>Feature sequence01 190 304 gene locus_tag LOCUS_r00010 190 304 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 513 932 gene locus_tag LOCUS_00010 513 932 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289104.1 protein_id gnl|my_center|LOCUS_00010 1033 1944 gene locus_tag LOCUS_00020 1033 1944 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902943.1 protein_id gnl|my_center|LOCUS_00020 2525 1980 gene locus_tag LOCUS_00030 2525 1980 CDS product DUF5804 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289303.1 protein_id gnl|my_center|LOCUS_00030 3740 2553 gene locus_tag LOCUS_00040 3740 2553 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902941.1 protein_id gnl|my_center|LOCUS_00040 4990 3788 gene locus_tag LOCUS_00050 4990 3788 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902940.1 protein_id gnl|my_center|LOCUS_00050 5592 5050 gene locus_tag LOCUS_00060 gene cyaB 5592 5050 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902939.1 protein_id gnl|my_center|LOCUS_00060 5673 6701 gene locus_tag LOCUS_00070 5673 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6781 7728 gene locus_tag LOCUS_00080 6781 7728 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902937.1 protein_id gnl|my_center|LOCUS_00080 7874 8074 gene locus_tag LOCUS_00090 7874 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8706 8077 gene locus_tag LOCUS_00100 8706 8077 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878668.1 protein_id gnl|my_center|LOCUS_00100 9361 8735 gene locus_tag LOCUS_00110 9361 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9623 10555 gene locus_tag LOCUS_00120 9623 10555 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_00120 10595 11752 gene locus_tag LOCUS_00130 10595 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11910 12824 gene locus_tag LOCUS_00140 gene pyrB 11910 12824 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289640.1 protein_id gnl|my_center|LOCUS_00140 12821 13288 gene locus_tag LOCUS_00150 gene pyrI 12821 13288 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289641.1 protein_id gnl|my_center|LOCUS_00150 14176 13310 gene locus_tag LOCUS_00160 14176 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15173 14232 gene locus_tag LOCUS_00170 15173 14232 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_00170 16126 15170 gene locus_tag LOCUS_00180 16126 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16785 16126 gene locus_tag LOCUS_00190 16785 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19148 16782 gene locus_tag LOCUS_00200 19148 16782 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023083.1 protein_id gnl|my_center|LOCUS_00200 20941 19148 gene locus_tag LOCUS_00210 20941 19148 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_00210 21179 21817 gene locus_tag LOCUS_00220 gene dmsR 21179 21817 CDS product dimethyl sulfoxide reductase transcriptional activator DmsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902578.1 protein_id gnl|my_center|LOCUS_00220 21979 22221 gene locus_tag LOCUS_00230 21979 22221 CDS product 4Fe-4S ferredoxin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902579.1 protein_id gnl|my_center|LOCUS_00230 22214 24709 gene locus_tag LOCUS_00240 22214 24709 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902580.1 protein_id gnl|my_center|LOCUS_00240 24712 25542 gene locus_tag LOCUS_00250 24712 25542 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_00250 25542 26837 gene locus_tag LOCUS_00260 gene nrfD 25542 26837 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_00260 26834 27421 gene locus_tag LOCUS_00270 26834 27421 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902583.1 protein_id gnl|my_center|LOCUS_00270 28263 27631 gene locus_tag LOCUS_00280 28263 27631 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902175.1 protein_id gnl|my_center|LOCUS_00280 29674 28436 gene locus_tag LOCUS_00290 gene apbC 29674 28436 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_00290 30528 29677 gene locus_tag LOCUS_00300 30528 29677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31379 30525 gene locus_tag LOCUS_00310 31379 30525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32056 31376 gene locus_tag LOCUS_00320 32056 31376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 32889 32056 gene locus_tag LOCUS_00330 32889 32056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33958 32882 gene locus_tag LOCUS_00340 33958 32882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 36813 33955 gene locus_tag LOCUS_00350 36813 33955 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_00350 36988 36806 gene locus_tag LOCUS_00360 36988 36806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38379 36985 gene locus_tag LOCUS_00370 38379 36985 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229023.1 protein_id gnl|my_center|LOCUS_00370 39032 38379 gene locus_tag LOCUS_00380 39032 38379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39604 39029 gene locus_tag LOCUS_00390 39604 39029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39718 40443 gene locus_tag LOCUS_00400 39718 40443 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903087.1 protein_id gnl|my_center|LOCUS_00400 40539 41204 gene locus_tag LOCUS_00410 40539 41204 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_00410 41260 41577 gene locus_tag LOCUS_00420 41260 41577 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_00420 41717 42229 gene locus_tag LOCUS_00430 41717 42229 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902168.1 protein_id gnl|my_center|LOCUS_00430 42337 42975 gene locus_tag LOCUS_00440 42337 42975 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903332.1 protein_id gnl|my_center|LOCUS_00440 43020 43493 gene locus_tag LOCUS_00450 gene moaC 43020 43493 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902923.1 protein_id gnl|my_center|LOCUS_00450 43567 44394 gene locus_tag LOCUS_00460 43567 44394 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289090.1 protein_id gnl|my_center|LOCUS_00460 45223 44423 gene locus_tag LOCUS_00470 45223 44423 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903162.1 protein_id gnl|my_center|LOCUS_00470 46079 45198 gene locus_tag LOCUS_00480 46079 45198 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903163.1 protein_id gnl|my_center|LOCUS_00480 46192 47640 gene locus_tag LOCUS_00490 gene thiC 46192 47640 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_00490 47938 48762 gene locus_tag LOCUS_00500 47938 48762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902935.1 protein_id gnl|my_center|LOCUS_00500 49348 48782 gene locus_tag LOCUS_00510 49348 48782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 49668 49345 gene locus_tag LOCUS_00520 49668 49345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 49979 50164 gene locus_tag LOCUS_00530 49979 50164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902934.1 protein_id gnl|my_center|LOCUS_00530 50172 50597 gene locus_tag LOCUS_00540 50172 50597 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902933.1 protein_id gnl|my_center|LOCUS_00540 50597 51304 gene locus_tag LOCUS_00550 50597 51304 CDS product RNase P subunit p30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289302.1 protein_id gnl|my_center|LOCUS_00550 51449 51871 gene locus_tag LOCUS_00560 51449 51871 CDS product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903792.1 protein_id gnl|my_center|LOCUS_00560 52008 52493 gene locus_tag LOCUS_00570 52008 52493 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902926.1 protein_id gnl|my_center|LOCUS_00570 52496 53272 gene locus_tag LOCUS_00580 gene psmA 52496 53272 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_00580 53361 54089 gene locus_tag LOCUS_00590 53361 54089 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902925.1 protein_id gnl|my_center|LOCUS_00590 54452 54105 gene locus_tag LOCUS_00600 54452 54105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 54659 56854 gene locus_tag LOCUS_00610 gene katG 54659 56854 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904144.1 protein_id gnl|my_center|LOCUS_00610 57031 58341 gene locus_tag LOCUS_00620 gene hflX 57031 58341 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902924.1 protein_id gnl|my_center|LOCUS_00620 59793 58351 gene locus_tag LOCUS_00630 59793 58351 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289301.1 protein_id gnl|my_center|LOCUS_00630 60163 59840 gene locus_tag LOCUS_00640 60163 59840 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_00640 61077 60169 gene locus_tag LOCUS_00650 61077 60169 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902918.1 protein_id gnl|my_center|LOCUS_00650 61317 61790 gene locus_tag LOCUS_00660 61317 