07800 32220 33698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 33774 34682 gene locus_tag LOCUS_07810 33774 34682 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_07810 34716 35336 gene locus_tag LOCUS_07820 34716 35336 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_07820 35396 36226 gene locus_tag LOCUS_07830 35396 36226 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_07830 36226 37212 gene locus_tag LOCUS_07840 gene ligD 36226 37212 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392997.1 protein_id gnl|my_center|LOCUS_07840 37209 38144 gene locus_tag LOCUS_07850 37209 38144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 38287 39600 gene locus_tag LOCUS_07860 38287 39600 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_07860 39859 39698 gene locus_tag LOCUS_07870 39859 39698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 39995 40165 gene locus_tag LOCUS_07880 39995 40165 CDS product YpmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358352.1 protein_id gnl|my_center|LOCUS_07880 40251 40964 gene locus_tag LOCUS_07890 40251 40964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 40990 41475 gene locus_tag LOCUS_07900 40990 41475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 41599 42132 gene locus_tag LOCUS_07910 41599 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 42129 43625 gene locus_tag LOCUS_07920 42129 43625 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812900.1 protein_id gnl|my_center|LOCUS_07920 43705 44886 gene locus_tag LOCUS_07930 gene aspB 43705 44886 CDS product aspartate transaminase AspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398489.1 protein_id gnl|my_center|LOCUS_07930 45024 46361 gene locus_tag LOCUS_07940 gene asnS 45024 46361 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398777.1 protein_id gnl|my_center|LOCUS_07940 46395 47120 gene locus_tag LOCUS_07950 gene dnaD 46395 47120 CDS product DNA replication protein DnaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728542.1 protein_id gnl|my_center|LOCUS_07950 48082 47147 gene locus_tag LOCUS_07960 48082 47147 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258785.1 protein_id gnl|my_center|LOCUS_07960 48614 48090 gene locus_tag LOCUS_07970 gene yfkJ 48614 48090 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 protein_id gnl|my_center|LOCUS_07970 48691 49251 gene locus_tag LOCUS_07980 48691 49251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 49312 50097 gene locus_tag LOCUS_07990 49312 50097 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454866.1 protein_id gnl|my_center|LOCUS_07990 50312 51082 gene locus_tag LOCUS_08000 50312 51082 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 protein_id gnl|my_center|LOCUS_08000 51098 51904 gene locus_tag LOCUS_08010 gene pxpB 51098 51904 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence011 150 692 gene locus_tag LOCUS_08020 gene ahpA 150 692 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_08020 774 1229 gene locus_tag LOCUS_08030 gene ykuV 774 1229 CDS product thiol-disulfide oxidoreductase YkuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245810.1 protein_id gnl|my_center|LOCUS_08030 1257 1640 gene locus_tag LOCUS_08040 gene gcvH 1257 1640 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222781.1 protein_id gnl|my_center|LOCUS_08040 1820 2248 gene locus_tag LOCUS_08050 1820 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 2364 3134 gene locus_tag LOCUS_08060 gene sigI 2364 3134 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 protein_id gnl|my_center|LOCUS_08060 3131 4267 gene locus_tag LOCUS_08070 3131 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4294 4491 gene locus_tag LOCUS_08080 4294 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4671 4832 gene locus_tag LOCUS_08090 4671 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4855 5277 gene locus_tag LOCUS_08100 4855 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 5385 6086 gene locus_tag LOCUS_08110 5385 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 6106 6693 gene locus_tag LOCUS_08120 6106 6693 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_08120 6973 7758 gene locus_tag LOCUS_08130 gene sufC 6973 7758 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_08130 7787 9091 gene locus_tag LOCUS_08140 gene sufD 7787 9091 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228602.1 protein_id gnl|my_center|LOCUS_08140 9088 10311 gene locus_tag LOCUS_08150 gene sufS 9088 10311 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_08150 10298 10735 gene locus_tag LOCUS_08160 gene sufU 10298 10735 CDS product iron-sulfur cluster assembly scaffold protein SufU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009523.1 protein_id gnl|my_center|LOCUS_08160 10742 12139 gene locus_tag LOCUS_08170 gene sufB 10742 12139 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228608.1 protein_id gnl|my_center|LOCUS_08170 12632 12264 gene locus_tag LOCUS_08180 12632 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 13945 12962 gene locus_tag LOCUS_08190 13945 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683833.1 protein_id gnl|my_center|LOCUS_08190 15566 14301 gene locus_tag LOCUS_08200 15566 14301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15729 16088 gene locus_tag LOCUS_08210 15729 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 16246 16452 gene locus_tag LOCUS_08220 gene copZ 16246 16452 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076661.1 protein_id gnl|my_center|LOCUS_08220 16476 18902 gene locus_tag LOCUS_08230 gene copA 16476 18902 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242925.1 protein_id gnl|my_center|LOCUS_08230 19091 19879 gene locus_tag LOCUS_08240 gene lgt 19091 19879 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_08240 20798 19920 gene locus_tag LOCUS_08250 20798 19920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 21034 22686 gene locus_tag LOCUS_08260 21034 22686 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820031.1 protein_id gnl|my_center|LOCUS_08260 22865 23062 gene locus_tag LOCUS_08270 22865 23062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 23202 23432 gene locus_tag LOCUS_08280 23202 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 23453 23860 gene locus_tag LOCUS_08290 23453 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 23893 24588 gene locus_tag LOCUS_08300 23893 24588 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_08300 24585 25973 gene locus_tag LOCUS_08310 24585 25973 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822542.1 protein_id gnl|my_center|LOCUS_08310 26056 26802 gene locus_tag LOCUS_08320 26056 26802 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228870.1 protein_id gnl|my_center|LOCUS_08320 27443 26901 gene locus_tag LOCUS_08330 27443 26901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 27339 27803 gene locus_tag LOCUS_08340 27339 27803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 28089 27880 gene locus_tag LOCUS_08350 28089 27880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 28298 28086 gene locus_tag LOCUS_08360 28298 28086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 28725 28258 gene locus_tag LOCUS_08370 28725 28258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 28931 29737 gene locus_tag LOCUS_08380 28931 29737 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 protein_id gnl|my_center|LOCUS_08380 29794 31242 gene locus_tag LOCUS_08390 29794 31242 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242525.1 protein_id gnl|my_center|LOCUS_08390 31283 31531 gene locus_tag LOCUS_08400 31283 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 31612 31932 gene locus_tag LOCUS_08410 31612 31932 CDS product DUF1805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248463.1 protein_id gnl|my_center|LOCUS_08410 32123 33220 gene locus_tag LOCUS_08420 32123 33220 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_08420 33257 34762 gene locus_tag LOCUS_08430 33257 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 34863 35594 gene locus_tag LOCUS_08440 34863 35594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 36686 35667 gene locus_tag LOCUS_08450 gene lytH 36686 35667 CDS product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 protein_id gnl|my_center|LOCUS_08450 37653 36742 gene locus_tag LOCUS_08460 gene mneS 37653 36742 CDS product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 protein_id gnl|my_center|LOCUS_08460 37903 38781 gene locus_tag LOCUS_08470 gene lipA 37903 38781 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222888.1 protein_id gnl|my_center|LOCUS_08470 39437 38880 gene locus_tag LOCUS_08480 39437 38880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 39587 39958 gene locus_tag LOCUS_08490 39587 39958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 40212 39955 gene locus_tag LOCUS_08500 40212 39955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 40413 40856 gene locus_tag LOCUS_08510 40413 40856 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274006.1 protein_id gnl|my_center|LOCUS_08510 40919 41563 gene locus_tag LOCUS_08520 40919 41563 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503330.1 protein_id gnl|my_center|LOCUS_08520 41666 42481 gene locus_tag LOCUS_08530 41666 42481 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 protein_id gnl|my_center|LOCUS_08530 42429 43430 gene locus_tag LOCUS_08540 42429 43430 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258336.1 protein_id gnl|my_center|LOCUS_08540 43952 43440 gene locus_tag LOCUS_08550 43952 43440 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722422.1 protein_id gnl|my_center|LOCUS_08550 44042 44575 gene locus_tag LOCUS_08560 gene mutTA 44042 44575 CDS product antimutator 8-oxo-(dGTP/GTP)ase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276386.1 protein_id gnl|my_center|LOCUS_08560 44572 45591 gene locus_tag LOCUS_08570 44572 45591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 45651 46640 gene locus_tag LOCUS_08580 45651 46640 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459825.1 protein_id gnl|my_center|LOCUS_08580 46717 47712 gene locus_tag LOCUS_08590 46717 47712 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_08590 47969 47739 gene locus_tag LOCUS_08600 47969 47739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 48152 49078 gene locus_tag LOCUS_08610 48152 49078 CDS product O-acetylserine dependent cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103859.1 protein_id gnl|my_center|LOCUS_08610 49081 50220 gene locus_tag LOCUS_08620 49081 50220 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201906.1 protein_id gnl|my_center|LOCUS_08620 50319 50648 gene locus_tag LOCUS_08630 50319 50648 CDS product YuzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242597.1 protein_id gnl|my_center|LOCUS_08630 50697 50978 gene locus_tag LOCUS_08640 50697 50978 CDS product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222913.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence012 1481 120 gene locus_tag LOCUS_08650 1481 120 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435635.1 protein_id gnl|my_center|LOCUS_08650 1617 2012 gene locus_tag LOCUS_08660 1617 2012 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_08660 2457 1978 gene locus_tag LOCUS_08670 gene rlmH 2457 1978 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_08670 2595 3263 gene locus_tag LOCUS_08680 2595 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3537 3292 gene locus_tag LOCUS_08690 3537 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4846 3641 gene locus_tag LOCUS_08700 gene htrC 4846 3641 CDS product serine protease HtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969578.1 protein_id gnl|my_center|LOCUS_08700 4997 5245 gene locus_tag LOCUS_08710 4997 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5981 5169 gene locus_tag LOCUS_08720 5981 5169 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_08720 6809 6024 gene locus_tag LOCUS_08730 6809 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8133 6796 gene locus_tag LOCUS_08740 8133 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 9949 8117 gene locus_tag LOCUS_08750 gene walK 9949 8117 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755373.1 protein_id gnl|my_center|LOCUS_08750 10650 9946 gene locus_tag LOCUS_08760 gene walR 10650 9946 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971865.1 protein_id gnl|my_center|LOCUS_08760 12141 10747 gene locus_tag LOCUS_08770 12141 10747 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811628.1 protein_id gnl|my_center|LOCUS_08770 12410 12790 gene locus_tag LOCUS_08780 12410 12790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272592.1 protein_id gnl|my_center|LOCUS_08780 14209 12923 gene locus_tag LOCUS_08790 gene purA 14209 12923 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_08790 15725 14373 gene locus_tag LOCUS_08800 gene dnaB 15725 14373 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_08800 16215 15772 gene locus_tag LOCUS_08810 gene rplI 16215 15772 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864235.1 protein_id gnl|my_center|LOCUS_08810 18182 16212 gene locus_tag LOCUS_08820 18182 16212 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_08820 19172 18195 gene locus_tag LOCUS_08830 19172 18195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 19424 19197 gene locus_tag LOCUS_08840 gene rpsR 19424 19197 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219224.1 protein_id gnl|my_center|LOCUS_08840 19904 19455 gene locus_tag LOCUS_08850 gene ssbA 19904 19455 CDS product single-stranded DNA-binding protein SsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219228.1 protein_id gnl|my_center|LOCUS_08850 20249 19962 gene locus_tag LOCUS_08860 gene rpsF 20249 19962 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_08860 21519 20419 gene locus_tag LOCUS_08870 gene ychF 21519 20419 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_08870 21869 21624 gene locus_tag LOCUS_08880 21869 21624 CDS product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 protein_id gnl|my_center|LOCUS_08880 22845 21940 gene locus_tag LOCUS_08890 22845 21940 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364812.1 protein_id gnl|my_center|LOCUS_08890 23923 22892 gene locus_tag LOCUS_08900 23923 22892 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886647.1 protein_id gnl|my_center|LOCUS_08900 24031 24624 gene locus_tag LOCUS_08910 gene yyaC 24031 24624 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393985.1 protein_id gnl|my_center|LOCUS_08910 25575 24679 gene locus_tag LOCUS_08920 25575 24679 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_08920 26317 25580 gene locus_tag LOCUS_08930 26317 25580 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_08930 27531 26371 gene locus_tag LOCUS_08940 27531 26371 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_08940 28425 27565 gene locus_tag LOCUS_08950 gene spo0J 28425 27565 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_08950 29179 28418 gene locus_tag LOCUS_08960 gene soj 29179 28418 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_08960 30131 29301 gene locus_tag LOCUS_08970 gene noc 30131 29301 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_08970 30965 30252 gene locus_tag LOCUS_08980 gene rsmG 30965 30252 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243029.1 protein_id gnl|my_center|LOCUS_08980 32859 30970 gene locus_tag LOCUS_08990 gene mnmG 32859 30970 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_08990 34275 32902 gene locus_tag LOCUS_09000 gene mnmE 34275 32902 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244507.1 protein_id gnl|my_center|LOCUS_09000 35078 34452 gene locus_tag LOCUS_09010 35078 34452 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966995.1 protein_id gnl|my_center|LOCUS_09010 35827 35075 gene locus_tag LOCUS_09020 gene spoIIIJ 35827 35075 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727748.1 protein_id gnl|my_center|LOCUS_09020 36090 35866 gene locus_tag LOCUS_09030 gene yidD 36090 35866 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_09030 36434 36087 gene locus_tag LOCUS_09040 gene rnpA 36434 36087 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726621.1 protein_id gnl|my_center|LOCUS_09040 36723 36589 gene locus_tag LOCUS_09050 gene rpmH 36723 36589 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293121.1 protein_id gnl|my_center|LOCUS_09050 37223 38566 gene locus_tag LOCUS_09060 gene dnaA 37223 38566 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_09060 39054 40190 gene locus_tag LOCUS_09070 gene dnaN 39054 40190 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_09070 40222 40467 gene locus_tag LOCUS_09080 gene yaaA 40222 40467 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701414.1 protein_id gnl|my_center|LOCUS_09080 40473 41597 gene locus_tag LOCUS_09090 gene recF 40473 41597 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_09090 41603 41914 gene locus_tag LOCUS_09100 41603 41914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 41911 43827 gene locus_tag LOCUS_09110 gene gyrB 41911 43827 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_09110 43890 46331 gene locus_tag LOCUS_09120 gene gyrA 43890 46331 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence013 423 55 gene locus_tag LOCUS_09130 423 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1103 420 gene locus_tag LOCUS_09140 1103 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1941 1108 gene locus_tag LOCUS_09150 1941 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2689 1943 gene locus_tag LOCUS_09160 2689 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5610 3538 gene locus_tag LOCUS_09170 5610 3538 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065886.1 protein_id gnl|my_center|LOCUS_09170 6128 5580 gene locus_tag LOCUS_09180 6128 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09180 6611 6183 gene locus_tag LOCUS_09190 6611 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09190 7011 8309 gene locus_tag LOCUS_09200 7011 8309 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_09200 8503 9399 gene locus_tag LOCUS_09210 8503 9399 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_09210 9399 10238 gene locus_tag LOCUS_09220 9399 10238 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_09220 10475 10864 gene locus_tag LOCUS_09230 10475 10864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 10964 12721 gene locus_tag LOCUS_09240 10964 12721 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393356.1 protein_id gnl|my_center|LOCUS_09240 13541 13984 gene locus_tag LOCUS_09250 13541 13984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 14425 14048 gene locus_tag LOCUS_09260 14425 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 14600 15235 gene locus_tag LOCUS_09270 14600 15235 CDS product DUF4479 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006770.1 protein_id gnl|my_center|LOCUS_09270 16003 17835 gene locus_tag LOCUS_09280 16003 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 18081 19772 gene locus_tag LOCUS_09290 18081 19772 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529870.1 protein_id gnl|my_center|LOCUS_09290 19888 21513 gene locus_tag LOCUS_09300 19888 21513 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808965.1 protein_id gnl|my_center|LOCUS_09300 21816 23075 gene locus_tag LOCUS_09310 gene ugpC 21816 23075 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_09310 23072 23965 gene locus_tag LOCUS_09320 23072 23965 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416903.1 protein_id gnl|my_center|LOCUS_09320 23989 24837 gene locus_tag LOCUS_09330 23989 24837 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898651.1 protein_id gnl|my_center|LOCUS_09330 24869 26191 gene locus_tag LOCUS_09340 24869 26191 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898649.1 protein_id gnl|my_center|LOCUS_09340 26221 26955 gene locus_tag LOCUS_09350 26221 26955 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868825.1 protein_id gnl|my_center|LOCUS_09350 28328 26952 gene locus_tag LOCUS_09360 28328 26952 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 protein_id gnl|my_center|LOCUS_09360 29742 28306 gene locus_tag LOCUS_09370 gene glcD 29742 28306 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_09370 29949 31625 gene locus_tag LOCUS_09380 29949 31625 CDS product lactate permease LctP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071120.1 protein_id gnl|my_center|LOCUS_09380 31762 32514 gene locus_tag LOCUS_09390 gene lutR 31762 32514 CDS product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 protein_id gnl|my_center|LOCUS_09390 32554 33279 gene locus_tag LOCUS_09400 gene lutA 32554 33279 CDS product lactate utilization iron-sulfur protein LutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244353.1 protein_id gnl|my_center|LOCUS_09400 33281 34756 gene locus_tag LOCUS_09410 33281 34756 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061914.1 protein_id gnl|my_center|LOCUS_09410 34737 35459 gene locus_tag LOCUS_09420 gene lutC 34737 35459 CDS product lactate utilization protein LutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228309.1 protein_id gnl|my_center|LOCUS_09420 35602 36504 gene locus_tag LOCUS_09430 35602 36504 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_09430 36731 38239 gene locus_tag LOCUS_09440 36731 38239 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 protein_id gnl|my_center|LOCUS_09440 38656 39777 gene locus_tag LOCUS_09450 38656 39777 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_09450 40174 40815 gene locus_tag LOCUS_09460 gene sdhC 40174 40815 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678351.1 protein_id gnl|my_center|LOCUS_09460 40837 42603 gene locus_tag LOCUS_09470 gene sdhA 40837 42603 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229567.1 protein_id gnl|my_center|LOCUS_09470 42600 43352 gene locus_tag LOCUS_09480 gene sdhB 42600 43352 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_09480 43410 44102 gene locus_tag LOCUS_09490 gene sfsA 43410 44102 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391969.1 protein_id gnl|my_center|LOCUS_09490 44177 44647 gene locus_tag LOCUS_09500 44177 44647 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822735.1 protein_id gnl|my_center|LOCUS_09500 45085 44675 gene locus_tag LOCUS_09510 45085 44675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 45189 45413 gene locus_tag LOCUS_09520 gene gerE 45189 45413 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659484.1 protein_id gnl|my_center|LOCUS_09520 46379 45453 gene locus_tag LOCUS_09530 46379 45453 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence014 169 1173 gene locus_tag LOCUS_09540 169 1173 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089792.1 protein_id gnl|my_center|LOCUS_09540 1895 1515 gene locus_tag LOCUS_09550 1895 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2979 2029 gene locus_tag LOCUS_09560 2979 2029 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510049.1 protein_id gnl|my_center|LOCUS_09560 3303 2992 gene locus_tag LOCUS_09570 gene czrA 3303 2992 CDS product Zn(II)-responsive metalloregulatory transcriptional repressor CzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231284.1 protein_id gnl|my_center|LOCUS_09570 4055 3483 gene locus_tag LOCUS_09580 4055 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4860 4075 gene locus_tag LOCUS_09590 gene sigD 4860 4075 CDS product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 protein_id gnl|my_center|LOCUS_09590 5350 4874 gene locus_tag LOCUS_09600 5350 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5851 5354 gene locus_tag LOCUS_09610 5851 5354 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_09610 6465 5848 gene locus_tag LOCUS_09620 gene cheC 6465 5848 CDS product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 protein_id gnl|my_center|LOCUS_09620 6945 6469 gene locus_tag LOCUS_09630 6945 6469 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_09630 9212 7038 gene locus_tag LOCUS_09640 gene cheA 9212 7038 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_09640 10336 9218 gene locus_tag LOCUS_09650 10336 9218 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870053.1 protein_id gnl|my_center|LOCUS_09650 11287 10376 gene locus_tag LOCUS_09660 11287 10376 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460747.1 protein_id gnl|my_center|LOCUS_09660 12611 11280 gene locus_tag LOCUS_09670 gene flhF 12611 11280 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_09670 14653 12611 gene locus_tag LOCUS_09680 gene flhA 14653 12611 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_09680 15754 14669 gene locus_tag LOCUS_09690 gene flhB 15754 14669 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_09690 16554 15745 gene locus_tag LOCUS_09700 gene fliR 16554 15745 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_09700 16833 16564 gene locus_tag LOCUS_09710 gene fliQ 16833 16564 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_09710 17603 16830 gene locus_tag LOCUS_09720 gene fliP 17603 16830 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 protein_id gnl|my_center|LOCUS_09720 18316 17612 gene locus_tag LOCUS_09730 18316 17612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 18689 18327 gene locus_tag LOCUS_09740 18689 18327 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_09740 19949 18732 gene locus_tag LOCUS_09750 gene fliY 19949 18732 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_09750 20934 19912 gene locus_tag LOCUS_09760 gene fliM 20934 19912 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 protein_id gnl|my_center|LOCUS_09760 21417 20968 gene locus_tag LOCUS_09770 21417 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 21629 21435 gene locus_tag LOCUS_09780 21629 21435 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081092.1 protein_id gnl|my_center|LOCUS_09780 22553 21729 gene locus_tag LOCUS_09790 22553 21729 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392300.1 protein_id gnl|my_center|LOCUS_09790 22965 22585 gene locus_tag LOCUS_09800 gene flgD 22965 22585 