61790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 62165 61929 gene locus_tag LOCUS_00670 62165 61929 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902916.1 protein_id gnl|my_center|LOCUS_00670 62451 63284 gene locus_tag LOCUS_00680 62451 63284 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989536.1 protein_id gnl|my_center|LOCUS_00680 63451 64089 gene locus_tag LOCUS_00690 63451 64089 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_00690 64242 65312 gene locus_tag LOCUS_00700 64242 65312 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_00700 65425 65916 gene locus_tag LOCUS_00710 65425 65916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 66039 67223 gene locus_tag LOCUS_00720 66039 67223 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074039.1 protein_id gnl|my_center|LOCUS_00720 67280 68518 gene locus_tag LOCUS_00730 67280 68518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 68515 69723 gene locus_tag LOCUS_00740 68515 69723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 69784 70917 gene locus_tag LOCUS_00750 69784 70917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 70958 72229 gene locus_tag LOCUS_00760 70958 72229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 72783 72235 gene locus_tag LOCUS_00770 72783 72235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903626.1 protein_id gnl|my_center|LOCUS_00770 74495 72807 gene locus_tag LOCUS_00780 74495 72807 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_00780 75067 74495 gene locus_tag LOCUS_00790 75067 74495 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892532.1 protein_id gnl|my_center|LOCUS_00790 76307 75072 gene locus_tag LOCUS_00800 76307 75072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 76474 76650 gene locus_tag LOCUS_00810 76474 76650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 76652 77425 gene locus_tag LOCUS_00820 76652 77425 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807659.1 protein_id gnl|my_center|LOCUS_00820 77422 79803 gene locus_tag LOCUS_00830 77422 79803 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_00830 80458 80769 gene locus_tag LOCUS_00840 80458 80769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 81054 81518 gene locus_tag LOCUS_00850 81054 81518 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404870.1 protein_id gnl|my_center|LOCUS_00850 83286 81529 gene locus_tag LOCUS_00860 83286 81529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 83930 83322 gene locus_tag LOCUS_00870 83930 83322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 84131 85267 gene locus_tag LOCUS_00880 84131 85267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 85436 86173 gene locus_tag LOCUS_00890 gene spo0M 85436 86173 CDS product sporulation control protein Spo0M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233481.1 protein_id gnl|my_center|LOCUS_00890 89031 86197 gene locus_tag LOCUS_00900 89031 86197 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902906.1 protein_id gnl|my_center|LOCUS_00900 88946 89176 gene locus_tag LOCUS_00910 88946 89176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 89207 90055 gene locus_tag LOCUS_00920 89207 90055 CDS product class 1 fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902473.1 protein_id gnl|my_center|LOCUS_00920 90824 90075 gene locus_tag LOCUS_00930 90824 90075 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902907.1 protein_id gnl|my_center|LOCUS_00930 92649 90910 gene locus_tag LOCUS_00940 92649 90910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 93926 92646 gene locus_tag LOCUS_00950 93926 92646 CDS product Single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289299.1 protein_id gnl|my_center|LOCUS_00950 94146 94628 gene locus_tag LOCUS_00960 94146 94628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 94673 95332 gene locus_tag LOCUS_00970 94673 95332 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902910.1 protein_id gnl|my_center|LOCUS_00970 95636 95349 gene locus_tag LOCUS_00980 95636 95349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902911.1 protein_id gnl|my_center|LOCUS_00980 96748 95699 gene locus_tag LOCUS_00990 96748 95699 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902912.1 protein_id gnl|my_center|LOCUS_00990 96850 97134 gene locus_tag LOCUS_01000 96850 97134 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902913.1 protein_id gnl|my_center|LOCUS_01000 97209 97730 gene locus_tag LOCUS_01010 97209 97730 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403040.1 protein_id gnl|my_center|LOCUS_01010 97931 98206 gene locus_tag LOCUS_01020 97931 98206 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_01020 98262 98564 gene locus_tag LOCUS_01030 98262 98564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 99036 100004 gene locus_tag LOCUS_01040 99036 100004 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_01040 100078 100257 gene locus_tag LOCUS_01050 100078 100257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902914.1 protein_id gnl|my_center|LOCUS_01050 100662 100258 gene locus_tag LOCUS_01060 100662 100258 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902915.1 protein_id gnl|my_center|LOCUS_01060 101912 101169 gene locus_tag LOCUS_01070 gene thyX 101912 101169 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289309.1 protein_id gnl|my_center|LOCUS_01070 102654 101995 gene locus_tag LOCUS_01080 102654 101995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902413.1 protein_id gnl|my_center|LOCUS_01080 103249 102665 gene locus_tag LOCUS_01090 103249 102665 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903498.1 protein_id gnl|my_center|LOCUS_01090 103372 103947 gene locus_tag LOCUS_01100 103372 103947 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902963.1 protein_id gnl|my_center|LOCUS_01100 104793 103969 gene locus_tag LOCUS_01110 104793 103969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 105113 104790 gene locus_tag LOCUS_01120 105113 104790 CDS product DUF5827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902964.1 protein_id gnl|my_center|LOCUS_01120 105141 106886 gene locus_tag LOCUS_01130 105141 106886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 106928 109087 gene locus_tag LOCUS_01140 106928 109087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 109196 109585 gene locus_tag LOCUS_01150 109196 109585 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902944.1 protein_id gnl|my_center|LOCUS_01150 111741 109588 gene locus_tag LOCUS_01160 111741 109588 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289305.1 protein_id gnl|my_center|LOCUS_01160 112059 111796 gene locus_tag LOCUS_01170 112059 111796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 112205 113557 gene locus_tag LOCUS_01180 gene purD 112205 113557 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902946.1 protein_id gnl|my_center|LOCUS_01180 113712 114131 gene locus_tag LOCUS_01190 113712 114131 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903007.1 protein_id gnl|my_center|LOCUS_01190 114932 114138 gene locus_tag LOCUS_01200 114932 114138 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903009.1 protein_id gnl|my_center|LOCUS_01200 115744 114935 gene locus_tag LOCUS_01210 gene dacZ 115744 114935 CDS product diadenylate cyclase DacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903010.1 protein_id gnl|my_center|LOCUS_01210 116932 115817 gene locus_tag LOCUS_01220 116932 115817 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289356.1 protein_id gnl|my_center|LOCUS_01220 118179 117139 gene locus_tag LOCUS_01230 118179 117139 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289355.1 protein_id gnl|my_center|LOCUS_01230 118266 118490 gene locus_tag LOCUS_01240 118266 118490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 119168 119494 gene locus_tag LOCUS_01250 119168 119494 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289310.1 protein_id gnl|my_center|LOCUS_01250 121359 119533 gene locus_tag LOCUS_01260 121359 119533 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902947.1 protein_id gnl|my_center|LOCUS_01260 121607 122956 gene locus_tag LOCUS_01270 121607 122956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 123314 123027 gene locus_tag LOCUS_01280 123314 123027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 124213 123374 gene locus_tag LOCUS_01290 124213 123374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903774.1 protein_id gnl|my_center|LOCUS_01290 125346 124459 gene locus_tag LOCUS_01300 125346 124459 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902948.1 protein_id gnl|my_center|LOCUS_01300 125715 125350 gene locus_tag LOCUS_01310 125715 125350 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902949.1 protein_id