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870071.1 protein_id gnl|my_center|LOCUS_09800 24370 22976 gene locus_tag LOCUS_09810 24370 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 25318 24386 gene locus_tag LOCUS_09820 25318 24386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 25779 25315 gene locus_tag LOCUS_09830 25779 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 27104 25776 gene locus_tag LOCUS_09840 gene fliI 27104 25776 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_09840 27930 27082 gene locus_tag LOCUS_09850 27930 27082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 28933 27923 gene locus_tag LOCUS_09860 gene fliG 28933 27923 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_09860 30526 28946 gene locus_tag LOCUS_09870 gene fliF 30526 28946 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 protein_id gnl|my_center|LOCUS_09870 30876 30583 gene locus_tag LOCUS_09880 30876 30583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 31354 30908 gene locus_tag LOCUS_09890 gene flgC 31354 30908 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_09890 31770 31357 gene locus_tag LOCUS_09900 gene flgB 31770 31357 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_09900 32860 32081 gene locus_tag LOCUS_09910 gene codY 32860 32081 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220850.1 protein_id gnl|my_center|LOCUS_09910 34317 32914 gene locus_tag LOCUS_09920 gene hslU 34317 32914 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_09920 34868 34320 gene locus_tag LOCUS_09930 gene clpQ 34868 34320 CDS product ATP-dependent protease subunit ClpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238555.1 protein_id gnl|my_center|LOCUS_09930 35777 34881 gene locus_tag LOCUS_09940 gene xerC 35777 34881 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231988.1 protein_id gnl|my_center|LOCUS_09940 37150 35819 gene locus_tag LOCUS_09950 gene trmFO 37150 35819 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_09950 39300 37147 gene locus_tag LOCUS_09960 gene topA 39300 37147 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_09960 40610 39366 gene locus_tag LOCUS_09970 gene dprA 40610 39366 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813280.1 protein_id gnl|my_center|LOCUS_09970 41659 40748 gene locus_tag LOCUS_09980 gene sucD 41659 40748 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_09980 42907 41747 gene locus_tag LOCUS_09990 gene sucC 42907 41747 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_09990 43154 42984 gene locus_tag LOCUS_10000 43154 42984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 43258 43560 gene locus_tag LOCUS_10010 43258 43560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 43579 43716 gene locus_tag LOCUS_10020 43579 43716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 44956 43724 gene locus_tag LOCUS_10030 44956 43724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543417.1 protein_id gnl|my_center|LOCUS_10030 45984 45670 gene locus_tag LOCUS_10040 45984 45670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence015 66 141 gene locus_tag LOCUS_t00070 66 141 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 147 222 gene locus_tag LOCUS_t00080 147 222 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 226 301 gene locus_tag LOCUS_t00090 226 301 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 307 391 gene locus_tag LOCUS_t00100 307 391 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 399 473 gene locus_tag LOCUS_t00110 399 473 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 479 554 gene locus_tag LOCUS_t00120 479 554 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 561 635 gene locus_tag LOCUS_t00130 561 635 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 642 718 gene locus_tag LOCUS_t00140 642 718 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 734 811 gene locus_tag LOCUS_t00150 734 811 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 817 892 gene locus_tag LOCUS_t00160 817 892 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1126 2028 gene locus_tag LOCUS_10050 gene rocF 1126 2028 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711563.1 protein_id gnl|my_center|LOCUS_10050 2207 3031 gene locus_tag LOCUS_10060 gene cdaA 2207 3031 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_10060 3024 4298 gene locus_tag LOCUS_10070 3024 4298 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869586.1 protein_id gnl|my_center|LOCUS_10070 4302 5642 gene locus_tag LOCUS_10080 gene glmM 4302 5642 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_10080 5743 6057 gene locus_tag LOCUS_10090 5743 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 6091 7914 gene locus_tag LOCUS_10100 gene glmS 6091 7914 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_10100 8180 7920 gene locus_tag LOCUS_10110 8180 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 8328 8495 gene locus_tag LOCUS_10120 8328 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9416 10213 gene locus_tag LOCUS_10130 9416 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 10258 11256 gene locus_tag LOCUS_10140 10258 11256 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002004297.1 protein_id gnl|my_center|LOCUS_10140 11425 11853 gene locus_tag LOCUS_10150 11425 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 11866 13005 gene locus_tag LOCUS_10160 gene alr 11866 13005 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_10160 13119 13403 gene locus_tag LOCUS_10170 13119 13403 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393653.1 protein_id gnl|my_center|LOCUS_10170 13408 13758 gene locus_tag LOCUS_10180 gene ndoA 13408 13758 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_10180 14062 13931 gene locus_tag LOCUS_10190 14062 13931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 14224 14298 gene locus_tag LOCUS_t00170 14224 14298 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 14307 14401 gene locus_tag LOCUS_t00180 14307 14401 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14410 14485 gene locus_tag LOCUS_t00190 14410 14485 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14489 14564 gene locus_tag LOCUS_t00200 14489 14564 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14605 14680 gene locus_tag LOCUS_t00210 14605 14680 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 14692 14767 gene locus_tag LOCUS_t00220 14692 14767 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14780 14864 gene locus_tag LOCUS_t00230 14780 14864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15504 15079 gene locus_tag LOCUS_10200 15504 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 16785 16045 gene locus_tag LOCUS_10210 gene cobB 16785 16045 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_10210 16910 17350 gene locus_tag LOCUS_10220 16910 17350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 17466 18203 gene locus_tag LOCUS_10230 gene trmH 17466 18203 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_10230 21149 18993 gene locus_tag LOCUS_10240 21149 18993 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208599863.1 protein_id gnl|my_center|LOCUS_10240 21573 21977 gene locus_tag LOCUS_10250 21573 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 22062 22250 gene locus_tag LOCUS_10260 22062 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 22254 22568 gene locus_tag LOCUS_10270 22254 22568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 22873 26337 gene locus_tag LOCUS_10280 22873 26337 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_10280 26481 27032 gene locus_tag LOCUS_10290 26481 27032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 27477 27118 gene locus_tag LOCUS_10300 27477 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 28785 27895 gene locus_tag LOCUS_10310 gene thiM 28785 27895 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393513.1 protein_id gnl|my_center|LOCUS_10310 29212 29027 gene locus_tag LOCUS_10320 29212 29027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 29883 29173 gene locus_tag LOCUS_10330 29883 29173 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013857.1 protein_id gnl|my_center|LOCUS_10330 30108 30854 gene locus_tag LOCUS_10340 30108 30854 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243773.1 protein_id gnl|my_center|LOCUS_10340 31518 30832 gene locus_tag LOCUS_10350 31518 30832 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_10350 32739 31558 gene locus_tag LOCUS_10360 gene nirJ1 32739 31558 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_10360 32879 34108 gene locus_tag LOCUS_10370 32879 34108 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_10370 34499 34660 gene locus_tag LOCUS_10380 34499 34660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 34688 35158 gene locus_tag LOCUS_10390 gene cbaB 34688 35158 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_10390 35228 36877 gene locus_tag LOCUS_10400 35228 36877 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_10400 37044 36808 gene locus_tag LOCUS_10410 37044 36808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 37298 36990 gene locus_tag LOCUS_10420 37298 36990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 38199 37321 gene locus_tag LOCUS_10430 38199 37321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_10430 38542 38372 gene locus_tag LOCUS_10440 38542 38372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 38715 38503 gene locus_tag LOCUS_10450 38715 38503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 38987 39148 gene locus_tag LOCUS_10460 38987 39148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 39179 39649 gene locus_tag LOCUS_10470 gene cbaB 39179 39649 CDS product ba3-type cytochrome C oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173203.1 protein_id gnl|my_center|LOCUS_10470 39759 41363 gene locus_tag LOCUS_10480 39759 41363 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_10480 41506 42927 gene locus_tag LOCUS_10490 41506 42927 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410209.1 protein_id gnl|my_center|LOCUS_10490 42970 44937 gene locus_tag LOCUS_10500 42970 44937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence016 3 995 gene locus_tag LOCUS_10510 3 995 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_10510 1041 2519 gene locus_tag LOCUS_10520 1041 2519 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945999.1 protein_id gnl|my_center|LOCUS_10520 2581 3036 gene locus_tag LOCUS_10530 gene paaI 2581 3036 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_10530 3656 3132 gene locus_tag LOCUS_10540 3656 3132 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 protein_id gnl|my_center|LOCUS_10540 3750 4742 gene locus_tag LOCUS_10550 gene fabK 3750 4742 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392462.1 protein_id gnl|my_center|LOCUS_10550 4739 5131 gene locus_tag LOCUS_10560 4739 5131 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228335.1 protein_id gnl|my_center|LOCUS_10560 5219 6325 gene locus_tag LOCUS_10570 5219 6325 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_10570 6349 7425 gene locus_tag LOCUS_10580 gene pdhA 6349 7425 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_10580 7413 8111 gene locus_tag LOCUS_10590 7413 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 8048 8389 gene locus_tag LOCUS_10600 8048 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 8470 8691 gene locus_tag LOCUS_10610 8470 8691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 8808 9272 gene locus_tag LOCUS_10620 8808 9272 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274908.1 protein_id gnl|my_center|LOCUS_10620 9336 10157 gene locus_tag LOCUS_10630 9336 10157 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_10630 10144 11187 gene locus_tag LOCUS_10640 10144 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 11331 12746 gene locus_tag LOCUS_10650 11331 12746 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_10650 13347 12847 gene locus_tag LOCUS_10660 13347 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 14971 13451 gene locus_tag LOCUS_10670 14971 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 15830 15057 gene locus_tag LOCUS_10680 15830 15057 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143410.1 protein_id gnl|my_center|LOCUS_10680 17043 16231 gene locus_tag LOCUS_10690 17043 16231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 20700 17251 gene locus_tag LOCUS_10700 gene pyc 20700 17251 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164080.1 protein_id gnl|my_center|LOCUS_10700 21909 20728 gene locus_tag LOCUS_10710 21909 20728 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_10710 22400 21906 gene locus_tag LOCUS_10720 22400 21906 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968070.1 protein_id gnl|my_center|LOCUS_10720 22622 23398 gene locus_tag LOCUS_10730 gene fabI 22622 23398 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 protein_id gnl|my_center|LOCUS_10730 23931 23491 gene locus_tag LOCUS_10740 23931 23491 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543273.1 protein_id gnl|my_center|LOCUS_10740 24468 23953 gene locus_tag LOCUS_10750 24468 23953 CDS product YjcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765876.1 protein_id gnl|my_center|LOCUS_10750 24611 24763 gene locus_tag LOCUS_10760 24611 24763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 24868 25428 gene locus_tag LOCUS_10770 24868 25428 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665093.1 protein_id gnl|my_center|LOCUS_10770 25434 25673 gene locus_tag LOCUS_10780 25434 25673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 25741 25817 gene locus_tag LOCUS_t00240 25741 25817 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25823 25898 gene locus_tag LOCUS_t00250 25823 25898 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 25912 25987 gene locus_tag LOCUS_t00260 25912 25987 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25999 26074 gene locus_tag LOCUS_t00270 25999 26074 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26138 26854 gene locus_tag LOCUS_10790 26138 26854 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986752.1 protein_id gnl|my_center|LOCUS_10790 26845 27792 gene locus_tag LOCUS_10800 26845 27792 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986751.1 protein_id gnl|my_center|LOCUS_10800 27868 28791 gene locus_tag LOCUS_10810 27868 28791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986750.1 protein_id gnl|my_center|LOCUS_10810 28784 29533 gene locus_tag LOCUS_10820 28784 29533 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247643.1 protein_id gnl|my_center|LOCUS_10820 29662 30819 gene locus_tag LOCUS_10830 29662 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 30921 31280 gene locus_tag LOCUS_10840 30921 31280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 31664 31314 gene locus_tag LOCUS_10850 31664 31314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 31695 32567 gene locus_tag LOCUS_10860 31695 32567 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_10860 33173 35038 gene locus_tag LOCUS_10870 gene iolD 33173 35038 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195356.1 protein_id gnl|my_center|LOCUS_10870 35056 35973 gene locus_tag LOCUS_10880 gene iolE 35056 35973 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356924.1 protein_id gnl|my_center|LOCUS_10880 36032 36868 gene locus_tag LOCUS_10890 gene iolB 36032 36868 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210306.1 protein_id gnl|my_center|LOCUS_10890 36894 37901 gene locus_tag LOCUS_10900 gene degA 36894 37901 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_10900 37977 39473 gene locus_tag LOCUS_10910 gene gguA 37977 39473 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_10910 39741 40313 gene locus_tag LOCUS_10920 39741 40313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 40362 41336 gene locus_tag LOCUS_10930 40362 41336 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530507.1 protein_id gnl|my_center|LOCUS_10930 41393 42427 gene locus_tag LOCUS_10940 gene iolG 41393 42427 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398990.1 protein_id gnl|my_center|LOCUS_10940 42424 43452 gene locus_tag LOCUS_10950 gene iolC 42424 43452 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence017 347 1015 gene locus_tag LOCUS_10960 gene tenA 347 1015 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198338.1 protein_id gnl|my_center|LOCUS_10960 1209 1613 gene locus_tag LOCUS_10970 1209 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1627 2427 gene locus_tag LOCUS_10980 gene thiD 1627 2427 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867389.1 protein_id gnl|my_center|LOCUS_10980 2528 3034 gene locus_tag LOCUS_10990 2528 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3086 3667 gene locus_tag LOCUS_11000 gene thpR 3086 3667 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256208.1 protein_id gnl|my_center|LOCUS_11000 3773 5200 gene locus_tag LOCUS_11010 3773 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 6361 5327 gene locus_tag LOCUS_11020 6361 5327 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840950.1 protein_id gnl|my_center|LOCUS_11020 6622 6377 gene locus_tag LOCUS_11030 6622 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 6841 7485 gene locus_tag LOCUS_11040 6841 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11040 7485 7907 gene locus_tag LOCUS_11050 7485 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11050 8088 9377 gene locus_tag LOCUS_11060 gene amt 8088 9377 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_11060 9434 10465 gene locus_tag LOCUS_11070 9434 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 10479 11225 gene locus_tag LOCUS_11080 10479 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 11396 11899 gene locus_tag LOCUS_11090 gene moaC 11396 11899 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722672.1 protein_id gnl|my_center|LOCUS_11090 12217 12390 gene locus_tag LOCUS_11100 12217 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 12488 14506 gene locus_tag LOCUS_11110 12488 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 14503 15366 gene locus_tag LOCUS_11120 14503 15366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948651.1 protein_id gnl|my_center|LOCUS_11120 15351 16058 gene locus_tag LOCUS_11130 15351 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 16199 16396 gene locus_tag LOCUS_11140 16199 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 16536 17216 gene locus_tag LOCUS_11150 16536 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 18502 18332 gene locus_tag LOCUS_11160 18502 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 19972 18935 gene locus_tag LOCUS_11170 19972 18935 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_11170 20139 21224 gene locus_tag LOCUS_11180 20139 21224 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887146.1 protein_id gnl|my_center|LOCUS_11180 21300 21911 gene locus_tag LOCUS_11190 21300 21911 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256712.1 protein_id gnl|my_center|LOCUS_11190 22022 25570 gene locus_tag LOCUS_11200 22022 25570 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963692.1 protein_id gnl|my_center|LOCUS_11200 26786 25500 gene locus_tag LOCUS_11210 26786 25500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 27240 26968 gene locus_tag LOCUS_11220 27240 26968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 27881 27294 gene locus_tag LOCUS_11230 27881 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 28011 29528 gene locus_tag LOCUS_11240 gene ypwA 28011 29528 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_11240 29564 29845 gene locus_tag LOCUS_11250 29564 29845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 29924 30349 gene locus_tag LOCUS_11260 29924 30349 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_11260 30533 31459 gene locus_tag LOCUS_11270 30533 31459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 32009 31497 gene locus_tag LOCUS_11280 32009 31497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 33631 32120 gene locus_tag LOCUS_11290 gene dhaS 33631 32120 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_11290 33980 35935 gene locus_tag LOCUS_11300 33980 35935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 36047 37015 gene locus_tag LOCUS_11310 36047 37015 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_11310 37049 37822 gene locus_tag LOCUS_11320 37049 37822 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964169.1 protein_id gnl|my_center|LOCUS_11320 38029 38649 gene locus_tag LOCUS_11330 38029 38649 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_11330 38654 39634 gene locus_tag LOCUS_11340 38654 39634 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence018 967 188 gene locus_tag LOCUS_11350 967 188 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_11350 1785 997 gene locus_tag LOCUS_11360 1785 997 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_11360 2094 1786 gene locus_tag LOCUS_11370 2094 1786 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566769.1 protein_id gnl|my_center|LOCUS_11370 3554 2199 gene locus_tag LOCUS_11380 3554 2199 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926050.1 protein_id gnl|my_center|LOCUS_11380 4200 3715 gene locus_tag LOCUS_11390 gene paaJ 4200 3715 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618854.1 protein_id gnl|my_center|LOCUS_11390 4999 4244 gene locus_tag LOCUS_11400 gene paaC 4999 4244 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_11400 5390 5007 gene locus_tag LOCUS_11410 5390 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 6411 5425 gene locus_tag LOCUS_11420 gene paaA 6411 5425 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_11420 7009 6356 gene locus_tag LOCUS_11430 7009 6356 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_11430 8054 7260 gene locus_tag LOCUS_11440 gene paaC 8054 7260 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889010.1 protein_id gnl|my_center|LOCUS_11440 8395 8051 gene locus_tag LOCUS_11450 8395 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 9389 8409 gene locus_tag LOCUS_11460 gene paaA 9389 8409 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228339.1 protein_id gnl|my_center|LOCUS_11460 10085 9633 gene locus_tag LOCUS_11470 10085 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 10392 10252 gene locus_tag LOCUS_11480 10392 10252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 11328 10546 gene locus_tag LOCUS_11490 11328 10546 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231526.1 protein_id gnl|my_center|LOCUS_11490 11999 11403 gene locus_tag LOCUS_11500 11999 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 12506 12033 gene locus_tag LOCUS_11510 gene ytfJ 12506 12033 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_11510 13129 12479 gene locus_tag LOCUS_11520 13129 12479 CDS product DUF2953 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181652.1 protein_id gnl|my_center|LOCUS_11520 13591 13238 gene locus_tag LOCUS_11530 13591 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 15364 13706 gene locus_tag LOCUS_11540 15364 13706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 17100 15481 gene locus_tag LOCUS_11550 17100 15481 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229333.1 protein_id gnl|my_center|LOCUS_11550 18401 17082 gene locus_tag LOCUS_11560 18401 17082 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558868.1 protein_id gnl|my_center|LOCUS_11560 19352 18756 gene locus_tag LOCUS_11570 19352 18756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 20415 19651 gene locus_tag LOCUS_11580 20415 19651 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228127.1 protein_id gnl|my_center|LOCUS_11580 21659 20502 gene locus_tag LOCUS_11590 21659 20502 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228126.1 protein_id gnl|my_center|LOCUS_11590 22627 21662 gene locus_tag LOCUS_11600 22627 21662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 24316 22784 gene locus_tag LOCUS_11610 24316 22784 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031537.1 protein_id gnl|my_center|LOCUS_11610 25983 24346 gene locus_tag LOCUS_11620 25983 24346 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926032.1 protein_id gnl|my_center|LOCUS_11620 26622 26050 gene locus_tag LOCUS_11630 26622 26050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 28456 26831 gene locus_tag LOCUS_11640 28456 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 29138 28512 gene locus_tag LOCUS_11650 29138 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 29585 30481 gene locus_tag LOCUS_11660 29585 30481 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909376.1 protein_id gnl|my_center|LOCUS_11660 31695 30550 gene locus_tag LOCUS_11670 31695 30550 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_11670 31811 33004 gene locus_tag LOCUS_11680 31811 33004 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765511.1 protein_id gnl|my_center|LOCUS_11680 34102 33086 gene locus_tag LOCUS_11690 gene bioB 34102 33086 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398967.1 protein_id gnl|my_center|LOCUS_11690 34960 34136 gene locus_tag LOCUS_11700 gene bioC 34960 34136 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608924.1 protein_id gnl|my_center|LOCUS_11700 35827 34982 gene locus_tag LOCUS_11710 35827 34982 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943266.1 protein_id gnl|my_center|LOCUS_11710 37059 35824 gene locus_tag LOCUS_11720 gene bioF 37059 35824 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_11720 37787 37059 gene locus_tag LOCUS_11730 gene bioD 37787 37059 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012476.1 protein_id gnl|my_center|LOCUS_11730 39160 37784 gene locus_tag LOCUS_11740 gene bioA 39160 37784 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144314.1 protein_id gnl|my_center|LOCUS_11740 39408 39322 gene locus_tag LOCUS_t00280 39408 39322 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39491 39416 gene locus_tag LOCUS_t00290 39491 39416 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 326 913 gene locus_tag