gnl|my_center|LOCUS_01310 126134 125715 gene locus_tag LOCUS_01320 gene sdhC 126134 125715 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289306.1 protein_id gnl|my_center|LOCUS_01320 127256 126234 gene locus_tag LOCUS_01330 127256 126234 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227959.1 protein_id gnl|my_center|LOCUS_01330 127370 128722 gene locus_tag LOCUS_01340 127370 128722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 129364 128753 gene locus_tag LOCUS_01350 129364 128753 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902951.1 protein_id gnl|my_center|LOCUS_01350 129967 129410 gene locus_tag LOCUS_01360 gene cysE 129967 129410 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_01360 131390 130233 gene locus_tag LOCUS_01370 131390 130233 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_01370 131504 133468 gene locus_tag LOCUS_01380 131504 133468 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_01380 133624 133699 gene locus_tag LOCUS_t00010 133624 133699 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 135175 133787 gene locus_tag LOCUS_01390 135175 133787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 135490 136728 gene locus_tag LOCUS_01400 135490 136728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 136829 138010 gene locus_tag LOCUS_01410 136829 138010 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901949.1 protein_id gnl|my_center|LOCUS_01410 138149 138328 gene locus_tag LOCUS_01420 138149 138328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 138642 138433 gene locus_tag LOCUS_01430 138642 138433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 138806 140788 gene locus_tag LOCUS_01440 138806 140788 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903521.1 protein_id gnl|my_center|LOCUS_01440 141204 140812 gene locus_tag LOCUS_01450 141204 140812 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868534.1 protein_id gnl|my_center|LOCUS_01450 143375 141336 gene locus_tag LOCUS_01460 143375 141336 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902517.1 protein_id gnl|my_center|LOCUS_01460 144688 143372 gene locus_tag LOCUS_01470 144688 143372 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902518.1 protein_id gnl|my_center|LOCUS_01470 146961 144679 gene locus_tag LOCUS_01480 146961 144679 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902519.1 protein_id gnl|my_center|LOCUS_01480 149033 146961 gene locus_tag LOCUS_01490 149033 146961 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902520.1 protein_id gnl|my_center|LOCUS_01490 149645 150022 gene locus_tag LOCUS_01500 149645 150022 CDS product DUF5820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903019.1 protein_id gnl|my_center|LOCUS_01500 150055 150507 gene locus_tag LOCUS_01510 150055 150507 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903018.1 protein_id gnl|my_center|LOCUS_01510 152038 150872 gene locus_tag LOCUS_01520 152038 150872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 152386 153414 gene locus_tag LOCUS_01530 152386 153414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 153425 154570 gene locus_tag LOCUS_01540 153425 154570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 155772 156218 gene locus_tag LOCUS_01550 155772 156218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 157506 156358 gene locus_tag LOCUS_01560 157506 156358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 158558 159880 gene locus_tag LOCUS_01570 158558 159880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 161331 159907 gene locus_tag LOCUS_01580 161331 159907 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902756.1 protein_id gnl|my_center|LOCUS_01580 161864 162379 gene locus_tag LOCUS_01590 161864 162379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 162711 163451 gene locus_tag LOCUS_01600 162711 163451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 164071 163505 gene locus_tag LOCUS_01610 164071 163505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 164307 164567 gene locus_tag LOCUS_01620 164307 164567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 165755 164589 gene locus_tag LOCUS_01630 165755 164589 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724359.1 protein_id gnl|my_center|LOCUS_01630 165666 165890 gene locus_tag LOCUS_01640 165666 165890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 166125 166484 gene locus_tag LOCUS_01650 166125 166484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 167320 166532 gene locus_tag LOCUS_01660 167320 166532 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405419.1 protein_id gnl|my_center|LOCUS_01660 167848 167366 gene locus_tag LOCUS_01670 167848 167366 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903017.1 protein_id gnl|my_center|LOCUS_01670 168046 168132 gene locus_tag LOCUS_t00020 168046 168132 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 168858 170174 gene locus_tag LOCUS_01680 168858 170174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 170629 172059 gene locus_tag LOCUS_01690 170629 172059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 172968 172549 gene locus_tag LOCUS_01700 172968 172549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 174186 173173 gene locus_tag LOCUS_01710 174186 173173 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_01710 174315 176474 gene locus_tag LOCUS_01720 174315 176474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 176668 178356 gene locus_tag LOCUS_01730 176668 178356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 178454 179155 gene locus_tag LOCUS_01740 178454 179155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_01740 179163 182228 gene locus_tag LOCUS_01750 179163 182228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 182318 182593 gene locus_tag LOCUS_01760 182318 182593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 182593 183687 gene locus_tag LOCUS_01770 182593 183687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 183680 184690 gene locus_tag LOCUS_01780 183680 184690 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_01780 185661 184705 gene locus_tag LOCUS_01790 185661 184705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 186161 185658 gene locus_tag LOCUS_01800 186161 185658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 187603 186158 gene locus_tag LOCUS_01810 187603 186158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 187894 188817 gene locus_tag LOCUS_01820 187894 188817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 190060 188846 gene locus_tag LOCUS_01830 190060 188846 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_01830 190958 191158 gene locus_tag LOCUS_01840 190958 191158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 191231 192064 gene locus_tag LOCUS_01850 191231 192064 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903001.1 protein_id gnl|my_center|LOCUS_01850 192173 193321 gene locus_tag LOCUS_01860 192173 193321 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903025.1 protein_id gnl|my_center|LOCUS_01860 195079 193370 gene locus_tag LOCUS_01870 195079 193370 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892506.1 protein_id gnl|my_center|LOCUS_01870 195929 195111 gene locus_tag LOCUS_01880 195929 195111 CDS product DUF5821 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289323.1 protein_id gnl|my_center|LOCUS_01880 198393 196306 gene locus_tag LOCUS_01890 198393 196306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289324.1 protein_id gnl|my_center|LOCUS_01890 198548 199795 gene locus_tag LOCUS_01900 198548 199795 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289325.1 protein_id gnl|my_center|LOCUS_01900 199902 200468 gene locus_tag LOCUS_01910 199902 200468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 200544 201437 gene locus_tag LOCUS_01920 200544 201437 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903030.1 protein_id gnl|my_center|LOCUS_01920 201438 201920 gene locus_tag LOCUS_01930 201438 201920 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110618.1 protein_id gnl|my_center|LOCUS_01930 202644 201925 gene locus_tag LOCUS_01940 202644 201925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289326.1 protein_id gnl|my_center|LOCUS_01940 202704 202850 gene locus_tag LOCUS_01950 202704 202850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 203293 203099 gene locus_tag LOCUS_01960 203293 203099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 203570 203845 gene locus_tag LOCUS_01970 203570 203845 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890479.1 protein_id gnl|my_center|LOCUS_01970 203969 205243 gene locus_tag LOCUS_01980 203969 205243 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361690.1 protein_id