LOCUS_11750 326 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2579 900 gene locus_tag LOCUS_11760 2579 900 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_11760 3568 2699 gene locus_tag LOCUS_11770 gene dapA 3568 2699 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_11770 4812 3550 gene locus_tag LOCUS_11780 gene dapG 4812 3550 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692470.1 protein_id gnl|my_center|LOCUS_11780 5847 4828 gene locus_tag LOCUS_11790 5847 4828 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228015.1 protein_id gnl|my_center|LOCUS_11790 6541 5939 gene locus_tag LOCUS_11800 gene dpaB 6541 5939 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049484.1 protein_id gnl|my_center|LOCUS_11800 7437 6538 gene locus_tag LOCUS_11810 gene dpaA 7437 6538 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954735.1 protein_id gnl|my_center|LOCUS_11810 7850 7584 gene locus_tag LOCUS_11820 7850 7584 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774520.1 protein_id gnl|my_center|LOCUS_11820 8408 7962 gene locus_tag LOCUS_11830 gene dut 8408 7962 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_11830 9654 8401 gene locus_tag LOCUS_11840 9654 8401 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_11840 10748 9717 gene locus_tag LOCUS_11850 10748 9717 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244721.1 protein_id gnl|my_center|LOCUS_11850 11305 10940 gene locus_tag LOCUS_11860 11305 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 13425 11302 gene locus_tag LOCUS_11870 gene pnp 13425 11302 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_11870 13828 13559 gene locus_tag LOCUS_11880 gene rpsO 13828 13559 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_11880 14921 13989 gene locus_tag LOCUS_11890 gene ribF 14921 13989 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766706.1 protein_id gnl|my_center|LOCUS_11890 15832 14918 gene locus_tag LOCUS_11900 gene truB 15832 14918 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399346.1 protein_id gnl|my_center|LOCUS_11900 16823 15822 gene locus_tag LOCUS_11910 16823 15822 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_11910 17232 16813 gene locus_tag LOCUS_11920 gene rbfA 17232 16813 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_11920 17532 17251 gene locus_tag LOCUS_11930 17532 17251 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393381.1 protein_id gnl|my_center|LOCUS_11930 19949 17529 gene locus_tag LOCUS_11940 19949 17529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 20269 19946 gene locus_tag LOCUS_11950 20269 19946 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439520.1 protein_id gnl|my_center|LOCUS_11950 20537 20262 gene locus_tag LOCUS_11960 20537 20262 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_11960 21856 20576 gene locus_tag LOCUS_11970 gene nusA 21856 20576 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_11970 22368 21898 gene locus_tag LOCUS_11980 gene rimP 22368 21898 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_11980 26808 22495 gene locus_tag LOCUS_11990 26808 22495 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 protein_id gnl|my_center|LOCUS_11990 28602 26872 gene locus_tag LOCUS_12000 gene proS 28602 26872 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814303.1 protein_id gnl|my_center|LOCUS_12000 29716 28619 gene locus_tag LOCUS_12010 gene ispG 29716 28619 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886567.1 protein_id gnl|my_center|LOCUS_12010 31007 29733 gene locus_tag LOCUS_12020 gene rseP 31007 29733 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886508.1 protein_id gnl|my_center|LOCUS_12020 32177 31023 gene locus_tag LOCUS_12030 32177 31023 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_12030 33017 32232 gene locus_tag LOCUS_12040 33017 32232 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829499.1 protein_id gnl|my_center|LOCUS_12040 33794 33030 gene locus_tag LOCUS_12050 33794 33030 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 protein_id gnl|my_center|LOCUS_12050 34430 33873 gene locus_tag LOCUS_12060 gene frr 34430 33873 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_12060 35155 34430 gene locus_tag LOCUS_12070 gene pyrH 35155 34430 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042668.1 protein_id gnl|my_center|LOCUS_12070 35954 35304 gene locus_tag LOCUS_12080 gene tsf 35954 35304 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_12080 36773 36072 gene locus_tag LOCUS_12090 gene rpsB 36773 36072 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence020 155 502 gene locus_tag LOCUS_12100 155 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417212.1 protein_id gnl|my_center|LOCUS_12100 1541 558 gene locus_tag LOCUS_12110 1541 558 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206500.1 protein_id gnl|my_center|LOCUS_12110 2494 1541 gene locus_tag LOCUS_12120 2494 1541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207717.1 protein_id gnl|my_center|LOCUS_12120 3321 2524 gene locus_tag LOCUS_12130 3321 2524 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256988.1 protein_id gnl|my_center|LOCUS_12130 3476 4285 gene locus_tag LOCUS_12140 3476 4285 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_12140 4254 5015 gene locus_tag LOCUS_12150 4254 5015 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391996.1 protein_id gnl|my_center|LOCUS_12150 5437 5108 gene locus_tag LOCUS_12160 5437 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 6904 6176 gene locus_tag LOCUS_12170 6904 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 8250 7045 gene locus_tag LOCUS_12180 8250 7045 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_12180 9026 8562 gene locus_tag LOCUS_12190 9026 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 9220 9023 gene locus_tag LOCUS_12200 9220 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 9967 9401 gene locus_tag LOCUS_12210 9967 9401 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_12210 11943 10126 gene locus_tag LOCUS_12220 gene pepF 11943 10126 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_12220 13111 11987 gene locus_tag LOCUS_12230 13111 11987 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 protein_id gnl|my_center|LOCUS_12230 13209 13724 gene locus_tag LOCUS_12240 13209 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 14506 13721 gene locus_tag LOCUS_12250 14506 13721 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006542.1 protein_id gnl|my_center|LOCUS_12250 16330 14639 gene locus_tag LOCUS_12260 16330 14639 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_12260 17543 16395 gene locus_tag LOCUS_12270 17543 16395 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_12270 19145 18006 gene locus_tag LOCUS_12280 gene rpoD 19145 18006 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_12280 20999 19167 gene locus_tag LOCUS_12290 gene dnaG 20999 19167 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_12290 23981 21306 gene locus_tag LOCUS_12300 gene ppdK 23981 21306 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_12300 24778 23981 gene locus_tag LOCUS_12310 24778 23981 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230064.1 protein_id gnl|my_center|LOCUS_12310 25354 24848 gene locus_tag LOCUS_12320 25354 24848 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583757.1 protein_id gnl|my_center|LOCUS_12320 25641 25769 gene locus_tag LOCUS_12330 25641 25769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 27937 25928 gene locus_tag LOCUS_12340 gene tkt 27937 25928 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019779.1 protein_id gnl|my_center|LOCUS_12340 28095 28790 gene locus_tag LOCUS_12350 28095 28790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 29398 28823 gene locus_tag LOCUS_12360 gene glpP 29398 28823 CDS product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394287.1 protein_id gnl|my_center|LOCUS_12360 31124 29442 gene locus_tag LOCUS_12370 gene glpD 31124 29442 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_12370 32882 31371 gene locus_tag LOCUS_12380 gene glpK 32882 31371 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_12380 33755 32922 gene locus_tag LOCUS_12390 gene glpF 33755 32922 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272193.1 protein_id gnl|my_center|LOCUS_12390 33811 33978 gene locus_tag LOCUS_12400 33811 33978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 34790 34035 gene locus_tag LOCUS_12410 34790 34035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 34770 35225 gene locus_tag LOCUS_12420 34770 35225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 <36429 35574 gene locus_tag LOCUS_12430 <36429 35574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050754218.1:DDE-type integrase/transposase/recombinase >Feature sequence021 1827 88 gene locus_tag LOCUS_12440 gene acsA 1827 88 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_12440 2348 2028 gene locus_tag LOCUS_12450 2348 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3265 2657 gene locus_tag LOCUS_12460 gene spoIIIAG 3265 2657 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230248.1 protein_id gnl|my_center|LOCUS_12460 4007 3315 gene locus_tag LOCUS_12470 4007 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5176 4019 gene locus_tag LOCUS_12480 gene spoIIIAE 5176 4019 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_12480 5597 5208 gene locus_tag LOCUS_12490 gene spoIIIAD 5597 5208 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_12490 5813 5610 gene locus_tag LOCUS_12500 gene spoIIIAC 5813 5610 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153142.1 protein_id gnl|my_center|LOCUS_12500 6353 5835 gene locus_tag LOCUS_12510 6353 5835 CDS product stage III sporulation protein AB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393044.1 protein_id gnl|my_center|LOCUS_12510 7309 6347 gene locus_tag LOCUS_12520 gene spoIIIAA 7309 6347 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_12520 7940 7506 gene locus_tag LOCUS_12530 7940 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_12530 8364 8095 gene locus_tag LOCUS_12540 8364 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8487 9734 gene locus_tag LOCUS_12550 8487 9734 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245414.1 protein_id gnl|my_center|LOCUS_12550 9797 10606 gene locus_tag LOCUS_12560 9797 10606 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391666.1 protein_id gnl|my_center|LOCUS_12560 10703 11158 gene locus_tag LOCUS_12570 10703 11158 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391668.1 protein_id gnl|my_center|LOCUS_12570 11704 11249 gene locus_tag LOCUS_12580 11704 11249 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199022.1 protein_id gnl|my_center|LOCUS_12580 11854 12213 gene locus_tag LOCUS_12590 11854 12213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 12288 13445 gene locus_tag LOCUS_12600 gene spoVE 12288 13445 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_12600 13694 13554 gene locus_tag LOCUS_12610 13694 13554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 14510 13719 gene locus_tag LOCUS_12620 14510 13719 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_12620 15318 14650 gene locus_tag LOCUS_12630 15318 14650 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391764.1 protein_id gnl|my_center|LOCUS_12630 16702 15515 gene locus_tag LOCUS_12640 16702 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 17376 16708 gene locus_tag LOCUS_12650 17376 16708 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130756.1 protein_id gnl|my_center|LOCUS_12650 17503 18378 gene locus_tag LOCUS_12660 17503 18378 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067729.1 protein_id gnl|my_center|LOCUS_12660 18380 18745 gene locus_tag LOCUS_12670 18380 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 18996 18790 gene locus_tag LOCUS_12680 18996 18790 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393288.1 protein_id gnl|my_center|LOCUS_12680 20726 19002 gene locus_tag LOCUS_12690 20726 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 21985 20927 gene locus_tag LOCUS_12700 21985 20927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 22417 22133 gene locus_tag LOCUS_12710 22417 22133 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135695.1 protein_id gnl|my_center|LOCUS_12710 23444 22479 gene locus_tag LOCUS_12720 gene glsA 23444 22479 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399984.1 protein_id gnl|my_center|LOCUS_12720 23579 24082 gene locus_tag LOCUS_12730 23579 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289792.1 protein_id gnl|my_center|LOCUS_12730 25112 24192 gene locus_tag LOCUS_12740 25112 24192 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947031.1 protein_id gnl|my_center|LOCUS_12740 25270 26415 gene locus_tag LOCUS_12750 gene yfkAB 25270 26415 CDS product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 protein_id gnl|my_center|LOCUS_12750 26717 26511 gene locus_tag LOCUS_12760 26717 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 27663 26869 gene locus_tag LOCUS_12770 27663 26869 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181838.1 protein_id gnl|my_center|LOCUS_12770 28286 27714 gene locus_tag LOCUS_12780 28286 27714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 28839 28300 gene locus_tag LOCUS_12790 28839 28300 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 protein_id gnl|my_center|LOCUS_12790 30340 28859 gene locus_tag LOCUS_12800 30340 28859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 31694 30480 gene locus_tag LOCUS_12810 31694 30480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 31893 32180 gene locus_tag LOCUS_12820 31893 32180 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391619.1 protein_id gnl|my_center|LOCUS_12820 33753 32197 gene locus_tag LOCUS_12830 33753 32197 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392612.1 protein_id gnl|my_center|LOCUS_12830 34363 33659 gene locus_tag LOCUS_12840 34363 33659 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812049.1 protein_id gnl|my_center|LOCUS_12840 35508 34345 gene locus_tag LOCUS_12850 gene cobD 35508 34345 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943619.1 protein_id gnl|my_center|LOCUS_12850 <36300 35584 gene locus_tag LOCUS_12860 <36300 35584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392613.1:adenosylcobinamide-phosphate synthase CbiB >Feature sequence022 732 1094 gene locus_tag LOCUS_12870 732 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4987 1538 gene locus_tag LOCUS_12880 gene metH 4987 1538 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_12880 6166 5006 gene locus_tag LOCUS_12890 6166 5006 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941613.1 protein_id gnl|my_center|LOCUS_12890 7323 6169 gene locus_tag LOCUS_12900 7323 6169 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817365.1 protein_id gnl|my_center|LOCUS_12900 9013 7595 gene locus_tag LOCUS_12910 9013 7595 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816836.1 protein_id gnl|my_center|LOCUS_12910 9222 10220 gene locus_tag LOCUS_12920 9222 10220 CDS product LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112461.1 protein_id gnl|my_center|LOCUS_12920 10562 10335 gene locus_tag LOCUS_12930 10562 10335 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804119.1 protein_id gnl|my_center|LOCUS_12930 11659 10703 gene locus_tag LOCUS_12940 gene tsuA 11659 10703 CDS product thiosulfate utilization transporter TsuA/YeeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492339.1 protein_id gnl|my_center|LOCUS_12940 11853 13418 gene locus_tag LOCUS_12950 11853 13418 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_12950 13448 13804 gene locus_tag LOCUS_12960 13448 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 13801 14667 gene locus_tag LOCUS_12970 13801 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12970 14664 14903 gene locus_tag LOCUS_12980 14664 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 14968 16128 gene locus_tag LOCUS_12990 14968 16128 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943959.1 protein_id gnl|my_center|LOCUS_12990 17505 16180 gene locus_tag LOCUS_13000 gene lysA 17505 16180 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280679.1 protein_id gnl|my_center|LOCUS_13000 17889 17632 gene locus_tag LOCUS_13010 17889 17632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 19489 17990 gene locus_tag LOCUS_13020 gene spoVAF 19489 17990 CDS product spore germination protein SpoVAF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230471.1 protein_id gnl|my_center|LOCUS_13020 20048 19476 gene locus_tag LOCUS_13030 20048 19476 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254415.1 protein_id gnl|my_center|LOCUS_13030 20405 20055 gene locus_tag LOCUS_13040 gene spoVAE 20405 20055 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_13040 21449 20409 gene locus_tag LOCUS_13050 gene spoVAD 21449 20409 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230465.1 protein_id gnl|my_center|LOCUS_13050 21937 21452 gene locus_tag LOCUS_13060 gene spoVAC 21937 21452 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_13060 22438 22022 gene locus_tag LOCUS_13070 gene spoVAB 22438 22022 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572931.1 protein_id gnl|my_center|LOCUS_13070 23058 22435 gene locus_tag LOCUS_13080 23058 22435 CDS product stage V sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438369.1 protein_id gnl|my_center|LOCUS_13080 23959 23207 gene locus_tag LOCUS_13090 gene sigF 23959 23207 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_13090 24416 23970 gene locus_tag LOCUS_13100 gene spoIIAB 24416 23970 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_13100 24768 24418 gene locus_tag LOCUS_13110 gene spoIIAA 24768 24418 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059133.1 protein_id gnl|my_center|LOCUS_13110 26101 24917 gene locus_tag LOCUS_13120 gene dacF 26101 24917 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_13120 26923 26324 gene locus_tag LOCUS_13130 26923 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 28298 26976 gene locus_tag LOCUS_13140 28298 26976 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_13140 29125 28298 gene locus_tag LOCUS_13150 29125 28298 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_13150 29960 29145 gene locus_tag LOCUS_13160 29960 29145 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_13160 31144 29975 gene locus_tag LOCUS_13170 gene deoB 31144 29975 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_13170 32109 31222 gene locus_tag LOCUS_13180 gene xerD 32109 31222 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_13180 32540 32301 gene locus_tag LOCUS_13190 32540 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 32836 32597 gene locus_tag LOCUS_13200 32836 32597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 34004 33477 gene locus_tag LOCUS_13210 34004 33477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 35451 34336 gene locus_tag LOCUS_13220 gene ald 35451 34336 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243280.1 protein_id gnl|my_center|LOCUS_13220 36058 35567 gene locus_tag LOCUS_13230 gene fur 36058 35567 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223972.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence023 383 114 gene locus_tag LOCUS_13240 383 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 337 906 gene locus_tag LOCUS_13250 337 906 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398582.1 protein_id gnl|my_center|LOCUS_13250 1032 1871 gene locus_tag LOCUS_13260 1032 1871 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_13260 3609 1930 gene locus_tag LOCUS_13270 3609 1930 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392261.1 protein_id gnl|my_center|LOCUS_13270 4794 3829 gene locus_tag LOCUS_13280 gene selD 4794 3829 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_13280 5664 4912 gene locus_tag LOCUS_13290 gene phnC 5664 4912 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090670.1 protein_id gnl|my_center|LOCUS_13290 6425 5667 gene locus_tag LOCUS_13300 gene phnE 6425 5667 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_13300 7370 6459 gene locus_tag LOCUS_13310 7370 6459 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119656.1 protein_id gnl|my_center|LOCUS_13310 8507 7452 gene locus_tag LOCUS_13320 8507 7452 CDS product GPMC system family 4 glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039643499.1 protein_id gnl|my_center|LOCUS_13320 8665 9756 gene locus_tag LOCUS_13330 gene mnmH 8665 9756 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812887.1 protein_id gnl|my_center|LOCUS_13330 9949 9862 gene locus_tag LOCUS_t00300 9949 9862 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10432 11259 gene locus_tag LOCUS_13340 10432 11259 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393282.1 protein_id gnl|my_center|LOCUS_13340 11863 11342 gene locus_tag LOCUS_13350 gene resA 11863 11342 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_13350 12129 14330 gene locus_tag LOCUS_13360 12129 14330 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_13360 16038 14440 gene locus_tag LOCUS_13370 16038 14440 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817748.1 protein_id gnl|my_center|LOCUS_13370 16451 16236 gene locus_tag LOCUS_13380 gene sasP 16451 16236 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284598.1 protein_id gnl|my_center|LOCUS_13380 17610 16531 gene locus_tag LOCUS_13390 gene pepQ 17610 16531 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 protein_id gnl|my_center|LOCUS_13390 18843 17677 gene locus_tag LOCUS_13400 18843 17677 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_13400 19422 18868 gene locus_tag LOCUS_13410 19422 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245777.1 protein_id gnl|my_center|LOCUS_13410 20167 19499 gene locus_tag LOCUS_13420 20167 19499 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_13420 21544 20360 gene locus_tag LOCUS_13430 21544 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 21816 21646 gene locus_tag LOCUS_13440 21816 21646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 21736 21936 gene locus_tag LOCUS_13450 21736 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 22632 21988 gene locus_tag LOCUS_13460 22632 21988 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_13460 24019 22820 gene locus_tag LOCUS_13470 gene thiI 24019 22820 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_13470 25177 24023 gene locus_tag LOCUS_13480 25177 24023 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_13480 25432 25578 gene locus_tag LOCUS_13490 25432 25578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 26025 25669 gene locus_tag LOCUS_13500 26025 25669 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886568.1 protein_id gnl|my_center|LOCUS_13500 26184 26777 gene locus_tag LOCUS_13510 26184 26777 CDS product nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246215.1 protein_id gnl|my_center|LOCUS_13510 27029 26820 gene locus_tag LOCUS_13520 27029 26820 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115477.1 protein_id gnl|my_center|LOCUS_13520 28448 27273 gene locus_tag LOCUS_13530 28448 27273 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_13530 30677 28470 gene locus_tag LOCUS_13540 30677 28470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 30937 30773 gene locus_tag LOCUS_13550 30937 30773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 31940 31044 gene locus_tag LOCUS_13560 31940 31044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 32659 32006 gene locus_tag LOCUS_13570 32659 32006 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536320.1 protein_id gnl|my_center|LOCUS_13570 33498 32854 gene locus_tag LOCUS_13580 33498 32854 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256260.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence024 336 794 gene locus_tag LOCUS_13590 336 794 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229573.1 protein_id gnl|my_center|LOCUS_13590 841 1662 gene locus_tag LOCUS_13600 gene racE 841 1662 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 protein_id gnl|my_center|LOCUS_13600 1762 2841 gene locus_tag LOCUS_13610 gene gerM 1762 2841 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229578.1 protein_id gnl|my_center|LOCUS_13610 3390 2917 gene locus_tag LOCUS_13620 3390 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3555 4391 gene locus_tag LOCUS_13630 3555 4391 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261764.1 protein_id gnl|my_center|LOCUS_13630 4375 5007 gene locus_tag LOCUS_13640 4375 5007 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_13640 4985 5500 gene locus_tag LOCUS_13650 4985 5500 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229585.1 protein_id gnl|my_center|LOCUS_13650 5563 5639 gene locus_tag LOCUS_t00310 5563 5639 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6014 6136 gene locus_tag LOCUS_13660 6014 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 6360 7685 gene locus_tag LOCUS_13670 6360 7685 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485341.1 protein_id gnl|my_center|LOCUS_13670 7698 8714 gene locus_tag LOCUS_13680 7698 8714 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485881.1 protein_id gnl|my_center|LOCUS_13680 8756 9160 gene locus_tag LOCUS_13690 8756 9160 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258819.1 protein_id gnl|my_center|LOCUS_13690 9201 10289 gene locus_tag LOCUS_13700 gene ddcA 9201 10289 CDS product DNA damage checkpoint antagonist DdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229609.1 protein_id gnl|my_center|LOCUS_13700 10380 11672 gene locus_tag LOCUS_13710 gene tig 10380 11672 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_13710 11771 12352 gene locus_tag LOCUS_13720 gene clpP 11771 12352 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_13720 12374 13651 gene locus_tag LOCUS_13730 gene clpX 12374 13651 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_13730 13790 15508 gene locus_tag LOCUS_13740 gene lonB 13790 15508 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398923.1 protein_id gnl|my_center|LOCUS_13740 15545 18004 gene locus_tag LOCUS_13750 gene lon 15545 18004 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_13750 17973 18578 gene locus_tag LOCUS_13760 gene yihA 17973 18578 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_13760 19012 18821 gene locus_tag LOCUS_13770 19012 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 19108 19494 gene locus_tag LOCUS_13780 19108 19494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 19540 20295 gene locus_tag LOCUS_13790 19540 20295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 20847 20350 gene locus_tag LOCUS_13800 20847 20350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 21839 20868 gene locus_tag LOCUS_13810 21839 20868 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195333.1 protein_id gnl|my_center|LOCUS_13810 22034 23407 gene locus_tag LOCUS_13820 gene hemA 22034 23407 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547841.1 protein_id gnl|my_center|LOCUS_13820 23450 24271 gene locus_tag LOCUS_13830 gene ccsA 23450 24271 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008996.1 protein_id gnl|my_center|LOCUS_13830 24284 24988 gene locus_tag LOCUS_13840 24284 24988 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_13840 24992 25918 gene locus_tag LOCUS_13850 gene hemC 24992 25918 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_13850 25915 27492 gene locus_tag LOCUS_13860 gene cobA 25915 27492 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_13860 27489 28463 gene locus_tag LOCUS_13870 gene hemB 27489 28463 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087062.1 protein_id gnl|my_center|LOCUS_13870 28465 29520 gene locus_tag LOCUS_13880 28465 29520 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_13880 29767 33093 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttggagcctacctatgagggattggaac >Feature sequence025 291 1571 gene locus_tag LOCUS_13890 291 1571 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938460.1 protein_id gnl|my_center|LOCUS_13890 1679 2089 gene locus_tag LOCUS_13900 1679 2089 CDS product DUF2294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092004.1 protein_id gnl|my_center|LOCUS_13900 2206 3204 gene locus_tag LOCUS_13910 gene moaA 2206 3204 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_13910 3279 5657 gene locus_tag LOCUS_13920 3279 5657 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_13920 6538 5720 gene locus_tag LOCUS_13930 6538 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 7725 6559 gene locus_tag LOCUS_13940 7725 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 7950 9062 gene locus_tag LOCUS_13950 7950 9062 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_13950 9548 9150 gene locus_tag LOCUS_13960 9548 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 11486 9558 gene locus_tag LOCUS_13970 11486 9558 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_13970 11865 13076 gene locus_tag LOCUS_13980 11865 13076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774229.1 protein_id gnl|my_center|LOCUS_13980 13137 13829 gene locus_tag LOCUS_13990 13137 13829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173093.1 protein_id gnl|my_center|LOCUS_13990 13860 14051 gene locus_tag LOCUS_14000 13860 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 14344 14874 gene locus_tag LOCUS_14010 14344 14874 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064860.1 protein_id gnl|my_center|LOCUS_14010 15936 14914 gene locus_tag LOCUS_14020 15936 14914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 16845 16018 gene locus_tag LOCUS_14030 16845 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 17611 20286 gene locus_tag LOCUS_14040 gene valS 17611 20286 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_14040 20359 21690 gene locus_tag LOCUS_14050 gene folC 20359 21690 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_14050 21690 23084 gene locus_tag LOCUS_14060 gene murC 21690 23084 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_14060 23230 24951 gene locus_tag LOCUS_14070 23230 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 25589 25041 gene locus_tag LOCUS_14080 25589 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 26063 25683 gene locus_tag LOCUS_14090 26063 25683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 26229 27656 gene locus_tag LOCUS_14100 26229 27656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 27742 29394 gene locus_tag LOCUS_14110 27742 29394 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_14110 29434 30486 gene locus_tag LOCUS_14120 29434 30486 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_14120 30522 31730 gene locus_tag LOCUS_14130 30522 31730 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence026 1342 359 gene locus_tag LOCUS_14140 gene bfmBAB 1342 359 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_14140 2351 1356 gene locus_tag LOCUS_14150 gene bfmBAA 2351 1356 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 protein_id gnl|my_center|LOCUS_14150 3850 2426 gene locus_tag LOCUS_14160 gene lpdA 3850 2426 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051291.1 protein_id gnl|my_center|LOCUS_14160 5058 3949 gene locus_tag LOCUS_14170 gene buk 5058 3949 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115781.1 protein_id gnl|my_center|LOCUS_14170 6168 5074 gene locus_tag LOCUS_14180 6168 5074 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171355.1 protein_id gnl|my_center|LOCUS_14180 7141 6221 gene locus_tag LOCUS_14190 gene ptb 7141 6221 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_14190 9401 7362 gene locus_tag LOCUS_14200 9401 7362 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810985.1 protein_id gnl|my_center|LOCUS_14200 9601 9867 gene locus_tag LOCUS_14210 9601 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 10796 9906 gene locus_tag LOCUS_14220 10796 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11482 10793 gene locus_tag LOCUS_14230 11482 10793 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438150.1 protein_id gnl|my_center|LOCUS_14230 12030 11479 gene locus_tag LOCUS_14240 12030 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 13182 12040 gene locus_tag LOCUS_14250 gene steA 13182 12040 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428389.1 protein_id gnl|my_center|LOCUS_14250 13509 13336 gene locus_tag LOCUS_14260 13509 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 14404 13619 gene locus_tag LOCUS_14270 gene spo0A 14404 13619 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_14270 15934 14486 gene locus_tag LOCUS_14280 gene spoIVB 15934 14486 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_14280 17790 16066 gene locus_tag LOCUS_14290 gene recN 17790 16066 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_14290 18265 17816 gene locus_tag LOCUS_14300 gene argR 18265 17816 CDS product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032581.1 protein_id gnl|my_center|LOCUS_14300 19134 18262 gene locus_tag LOCUS_14310 19134 18262 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_14310 19636 19145 gene locus_tag LOCUS_14320 19636 19145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 20499 19672 gene locus_tag LOCUS_14330 20499 19672 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 protein_id gnl|my_center|LOCUS_14330 22391 20505 gene locus_tag LOCUS_14340 gene dxs 22391 20505 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366452.1 protein_id gnl|my_center|LOCUS_14340 23045 22395 gene locus_tag LOCUS_14350 23045 22395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393021.1 protein_id gnl|my_center|LOCUS_14350 24698 23802 gene locus_tag LOCUS_14360 24698 23802 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_14360 24964 24695 gene locus_tag LOCUS_14370 24964 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 26309 24912 gene locus_tag LOCUS_14380 gene xseA 26309 24912 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_14380 27206 26346 gene locus_tag LOCUS_14390 gene folD 27206 26346 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_14390 28276 27302 gene locus_tag LOCUS_14400 28276 27302 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_14400 28812 28276 gene locus_tag LOCUS_14410 gene nusB 28812 28276 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393030.1 protein_id gnl|my_center|LOCUS_14410 29096 28872 gene locus_tag LOCUS_14420 29096 28872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 29649 29107 gene locus_tag LOCUS_14430 29649 29107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 30099 29695 gene locus_tag LOCUS_14440 30099 29695 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_14440 31513 30137 gene locus_tag LOCUS_14450 gene accC 31513 30137 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence027 <1 1144 gene locus_tag LOCUS_14460 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399040.1:SH3 domain-containing protein 1832 1380 gene locus_tag LOCUS_14470 1832 1380 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266965.1 protein_id gnl|my_center|LOCUS_14470 4042 1889 gene locus_tag LOCUS_14480 gene relA 4042 1889 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_14480 4710 4192 gene locus_tag LOCUS_14490 4710 4192 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565731.1 protein_id gnl|my_center|LOCUS_14490 7099 4694 gene locus_tag LOCUS_14500 gene recJ 7099 4694 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941257.1 protein_id gnl|my_center|LOCUS_14500 8124 7105 gene locus_tag LOCUS_14510 8124 7105 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_14510 9185 8235 gene locus_tag LOCUS_14520 9185 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 10410 9175 gene locus_tag LOCUS_14530 10410 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14530 10630 11253 gene locus_tag LOCUS_14540 10630 11253 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140612.1 protein_id gnl|my_center|LOCUS_14540 11626 11342 gene locus_tag LOCUS_14550 11626 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 11755 13335 gene locus_tag LOCUS_14560 gene spoVB 11755 13335 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398529.1 protein_id gnl|my_center|LOCUS_14560 14053 13367 gene locus_tag LOCUS_14570 14053 13367 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454832.1 protein_id gnl|my_center|LOCUS_14570 15112 14132 gene locus_tag LOCUS_14580 gene corA 15112 14132 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_14580 15753 16124 gene locus_tag LOCUS_14590 15753 16124 CDS product TIGR04086 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229729.1 protein_id gnl|my_center|LOCUS_14590 16231 17049 gene locus_tag LOCUS_14600 16231 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 17432 17130 gene locus_tag LOCUS_14610 gene yajC 17432 17130 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939107.1 protein_id gnl|my_center|LOCUS_14610 18592 17462 gene locus_tag LOCUS_14620 gene tgt 18592 17462 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_14620 19687 18656 gene locus_tag LOCUS_14630 gene queA 19687 18656 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354017.1 protein_id gnl|my_center|LOCUS_14630 21665 19728 gene locus_tag LOCUS_14640 21665 19728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 21996 21775 gene locus_tag LOCUS_14650 21996 21775 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_14650 22994 21993 gene locus_tag LOCUS_14660 gene ruvB 22994 21993 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_14660 23645 23016 gene locus_tag LOCUS_14670 gene ruvA 23645 23016 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 protein_id gnl|my_center|LOCUS_14670 24142 23642 gene locus_tag LOCUS_14680 gene ruvC 24142 23642 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_14680 24502 24314 gene locus_tag LOCUS_14690 24502 24314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 25197 24613 gene locus_tag LOCUS_14700 25197 24613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 26046 25288 gene locus_tag LOCUS_14710 26046 25288 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_14710 26915 26166 gene locus_tag LOCUS_14720 gene nadE 26915 26166 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_14720 27974 26958 gene locus_tag LOCUS_14730 27974 26958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 28661 28002 gene locus_tag LOCUS_14740 28661 28002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 29646 28747 gene locus_tag LOCUS_14750 gene ilvE 29646 28747 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005489.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence028 187 501 gene locus_tag LOCUS_14760 gene rpsJ 187 501 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_14760 533 1171 gene locus_tag LOCUS_14770 gene rplC 533 1171 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_14770 1203 1829 gene locus_tag LOCUS_14780 gene rplD 1203 1829 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_14780 1826 2116 gene locus_tag LOCUS_14790 gene rplW 1826 2116 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156467.1 protein_id gnl|my_center|LOCUS_14790 2149 2979 gene locus_tag LOCUS_14800 gene rplB 2149 2979 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511583.1 protein_id gnl|my_center|LOCUS_14800 3023 3301 gene locus_tag LOCUS_14810 gene rpsS 3023 3301 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124453.1 protein_id gnl|my_center|LOCUS_14810 3333 3752 gene locus_tag LOCUS_14820 gene rplV 3333 3752 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 protein_id gnl|my_center|LOCUS_14820 3756 4427 gene locus_tag LOCUS_14830 gene rpsC 3756 4427 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720944.1 protein_id gnl|my_center|LOCUS_14830 4430 4858 gene locus_tag LOCUS_14840 gene rplP 4430 4858 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928969.1 protein_id gnl|my_center|LOCUS_14840 4855 5058 gene locus_tag LOCUS_14850 gene rpmC 4855 5058 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_14850 5077 5409 gene locus_tag LOCUS_14860 gene rpsQ 5077 5409 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638069.1 protein_id gnl|my_center|LOCUS_14860 5435 5803 gene locus_tag LOCUS_14870 gene rplN 5435 5803 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_14870 5837 6163 gene locus_tag LOCUS_14880 gene rplX 5837 6163 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_14880 6195 6740 gene locus_tag LOCUS_14890 gene rplE 6195 6740 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_14890 6774 6959 gene locus_tag LOCUS_14900 gene rpsN 6774 6959 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_14900 6990 7388 gene locus_tag LOCUS_14910 gene rpsH 6990 7388 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245511.1 protein_id gnl|my_center|LOCUS_14910 7416 7952 gene locus_tag LOCUS_14920 gene rplF 7416 7952 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_14920 7995 8363 gene locus_tag LOCUS_14930 gene rplR 7995 8363 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_14930 8390 8887 gene locus_tag LOCUS_14940 gene rpsE 8390 8887 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554646.1 protein_id gnl|my_center|LOCUS_14940 8901 9089 gene locus_tag LOCUS_14950 gene rpmD 8901 9089 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_14950 9129 9563 gene locus_tag LOCUS_14960 gene rplO 9129 9563 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_14960 9563 10855 gene locus_tag LOCUS_14970 gene secY 9563 10855 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_14970 10883 11527 gene locus_tag LOCUS_14980 10883 11527 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_14980 11537 12283 gene locus_tag LOCUS_14990 gene map 11537 12283 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 protein_id gnl|my_center|LOCUS_14990 12297 12623 gene locus_tag LOCUS_15000 12297 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 12610 12828 gene locus_tag LOCUS_15010 gene infA 12610 12828 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_15010 13004 13372 gene locus_tag LOCUS_15020 gene rpsM 13004 13372 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_15020 13398 13796 gene locus_tag LOCUS_15030 gene rpsK 13398 13796 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_15030 13939 14883 gene locus_tag LOCUS_15040 gene rpoA 13939 14883 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_15040 14914 15279 gene locus_tag LOCUS_15050 gene rplQ 14914 15279 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_15050 15388 16239 gene locus_tag LOCUS_15060 15388 16239 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393906.1 protein_id gnl|my_center|LOCUS_15060 16215 17084 gene locus_tag LOCUS_15070 16215 17084 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406513.1 protein_id gnl|my_center|LOCUS_15070 17081 17881 gene locus_tag LOCUS_15080 17081 17881 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 protein_id gnl|my_center|LOCUS_15080 17909 18688 gene locus_tag LOCUS_15090 gene truA 17909 18688 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_15090 18781 19218 gene locus_tag LOCUS_15100 gene rplM 18781 19218 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_15100 19236 19631 gene locus_tag LOCUS_15110 gene rpsI 19236 19631 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_15110 19797 20549 gene locus_tag LOCUS_15120 gene cwlD 19797 20549 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_15120 20596 21693 gene locus_tag LOCUS_15130 20596 21693 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256628.1 protein_id gnl|my_center|LOCUS_15130 22458 21802 gene locus_tag LOCUS_15140 gene gerD 22458 21802 CDS product spore germination lipoprotein GerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827295.1 protein_id gnl|my_center|LOCUS_15140 22624 23265 gene locus_tag LOCUS_15150 22624 23265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 24030 23266 gene locus_tag LOCUS_15160 gene pdaB 24030 23266 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464710.1 protein_id gnl|my_center|LOCUS_15160 24111 24746 gene locus_tag LOCUS_15170 24111 24746 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188542542.1 protein_id gnl|my_center|LOCUS_15170 24824 25060 gene locus_tag LOCUS_15180 24824 25060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 25079 26731 gene locus_tag LOCUS_15190 gene dctS 25079 26731 CDS product two-component system sensor histidine kinase DctS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234348.1 protein_id gnl|my_center|LOCUS_15190 26703 27383 gene locus_tag LOCUS_15200 26703 27383 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462100.1 protein_id gnl|my_center|LOCUS_15200 27399 28454 gene locus_tag LOCUS_15210 27399 28454 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813559.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence029 <1 1942 gene locus_tag LOCUS_15220 <1 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861168.1:membrane protein 2001 2636 gene locus_tag LOCUS_15230 2001 2636 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_15230 2757 3260 gene locus_tag LOCUS_15240 2757 3260 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_15240 3298 3492 gene locus_tag LOCUS_15250 3298 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3559 4353 gene locus_tag LOCUS_15260 gene tatC 3559 4353 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_15260 4523 4804 gene locus_tag LOCUS_15270 gene groES 4523 4804 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_15270 4851 6467 gene locus_tag LOCUS_15280 gene groEL 4851 6467 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029999.1 protein_id gnl|my_center|LOCUS_15280 6678 7136 gene locus_tag LOCUS_15290 6678 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15290 7149 7475 gene locus_tag LOCUS_15300 7149 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15300 7721 8713 gene locus_tag LOCUS_15310 7721 8713 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140018.1 protein_id gnl|my_center|LOCUS_15310 8881 9873 gene locus_tag LOCUS_15320 gene pstC 8881 9873 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_15320 9875 10744 gene locus_tag LOCUS_15330 gene pstA 9875 10744 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_15330 10758 11510 gene locus_tag LOCUS_15340 gene pstB 10758 11510 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_15340 11697 11491 gene locus_tag LOCUS_15350 11697 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 11973 12710 gene locus_tag LOCUS_15360 11973 12710 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_15360 12832 13155 gene locus_tag LOCUS_15370 12832 13155 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 protein_id gnl|my_center|LOCUS_15370 13198 14259 gene locus_tag LOCUS_15380 gene arsB 13198 14259 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_15380 14305 14739 gene locus_tag LOCUS_15390 gene arsC 14305 14739 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461622.1 protein_id gnl|my_center|LOCUS_15390 15230 14853 gene locus_tag LOCUS_15400 15230 14853 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154861.1 protein_id gnl|my_center|LOCUS_15400 15767 15312 gene locus_tag LOCUS_15410 15767 15312 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271013.1 protein_id gnl|my_center|LOCUS_15410 16000 17640 gene locus_tag LOCUS_15420 16000 17640 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054402.1 protein_id gnl|my_center|LOCUS_15420 17773 18030 gene locus_tag LOCUS_15430 17773 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 17915 18760 gene locus_tag LOCUS_15440 17915 18760 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_15440 18764 20077 gene locus_tag LOCUS_15450 18764 20077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 20055 22310 gene locus_tag LOCUS_15460 20055 22310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 22432 23970 gene locus_tag LOCUS_15470 gene guaA 22432 23970 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 protein_id gnl|my_center|LOCUS_15470 24170 25579 gene locus_tag LOCUS_15480 24170 25579 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392746.1 protein_id gnl|my_center|LOCUS_15480 25742 27301 gene locus_tag LOCUS_15490 25742 27301 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_15490 28328 27279 gene locus_tag LOCUS_15500 28328 27279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence030 784 377 gene locus_tag LOCUS_15510 784 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1066 788 gene locus_tag LOCUS_15520 1066 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1281 2561 gene locus_tag LOCUS_15530 1281 2561 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713000.1 protein_id gnl|my_center|LOCUS_15530 5040 2959 gene locus_tag LOCUS_15540 gene glyS 5040 2959 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 protein_id gnl|my_center|LOCUS_15540 6021 5044 gene locus_tag LOCUS_15550 gene glyQ 6021 5044 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_15550 6500 7513 gene locus_tag LOCUS_15560 gene adhP 6500 7513 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_15560 7683 8987 gene locus_tag LOCUS_15570 7683 8987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228118.1 protein_id gnl|my_center|LOCUS_15570 9056 10045 gene locus_tag LOCUS_15580 gene trpS 9056 10045 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_15580 11294 10140 gene locus_tag LOCUS_15590 11294 10140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257605.1 protein_id gnl|my_center|LOCUS_15590 12303 11314 gene locus_tag LOCUS_15600 gene hutG 12303 11314 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399848.1 protein_id gnl|my_center|LOCUS_15600 13573 12296 gene locus_tag LOCUS_15610 gene hutI 13573 12296 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244327.1 protein_id gnl|my_center|LOCUS_15610 14776 13601 gene locus_tag LOCUS_15620 14776 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15620 18767 15627 gene locus_tag LOCUS_15630 18767 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 19918 18764 gene locus_tag LOCUS_15640 19918 18764 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_15640 20159 21100 gene locus_tag LOCUS_15650 20159 21100 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_15650 21158 22171 gene locus_tag LOCUS_15660 gene akrN 21158 22171 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_15660 26408 22509 gene locus_tag LOCUS_15670 gene addA 26408 22509 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101882.1 protein_id gnl|my_center|LOCUS_15670 <27749 26362 gene locus_tag LOCUS_15680 <27749 26362 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392018.1:helicase-exonuclease AddAB subunit AddB >Feature sequence031 <1 756 gene locus_tag LOCUS_15690 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817210.1:imidazole glycerol phosphate synthase subunit HisF 749 1405 gene locus_tag LOCUS_15700 gene hisIE 749 1405 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_15700 1455 3167 gene locus_tag LOCUS_15710 1455 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3268 4197 gene locus_tag LOCUS_15720 gene trxB 3268 4197 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243021.1 protein_id gnl|my_center|LOCUS_15720 4435 4902 gene locus_tag LOCUS_15730 4435 4902 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886622.1 protein_id gnl|my_center|LOCUS_15730 4934 5833 gene locus_tag LOCUS_15740 gene rapZ 4934 5833 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_15740 5842 6837 gene locus_tag LOCUS_15750 gene mgfK 5842 6837 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_15750 6858 7805 gene locus_tag LOCUS_15760 gene whiA 6858 7805 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006561.1 protein_id gnl|my_center|LOCUS_15760 7890 8147 gene locus_tag LOCUS_15770 7890 8147 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_15770 8891 8298 gene locus_tag LOCUS_15780 gene clpP 8891 8298 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 protein_id gnl|my_center|LOCUS_15780 8976 9944 gene locus_tag LOCUS_15790 8976 9944 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841777.1 protein_id gnl|my_center|LOCUS_15790 10242 11105 gene locus_tag LOCUS_15800 10242 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15800 11145 11816 gene locus_tag LOCUS_15810 