gnl|my_center|LOCUS_01980 205566 205240 gene locus_tag LOCUS_01990 205566 205240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289346.1 protein_id gnl|my_center|LOCUS_01990 205686 207590 gene locus_tag LOCUS_02000 205686 207590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 207712 208647 gene locus_tag LOCUS_02010 207712 208647 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903108.1 protein_id gnl|my_center|LOCUS_02010 208695 209702 gene locus_tag LOCUS_02020 208695 209702 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903678.1 protein_id gnl|my_center|LOCUS_02020 210310 209771 gene locus_tag LOCUS_02030 210310 209771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 210559 211005 gene locus_tag LOCUS_02040 gene mamA 210559 211005 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903701.1 protein_id gnl|my_center|LOCUS_02040 211133 211303 gene locus_tag LOCUS_02050 211133 211303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 211413 211991 gene locus_tag LOCUS_02060 211413 211991 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_02060 212072 212776 gene locus_tag LOCUS_02070 212072 212776 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903104.1 protein_id gnl|my_center|LOCUS_02070 212803 213066 gene locus_tag LOCUS_02080 212803 213066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289345.1 protein_id gnl|my_center|LOCUS_02080 213131 215311 gene locus_tag LOCUS_02090 213131 215311 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289344.1 protein_id gnl|my_center|LOCUS_02090 215352 215840 gene locus_tag LOCUS_02100 215352 215840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 217736 215844 gene locus_tag LOCUS_02110 gene htr8 217736 215844 CDS product chemotaxis signal transducer protein Htr8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903109.1 protein_id gnl|my_center|LOCUS_02110 218127 219782 gene locus_tag LOCUS_02120 218127 219782 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903101.1 protein_id gnl|my_center|LOCUS_02120 220140 223187 gene locus_tag LOCUS_02130 220140 223187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 223297 224451 gene locus_tag LOCUS_02140 223297 224451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 224523 225557 gene locus_tag LOCUS_02150 224523 225557 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902422.1 protein_id gnl|my_center|LOCUS_02150 225594 227747 gene locus_tag LOCUS_02160 gene rqcH 225594 227747 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903100.1 protein_id gnl|my_center|LOCUS_02160 227793 228821 gene locus_tag LOCUS_02170 227793 228821 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289639.1 protein_id gnl|my_center|LOCUS_02170 228972 229673 gene locus_tag LOCUS_02180 228972 229673 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_02180 229759 230826 gene locus_tag LOCUS_02190 229759 230826 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903099.1 protein_id gnl|my_center|LOCUS_02190 230946 232103 gene locus_tag LOCUS_02200 230946 232103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 232852 232100 gene locus_tag LOCUS_02210 232852 232100 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903097.1 protein_id gnl|my_center|LOCUS_02210 233136 233750 gene locus_tag LOCUS_02220 233136 233750 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902927.1 protein_id gnl|my_center|LOCUS_02220 234589 233774 gene locus_tag LOCUS_02230 234589 233774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 235535 234660 gene locus_tag LOCUS_02240 gene dapA 235535 234660 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642619.1 protein_id gnl|my_center|LOCUS_02240 235633 238383 gene locus_tag LOCUS_02250 235633 238383 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_02250 238476 239114 gene locus_tag LOCUS_02260 238476 239114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 240255 239188 gene locus_tag LOCUS_02270 240255 239188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 240397 240858 gene locus_tag LOCUS_02280 240397 240858 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_02280 240855 242540 gene locus_tag LOCUS_02290 240855 242540 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902982.1 protein_id gnl|my_center|LOCUS_02290 245276 242541 gene locus_tag LOCUS_02300 245276 242541 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289343.1 protein_id gnl|my_center|LOCUS_02300 245741 245346 gene locus_tag LOCUS_02310 245741 245346 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404838.1 protein_id gnl|my_center|LOCUS_02310 247034 245793 gene locus_tag LOCUS_02320 247034 245793 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_02320 248539 247112 gene locus_tag LOCUS_02330 248539 247112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 249871 248540 gene locus_tag LOCUS_02340 249871 248540 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_02340 250797 249871 gene locus_tag LOCUS_02350 250797 249871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 252518 250794 gene locus_tag LOCUS_02360 252518 250794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 252618 252950 gene locus_tag LOCUS_02370 252618 252950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 253242 253787 gene locus_tag LOCUS_02380 253242 253787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289342.1 protein_id gnl|my_center|LOCUS_02380 253828 254163 gene locus_tag LOCUS_02390 253828 254163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 254387 254160 gene locus_tag LOCUS_02400 254387 254160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 254462 255811 gene locus_tag LOCUS_02410 254462 255811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_02410 255881 256567 gene locus_tag LOCUS_02420 255881 256567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 256610 258397 gene locus_tag LOCUS_02430 256610 258397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 259450 258428 gene locus_tag LOCUS_02440 259450 258428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 260304 259447 gene locus_tag LOCUS_02450 260304 259447 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_02450 260683 260297 gene locus_tag LOCUS_02460 260683 260297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 261360 260686 gene locus_tag LOCUS_02470 261360 260686 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393713.1 protein_id gnl|my_center|LOCUS_02470 261635 262057 gene locus_tag LOCUS_02480 261635 262057 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902462.1 protein_id gnl|my_center|LOCUS_02480 262054 263112 gene locus_tag LOCUS_02490 gene meaB 262054 263112 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902463.1 protein_id gnl|my_center|LOCUS_02490 263220 264161 gene locus_tag LOCUS_02500 263220 264161 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289638.1 protein_id gnl|my_center|LOCUS_02500 264551 264165 gene locus_tag LOCUS_02510 264551 264165 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902465.1 protein_id gnl|my_center|LOCUS_02510 265714 264548 gene locus_tag LOCUS_02520 265714 264548 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902466.1 protein_id gnl|my_center|LOCUS_02520 266067 265870 gene locus_tag LOCUS_02530 266067 265870 CDS product DUF5800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902336.1 protein_id gnl|my_center|LOCUS_02530 266811 266173 gene locus_tag LOCUS_02540 266811 266173 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902287.1 protein_id gnl|my_center|LOCUS_02540 268017 267142 gene locus_tag LOCUS_02550 268017 267142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 268077 269066 gene locus_tag LOCUS_02560 268077 269066 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028671.1 protein_id gnl|my_center|LOCUS_02560 269127 270203 gene locus_tag LOCUS_02570 269127 270203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 270436 271965 gene locus_tag LOCUS_02580 270436 271965 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401256.1 protein_id gnl|my_center|LOCUS_02580 272044 273024 gene locus_tag LOCUS_02590 272044 273024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 273026 274027 gene locus_tag LOCUS_02600 273026 274027 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 protein_id gnl|my_center|LOCUS_02600 274032 275228 gene locus_tag LOCUS_02610 gene ugpC 274032 275228 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_02610 275230 275433 gene locus_tag LOCUS_02620 275230 275433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 275459 276535 gene locus_tag LOCUS_02630 275459 276535 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_02630 276576 277640 gene locus_tag LOCUS_02640 276576 277640 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902286.1 protein_id gnl|my_center|LOCUS_02640 