11145 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 12016 11938 gene locus_tag LOCUS_t00320 12016 11938 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12141 13568 gene locus_tag LOCUS_15820 gene rpoN 12141 13568 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391805.1 protein_id gnl|my_center|LOCUS_15820 13727 14746 gene locus_tag LOCUS_15830 gene cggR 13727 14746 CDS product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 protein_id gnl|my_center|LOCUS_15830 14900 15904 gene locus_tag LOCUS_15840 gene gap 14900 15904 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_15840 16003 17187 gene locus_tag LOCUS_15850 16003 17187 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_15850 17195 17983 gene locus_tag LOCUS_15860 gene tpiA 17195 17983 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_15860 17980 19530 gene locus_tag LOCUS_15870 gene gpmI 17980 19530 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_15870 19589 20890 gene locus_tag LOCUS_15880 gene eno 19589 20890 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_15880 20909 21244 gene locus_tag LOCUS_15890 20909 21244 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930603.1 protein_id gnl|my_center|LOCUS_15890 21351 21584 gene locus_tag LOCUS_15900 gene secG 21351 21584 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_15900 21747 22475 gene locus_tag LOCUS_15910 21747 22475 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721422.1 protein_id gnl|my_center|LOCUS_15910 22472 23254 gene locus_tag LOCUS_15920 gene estA 22472 23254 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 protein_id gnl|my_center|LOCUS_15920 23260 25605 gene locus_tag LOCUS_15930 gene rnr 23260 25605 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_15930 25872 26909 gene locus_tag LOCUS_15940 25872 26909 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence032 1818 826 gene locus_tag LOCUS_15950 1818 826 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670942.1 protein_id gnl|my_center|LOCUS_15950 2450 1815 gene locus_tag LOCUS_15960 2450 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3608 2511 gene locus_tag LOCUS_15970 gene recA 3608 2511 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283860.1 protein_id gnl|my_center|LOCUS_15970 5317 3677 gene locus_tag LOCUS_15980 5317 3677 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_15980 6660 5416 gene locus_tag LOCUS_15990 gene cinA 6660 5416 CDS product competence/damage-inducible protein CinA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990712.1 protein_id gnl|my_center|LOCUS_15990 7309 6725 gene locus_tag LOCUS_16000 gene pgsA 7309 6725 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_16000 8628 7300 gene locus_tag LOCUS_16010 gene rimO 8628 7300 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_16010 9662 8754 gene locus_tag LOCUS_16020 9662 8754 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732284.1 protein_id gnl|my_center|LOCUS_16020 10444 9680 gene locus_tag LOCUS_16030 10444 9680 CDS product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 protein_id gnl|my_center|LOCUS_16030 10843 10595 gene locus_tag LOCUS_16040 10843 10595 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114451.1 protein_id gnl|my_center|LOCUS_16040 11672 10920 gene locus_tag LOCUS_16050 gene fabG 11672 10920 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_16050 12985 11669 gene locus_tag LOCUS_16060 12985 11669 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 protein_id gnl|my_center|LOCUS_16060 14310 12982 gene locus_tag LOCUS_16070 14310 12982 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772418.1 protein_id gnl|my_center|LOCUS_16070 14570 14409 gene locus_tag LOCUS_16080 14570 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 15637 14672 gene locus_tag LOCUS_16090 15637 14672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008843.1 protein_id gnl|my_center|LOCUS_16090 16736 15621 gene locus_tag LOCUS_16100 16736 15621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_16100 18265 16733 gene locus_tag LOCUS_16110 18265 16733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_16110 19420 18350 gene locus_tag LOCUS_16120 19420 18350 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725771.1 protein_id gnl|my_center|LOCUS_16120 20264 19536 gene locus_tag LOCUS_16130 20264 19536 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114176.1 protein_id gnl|my_center|LOCUS_16130 22802 20376 gene locus_tag LOCUS_16140 22802 20376 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118781.1 protein_id gnl|my_center|LOCUS_16140 23136 22912 gene locus_tag LOCUS_16150 23136 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 23954 23133 gene locus_tag LOCUS_16160 gene tepA 23954 23133 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139806.1 protein_id gnl|my_center|LOCUS_16160 24244 24032 gene locus_tag LOCUS_16170 24244 24032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 24826 24395 gene locus_tag LOCUS_16180 24826 24395 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966899.1 protein_id gnl|my_center|LOCUS_16180 25098 24901 gene locus_tag LOCUS_16190 25098 24901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence033 185 931 gene locus_tag LOCUS_16200 185 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 959 2626 gene locus_tag LOCUS_16210 959 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2694 4214 gene locus_tag LOCUS_16220 2694 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4211 4993 gene locus_tag LOCUS_16230 4211 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5077 5259 gene locus_tag LOCUS_16240 5077 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 5318 6802 gene locus_tag LOCUS_16250 5318 6802 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 protein_id gnl|my_center|LOCUS_16250 6849 7547 gene locus_tag LOCUS_16260 gene tmk 6849 7547 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356366.1 protein_id gnl|my_center|LOCUS_16260 7510 7836 gene locus_tag LOCUS_16270 7510 7836 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781979.1 protein_id gnl|my_center|LOCUS_16270 7872 8309 gene locus_tag LOCUS_16280 7872 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 8327 9319 gene locus_tag LOCUS_16290 gene holB 8327 9319 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_16290 9312 10121 gene locus_tag LOCUS_16300 9312 10121 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_16300 10154 10507 gene locus_tag LOCUS_16310 gene yabA 10154 10507 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412063.1 protein_id gnl|my_center|LOCUS_16310 10552 11301 gene locus_tag LOCUS_16320 10552 11301 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989364.1 protein_id gnl|my_center|LOCUS_16320 13331 11382 gene locus_tag LOCUS_16330 13331 11382 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_16330 13854 13300 gene locus_tag LOCUS_16340 13854 13300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 14968 13955 gene locus_tag LOCUS_16350 14968 13955 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_16350 15082 15957 gene locus_tag LOCUS_16360 gene rsmI 15082 15957 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243457.1 protein_id gnl|my_center|LOCUS_16360 16388 16134 gene locus_tag LOCUS_16370 16388 16134 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_16370 16579 17523 gene locus_tag LOCUS_16380 16579 17523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 17593 19428 gene locus_tag LOCUS_16390 17593 19428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 19917 21986 gene locus_tag LOCUS_16400 gene metG 19917 21986 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_16400 21983 22774 gene locus_tag LOCUS_16410 21983 22774 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_16410 22948 24030 gene locus_tag LOCUS_16420 22948 24030 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_16420 24111 24704 gene locus_tag LOCUS_16430 gene rnmV 24111 24704 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_16430 24701 25582 gene locus_tag LOCUS_16440 gene rsmA 24701 25582 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_16440 25593 26066 gene locus_tag LOCUS_16450 25593 26066 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773636.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence034 1022 357 gene locus_tag LOCUS_16460 gene cobU 1022 357 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_16460 2107 1019 gene locus_tag LOCUS_16470 gene cobT 2107 1019 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258437.1 protein_id gnl|my_center|LOCUS_16470 2766 2206 gene locus_tag LOCUS_16480 gene cobO 2766 2206 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_16480 3572 2727 gene locus_tag LOCUS_16490 3572 2727 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460056.1 protein_id gnl|my_center|LOCUS_16490 4592 3591 gene locus_tag LOCUS_16500 4592 3591 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_16500 5607 4639 gene locus_tag LOCUS_16510 5607 4639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_16510 6943 6119 gene locus_tag LOCUS_16520 6943 6119 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229044.1 protein_id gnl|my_center|LOCUS_16520 7144 8421 gene locus_tag LOCUS_16530 7144 8421 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_16530 8418 9371 gene locus_tag LOCUS_16540 8418 9371 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_16540 9368 11215 gene locus_tag LOCUS_16550 9368 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 11283 11984 gene locus_tag LOCUS_16560 11283 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 12696 12112 gene locus_tag LOCUS_16570 12696 12112 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393512.1 protein_id gnl|my_center|LOCUS_16570 13970 12858 gene locus_tag LOCUS_16580 gene citA 13970 12858 CDS product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 protein_id gnl|my_center|LOCUS_16580 14254 15807 gene locus_tag LOCUS_16590 gene hutH 14254 15807 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_16590 16726 16061 gene locus_tag LOCUS_16600 16726 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 18169 16739 gene locus_tag LOCUS_16610 18169 16739 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_16610 18714 18175 gene locus_tag LOCUS_16620 18714 18175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 19290 20309 gene locus_tag LOCUS_16630 19290 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 20306 21190 gene locus_tag LOCUS_16640 20306 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 21585 21953 gene locus_tag LOCUS_16650 21585 21953 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817360.1 protein_id gnl|my_center|LOCUS_16650 22022 23539 gene locus_tag LOCUS_16660 22022 23539 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227390.1 protein_id gnl|my_center|LOCUS_16660 24269 23625 gene locus_tag LOCUS_16670 24269 23625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 25222 24263 gene locus_tag LOCUS_16680 gene rfbB 25222 24263 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence035 197 1804 gene locus_tag LOCUS_16690 gene pyrG 197 1804 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170458.1 protein_id gnl|my_center|LOCUS_16690 2010 2378 gene locus_tag LOCUS_16700 gene spo0F 2010 2378 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_16700 2394 2786 gene locus_tag LOCUS_16710 2394 2786 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_16710 2900 3724 gene locus_tag LOCUS_16720 2900 3724 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_16720 3757 4614 gene locus_tag LOCUS_16730 3757 4614 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243339.1 protein_id gnl|my_center|LOCUS_16730 4636 5292 gene locus_tag LOCUS_16740 gene fsa 4636 5292 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667670.1 protein_id gnl|my_center|LOCUS_16740 5528 6532 gene locus_tag LOCUS_16750 gene glpX 5528 6532 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442336.1 protein_id gnl|my_center|LOCUS_16750 6529 7812 gene locus_tag LOCUS_16760 gene rho 6529 7812 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053899.1 protein_id gnl|my_center|LOCUS_16760 8026 8634 gene locus_tag LOCUS_16770 8026 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 8845 9744 gene locus_tag LOCUS_16780 8845 9744 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228133.1 protein_id gnl|my_center|LOCUS_16780 9875 10072 gene locus_tag LOCUS_16790 gene rpmE 9875 10072 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_16790 10159 10785 gene locus_tag LOCUS_16800 10159 10785 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_16800 10850 11407 gene locus_tag LOCUS_16810 10850 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 11535 12602 gene locus_tag LOCUS_16820 gene prfA 11535 12602 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_16820 12678 13481 gene locus_tag LOCUS_16830 gene prmC 12678 13481 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393873.1 protein_id gnl|my_center|LOCUS_16830 13602 14240 gene locus_tag LOCUS_16840 13602 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 14467 15531 gene locus_tag LOCUS_16850 14467 15531 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 protein_id gnl|my_center|LOCUS_16850 15597 16163 gene locus_tag LOCUS_16860 15597 16163 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_16860 16212 16916 gene locus_tag LOCUS_16870 16212 16916 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393870.1 protein_id gnl|my_center|LOCUS_16870 16997 17449 gene locus_tag LOCUS_16880 gene rpiB 16997 17449 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_16880 17454 18113 gene locus_tag LOCUS_16890 17454 18113 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227667.1 protein_id gnl|my_center|LOCUS_16890 18234 19478 gene locus_tag LOCUS_16900 18234 19478 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_16900 19548 20753 gene locus_tag LOCUS_16910 19548 20753 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_16910 20794 21423 gene locus_tag LOCUS_16920 gene upp 20794 21423 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_16920 21490 22653 gene locus_tag LOCUS_16930 gene wecB 21490 22653 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140145.1 protein_id gnl|my_center|LOCUS_16930 22809 25085 gene locus_tag LOCUS_16940 22809 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence036 921 136 gene locus_tag LOCUS_16950 921 136 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258428.1 protein_id gnl|my_center|LOCUS_16950 2688 1177 gene locus_tag LOCUS_16960 2688 1177 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550944.1 protein_id gnl|my_center|LOCUS_16960 2962 2765 gene locus_tag LOCUS_16970 2962 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3275 2943 gene locus_tag LOCUS_16980 3275 2943 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811676.1 protein_id gnl|my_center|LOCUS_16980 3934 3275 gene locus_tag LOCUS_16990 3934 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4764 3931 gene locus_tag LOCUS_17000 4764 3931 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391606.1 protein_id gnl|my_center|LOCUS_17000 5448 5110 gene locus_tag LOCUS_17010 gene ytxJ 5448 5110 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 protein_id gnl|my_center|LOCUS_17010 6033 5683 gene locus_tag LOCUS_17020 6033 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 6276 7220 gene locus_tag LOCUS_17030 gene coxB 6276 7220 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_17030 7276 8922 gene locus_tag LOCUS_17040 gene ctaD 7276 8922 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142160.1 protein_id gnl|my_center|LOCUS_17040 9001 9966 gene locus_tag LOCUS_17050 gene ctaB 9001 9966 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015058.1 protein_id gnl|my_center|LOCUS_17050 10001 10615 gene locus_tag LOCUS_17060 10001 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 10999 11604 gene locus_tag LOCUS_17070 10999 11604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 12986 11700 gene locus_tag LOCUS_17080 12986 11700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_17080 14572 13085 gene locus_tag LOCUS_17090 gene gcvPB 14572 13085 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_17090 15915 14569 gene locus_tag LOCUS_17100 gene gcvPA 15915 14569 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903240.1 protein_id gnl|my_center|LOCUS_17100 17048 15942 gene locus_tag LOCUS_17110 gene gcvT 17048 15942 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_17110 17455 19158 gene locus_tag LOCUS_17120 17455 19158 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100021.1 protein_id gnl|my_center|LOCUS_17120 19163 20065 gene locus_tag LOCUS_17130 19163 20065 CDS product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183959.1 protein_id gnl|my_center|LOCUS_17130 20135 21034 gene locus_tag LOCUS_17140 20135 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 21602 21048 gene locus_tag LOCUS_17150 21602 21048 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057305.1 protein_id gnl|my_center|LOCUS_17150 22306 21656 gene locus_tag LOCUS_17160 22306 21656 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 protein_id gnl|my_center|LOCUS_17160 23031 22303 gene locus_tag LOCUS_17170 gene mtnX 23031 22303 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_17170 24245 23028 gene locus_tag LOCUS_17180 gene mtnW 24245 23028 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_17180 24789 24589 gene locus_tag LOCUS_17190 24789 24589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence037 1743 178 gene locus_tag LOCUS_17200 1743 178 CDS product benzoate-CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_17200 2614 1847 gene locus_tag LOCUS_17210 2614 1847 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_17210 3538 2627 gene locus_tag LOCUS_17220 3538 2627 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_17220 4334 3708 gene locus_tag LOCUS_17230 4334 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4505 4341 gene locus_tag LOCUS_17240 4505 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4897 4568 gene locus_tag LOCUS_17250 4897 4568 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_17250 5828 4899 gene locus_tag LOCUS_17260 gene paaA 5828 4899 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976335.1 protein_id gnl|my_center|LOCUS_17260 6728 5955 gene locus_tag LOCUS_17270 6728 5955 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_17270 8904 7132 gene locus_tag LOCUS_17280 8904 7132 CDS product adenine deaminase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517625.1 protein_id gnl|my_center|LOCUS_17280 9106 9381 gene locus_tag LOCUS_17290 9106 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 9403 9594 gene locus_tag LOCUS_17300 9403 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 11085 9814 gene locus_tag LOCUS_17310 gene purD 11085 9814 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242993.1 protein_id gnl|my_center|LOCUS_17310 12744 11209 gene locus_tag LOCUS_17320 gene purH 12744 11209 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745439.1 protein_id gnl|my_center|LOCUS_17320 13472 12837 gene locus_tag LOCUS_17330 gene purN 13472 12837 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_17330 14512 13469 gene locus_tag LOCUS_17340 gene purM 14512 13469 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_17340 15966 14509 gene locus_tag LOCUS_17350 gene purF 15966 14509 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_17350 18260 15966 gene locus_tag LOCUS_17360 gene purL 18260 15966 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_17360 18945 18205 gene locus_tag LOCUS_17370 gene purQ 18945 18205 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666774.1 protein_id gnl|my_center|LOCUS_17370 19196 18948 gene locus_tag LOCUS_17380 gene purS 19196 18948 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_17380 19981 19178 gene locus_tag LOCUS_17390 gene purC 19981 19178 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170544.1 protein_id gnl|my_center|LOCUS_17390 21364 20051 gene locus_tag LOCUS_17400 gene purB 21364 20051 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_17400 22649 21456 gene locus_tag LOCUS_17410 gene purK 22649 21456 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_17410 23168 22653 gene locus_tag LOCUS_17420 gene purE 23168 22653 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 protein_id gnl|my_center|LOCUS_17420 23509 24027 gene locus_tag LOCUS_17430 23509 24027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 24444 24357 gene locus_tag LOCUS_t00330 24444 24357 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 927 52 gene locus_tag LOCUS_17440 gene pheA 927 52 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 protein_id gnl|my_center|LOCUS_17440 1871 930 gene locus_tag LOCUS_17450 gene thrB 1871 930 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_17450 2991 1927 gene locus_tag LOCUS_17460 gene thrC 2991 1927 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228697.1 protein_id gnl|my_center|LOCUS_17460 4288 2993 gene locus_tag LOCUS_17470 4288 2993 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 protein_id gnl|my_center|LOCUS_17470 4779 4336 gene locus_tag LOCUS_17480 gene thrR 4779 4336 CDS product transcriptional regulator ThrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222630.1 protein_id gnl|my_center|LOCUS_17480 6303 5005 gene locus_tag LOCUS_17490 gene obgE 6303 5005 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_17490 7042 6329 gene locus_tag LOCUS_17500 7042 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 7477 7187 gene locus_tag LOCUS_17510 gene rpmA 7477 7187 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944957.1 protein_id gnl|my_center|LOCUS_17510 7827 7483 gene locus_tag LOCUS_17520 7827 7483 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973720.1 protein_id gnl|my_center|LOCUS_17520 8135 7824 gene locus_tag LOCUS_17530 gene rplU 8135 7824 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_17530 8180 8377 gene locus_tag LOCUS_17540 8180 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 9151 8297 gene locus_tag LOCUS_17550 gene spoIVFB 9151 8297 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599058.1 protein_id gnl|my_center|LOCUS_17550 9923 9144 gene locus_tag LOCUS_17560 9923 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 11137 10001 gene locus_tag LOCUS_17570 gene rodA 11137 10001 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_17570 12088 11288 gene locus_tag LOCUS_17580 gene minD 12088 11288 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503310.1 protein_id gnl|my_center|LOCUS_17580 12796 12104 gene locus_tag LOCUS_17590 gene minC 12796 12104 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391517.1 protein_id gnl|my_center|LOCUS_17590 14896 12815 gene locus_tag LOCUS_17600 gene pbpA 14896 12815 CDS product penicillin-binding protein 2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398702.1 protein_id gnl|my_center|LOCUS_17600 15398 14877 gene locus_tag LOCUS_17610 15398 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 16300 15395 gene locus_tag LOCUS_17620 gene mreC 16300 15395 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_17620 17344 16313 gene locus_tag LOCUS_17630 gene mreB 17344 16313 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466737.1 protein_id gnl|my_center|LOCUS_17630 18206 17520 gene locus_tag LOCUS_17640 gene radC 18206 17520 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246034.1 protein_id gnl|my_center|LOCUS_17640 18844 18257 gene locus_tag LOCUS_17650 18844 18257 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_17650 19474 18926 gene locus_tag LOCUS_17660 19474 18926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 19604 20131 gene locus_tag LOCUS_17670 19604 20131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 21050 20163 gene locus_tag LOCUS_17680 21050 20163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 21648 21034 gene locus_tag LOCUS_17690 21648 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 22707 21664 gene locus_tag LOCUS_17700 22707 21664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 23218 22808 gene locus_tag LOCUS_17710 23218 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 <24402 23384 gene locus_tag LOCUS_17720 <24402 23384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467257.1:pyruvate oxidase >Feature sequence039 1606 71 gene locus_tag LOCUS_17730 1606 71 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392536.1 protein_id gnl|my_center|LOCUS_17730 2276 1635 gene locus_tag LOCUS_17740 2276 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17740 2920 2519 gene locus_tag LOCUS_17750 2920 2519 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525681.1 protein_id gnl|my_center|LOCUS_17750 3231 2917 gene locus_tag LOCUS_17760 3231 2917 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082188.1 protein_id gnl|my_center|LOCUS_17760 4580 3228 gene locus_tag LOCUS_17770 4580 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5551 4757 gene locus_tag LOCUS_17780 gene rnhB 5551 4757 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245658.1 protein_id gnl|my_center|LOCUS_17780 6474 5599 gene locus_tag LOCUS_17790 gene ylqF 6474 5599 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_17790 7135 6485 gene locus_tag LOCUS_17800 gene lepB 7135 6485 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711857.1 protein_id gnl|my_center|LOCUS_17800 7496 7155 gene locus_tag LOCUS_17810 gene rplS 7496 7155 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_17810 8388 7651 gene locus_tag LOCUS_17820 gene trmD 8388 7651 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_17820 8927 8403 gene locus_tag LOCUS_17830 gene rimM 8927 8403 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 protein_id gnl|my_center|LOCUS_17830 9339 8908 gene locus_tag LOCUS_17840 9339 8908 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008948139.1 protein_id gnl|my_center|LOCUS_17840 9644 9417 gene locus_tag LOCUS_17850 9644 9417 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_17850 9950 9672 gene locus_tag LOCUS_17860 gene rpsP 9950 9672 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419338.1 protein_id gnl|my_center|LOCUS_17860 11341 9992 gene locus_tag LOCUS_17870 gene ffh 11341 9992 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_17870 11685 11353 gene locus_tag LOCUS_17880 11685 11353 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723862.1 protein_id gnl|my_center|LOCUS_17880 12802 11792 gene locus_tag LOCUS_17890 gene ftsY 12802 11792 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_17890 16425 12856 gene locus_tag LOCUS_17900 gene smc 16425 12856 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_17900 17203 16514 gene locus_tag LOCUS_17910 gene rncS 17203 16514 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 protein_id gnl|my_center|LOCUS_17910 18477 17233 gene locus_tag LOCUS_17920 gene fabF 18477 17233 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_17920 18840 18601 gene locus_tag LOCUS_17930 gene acpP 18840 18601 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_17930 19632 18895 gene locus_tag LOCUS_17940 gene fabG 19632 18895 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_17940 20629 19694 gene locus_tag LOCUS_17950 gene fabD 20629 19694 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_17950 21640 20633 gene locus_tag LOCUS_17960 21640 20633 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_17960 22664 21654 gene locus_tag LOCUS_17970 gene plsX 22664 21654 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_17970 23232 22618 gene locus_tag LOCUS_17980 gene fapR 23232 22618 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232044.1 protein_id gnl|my_center|LOCUS_17980 23552 23379 gene locus_tag LOCUS_17990 gene rpmF 23552 23379 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_17990 24144 23584 gene locus_tag LOCUS_18000 24144 23584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence040 83 742 gene locus_tag LOCUS_18010 83 742 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068762.1 protein_id gnl|my_center|LOCUS_18010 1000 773 gene locus_tag LOCUS_18020 1000 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2725 1085 gene locus_tag LOCUS_18030 2725 1085 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119621.1 protein_id gnl|my_center|LOCUS_18030 3974 3027 gene locus_tag LOCUS_18040 3974 3027 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272199.1 protein_id gnl|my_center|LOCUS_18040 4215 6326 gene locus_tag LOCUS_18050 gene cstA 4215 6326 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047792095.1 protein_id gnl|my_center|LOCUS_18050 6367 6570 gene locus_tag LOCUS_18060 6367 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 8256 6757 gene locus_tag LOCUS_18070 gene putP 8256 6757 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_18070 9159 8443 gene locus_tag LOCUS_18080 9159 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 11111 9564 gene locus_tag LOCUS_18090 gene pruA 11111 9564 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_18090 12347 11244 gene locus_tag LOCUS_18100 12347 11244 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242795.1 protein_id gnl|my_center|LOCUS_18100 14412 12397 gene locus_tag LOCUS_18110 gene ligA 14412 12397 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_18110 16662 14431 gene locus_tag LOCUS_18120 gene pcrA 16662 14431 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_18120 17473 16766 gene locus_tag LOCUS_18130 17473 16766 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272099.1 protein_id gnl|my_center|LOCUS_18130 18817 17603 gene locus_tag LOCUS_18140 18817 17603 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521091.1 protein_id gnl|my_center|LOCUS_18140 19236 18967 gene locus_tag LOCUS_18150 19236 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 20013 19348 gene locus_tag LOCUS_18160 20013 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 20506 20144 gene locus_tag LOCUS_18170 20506 20144 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_18170 21618 20587 gene locus_tag LOCUS_18180 21618 20587 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_18180 22644 21826 gene locus_tag LOCUS_18190 gene paaX 22644 21826 CDS product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029883661.1 protein_id gnl|my_center|LOCUS_18190 23846 22854 gene locus_tag LOCUS_18200 23846 22854 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence041 518 153 gene locus_tag LOCUS_18210 518 153 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218967.1 protein_id gnl|my_center|LOCUS_18210 820 641 gene locus_tag LOCUS_18220 820 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1748 951 gene locus_tag LOCUS_18230 1748 951 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_18230 2509 1778 gene locus_tag LOCUS_18240 2509 1778 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_18240 3183 2524 gene locus_tag LOCUS_18250 gene thiE 3183 2524 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_18250 3357 3524 gene locus_tag LOCUS_18260 3357 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 5209 3782 gene locus_tag LOCUS_18270 5209 3782 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272659.1 protein_id gnl|my_center|LOCUS_18270 5903 5190 gene locus_tag LOCUS_18280 5903 5190 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461794.1 protein_id gnl|my_center|LOCUS_18280 6140 6487 gene locus_tag LOCUS_18290 6140 6487 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229265.1 protein_id gnl|my_center|LOCUS_18290 6890 6540 gene locus_tag LOCUS_18300 6890 6540 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_18300 7052 8077 gene locus_tag LOCUS_18310 7052 8077 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003293891.1 protein_id gnl|my_center|LOCUS_18310 8786 8082 gene locus_tag LOCUS_18320 8786 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 10251 8851 gene locus_tag LOCUS_18330 10251 8851 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052704.1 protein_id gnl|my_center|LOCUS_18330 11490 10306 gene locus_tag LOCUS_18340 11490 10306 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064976.1 protein_id gnl|my_center|LOCUS_18340 12096 11617 gene locus_tag LOCUS_18350 12096 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 12993 12223 gene locus_tag LOCUS_18360 gene fetB 12993 12223 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232776.1 protein_id gnl|my_center|LOCUS_18360 13598 12978 gene locus_tag LOCUS_18370 13598 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 13875 13666 gene locus_tag LOCUS_18380 13875 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 16000 13898 gene locus_tag LOCUS_18390 16000 13898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_18390 17883 15997 gene locus_tag LOCUS_18400 17883 15997 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_18400 18944 18108 gene locus_tag LOCUS_18410 18944 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 20152 19601 gene locus_tag LOCUS_18420 20152 19601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 20132 20887 gene locus_tag LOCUS_18430 20132 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 <22215 20876 gene locus_tag LOCUS_18440 <22215 20876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181746991.1:IS1182 family transposase >Feature sequence042 119 778 gene locus_tag LOCUS_18450 119 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 864 1256 gene locus_tag LOCUS_18460 864 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1356 1802 gene locus_tag LOCUS_18470 1356 1802 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724095.1 protein_id gnl|my_center|LOCUS_18470 1883 2161 gene locus_tag LOCUS_18480 1883 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2465 2250 gene locus_tag LOCUS_18490 2465 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2945 2547 gene locus_tag LOCUS_18500 2945 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616017.1 protein_id gnl|my_center|LOCUS_18500 3106 3033 gene locus_tag LOCUS_t00340 3106 3033 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3259 4365 gene locus_tag LOCUS_18510 3259 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4343 5386 gene locus_tag LOCUS_18520 4343 5386 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880450.1 protein_id gnl|my_center|LOCUS_18520 5408 5746 gene locus_tag LOCUS_18530 gene comGC 5408 5746 CDS product comG operon protein ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230162.1 protein_id gnl|my_center|LOCUS_18530 5760 6206 gene locus_tag LOCUS_18540 5760 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6217 6570 gene locus_tag LOCUS_18550 6217 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 6570 7004 gene locus_tag LOCUS_18560 6570 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 6979 7404 gene locus_tag LOCUS_18570 6979 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 7413 7952 gene locus_tag LOCUS_18580 7413 7952 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258976.1 protein_id gnl|my_center|LOCUS_18580 7974 8138 gene locus_tag LOCUS_18590 7974 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 8173 8439 gene locus_tag LOCUS_18600 8173 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 8607 9164 gene locus_tag LOCUS_18610 8607 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 9875 9165 gene locus_tag LOCUS_18620 gene ccdA 9875 9165 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 protein_id gnl|my_center|LOCUS_18620 9960 10415 gene locus_tag LOCUS_18630 9960 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 10575 10892 gene locus_tag LOCUS_18640 10575 10892 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173319.1 protein_id gnl|my_center|LOCUS_18640 11771 11031 gene locus_tag LOCUS_18650 11771 11031 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245358.1 protein_id gnl|my_center|LOCUS_18650 12509 11787 gene locus_tag LOCUS_18660 gene lipB 12509 11787 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_18660 12717 13793 gene locus_tag LOCUS_18670 gene pdhA 12717 13793 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 protein_id gnl|my_center|LOCUS_18670 13797 14777 gene locus_tag LOCUS_18680 gene pdhB 13797 14777 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068168.1 protein_id gnl|my_center|LOCUS_18680 14817 16175 gene locus_tag LOCUS_18690 gene pdhC 14817 16175 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_18690 16178 17590 gene locus_tag LOCUS_18700 gene lpdA 16178 17590 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_18700 17848 18248 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgttgcattcgtgtgactcgcttcaagaggattgaaag 18349 18594 gene locus_tag LOCUS_18710 18349 18594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 18682 19959 gene locus_tag LOCUS_18720 18682 19959 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537666.1 protein_id gnl|my_center|LOCUS_18720 <21229 19846 gene locus_tag LOCUS_18730 <21229 19846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181746991.1:IS1182 family transposase >Feature sequence043 266 751 gene locus_tag LOCUS_18740 266 751 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_18740 853 1719 gene locus_tag LOCUS_18750 853 1719 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641460.1 protein_id gnl|my_center|LOCUS_18750 1862 2254 gene locus_tag LOCUS_18760 1862 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3131 2397 gene locus_tag LOCUS_18770 3131 2397 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477810.1 protein_id gnl|my_center|LOCUS_18770 4487 3498 gene locus_tag LOCUS_18780 4487 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 5152 4505 gene locus_tag LOCUS_18790 5152 4505 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632821.1 protein_id gnl|my_center|LOCUS_18790 5979 5149 gene locus_tag LOCUS_18800 5979 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 6712 6287 gene locus_tag LOCUS_18810 gene zur 6712 6287 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398578.1 protein_id gnl|my_center|LOCUS_18810 7562 6729 gene locus_tag LOCUS_18820 gene zurM 7562 6729 CDS product zinc ABC transporter permease ZurM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933330.1 protein_id gnl|my_center|LOCUS_18820 8487 7645 gene locus_tag LOCUS_18830 8487 7645 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613815.1 protein_id gnl|my_center|LOCUS_18830 9266 8502 gene locus_tag LOCUS_18840 9266 8502 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_18840 10201 9284 gene locus_tag LOCUS_18850 10201 9284 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126148.1 protein_id gnl|my_center|LOCUS_18850 11383 10619 gene locus_tag LOCUS_18860 gene recO 11383 10619 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487010.1 protein_id gnl|my_center|LOCUS_18860 11550 11422 gene locus_tag LOCUS_18870 11550 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 12543 11635 gene locus_tag LOCUS_18880 gene era 12543 11635 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_18880 12934 12521 gene locus_tag LOCUS_18890 12934 12521 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_18890 13664 12942 gene locus_tag LOCUS_18900 13664 12942 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392134.1 protein_id gnl|my_center|LOCUS_18900 14336 13695 gene locus_tag LOCUS_18910 14336 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 14828 14352 gene locus_tag LOCUS_18920 gene ybeY 14828 14352 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054684.1 protein_id gnl|my_center|LOCUS_18920 16747 14861 gene locus_tag LOCUS_18930 gene pgpH 16747 14861 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_18930 16997 16707 gene locus_tag LOCUS_18940 16997 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 17986 17009 gene locus_tag LOCUS_18950 17986 17009 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_18950 19183 17993 gene locus_tag LOCUS_18960 gene yqfD 19183 17993 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792478.1 protein_id gnl|my_center|LOCUS_18960 19478 19200 gene locus_tag LOCUS_18970 gene yqfC 19478 19200 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_18970 20029 19583 gene locus_tag LOCUS_18980 20029 19583 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640683.1 protein_id gnl|my_center|LOCUS_18980 20222 20046 gene locus_tag LOCUS_18990 20222 20046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence044 479 1681 gene locus_tag LOCUS_19000 479 1681 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241220.1 protein_id gnl|my_center|LOCUS_19000 1757 2230 gene locus_tag LOCUS_19010 1757 2230 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415315.1 protein_id gnl|my_center|LOCUS_19010 2379 2570 gene locus_tag LOCUS_19020 2379 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2907 3659 gene locus_tag LOCUS_19030 2907 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19030 4451 3714 gene locus_tag LOCUS_19040 4451 3714 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869292.1 protein_id gnl|my_center|LOCUS_19040 4484 4657 gene locus_tag LOCUS_19050 4484 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4684 4953 gene locus_tag LOCUS_19060 4684 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 5106 5771 gene locus_tag LOCUS_19070 5106 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 6645 5827 gene locus_tag LOCUS_19080 6645 5827 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888014.1 protein_id gnl|my_center|LOCUS_19080 8403 7042 gene locus_tag LOCUS_19090 gene mgtE 8403 7042 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232543.1 protein_id gnl|my_center|LOCUS_19090 8905 8447 gene locus_tag LOCUS_19100 8905 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 9116 10075 gene locus_tag LOCUS_19110 9116 10075 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754999.1 protein_id gnl|my_center|LOCUS_19110 10133 11566 gene locus_tag LOCUS_19120 10133 11566 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_19120 11637 12362 gene locus_tag LOCUS_19130 11637 12362 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143928.1 protein_id gnl|my_center|LOCUS_19130 12459 13076 gene locus_tag LOCUS_19140 gene sodA 12459 13076 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052031.1 protein_id gnl|my_center|LOCUS_19140 13216 15009 gene locus_tag LOCUS_19150 13216 15009 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921779.1 protein_id gnl|my_center|LOCUS_19150 17147 15408 gene locus_tag LOCUS_19160 gene ilvD 17147 15408 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_19160 17392 18465 gene locus_tag LOCUS_19170 17392 18465 CDS product tetraprenyl-beta-curcumene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657152.1 protein_id gnl|my_center|LOCUS_19170 18570 19145 gene locus_tag LOCUS_19180 18570 19145 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963361.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence045 465 2279 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctcttgcaacgagtcagtcttctgcaac 3181 2528 gene locus_tag LOCUS_19190 3181 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3445 3194 gene locus_tag LOCUS_19200 gene cas2 3445 3194 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846123.1 protein_id gnl|my_center|LOCUS_19200 4461 3448 gene locus_tag LOCUS_19210 gene cas1 4461 3448 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258803.1 protein_id gnl|my_center|LOCUS_19210 5238 4531 gene locus_tag LOCUS_19220 5238 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255976.1 protein_id gnl|my_center|LOCUS_19220 6190 5243 gene locus_tag LOCUS_19230 6190 5243 CDS product DevR family CRISPR-associated autoregulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255977.1 protein_id gnl|my_center|LOCUS_19230 7989 6229 gene locus_tag LOCUS_19240 7989 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157913107.1 protein_id gnl|my_center|LOCUS_19240 10385 7986 gene locus_tag LOCUS_19250 10385 7986 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255980.1 protein_id gnl|my_center|LOCUS_19250 11443 10349 gene locus_tag LOCUS_19260 gene cas6 11443 10349 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_19260 12149 13555 gene locus_tag LOCUS_19270 12149 13555 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 protein_id gnl|my_center|LOCUS_19270 15487 13691 gene locus_tag LOCUS_19280 gene fadE 15487 13691 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244094.1 protein_id gnl|my_center|LOCUS_19280 16749 15568 gene locus_tag LOCUS_19290 16749 15568 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_19290 19217 16830 gene locus_tag LOCUS_19300 19217 16830 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486386.1 protein_id gnl|my_center|LOCUS_19300 19135 19401 gene locus_tag LOCUS_19310 19135 19401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence046 279 965 gene locus_tag LOCUS_19320 279 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 935 1669 gene locus_tag LOCUS_19330 935 1669 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 protein_id gnl|my_center|LOCUS_19330 1815 2297 gene locus_tag LOCUS_19340 gene ctsR 1815 2297 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_19340 2294 2806 gene locus_tag LOCUS_19350 2294 2806 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_19350 2831 3904 gene locus_tag LOCUS_19360 2831 3904 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_19360 3921 6368 gene locus_tag LOCUS_19370 gene clpC 3921 6368 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_19370 6583 7848 gene locus_tag LOCUS_19380 gene radA 6583 7848 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_19380 7852 8928 gene locus_tag LOCUS_19390 gene disA 7852 8928 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392168.1 protein_id gnl|my_center|LOCUS_19390 9034 9753 gene locus_tag LOCUS_19400 gene pssA 9034 9753 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285422.1 protein_id gnl|my_center|LOCUS_19400 9968 10462 gene locus_tag LOCUS_19410 9968 10462 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_19410 10528 11616 gene locus_tag LOCUS_19420 10528 11616 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919684.1 protein_id gnl|my_center|LOCUS_19420 11641 12351 gene locus_tag LOCUS_19430 gene ispD 11641 12351 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_19430 12329 12808 gene locus_tag LOCUS_19440 gene ispF 12329 12808 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_19440 12839 14332 gene locus_tag LOCUS_19450 gene gltX 12839 14332 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399675.1 protein_id gnl|my_center|LOCUS_19450 14754 15464 gene locus_tag LOCUS_19460 gene cysE 14754 15464 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_19460 15418 16866 gene locus_tag LOCUS_19470 gene cysS 15418 16866 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399682.1 protein_id gnl|my_center|LOCUS_19470 16879 17322 gene locus_tag LOCUS_19480 16879 17322 CDS product mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399685.1 protein_id gnl|my_center|LOCUS_19480 17319 18059 gene locus_tag LOCUS_19490 gene rlmB 17319 18059 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200237.1 protein_id gnl|my_center|LOCUS_19490 18071 18610 gene locus_tag LOCUS_19500 gene rae1 18071 18610 CDS product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 protein_id gnl|my_center|LOCUS_19500 18679 19332 gene locus_tag LOCUS_19510 gene sigH 18679 19332 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence047 216 509 gene locus_tag LOCUS_19520 gene gatC 216 509 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_19520 576 2030 gene locus_tag LOCUS_19530 gene gatA 576 2030 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051433.1 protein_id gnl|my_center|LOCUS_19530 2047 3483 gene locus_tag LOCUS_19540 gene gatB 2047 3483 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_19540 3480 4268 gene locus_tag LOCUS_19550 gene nfsA 3480 4268 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004543.1 protein_id gnl|my_center|LOCUS_19550 4265 5059 gene locus_tag LOCUS_19560 4265 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 5067 5945 gene locus_tag LOCUS_19570 5067 5945 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_19570 5942 7324 gene locus_tag LOCUS_19580 gene rlmD 5942 7324 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_19580 8019 8297 gene locus_tag LOCUS_19590 8019 8297 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_19590 8294 8929 gene locus_tag LOCUS_19600 8294 8929 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716356.1 protein_id gnl|my_center|LOCUS_19600 8984 9787 gene locus_tag LOCUS_19610 8984 9787 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182367.1 protein_id gnl|my_center|LOCUS_19610 11361 9835 gene locus_tag LOCUS_19620 gene opuD 11361 9835 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229220.1 protein_id gnl|my_center|LOCUS_19620 11631 12146 gene locus_tag LOCUS_19630 11631 12146 CDS product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 protein_id gnl|my_center|LOCUS_19630 12215 12850 gene locus_tag LOCUS_19640 gene pcp 12215 12850 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401632.1 protein_id gnl|my_center|LOCUS_19640 12985 14157 gene locus_tag LOCUS_19650 12985 14157 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_19650 14600 15541 gene locus_tag LOCUS_19660 14600 15541 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448370.1 protein_id gnl|my_center|LOCUS_19660 15621 16343 gene locus_tag LOCUS_19670 15621 16343 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_19670 16402 17622 gene locus_tag LOCUS_19680 gene mtnK 16402 17622 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 protein_id gnl|my_center|LOCUS_19680 17622 18692 gene locus_tag LOCUS_19690 gene mtnA 17622 18692 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_19690 18860 18708 gene locus_tag LOCUS_19700 18860 18708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 19049 19207 gene locus_tag LOCUS_19710 19049 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence048 430 32 gene locus_tag LOCUS_19720 gene rsfS 430 32 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_19720 1029 427 gene locus_tag LOCUS_19730 gene yqeK 1029 427 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_19730 1591 1010 gene locus_tag LOCUS_19740 gene nadD 1591 1010 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404800.1 protein_id gnl|my_center|LOCUS_19740 1889 1596 gene locus_tag LOCUS_19750 gene yhbY 1889 1596 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 protein_id gnl|my_center|LOCUS_19750 2818 1883 gene locus_tag LOCUS_19760 2818 1883 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_19760 3821 2838 gene locus_tag LOCUS_19770 gene mltG 3821 2838 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_19770 4948 3836 gene locus_tag LOCUS_19780 gene yqeH 4948 3836 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140795.1 protein_id gnl|my_center|LOCUS_19780 5469 4945 gene locus_tag LOCUS_19790 5469 4945 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765311.1 protein_id gnl|my_center|LOCUS_19790 6302 5571 gene locus_tag LOCUS_19800 gene sigK 6302 5571 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_19800 6508 6903 gene locus_tag LOCUS_19810 6508 6903 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285639.1 protein_id gnl|my_center|LOCUS_19810 6971 7657 gene locus_tag LOCUS_19820 6971 7657 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_19820 7729 9096 gene locus_tag LOCUS_19830 7729 9096 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_19830 9315 9106 gene locus_tag LOCUS_19840 9315 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 11176 9377 gene locus_tag LOCUS_19850 11176 9377 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 protein_id gnl|my_center|LOCUS_19850 11680 11366 gene locus_tag LOCUS_19860 11680 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 12027 11677 gene locus_tag LOCUS_19870 12027 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 12445 12005 gene locus_tag LOCUS_19880 gene ruvX 12445 12005 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_19880 12836 12570 gene locus_tag LOCUS_19890 12836 12570 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_19890 15635 12996 gene locus_tag LOCUS_19900 gene alaS 15635 12996 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 protein_id gnl|my_center|LOCUS_19900 18311 16851 gene locus_tag LOCUS_19910 18311 16851 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243062.