277917 279293 gene locus_tag LOCUS_02650 277917 279293 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776637.1 protein_id gnl|my_center|LOCUS_02650 279473 280525 gene locus_tag LOCUS_02660 gene trmB 279473 280525 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_02660 280956 281732 gene locus_tag LOCUS_02670 280956 281732 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020906.1 protein_id gnl|my_center|LOCUS_02670 281782 282495 gene locus_tag LOCUS_02680 281782 282495 CDS product dolichyl-phosphate hexose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902647.1 protein_id gnl|my_center|LOCUS_02680 283107 282526 gene locus_tag LOCUS_02690 283107 282526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 285123 283117 gene locus_tag LOCUS_02700 285123 283117 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902648.1 protein_id gnl|my_center|LOCUS_02700 286250 285120 gene locus_tag LOCUS_02710 286250 285120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_02710 287905 286250 gene locus_tag LOCUS_02720 287905 286250 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_02720 289064 287874 gene locus_tag LOCUS_02730 289064 287874 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902651.1 protein_id gnl|my_center|LOCUS_02730 290265 289102 gene locus_tag LOCUS_02740 290265 289102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289248.1 protein_id gnl|my_center|LOCUS_02740 290484 291227 gene locus_tag LOCUS_02750 gene fabG 290484 291227 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_02750 291229 292812 gene locus_tag LOCUS_02760 291229 292812 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_02760 292814 293125 gene locus_tag LOCUS_02770 292814 293125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 293307 293122 gene locus_tag LOCUS_02780 293307 293122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 293451 294617 gene locus_tag LOCUS_02790 293451 294617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_02790 294624 295451 gene locus_tag LOCUS_02800 294624 295451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902139.1 protein_id gnl|my_center|LOCUS_02800 295516 296667 gene locus_tag LOCUS_02810 295516 296667 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_02810 296664 297044 gene locus_tag LOCUS_02820 296664 297044 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902658.1 protein_id gnl|my_center|LOCUS_02820 298151 297672 gene locus_tag LOCUS_02830 298151 297672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 298815 298231 gene locus_tag LOCUS_02840 298815 298231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 299791 299258 gene locus_tag LOCUS_02850 gene dpsA 299791 299258 CDS product DNA starvation/stationary phase protection protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903826.1 protein_id gnl|my_center|LOCUS_02850 300359 299970 gene locus_tag LOCUS_02860 300359 299970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 300511 302598 gene locus_tag LOCUS_02870 300511 302598 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902665.1 protein_id gnl|my_center|LOCUS_02870 302595 303671 gene locus_tag LOCUS_02880 302595 303671 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902666.1 protein_id gnl|my_center|LOCUS_02880 304610 303870 gene locus_tag LOCUS_02890 gene bioD 304610 303870 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012476.1 protein_id gnl|my_center|LOCUS_02890 305809 304607 gene locus_tag LOCUS_02900 gene bioF 305809 304607 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968008.1 protein_id gnl|my_center|LOCUS_02900 306937 305831 gene locus_tag LOCUS_02910 306937 305831 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_02910 308055 306940 gene locus_tag LOCUS_02920 gene bioB 308055 306940 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_02920 308161 308976 gene locus_tag LOCUS_02930 308161 308976 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902453.1 protein_id gnl|my_center|LOCUS_02930 309525 309001 gene locus_tag LOCUS_02940 309525 309001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 311811 309529 gene locus_tag LOCUS_02950 311811 309529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 311989 312711 gene locus_tag LOCUS_02960 gene coxB 311989 312711 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902455.1 protein_id gnl|my_center|LOCUS_02960 313543 312734 gene locus_tag LOCUS_02970 gene panB 313543 312734 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903078.1 protein_id gnl|my_center|LOCUS_02970 313641 313868 gene locus_tag LOCUS_02980 313641 313868 CDS product DUF5822 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289339.1 protein_id gnl|my_center|LOCUS_02980 314416 313847 gene locus_tag LOCUS_02990 314416 313847 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289340.1 protein_id gnl|my_center|LOCUS_02990 315565 314438 gene locus_tag LOCUS_03000 315565 314438 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903082.1 protein_id gnl|my_center|LOCUS_03000 316107 315604 gene locus_tag LOCUS_03010 316107 315604 CDS product multiprotein-bridging factor 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903083.1 protein_id gnl|my_center|LOCUS_03010 316239 316324 gene locus_tag LOCUS_t00030 316239 316324 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 316807 316460 gene locus_tag LOCUS_03020 316807 316460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 317331 316957 gene locus_tag LOCUS_03030 317331 316957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 319178 318054 gene locus_tag LOCUS_03040 319178 318054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 319416 319331 gene locus_tag LOCUS_t00040 319416 319331 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 319503 319811 gene locus_tag LOCUS_03050 319503 319811 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903011.1 protein_id gnl|my_center|LOCUS_03050 320300 319812 gene locus_tag LOCUS_03060 320300 319812 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903012.1 protein_id gnl|my_center|LOCUS_03060 320934 320371 gene locus_tag LOCUS_03070 320934 320371 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903013.1 protein_id gnl|my_center|LOCUS_03070 322126 321047 gene locus_tag LOCUS_03080 322126 321047 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903015.1 protein_id gnl|my_center|LOCUS_03080 322867 322235 gene locus_tag LOCUS_03090 322867 322235 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902848.1 protein_id gnl|my_center|LOCUS_03090 323703 322864 gene locus_tag LOCUS_03100 323703 322864 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902847.1 protein_id gnl|my_center|LOCUS_03100 324571 323789 gene locus_tag LOCUS_03110 324571 323789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 325252 324581 gene locus_tag LOCUS_03120 325252 324581 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902528.1 protein_id gnl|my_center|LOCUS_03120 325782 325252 gene locus_tag LOCUS_03130 325782 325252 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289219.1 protein_id gnl|my_center|LOCUS_03130 326256 325978 gene locus_tag LOCUS_03140 326256 325978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 326885 326328 gene locus_tag LOCUS_03150 326885 326328 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_03150 328234 326882 gene locus_tag LOCUS_03160 328234 326882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 328832 328290 gene locus_tag LOCUS_03170 328832 328290 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289218.1 protein_id gnl|my_center|LOCUS_03170 329497 328829 gene locus_tag LOCUS_03180 329497 328829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 329597 330541 gene locus_tag LOCUS_03190 329597 330541 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902523.1 protein_id gnl|my_center|LOCUS_03190 331005 330550 gene locus_tag LOCUS_03200 331005 330550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 331054 331836 gene locus_tag LOCUS_03210 331054 331836 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289189.1 protein_id gnl|my_center|LOCUS_03210 331914 332927 gene locus_tag LOCUS_03220 331914 332927 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903207.1 protein_id gnl|my_center|LOCUS_03220 332920 333222 gene locus_tag LOCUS_03230 332920 333222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 333374 334363 gene locus_tag LOCUS_03240 333374 334363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 334430 334864 gene locus_tag LOCUS_03250 334430 334864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902404.1 protein_id gnl|my_center|LOCUS_03250 337259 335013 gene locus_tag LOCUS_03260 337259 335013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 339040 337421 gene locus_tag LOCUS_03270 339040 337421 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 protein_id gnl|my_center|LOCUS_03270 339175 340134 gene locus_tag LOCUS_03280 339175 340134 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_03280 340131 341177 gene locus_tag LOCUS_03290 340131 341177 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289275.1 protein_id gnl|my_center|LOCUS_03290 341170 342693 gene locus_tag LOCUS_03300 341170 342693 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902770.1 protein_id gnl|my_center|LOCUS_03300 342748 343485 gene locus_tag LOCUS_03310 342748 343485 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_03310 343513 343863 gene locus_tag LOCUS_03320 343513 343863 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902769.1 protein_id gnl|my_center|LOCUS_03320 344802 343885 gene locus_tag LOCUS_03330 344802 343885 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902774.1 protein_id gnl|my_center|LOCUS_03330 344922 345194 gene locus_tag LOCUS_03340 344922 345194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 345253 346206 gene locus_tag LOCUS_03350 345253 346206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 347989 346211 gene locus_tag LOCUS_03360 gene menD 347989 346211 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902775.1 protein_id gnl|my_center|LOCUS_03360 349323 347986 gene locus_tag LOCUS_03370 349323 347986 CDS product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902776.1 protein_id gnl|my_center|LOCUS_03370 349592 349807 gene locus_tag LOCUS_03380 349592 349807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902778.1 protein_id gnl|my_center|LOCUS_03380 349852 350160 gene locus_tag LOCUS_03390 349852 350160 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902779.1 protein_id gnl|my_center|LOCUS_03390 350739 350221 gene locus_tag LOCUS_03400 350739 350221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 351745 350888 gene locus_tag LOCUS_03410 351745 350888 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_03410 351789 353186 gene locus_tag LOCUS_03420 351789 353186 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289312.1 protein_id gnl|my_center|LOCUS_03420 353369 353980 gene locus_tag LOCUS_03430 gene sod 353369 353980 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902966.1 protein_id gnl|my_center|LOCUS_03430 354314 355546 gene locus_tag LOCUS_03440 354314 355546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 356330 355575 gene locus_tag LOCUS_03450 356330 355575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_03450 357157 356327 gene locus_tag LOCUS_03460 357157 356327 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_03460 358433 357150 gene locus_tag LOCUS_03470 358433 357150 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_03470 359545 358430 gene locus_tag LOCUS_03480 359545 358430 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_03480 359893 361080 gene locus_tag LOCUS_03490 359893 361080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_03490 361210 361284 gene locus_tag LOCUS_t00050 361210 361284 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 361365 362060 gene locus_tag LOCUS_03500 361365 362060 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_03500 362257 363327 gene locus_tag LOCUS_03510 362257 363327 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902533.1 protein_id gnl|my_center|LOCUS_03510 363426 364460 gene locus_tag LOCUS_03520 363426 364460 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902535.1 protein_id gnl|my_center|LOCUS_03520 364577 364834 gene locus_tag LOCUS_03530 364577 364834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 366023 364857 gene locus_tag LOCUS_03540 366023 364857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 366126 366356 gene locus_tag LOCUS_03550 366126 366356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 366420 366647 gene locus_tag LOCUS_03560 366420 366647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902537.1 protein_id gnl|my_center|LOCUS_03560 366715 367146 gene locus_tag LOCUS_03570 366715 367146 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902538.1 protein_id gnl|my_center|LOCUS_03570 367143 367961 gene locus_tag LOCUS_03580 367143 367961 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_03580 368040 369053 gene locus_tag LOCUS_03590 368040 369053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 371446 369329 gene locus_tag LOCUS_03600 371446 369329 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904077.1 protein_id gnl|my_center|LOCUS_03600 371532 371666 gene locus_tag LOCUS_03610 371532 371666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 372134 371709 gene locus_tag LOCUS_03620 372134 371709 CDS product DUF5796 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902902.1 protein_id gnl|my_center|LOCUS_03620 372258 373802 gene locus_tag LOCUS_03630 372258 373802 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_03630 373879 374409 gene locus_tag LOCUS_03640 373879 374409 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_03640 375396 374446 gene locus_tag LOCUS_03650 375396 374446 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903094.1 protein_id gnl|my_center|LOCUS_03650 375759 375481 gene locus_tag LOCUS_03660 375759 375481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 375873 376931 gene locus_tag LOCUS_03670 375873 376931 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903093.1 protein_id gnl|my_center|LOCUS_03670 377003 377185 gene locus_tag LOCUS_03680 377003 377185 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289341.1 protein_id gnl|my_center|LOCUS_03680 377370 378812 gene locus_tag LOCUS_03690 gene purF 377370 378812 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903090.1 protein_id gnl|my_center|LOCUS_03690 378869 379429 gene locus_tag LOCUS_03700 378869 379429 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903528.1 protein_id gnl|my_center|LOCUS_03700 379992 379432 gene locus_tag LOCUS_03710 379992 379432 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903089.1 protein_id gnl|my_center|LOCUS_03710 381589 380054 gene locus_tag LOCUS_03720 381589 380054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 381722 382471 gene locus_tag LOCUS_03730 381722 382471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 384802 382529 gene locus_tag LOCUS_03740 384802 382529 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903073.1 protein_id gnl|my_center|LOCUS_03740 385047 384802 gene locus_tag LOCUS_03750 385047 384802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 385195 385971 gene locus_tag LOCUS_03760 385195 385971 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289338.1 protein_id gnl|my_center|LOCUS_03760 386679 385993 gene locus_tag LOCUS_03770 386679 385993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 387447 386752 gene locus_tag LOCUS_03780 387447 386752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 387935 387639 gene locus_tag LOCUS_03790 387935 387639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 388504 387950 gene locus_tag LOCUS_03800 388504 387950 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903802.1 protein_id gnl|my_center|LOCUS_03800 388697 390160 gene locus_tag LOCUS_03810 388697 390160 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_03810 390216 390632 gene locus_tag LOCUS_03820 390216 390632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 391787 390648 gene locus_tag LOCUS_03830 391787 390648 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902541.1 protein_id gnl|my_center|LOCUS_03830 391870 392664 gene locus_tag LOCUS_03840 391870 392664 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289221.1 protein_id gnl|my_center|LOCUS_03840 393584 392682 gene locus_tag LOCUS_03850 393584 392682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_03850 394220 393735 gene locus_tag LOCUS_03860 394220 393735 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902805.1 protein_id gnl|my_center|LOCUS_03860 395540 394284 gene locus_tag LOCUS_03870 gene gdhA1 395540 394284 CDS product NADP-specific glutamate dehydrogenase GdhA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289198.1 protein_id gnl|my_center|LOCUS_03870 396113 395730 gene locus_tag LOCUS_03880 396113 395730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 396331 398361 gene locus_tag LOCUS_03890 396331 398361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 399255 398380 gene locus_tag LOCUS_03900 399255 398380 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089826111.1 protein_id gnl|my_center|LOCUS_03900 399524 400381 gene locus_tag LOCUS_03910 399524 400381 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902470.1 protein_id gnl|my_center|LOCUS_03910 400487 401635 gene locus_tag LOCUS_03920 400487 