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence049 804 980 gene locus_tag LOCUS_19920 804 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 1108 2625 gene locus_tag LOCUS_19930 1108 2625 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924633.1 protein_id gnl|my_center|LOCUS_19930 2923 3933 gene locus_tag LOCUS_19940 2923 3933 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_19940 4001 4252 gene locus_tag LOCUS_19950 4001 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 4674 5951 gene locus_tag LOCUS_19960 gene hisS 4674 5951 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_19960 5985 7769 gene locus_tag LOCUS_19970 gene aspS 5985 7769 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_19970 7940 8173 gene locus_tag LOCUS_19980 7940 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 8306 9637 gene locus_tag LOCUS_19990 8306 9637 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_19990 9735 10151 gene locus_tag LOCUS_20000 gene cymR 9735 10151 CDS product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 protein_id gnl|my_center|LOCUS_20000 10166 11314 gene locus_tag LOCUS_20010 10166 11314 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439913.1 protein_id gnl|my_center|LOCUS_20010 11453 12028 gene locus_tag LOCUS_20020 11453 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 12202 13338 gene locus_tag LOCUS_20030 gene mnmA 12202 13338 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_20030 13488 15818 gene locus_tag LOCUS_20040 13488 15818 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528083.1 protein_id gnl|my_center|LOCUS_20040 15989 16180 gene locus_tag LOCUS_20050 15989 16180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469281.1 protein_id gnl|my_center|LOCUS_20050 16199 16441 gene locus_tag LOCUS_20060 16199 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 16530 17597 gene locus_tag LOCUS_20070 16530 17597 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967889.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence050 118 193 gene locus_tag LOCUS_t00350 118 193 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 385 1149 gene locus_tag LOCUS_20080 gene fabL 385 1149 CDS product enoyl-[acyl-carrier-protein] reductase FabL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223262.1 protein_id gnl|my_center|LOCUS_20080 1244 1675 gene locus_tag LOCUS_20090 1244 1675 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208525.1 protein_id gnl|my_center|LOCUS_20090 1681 2238 gene locus_tag LOCUS_20100 1681 2238 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506628.1 protein_id gnl|my_center|LOCUS_20100 3321 2224 gene locus_tag LOCUS_20110 3321 2224 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765787.1 protein_id gnl|my_center|LOCUS_20110 3506 4270 gene locus_tag LOCUS_20120 3506 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 8907 4357 gene locus_tag LOCUS_20130 8907 4357 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932762.1 protein_id gnl|my_center|LOCUS_20130 10636 9350 gene locus_tag LOCUS_20140 10636 9350 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233535.1 protein_id gnl|my_center|LOCUS_20140 10800 11249 gene locus_tag LOCUS_20150 10800 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 11271 12278 gene locus_tag LOCUS_20160 11271 12278 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843667.1 protein_id gnl|my_center|LOCUS_20160 12271 13140 gene locus_tag LOCUS_20170 12271 13140 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521524.1 protein_id gnl|my_center|LOCUS_20170 13137 13934 gene locus_tag LOCUS_20180 13137 13934 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965773.1 protein_id gnl|my_center|LOCUS_20180 14087 14224 gene locus_tag LOCUS_20190 14087 14224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20190 14237 14560 gene locus_tag LOCUS_20200 14237 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20200 14622 15200 gene locus_tag LOCUS_20210 14622 15200 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_20210 15641 15336 gene locus_tag LOCUS_20220 15641 15336 CDS product YfhH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244592.1 protein_id gnl|my_center|LOCUS_20220 15763 16455 gene locus_tag LOCUS_20230 gene nth 15763 16455 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387915.1 protein_id gnl|my_center|LOCUS_20230 16553 16987 gene locus_tag LOCUS_20240 gene perR 16553 16987 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223285.1 protein_id gnl|my_center|LOCUS_20240 17346 17029 gene locus_tag LOCUS_20250 17346 17029 CDS product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025063.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence051 37 589 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctcttgcaacgagtcaactctctgcaac 2023 833 gene locus_tag LOCUS_20260 gene tuf 2023 833 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_20260 4217 2142 gene locus_tag LOCUS_20270 gene fusA 4217 2142 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 protein_id gnl|my_center|LOCUS_20270 4727 4257 gene locus_tag LOCUS_20280 gene rpsG 4727 4257 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_20280 5199 4777 gene locus_tag LOCUS_20290 gene rpsL 5199 4777 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_20290 5582 5325 gene locus_tag LOCUS_20300 5582 5325 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225778.1 protein_id gnl|my_center|LOCUS_20300 9352 5714 gene locus_tag LOCUS_20310 gene rpoC 9352 5714 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_20310 12910 9365 gene locus_tag LOCUS_20320 gene rpoB 12910 9365 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147553.1 protein_id gnl|my_center|LOCUS_20320 13764 13162 gene locus_tag LOCUS_20330 13764 13162 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763267.1 protein_id gnl|my_center|LOCUS_20330 14310 13939 gene locus_tag LOCUS_20340 gene rplL 14310 13939 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_20340 14889 14374 gene locus_tag LOCUS_20350 gene rplJ 14889 14374 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048982.1 protein_id gnl|my_center|LOCUS_20350 15806 15117 gene locus_tag LOCUS_20360 gene rplA 15806 15117 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987630.1 protein_id gnl|my_center|LOCUS_20360 16315 15890 gene locus_tag LOCUS_20370 gene rplK 16315 15890 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 protein_id gnl|my_center|LOCUS_20370 17012 16479 gene locus_tag LOCUS_20380 gene nusG 17012 16479 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_20380 17262 17047 gene locus_tag LOCUS_20390 17262 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 17427 17278 gene locus_tag LOCUS_20400 gene rpmG 17427 17278 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583730.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence052 330 596 gene locus_tag LOCUS_20410 330 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20410 566 1822 gene locus_tag LOCUS_20420 566 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20420 1908 2726 gene locus_tag LOCUS_20430 1908 2726 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_20430 2845 3033 gene locus_tag LOCUS_20440 2845 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 3215 4204 gene locus_tag LOCUS_20450 gene ispH 3215 4204 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_20450 4621 6708 gene locus_tag LOCUS_20460 4621 6708 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086758.1 protein_id gnl|my_center|LOCUS_20460 6796 7983 gene locus_tag LOCUS_20470 6796 7983 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230291.1 protein_id gnl|my_center|LOCUS_20470 8060 8941 gene locus_tag LOCUS_20480 8060 8941 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816050.1 protein_id gnl|my_center|LOCUS_20480 8969 10111 gene locus_tag LOCUS_20490 8969 10111 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074554312.1 protein_id gnl|my_center|LOCUS_20490 10202 11350 gene locus_tag LOCUS_20500 gene acdA 10202 11350 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545532.1 protein_id gnl|my_center|LOCUS_20500 11458 12444 gene locus_tag LOCUS_20510 gene meaB 11458 12444 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_20510 12449 13105 gene locus_tag LOCUS_20520 12449 13105 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238599.1 protein_id gnl|my_center|LOCUS_20520 13112 16447 gene locus_tag LOCUS_20530 13112 16447 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224369.1 protein_id gnl|my_center|LOCUS_20530 16600 17244 gene locus_tag LOCUS_20540 gene sleB 16600 17244 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence053 393 890 gene locus_tag LOCUS_20550 393 890 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393559.1 protein_id gnl|my_center|LOCUS_20550 898 2139 gene locus_tag LOCUS_20560 gene khtU 898 2139 CDS product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 protein_id gnl|my_center|LOCUS_20560 2398 3408 gene locus_tag LOCUS_20570 2398 3408 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_20570 4937 3495 gene locus_tag LOCUS_20580 gene pepA 4937 3495 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487984.1 protein_id gnl|my_center|LOCUS_20580 5428 5045 gene locus_tag LOCUS_20590 5428 5045 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056975.1 protein_id gnl|my_center|LOCUS_20590 6148 5453 gene locus_tag LOCUS_20600 6148 5453 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_20600 7364 6123 gene locus_tag LOCUS_20610 7364 6123 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062798.1 protein_id gnl|my_center|LOCUS_20610 8609 7407 gene locus_tag LOCUS_20620 8609 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 10007 9432 gene locus_tag LOCUS_20630 10007 9432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 11405 10143 gene locus_tag LOCUS_20640 gene kinB 11405 10143 CDS product sporulation sensor histidine kinase KinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228853.1 protein_id gnl|my_center|LOCUS_20640 12838 11492 gene locus_tag LOCUS_20650 gene rlmD 12838 11492 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615206.1 protein_id gnl|my_center|LOCUS_20650 13873 12956 gene locus_tag LOCUS_20660 13873 12956 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_20660 14092 15942 gene locus_tag LOCUS_20670 14092 15942 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078404951.1 protein_id gnl|my_center|LOCUS_20670 16752 16641 gene locus_tag LOCUS_r00010 16752 16641 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence054 304 807 gene locus_tag LOCUS_20680 gene infC 304 807 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_20680 819 1016 gene locus_tag LOCUS_20690 gene rpmI 819 1016 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_20690 1076 1435 gene locus_tag LOCUS_20700 gene rplT 1076 1435 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138362.1 protein_id gnl|my_center|LOCUS_20700 1767 2966 gene locus_tag LOCUS_20710 1767 2966 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_20710 3292 4080 gene locus_tag LOCUS_20720 3292 4080 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545211.1 protein_id gnl|my_center|LOCUS_20720 4061 4201 gene locus_tag LOCUS_20730 4061 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4673 5380 gene locus_tag LOCUS_20740 4673 5380 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232103.1 protein_id gnl|my_center|LOCUS_20740 5403 6299 gene locus_tag LOCUS_20750 5403 6299 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246070.1 protein_id gnl|my_center|LOCUS_20750 6362 7519 gene locus_tag LOCUS_20760 gene sat 6362 7519 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029491.1 protein_id gnl|my_center|LOCUS_20760 9098 7704 gene locus_tag LOCUS_20770 9098 7704 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809373.1 protein_id gnl|my_center|LOCUS_20770 9886 11628 gene locus_tag LOCUS_20780 gene ilvB 9886 11628 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_20780 11628 12140 gene locus_tag LOCUS_20790 gene ilvN 11628 12140 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_20790 12252 13265 gene locus_tag LOCUS_20800 gene ilvC 12252 13265 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816729.1 protein_id gnl|my_center|LOCUS_20800 13349 14905 gene locus_tag LOCUS_20810 13349 14905 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 protein_id gnl|my_center|LOCUS_20810 14898 15992 gene locus_tag LOCUS_20820 gene leuB 14898 15992 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583554.1 protein_id gnl|my_center|LOCUS_20820 16313 16065 gene locus_tag LOCUS_20830 16313 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence055 370 47 gene locus_tag LOCUS_20840 370 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 951 382 gene locus_tag LOCUS_20850 951 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1235 948 gene locus_tag LOCUS_20860 gene yabP 1235 948 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059101.1 protein_id gnl|my_center|LOCUS_20860 2287 1349 gene locus_tag LOCUS_20870 2287 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2667 2299 gene locus_tag LOCUS_20880 2667 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3117 2824 gene locus_tag LOCUS_20890 3117 2824 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_20890 3391 3119 gene locus_tag LOCUS_20900 3391 3119 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_20900 4943 3477 gene locus_tag LOCUS_20910 gene mazG 4943 3477 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 protein_id gnl|my_center|LOCUS_20910 6600 4930 gene locus_tag LOCUS_20920 6600 4930 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444142.1 protein_id gnl|my_center|LOCUS_20920 7302 6760 gene locus_tag LOCUS_20930 gene spoVT 7302 6760 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_20930 8535 7576 gene locus_tag LOCUS_20940 8535 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 12085 8549 gene locus_tag LOCUS_20950 gene mfd 12085 8549 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 protein_id gnl|my_center|LOCUS_20950 12418 12191 gene locus_tag LOCUS_20960 12418 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 13038 12478 gene locus_tag LOCUS_20970 gene pth 13038 12478 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_20970 13740 13120 gene locus_tag LOCUS_20980 13740 13120 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 protein_id gnl|my_center|LOCUS_20980 14884 13934 gene locus_tag LOCUS_20990 14884 13934 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_20990 16270 14897 gene locus_tag LOCUS_21000 gene glmU 16270 14897 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence056 <1 1096 gene locus_tag LOCUS_21010 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000257660.1:dihydrolipoamide acetyltransferase family protein 1299 1778 gene locus_tag LOCUS_21020 1299 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 1836 2276 gene locus_tag LOCUS_21030 1836 2276 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173262.1 protein_id gnl|my_center|LOCUS_21030 3005 2277 gene locus_tag LOCUS_21040 3005 2277 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_21040 3209 4873 gene locus_tag LOCUS_21050 3209 4873 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_21050 4877 5740 gene locus_tag LOCUS_21060 4877 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 5781 7364 gene locus_tag LOCUS_21070 5781 7364 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_21070 7420 8790 gene locus_tag LOCUS_21080 7420 8790 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_21080 9007 10140 gene locus_tag LOCUS_21090 9007 10140 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609811.1 protein_id gnl|my_center|LOCUS_21090 10137 11399 gene locus_tag LOCUS_21100 10137 11399 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245231.1 protein_id gnl|my_center|LOCUS_21100 11453 12664 gene locus_tag LOCUS_21110 11453 12664 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_21110 12898 12758 gene locus_tag LOCUS_21120 12898 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 12976 13527 gene locus_tag LOCUS_21130 12976 13527 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002325125.1 protein_id gnl|my_center|LOCUS_21130 13527 14720 gene locus_tag LOCUS_21140 13527 14720 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_21140 14814 15452 gene locus_tag LOCUS_21150 gene spoIIM 14814 15452 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269093.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence057 93 1791 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttccgtcccttataactcaggtcaa 1884 2728 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgtcccttataactcaggtcaaaac 4206 2839 gene locus_tag LOCUS_21160 4206 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 5384 4263 gene locus_tag LOCUS_21170 gene csm5 5384 4263 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546824.1 protein_id gnl|my_center|LOCUS_21170 6313 5381 gene locus_tag LOCUS_21180 gene csm4 6313 5381 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 protein_id gnl|my_center|LOCUS_21180 7149 6310 gene locus_tag LOCUS_21190 gene csm3 7149 6310 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021929.1 protein_id gnl|my_center|LOCUS_21190 7839 7162 gene locus_tag LOCUS_21200 7839 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 10201 7829 gene locus_tag LOCUS_21210 10201 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 10737 10198 gene locus_tag LOCUS_21220 10737 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 12276 11353 gene locus_tag LOCUS_21230 12276 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 12406 13038 gene locus_tag LOCUS_21240 12406 13038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 13476 14615 gene locus_tag LOCUS_21250 13476 14615 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_21250 14900 14715 gene locus_tag LOCUS_21260 14900 14715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 >Feature sequence058 487 1329 gene locus_tag LOCUS_21270 gene proI 487 1329 CDS product pyrroline-5-carboxylate reductase ProI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027249.1 protein_id gnl|my_center|LOCUS_21270 1444 1776 gene locus_tag LOCUS_21280 1444 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2903 1905 gene locus_tag LOCUS_21290 2903 1905 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909335.1 protein_id gnl|my_center|LOCUS_21290 3075 3398 gene locus_tag LOCUS_21300 3075 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3411 3794 gene locus_tag LOCUS_21310 3411 3794 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228564.1 protein_id gnl|my_center|LOCUS_21310 5155 3932 gene locus_tag LOCUS_21320 5155 3932 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919355.1 protein_id gnl|my_center|LOCUS_21320 5373 5298 gene locus_tag LOCUS_t00360 5373 5298 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5509 6492 gene locus_tag LOCUS_21330 5509 6492 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448370.1 protein_id gnl|my_center|LOCUS_21330 6858 8576 gene locus_tag LOCUS_21340 gene thiC 6858 8576 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_21340 8710 9552 gene locus_tag LOCUS_21350 8710 9552 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_21350 9575 9787 gene locus_tag LOCUS_21360 9575 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 11019 9784 gene locus_tag LOCUS_21370 gene sndC 11019 9784 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_21370 12041 11037 gene locus_tag LOCUS_21380 12041 11037 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399251.1 protein_id gnl|my_center|LOCUS_21380 12786 12094 gene locus_tag LOCUS_21390 12786 12094 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 protein_id gnl|my_center|LOCUS_21390 13694 12828 gene locus_tag LOCUS_21400 13694 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 13956 13881 gene locus_tag LOCUS_t00370 13956 13881 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14325 13970 gene locus_tag LOCUS_tm00010 14325 13970 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 14814 14350 gene locus_tag LOCUS_21410 gene smpB 14814 14350 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence059 126 2060 gene locus_tag LOCUS_21420 gene ftsH 126 2060 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 protein_id gnl|my_center|LOCUS_21420 2240 3937 gene locus_tag LOCUS_21430 2240 3937 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110057.1 protein_id gnl|my_center|LOCUS_21430 3987 4751 gene locus_tag LOCUS_21440 3987 4751 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_21440 5517 5807 gene locus_tag LOCUS_21450 5517 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 5916 6806 gene locus_tag LOCUS_21460 gene hslO 5916 6806 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_21460 6851 7762 gene locus_tag LOCUS_21470 6851 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 7837 8775 gene locus_tag LOCUS_21480 gene cysK 7837 8775 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_21480 8929 10416 gene locus_tag LOCUS_21490 gene pabB 8929 10416 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 protein_id gnl|my_center|LOCUS_21490 10419 11006 gene locus_tag LOCUS_21500 gene pabA 10419 11006 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_21500 11011 11880 gene locus_tag LOCUS_21510 gene pabC 11011 11880 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 protein_id gnl|my_center|LOCUS_21510 11918 12775 gene locus_tag LOCUS_21520 gene folP 11918 12775 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164656.1 protein_id gnl|my_center|LOCUS_21520 12777 13310 gene locus_tag LOCUS_21530 gene folK 12777 13310 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_21530 13262 13474 gene locus_tag LOCUS_21540 13262 13474 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387031.1 protein_id gnl|my_center|LOCUS_21540 13552 14562 gene locus_tag LOCUS_21550 gene dusB 13552 14562 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912262.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence060 1238 267 gene locus_tag LOCUS_21560 gene trxB 1238 267 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065103.1 protein_id gnl|my_center|LOCUS_21560 1884 1228 gene locus_tag LOCUS_21570 1884 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2019 2312 gene locus_tag LOCUS_21580 2019 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 2355 3398 gene locus_tag LOCUS_21590 2355 3398 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256728.1 protein_id gnl|my_center|LOCUS_21590 3498 4787 gene locus_tag LOCUS_21600 gene hemL 3498 4787 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_21600 5112 6224 gene locus_tag LOCUS_21610 5112 6224 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601752.1 protein_id gnl|my_center|LOCUS_21610 6221 6901 gene locus_tag LOCUS_21620 6221 6901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920518.1 protein_id gnl|my_center|LOCUS_21620 6979 7833 gene locus_tag LOCUS_21630 6979 7833 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461467.1 protein_id gnl|my_center|LOCUS_21630 7982 8449 gene locus_tag LOCUS_21640 7982 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 8653 9969 gene locus_tag LOCUS_21650 8653 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 9977 10981 gene locus_tag LOCUS_21660 9977 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 11761 10949 gene locus_tag LOCUS_21670 gene fdhD 11761 10949 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_21670 11863 13158 gene locus_tag LOCUS_21680 gene moeA 11863 13158 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229690.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence061 <1 2705 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaattcctcataggtaggctccaaac 3184 2915 gene locus_tag LOCUS_21690 gene cas2 3184 2915 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582991.1 protein_id gnl|my_center|LOCUS_21690 4177 3185 gene locus_tag LOCUS_21700 gene cas1b 4177 3185 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817555.1 protein_id gnl|my_center|LOCUS_21700 4711 4199 gene locus_tag LOCUS_21710 gene cas4 4711 4199 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_21710 7115 4734 gene locus_tag LOCUS_21720 7115 4734 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272460.1 protein_id gnl|my_center|LOCUS_21720 7816 7109 gene locus_tag LOCUS_21730 gene cas5 7816 7109 CDS product CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460587.1 protein_id gnl|my_center|LOCUS_21730 8761 7838 gene locus_tag LOCUS_21740 8761 7838 CDS product type I CRISPR-associated protein Cas7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944886.1 protein_id gnl|my_center|LOCUS_21740 10888 8795 gene locus_tag LOCUS_21750 10888 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816134.1 protein_id gnl|my_center|LOCUS_21750 11643 10882 gene locus_tag LOCUS_21760 gene cas6 11643 10882 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272867.1 protein_id gnl|my_center|LOCUS_21760 11860 12045 gene locus_tag LOCUS_21770 11860 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence062 1014 103 gene locus_tag LOCUS_21780 1014 103 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871102.1 protein_id gnl|my_center|LOCUS_21780 1450 1022 gene locus_tag LOCUS_21790 1450 1022 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151389.1 protein_id gnl|my_center|LOCUS_21790 3067 1523 gene locus_tag LOCUS_21800 gene fumA 3067 1523 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413503.1 protein_id gnl|my_center|LOCUS_21800 3277 3669 gene locus_tag LOCUS_21810 3277 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4185 3790 gene locus_tag LOCUS_21820 4185 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 4661 4233 gene locus_tag LOCUS_21830 gene cwlJ 4661 4233 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538169.1 protein_id gnl|my_center|LOCUS_21830 5642 4899 gene locus_tag LOCUS_21840 5642 4899 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_21840 6531 5629 gene locus_tag LOCUS_21850 gene garR 6531 5629 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_21850 8106 6601 gene locus_tag LOCUS_21860 gene pepA 8106 6601 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487943.1 protein_id gnl|my_center|LOCUS_21860 8461 8267 gene locus_tag LOCUS_21870 8461 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 8667 9293 gene locus_tag LOCUS_21880 8667 9293 CDS product YktB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232300.1 protein_id gnl|my_center|LOCUS_21880 9498 9367 gene locus_tag LOCUS_21890 9498 9367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 9779 9465 gene locus_tag LOCUS_21900 9779 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21900 10073 10528 gene locus_tag LOCUS_21910 10073 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21910 10611 10835 gene locus_tag LOCUS_21920 10611 10835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 11527 11084 gene locus_tag LOCUS_21930 11527 11084 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021908.