401635 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289209.1 protein_id gnl|my_center|LOCUS_03920 401886 401632 gene locus_tag LOCUS_03930 401886 401632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 402265 401975 gene locus_tag LOCUS_03940 402265 401975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 402353 402640 gene locus_tag LOCUS_03950 402353 402640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902467.1 protein_id gnl|my_center|LOCUS_03950 402922 405045 gene locus_tag LOCUS_03960 402922 405045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 405109 405531 gene locus_tag LOCUS_03970 405109 405531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 405741 407276 gene locus_tag LOCUS_03980 405741 407276 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404995.1 protein_id gnl|my_center|LOCUS_03980 407350 407706 gene locus_tag LOCUS_03990 407350 407706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 409423 407729 gene locus_tag LOCUS_04000 409423 407729 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903259.1 protein_id gnl|my_center|LOCUS_04000 410108 409425 gene locus_tag LOCUS_04010 410108 409425 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_04010 410233 410367 gene locus_tag LOCUS_04020 410233 410367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 410827 410390 gene locus_tag LOCUS_04030 410827 410390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 410969 411847 gene locus_tag LOCUS_04040 410969 411847 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902901.1 protein_id gnl|my_center|LOCUS_04040 411844 412137 gene locus_tag LOCUS_04050 411844 412137 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902900.1 protein_id gnl|my_center|LOCUS_04050 412200 412685 gene locus_tag LOCUS_04060 412200 412685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 413424 412888 gene locus_tag LOCUS_04070 413424 412888 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892495.1 protein_id gnl|my_center|LOCUS_04070 414232 414005 gene locus_tag LOCUS_04080 414232 414005 CDS product DUF5795 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902716.1 protein_id gnl|my_center|LOCUS_04080 415161 414274 gene locus_tag LOCUS_04090 415161 414274 CDS product DUF5794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902715.1 protein_id gnl|my_center|LOCUS_04090 415575 417059 gene locus_tag LOCUS_04100 gene guaB 415575 417059 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289261.1 protein_id gnl|my_center|LOCUS_04100 417489 417265 gene locus_tag LOCUS_04110 417489 417265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 417538 418017 gene locus_tag LOCUS_04120 417538 418017 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283762.1 protein_id gnl|my_center|LOCUS_04120 418276 418201 gene locus_tag LOCUS_t00060 418276 418201 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 418532 419998 gene locus_tag LOCUS_04130 418532 419998 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902698.1 protein_id gnl|my_center|LOCUS_04130 420300 419995 gene locus_tag LOCUS_04140 420300 419995 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902697.1 protein_id gnl|my_center|LOCUS_04140 420498 420953 gene locus_tag LOCUS_04150 420498 420953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 421493 420954 gene locus_tag LOCUS_04160 421493 420954 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903528.1 protein_id gnl|my_center|LOCUS_04160 422055 421549 gene locus_tag LOCUS_04170 422055 421549 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903731.1 protein_id gnl|my_center|LOCUS_04170 422185 422868 gene locus_tag LOCUS_04180 gene nth 422185 422868 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902399.1 protein_id gnl|my_center|LOCUS_04180 423391 422885 gene locus_tag LOCUS_04190 423391 422885 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289494.1 protein_id gnl|my_center|LOCUS_04190 423964 423482 gene locus_tag LOCUS_04200 423964 423482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 424052 424957 gene locus_tag LOCUS_04210 424052 424957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902396.1 protein_id gnl|my_center|LOCUS_04210 425022 425678 gene locus_tag LOCUS_04220 425022 425678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 425678 426097 gene locus_tag LOCUS_04230 425678 426097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902394.1 protein_id gnl|my_center|LOCUS_04230 426099 426965 gene locus_tag LOCUS_04240 426099 426965 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902393.1 protein_id gnl|my_center|LOCUS_04240 426969 427772 gene locus_tag LOCUS_04250 426969 427772 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902392.1 protein_id gnl|my_center|LOCUS_04250 427777 428541 gene locus_tag LOCUS_04260 427777 428541 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902391.1 protein_id gnl|my_center|LOCUS_04260 428652 428951 gene locus_tag LOCUS_04270 428652 428951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902390.1 protein_id gnl|my_center|LOCUS_04270 428962 429231 gene locus_tag LOCUS_04280 428962 429231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 429445 429269 gene locus_tag LOCUS_04290 429445 429269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 430139 429678 gene locus_tag LOCUS_04300 430139 429678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902388.1 protein_id gnl|my_center|LOCUS_04300 430894 430181 gene locus_tag LOCUS_04310 430894 430181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 432185 430950 gene locus_tag LOCUS_04320 432185 430950 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902302.1 protein_id gnl|my_center|LOCUS_04320 432297 433466 gene locus_tag LOCUS_04330 432297 433466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 433535 434083 gene locus_tag LOCUS_04340 433535 434083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 434083 434565 gene locus_tag LOCUS_04350 434083 434565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 434651 434860 gene locus_tag LOCUS_04360 434651 434860 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 protein_id gnl|my_center|LOCUS_04360 436260 434890 gene locus_tag LOCUS_04370 436260 434890 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903279.1 protein_id gnl|my_center|LOCUS_04370 437145 436360 gene locus_tag LOCUS_04380 437145 436360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 438276 437413 gene locus_tag LOCUS_04390 438276 437413 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902307.1 protein_id gnl|my_center|LOCUS_04390 440102 438273 gene locus_tag LOCUS_04400 440102 438273 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902308.1 protein_id gnl|my_center|LOCUS_04400 440239 440874 gene locus_tag LOCUS_04410 440239 440874 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902309.1 protein_id gnl|my_center|LOCUS_04410 441811 440945 gene locus_tag LOCUS_04420 441811 440945 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839436.1 protein_id gnl|my_center|LOCUS_04420 441870 442250 gene locus_tag LOCUS_04430 441870 442250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 442704 442288 gene locus_tag LOCUS_04440 442704 442288 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902240.1 protein_id gnl|my_center|LOCUS_04440 443240 444493 gene locus_tag LOCUS_04450 443240 444493 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_04450 445440 444568 gene locus_tag LOCUS_04460 445440 444568 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902239.1 protein_id gnl|my_center|LOCUS_04460 446174 445425 gene locus_tag LOCUS_04470 446174 445425 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902238.1 protein_id gnl|my_center|LOCUS_04470 447640 446171 gene locus_tag LOCUS_04480 gene pabB 447640 446171 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902237.1 protein_id gnl|my_center|LOCUS_04480 448247 447711 gene locus_tag LOCUS_04490 448247 447711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 449173 448376 gene locus_tag LOCUS_04500 449173 448376 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902235.1 protein_id gnl|my_center|LOCUS_04500 449306 450667 gene locus_tag LOCUS_04510 449306 450667 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_04510 450667 452022 gene locus_tag LOCUS_04520 450667 452022 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892484.1 protein_id gnl|my_center|LOCUS_04520 452126 453286 gene locus_tag LOCUS_04530 gene ftsZ 452126 453286 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_04530 453469 454653 gene locus_tag LOCUS_04540 gene basB 453469 454653 CDS product chemotactic signal transduction system substrate-binding protein BasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903360.1 protein_id gnl|my_center|LOCUS_04540 454650 