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence063 218 1447 gene locus_tag LOCUS_21940 218 1447 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106376.1 protein_id gnl|my_center|LOCUS_21940 2143 1565 gene locus_tag LOCUS_21950 2143 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21950 2314 2144 gene locus_tag LOCUS_21960 2314 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2781 2452 gene locus_tag LOCUS_21970 2781 2452 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365769.1 protein_id gnl|my_center|LOCUS_21970 4529 2778 gene locus_tag LOCUS_21980 4529 2778 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393464.1 protein_id gnl|my_center|LOCUS_21980 6597 4555 gene locus_tag LOCUS_21990 6597 4555 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_21990 7175 6633 gene locus_tag LOCUS_22000 7175 6633 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362795.1 protein_id gnl|my_center|LOCUS_22000 7748 7344 gene locus_tag LOCUS_22010 7748 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 7879 7694 gene locus_tag LOCUS_22020 7879 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 8801 7965 gene locus_tag LOCUS_22030 8801 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 8926 10077 gene locus_tag LOCUS_22040 8926 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 10074 10259 gene locus_tag LOCUS_22050 10074 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 11203 10241 gene locus_tag LOCUS_22060 11203 10241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence064 653 42 gene locus_tag LOCUS_22070 653 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 2313 832 gene locus_tag LOCUS_22080 gene rocR 2313 832 CDS product arginine utilization transcriptional regulator RocR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002706.1 protein_id gnl|my_center|LOCUS_22080 2514 3893 gene locus_tag LOCUS_22090 2514 3893 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_22090 4078 4281 gene locus_tag LOCUS_22100 4078 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 6027 4357 gene locus_tag LOCUS_22110 gene argS 6027 4357 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_22110 6449 6006 gene locus_tag LOCUS_22120 6449 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 7458 6589 gene locus_tag LOCUS_22130 gene speB 7458 6589 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209831.1 protein_id gnl|my_center|LOCUS_22130 8338 7502 gene locus_tag LOCUS_22140 gene speE 8338 7502 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 protein_id gnl|my_center|LOCUS_22140 8508 10550 gene locus_tag LOCUS_22150 8508 10550 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372988.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence065 1710 178 gene locus_tag LOCUS_22160 1710 178 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429812.1 protein_id gnl|my_center|LOCUS_22160 2526 1888 gene locus_tag LOCUS_22170 2526 1888 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390211.1 protein_id gnl|my_center|LOCUS_22170 2739 3668 gene locus_tag LOCUS_22180 2739 3668 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722579.1 protein_id gnl|my_center|LOCUS_22180 4727 3726 gene locus_tag LOCUS_22190 4727 3726 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_22190 5036 4761 gene locus_tag LOCUS_22200 5036 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6772 5078 gene locus_tag LOCUS_22210 6772 5078 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 protein_id gnl|my_center|LOCUS_22210 7026 7271 gene locus_tag LOCUS_22220 7026 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 8363 7380 gene locus_tag LOCUS_22230 8363 7380 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960316.1 protein_id gnl|my_center|LOCUS_22230 9611 8448 gene locus_tag LOCUS_22240 9611 8448 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015489.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 10321 9899 gene locus_tag LOCUS_22250 10321 9899 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114401.1 protein_id gnl|my_center|LOCUS_22250 10483 10745 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcctcttgcaacgagtcaactctctgcaac >Feature sequence066 129 1304 gene locus_tag LOCUS_22260 gene nifS 129 1304 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868962.1 protein_id gnl|my_center|LOCUS_22260 2223 1360 gene locus_tag LOCUS_22270 2223 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2392 2526 gene locus_tag LOCUS_22280 2392 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3860 2580 gene locus_tag LOCUS_22290 3860 2580 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924630.1 protein_id gnl|my_center|LOCUS_22290 4708 4007 gene locus_tag LOCUS_22300 gene queC 4708 4007 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_22300 5543 4788 gene locus_tag LOCUS_22310 gene queE 5543 4788 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_22310 6010 5546 gene locus_tag LOCUS_22320 gene queD 6010 5546 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368414.1 protein_id gnl|my_center|LOCUS_22320 7982 5973 gene locus_tag LOCUS_22330 7982 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 10013 8091 gene locus_tag LOCUS_22340 10013 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence067 157 894 gene locus_tag LOCUS_22350 157 894 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393245.1 protein_id gnl|my_center|LOCUS_22350 950 1117 gene locus_tag LOCUS_22360 950 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1593 1114 gene locus_tag LOCUS_22370 gene tadA 1593 1114 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832295.1 protein_id gnl|my_center|LOCUS_22370 1861 1785 gene locus_tag LOCUS_t00380 1861 1785 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1957 1866 gene locus_tag LOCUS_t00390 1957 1866 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3321 2035 gene locus_tag LOCUS_22380 gene serS 3321 2035 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247131.1 protein_id gnl|my_center|LOCUS_22380 3978 3406 gene locus_tag LOCUS_22390 gene pdxT 3978 3406 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238787.1 protein_id gnl|my_center|LOCUS_22390 4873 3989 gene locus_tag LOCUS_22400 gene pdxS 4873 3989 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_22400 5144 5013 gene locus_tag LOCUS_22410 5144 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 6459 5155 gene locus_tag LOCUS_22420 6459 5155 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110099.1 protein_id gnl|my_center|LOCUS_22420 8045 6588 gene locus_tag LOCUS_22430 gene guaB 8045 6588 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226803.1 protein_id gnl|my_center|LOCUS_22430 8225 9277 gene locus_tag LOCUS_22440 8225 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 9512 9300 gene locus_tag LOCUS_22450 9512 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence068 147 1313 gene locus_tag LOCUS_22460 147 1313 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393897.1 protein_id gnl|my_center|LOCUS_22460 1395 1958 gene locus_tag LOCUS_22470 1395 1958 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314298.1 protein_id gnl|my_center|LOCUS_22470 2757 1969 gene locus_tag LOCUS_22480 2757 1969 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393059.1 protein_id gnl|my_center|LOCUS_22480 3379 2870 gene locus_tag LOCUS_22490 3379 2870 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480176.1 protein_id gnl|my_center|LOCUS_22490 4745 3669 gene locus_tag LOCUS_22500 4745 3669 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168489.1 protein_id gnl|my_center|LOCUS_22500 5833 4829 gene locus_tag LOCUS_22510 gene manA 5833 4829 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101726.1 protein_id gnl|my_center|LOCUS_22510 8096 6000 gene locus_tag LOCUS_22520 8096 6000 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_22520 8313 9209 gene locus_tag LOCUS_22530 8313 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence069 150 359 gene locus_tag LOCUS_22540 150 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 356 736 gene locus_tag LOCUS_22550 356 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 779 1513 gene locus_tag LOCUS_22560 gene atpB 779 1513 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399877.1 protein_id gnl|my_center|LOCUS_22560 1650 1868 gene locus_tag LOCUS_22570 gene atpE 1650 1868 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048816.1 protein_id gnl|my_center|LOCUS_22570 2014 2499 gene locus_tag LOCUS_22580 gene atpF 2014 2499 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244051.1 protein_id gnl|my_center|LOCUS_22580 2496 3050 gene locus_tag LOCUS_22590 gene atpH 2496 3050 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064683.1 protein_id gnl|my_center|LOCUS_22590 3068 4585 gene locus_tag LOCUS_22600 gene atpA 3068 4585 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027518.1 protein_id gnl|my_center|LOCUS_22600 4622 5479 gene locus_tag LOCUS_22610 gene atpG 4622 5479 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157696.1 protein_id gnl|my_center|LOCUS_22610 5513 6919 gene locus_tag LOCUS_22620 gene atpD 5513 6919 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_22620 6943 7212 gene locus_tag LOCUS_22630 6943 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 7381 7746 gene locus_tag LOCUS_22640 gene nuoA 7381 7746 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_22640 7737 8258 gene locus_tag LOCUS_22650 gene nuoB 7737 8258 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236331.1 protein_id gnl|my_center|LOCUS_22650 >Feature sequence070 113 189 gene locus_tag LOCUS_t00400 113 189 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 196 272 gene locus_tag LOCUS_t00410 196 272 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 277 352 gene locus_tag LOCUS_t00420 277 352 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 366 441 gene locus_tag LOCUS_t00430 366 441 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 682 3189 gene locus_tag LOCUS_22660 gene spoIIE 682 3189 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123550.1 protein_id gnl|my_center|LOCUS_22660 3304 4083 gene locus_tag LOCUS_22670 3304 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4088 4993 gene locus_tag LOCUS_22680 4088 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 5001 5786 gene locus_tag LOCUS_22690 5001 5786 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 protein_id gnl|my_center|LOCUS_22690 5815 6264 gene locus_tag LOCUS_22700 5815 6264 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808679.1 protein_id gnl|my_center|LOCUS_22700 6245 7645 gene locus_tag LOCUS_22710 gene tilS 6245 7645 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_22710 7688 8224 gene locus_tag LOCUS_22720 7688 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 >Feature sequence071 243 842 gene locus_tag LOCUS_22730 gene rpsD 243 842 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135311.1 protein_id gnl|my_center|LOCUS_22730 2164 893 gene locus_tag LOCUS_22740 2164 893 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_22740 2723 2145 gene locus_tag LOCUS_22750 2723 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3877 2843 gene locus_tag LOCUS_22760 3877 2843 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813561.1 protein_id gnl|my_center|LOCUS_22760 4141 4377 gene locus_tag LOCUS_22770 4141 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 4442 5032 gene locus_tag LOCUS_22780 4442 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22780 5922 5611 gene locus_tag LOCUS_22790 5922 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22790 >Feature sequence072 <1 1295 gene locus_tag LOCUS_22800 <1 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181746991.1:IS1182 family transposase 1328 1732 gene locus_tag LOCUS_22810 1328 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 1701 1931 gene locus_tag LOCUS_22820 1701 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22820 2164 2646 gene locus_tag LOCUS_22830 2164 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2538 2846 gene locus_tag LOCUS_22840 2538 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 2913 3140 gene locus_tag LOCUS_22850 2913 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 3728 3213 gene locus_tag LOCUS_22860 3728 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3921 6179 gene locus_tag LOCUS_22870 3921 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 6235 6711 gene locus_tag LOCUS_22880 6235 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 >Feature sequence073 728 459 gene locus_tag LOCUS_22890 728 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1431 835 gene locus_tag LOCUS_22900 gene recR 1431 835 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_22900 1761 1441 gene locus_tag LOCUS_22910 1761 1441 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_22910 3516 1774 gene locus_tag LOCUS_22920 gene dnaX 3516 1774 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_22920 5058 3619 gene locus_tag LOCUS_22930 5058 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 6055 5717 gene locus_tag LOCUS_22940 6055 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 6404 6312 gene locus_tag LOCUS_t00440 6404 6312 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 156 1724 gene locus_tag LOCUS_22950 gene nadB 156 1724 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140848.1 protein_id gnl|my_center|LOCUS_22950 1678 2517 gene locus_tag LOCUS_22960 gene nadC 1678 2517 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_22960 2555 3655 gene locus_tag LOCUS_22970 gene nadA 2555 3655 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461809.1 protein_id gnl|my_center|LOCUS_22970 4827 3781 gene locus_tag LOCUS_22980 gene ilvA 4827 3781 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_22980 6218 5247 gene locus_tag LOCUS_22990 6218 5247 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141225.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence075 172 1386 gene locus_tag LOCUS_23000 gene metK 172 1386 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_23000 1475 2644 gene locus_tag LOCUS_23010 1475 2644 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392489.1 protein_id gnl|my_center|LOCUS_23010 2641 3330 gene locus_tag LOCUS_23020 gene degU 2641 3330 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_23020 3387 3794 gene locus_tag LOCUS_23030 3387 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3882 5561 gene locus_tag LOCUS_23040 3882 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence076 149 1153 gene locus_tag LOCUS_23050 149 1153 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026689.1 protein_id gnl|my_center|LOCUS_23050 1261 1467 gene locus_tag LOCUS_23060 1261 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1496 1930 gene locus_tag LOCUS_23070 1496 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2307 1954 gene locus_tag LOCUS_23080 2307 1954 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_23080 2651 2424 gene locus_tag LOCUS_23090 2651 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2943 4049 gene locus_tag LOCUS_23100 gene mqnE 2943 4049 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_23100 4207 4458 gene locus_tag LOCUS_23110 4207 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4537 5643 gene locus_tag LOCUS_23120 gene mqnE 4537 5643 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence077 1371 721 gene locus_tag LOCUS_23130 gene hisH 1371 721 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244267.1 protein_id gnl|my_center|LOCUS_23130 2033 1419 gene locus_tag LOCUS_23140 gene hisB 2033 1419 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_23140 3400 2030 gene locus_tag LOCUS_23150 gene hisD 3400 2030 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243286.1 protein_id gnl|my_center|LOCUS_23150 3708 3397 gene locus_tag LOCUS_23160 3708 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23160 5256 4045 gene locus_tag LOCUS_23170 5256 4045 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_23170 >Feature sequence078 3070 46 gene locus_tag LOCUS_r00020 3070 46 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3264 3189 gene locus_tag LOCUS_t00450 3264 3189 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence079 1523 1768 gene locus_tag LOCUS_23180 1523 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3129 1843 gene locus_tag LOCUS_23190 gene aceA 3129 1843 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_23190 4774 3170 gene locus_tag LOCUS_23200 gene aceB 4774 3170 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence080 1517 495 gene locus_tag LOCUS_23210 gene tsaD 1517 495 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_23210 1965 1480 gene locus_tag LOCUS_23220 gene rimI 1965 1480 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367190.1 protein_id gnl|my_center|LOCUS_23220 2719 1958 gene locus_tag LOCUS_23230 gene tsaB 2719 1958 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 protein_id gnl|my_center|LOCUS_23230 3210 2707 gene locus_tag LOCUS_23240 gene tsaE 3210 2707 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101163.1 protein_id gnl|my_center|LOCUS_23240 4183 3179 gene locus_tag LOCUS_23250 gene thiL 4183 3179 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234080.1 protein_id gnl|my_center|LOCUS_23250 4402 4326 gene locus_tag LOCUS_t00460 4402 4326 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4492 4419 gene locus_tag LOCUS_t00470 4492 4419 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4581 4505 gene locus_tag LOCUS_t00480 4581 4505 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4702 4616 gene locus_tag LOCUS_t00490 4702 4616 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 284 445 gene locus_tag LOCUS_23260 284 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 480 653 gene locus_tag LOCUS_23270 480 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1917 1324 gene locus_tag LOCUS_23280 1917 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3627 3370 gene locus_tag LOCUS_23290 3627 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 3725 3847 gene locus_tag LOCUS_23300 3725 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 4371 3877 gene locus_tag LOCUS_23310 4371 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence082 32 2748 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttggagcctacctatgaggaattggaac 3940 2882 gene locus_tag LOCUS_23320 3940 2882 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064426.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence083 385 3708 gene locus_tag LOCUS_23330 385 3708 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362298.1 protein_id gnl|my_center|LOCUS_23330 >Feature sequence084 981 1394 gene locus_tag LOCUS_23340 981 1394 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 protein_id gnl|my_center|LOCUS_23340 1448 3526 gene locus_tag LOCUS_23350 1448 3526 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086363.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence085 65 156 gene locus_tag LOCUS_t00500 65 156 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 183 259 gene locus_tag LOCUS_t00510 183 259 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 264 340 gene locus_tag LOCUS_t00520 264 340 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 406 481 gene locus_tag LOCUS_t00530 406 481 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 535 608 gene locus_tag LOCUS_t00540 535 608 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 615 690 gene locus_tag LOCUS_t00550 615 690 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 711 785 gene locus_tag LOCUS_t00560 711 785 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 804 878 gene locus_tag LOCUS_t00570 804 878 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 890 963 gene locus_tag LOCUS_t00580 890 963 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 975 1063 gene locus_tag LOCUS_t00590 975 1063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1099 1175 gene locus_tag LOCUS_t00600 1099 1175 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1185 1271 gene locus_tag LOCUS_t00610 1185 1271 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3265 1421 gene locus_tag LOCUS_23360 gene asnB 3265 1421 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_23360 3587 3423 gene locus_tag LOCUS_23370 3587 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence086 <1 974 gene locus_tag LOCUS_23380 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000678103.1:YhgE/Pip domain-containing protein 1799 1053 gene locus_tag LOCUS_23390 1799 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23390 2124 2504 gene locus_tag LOCUS_23400 2124 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2501 3643 gene locus_tag LOCUS_23410 gene mutY 2501 3643 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence087 102 314 gene locus_tag LOCUS_23420 102 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 546 719 gene locus_tag LOCUS_23430 546 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1258 1905 gene locus_tag LOCUS_23440 1258 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 2117 3145 gene locus_tag LOCUS_23450 2117 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence088 55 333 gene locus_tag LOCUS_23460 55 333 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832193.1 protein_id gnl|my_center|LOCUS_23460 404 598 gene locus_tag LOCUS_23470 gene sspF 404 598 CDS product acid-soluble spore protein SspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985066.1 protein_id gnl|my_center|LOCUS_23470 682 1551 gene locus_tag LOCUS_23480 gene ispE 682 1551 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_23480 1578 2396 gene locus_tag LOCUS_23490 gene purR 1578 2396 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 protein_id gnl|my_center|LOCUS_23490 2481 2858 gene locus_tag LOCUS_23500 2481 2858 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_23500 2965 3258 gene locus_tag LOCUS_23510 gene spoVG 2965 3258 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454041.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence089 148 447 gene locus_tag LOCUS_23520 148 447 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966071.1 protein_id gnl|my_center|LOCUS_23520 2453 501 gene locus_tag LOCUS_23530 gene thrS 2453 501 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence090 1902 412 gene locus_tag LOCUS_23540 gene lysS 1902 412 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_23540 2483 2007 gene locus_tag LOCUS_23550 gene greA 2483 2007 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence091 870 250 gene locus_tag LOCUS_23560 870 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 1025 1207 gene locus_tag LOCUS_23570 1025 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1298 1663 gene locus_tag LOCUS_23580 1298 1663 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665986.1 protein_id gnl|my_center|LOCUS_23580 1765 1986 gene locus_tag LOCUS_23590 1765 1986 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831346.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence092 1875 511 gene locus_tag LOCUS_23600 gene ablA 1875 511 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902136.1 protein_id gnl|my_center|LOCUS_23600 2431 1976 gene locus_tag LOCUS_23610 2431 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence093 1376 445 gene locus_tag LOCUS_r00030 1376 445 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 58 percent of the 16S ribosomal RNA >Feature sequence094 718 47 gene locus_tag LOCUS_23620 718 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 1799 1278 gene locus_tag LOCUS_23630 1799 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence095 11 1724 gene locus_tag LOCUS_r00040 11 1724 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 53 percent of the 23S ribosomal RNA >Feature sequence096 2 856 gene locus_tag LOCUS_23640 2 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 843 1589 gene locus_tag LOCUS_23650 843 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence097 724 1047 gene locus_tag LOCUS_23660 724 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 1130 1300 gene locus_tag LOCUS_23670 1130 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence098 726 37 gene locus_tag LOCUS_23680 726 37 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273131.1 protein_id gnl|my_center|LOCUS_23680 995 723 gene locus_tag LOCUS_23690 995 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence099 831 322 gene locus_tag LOCUS_23700 831 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence100 >Feature sequence101 437 132 gene locus_tag LOCUS_23710 437 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 >Feature sequence102 >Feature sequence103 >Feature sequence104 538 687 gene locus_tag LOCUS_23720 538 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence105 548 165 gene locus_tag LOCUS_23730 548 165 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence106 501 328 gene locus_tag LOCUS_23740 501 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence107 >Feature sequence108 578 297 gene locus_tag LOCUS_23750 578 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23750 >Feature sequence109 >Feature sequence110 >Feature sequence111 >Feature sequence112 463 107 gene locus_tag LOCUS_23760 463 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760