457103 gene locus_tag LOCUS_04550 gene basT 454650 457103 CDS product chemotaxis signal transducer protein BasT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289396.1 protein_id gnl|my_center|LOCUS_04550 457248 457427 gene locus_tag LOCUS_04560 457248 457427 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902231.1 protein_id gnl|my_center|LOCUS_04560 457432 457869 gene locus_tag LOCUS_04570 457432 457869 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902230.1 protein_id gnl|my_center|LOCUS_04570 458294 457995 gene locus_tag LOCUS_04580 458294 457995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289147.1 protein_id gnl|my_center|LOCUS_04580 458410 459171 gene locus_tag LOCUS_04590 458410 459171 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892483.1 protein_id gnl|my_center|LOCUS_04590 459674 459168 gene locus_tag LOCUS_04600 459674 459168 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289144.1 protein_id gnl|my_center|LOCUS_04600 460220 459711 gene locus_tag LOCUS_04610 460220 459711 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902226.1 protein_id gnl|my_center|LOCUS_04610 460298 460441 gene locus_tag LOCUS_04620 460298 460441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 460480 461598 gene locus_tag LOCUS_04630 460480 461598 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902330.1 protein_id gnl|my_center|LOCUS_04630 462654 461614 gene locus_tag LOCUS_04640 462654 461614 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228893.1 protein_id gnl|my_center|LOCUS_04640 463727 462651 gene locus_tag LOCUS_04650 463727 462651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 464988 463720 gene locus_tag LOCUS_04660 464988 463720 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903703.1 protein_id gnl|my_center|LOCUS_04660 466441 464978 gene locus_tag LOCUS_04670 466441 464978 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903702.1 protein_id gnl|my_center|LOCUS_04670 466899 466444 gene locus_tag LOCUS_04680 gene mamA 466899 466444 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903701.1 protein_id gnl|my_center|LOCUS_04680 467006 468196 gene locus_tag LOCUS_04690 467006 468196 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063669.1 protein_id gnl|my_center|LOCUS_04690 468267 468707 gene locus_tag LOCUS_04700 468267 468707 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890442.1 protein_id gnl|my_center|LOCUS_04700 468910 469470 gene locus_tag LOCUS_04710 468910 469470 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_04710 469611 472058 gene locus_tag LOCUS_04720 469611 472058 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903005.1 protein_id gnl|my_center|LOCUS_04720 472347 473435 gene locus_tag LOCUS_04730 472347 473435 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902224.1 protein_id gnl|my_center|LOCUS_04730 474278 473454 gene locus_tag LOCUS_04740 474278 473454 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_04740 475140 474334 gene locus_tag LOCUS_04750 475140 474334 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902222.1 protein_id gnl|my_center|LOCUS_04750 476075 475143 gene locus_tag LOCUS_04760 476075 475143 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902221.1 protein_id gnl|my_center|LOCUS_04760 477149 476205 gene locus_tag LOCUS_04770 477149 476205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 479823 477739 gene locus_tag LOCUS_04780 479823 477739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903117.1 protein_id gnl|my_center|LOCUS_04780 480050 480502 gene locus_tag LOCUS_04790 480050 480502 CDS product DUF5788 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289143.1 protein_id gnl|my_center|LOCUS_04790 480504 482240 gene locus_tag LOCUS_04800 480504 482240 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876189.1 protein_id gnl|my_center|LOCUS_04800 482233 482697 gene locus_tag LOCUS_04810 482233 482697 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_04810 483741 482722 gene locus_tag LOCUS_04820 483741 482722 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902315.1 protein_id gnl|my_center|LOCUS_04820 483800 484555 gene locus_tag LOCUS_04830 483800 484555 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_04830 484555 485790 gene locus_tag LOCUS_04840 484555 485790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_04840 485843 486322 gene locus_tag LOCUS_04850 485843 486322 CDS product DUF5797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902272.1 protein_id gnl|my_center|LOCUS_04850 487392 486346 gene locus_tag LOCUS_04860 487392 486346 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289155.1 protein_id gnl|my_center|LOCUS_04860 488125 487433 gene locus_tag LOCUS_04870 488125 487433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 488885 488457 gene locus_tag LOCUS_04880 488885 488457 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902274.1 protein_id gnl|my_center|LOCUS_04880 488981 489313 gene locus_tag LOCUS_04890 488981 489313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 489359 490648 gene locus_tag LOCUS_04900 489359 490648 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902278.1 protein_id gnl|my_center|LOCUS_04900 491043 490654 gene locus_tag LOCUS_04910 491043 490654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 492767 491349 gene locus_tag LOCUS_04920 492767 491349 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902279.1 protein_id gnl|my_center|LOCUS_04920 492916 493275 gene locus_tag LOCUS_04930 492916 493275 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902280.1 protein_id gnl|my_center|LOCUS_04930 493470 494072 gene locus_tag LOCUS_04940 493470 494072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 494770 494153 gene locus_tag LOCUS_04950 494770 494153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 494907 495884 gene locus_tag LOCUS_04960 494907 495884 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902295.1 protein_id gnl|my_center|LOCUS_04960 496575 497765 gene locus_tag LOCUS_04970 496575 497765 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903808.1 protein_id gnl|my_center|LOCUS_04970 499787 497766 gene locus_tag LOCUS_04980 499787 497766 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_04980 500801 499932 gene locus_tag LOCUS_04990 500801 499932 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227748.1 protein_id gnl|my_center|LOCUS_04990 501047 502396 gene locus_tag LOCUS_05000 501047 502396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 502406 503350 gene locus_tag LOCUS_05010 502406 503350 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 protein_id gnl|my_center|LOCUS_05010 503350 504498 gene locus_tag LOCUS_05020 503350 504498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 504500 505255 gene locus_tag LOCUS_05030 504500 505255 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 protein_id gnl|my_center|LOCUS_05030 505248 505985 gene locus_tag LOCUS_05040 505248 505985 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545450.1 protein_id gnl|my_center|LOCUS_05040 506715 506011 gene locus_tag LOCUS_05050 506715 506011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 506823 507407 gene locus_tag LOCUS_05060 506823 507407 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902314.1 protein_id gnl|my_center|LOCUS_05060 507900 507427 gene locus_tag LOCUS_05070 507900 507427 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250801.1 protein_id gnl|my_center|LOCUS_05070 508029 509711 gene locus_tag LOCUS_05080 508029 509711 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289163.1 protein_id gnl|my_center|LOCUS_05080 509794 510183 gene locus_tag LOCUS_05090 gene mce 509794 510183 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289162.1 protein_id gnl|my_center|LOCUS_05090 510854 510207 gene locus_tag LOCUS_05100 510854 510207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 510939 511907 gene locus_tag LOCUS_05110 510939 511907 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289150.1 protein_id gnl|my_center|LOCUS_05110 512655 511936 gene locus_tag LOCUS_05120 512655 511936 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902243.1 protein_id gnl|my_center|LOCUS_05120 513812 512691 gene locus_tag LOCUS_05130 513812 512691 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902244.1 protein_id gnl|my_center|LOCUS_05130 514848 513853 gene locus_tag LOCUS_05140 514848 513853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 515585 514848 gene locus_tag LOCUS_05150 515585 514848 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902328.1 protein_id gnl|my_center|LOCUS_05150 515673 516584 gene locus_tag LOCUS_05160 515673 516584 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902327.1 protein_id gnl|my_center|LOCUS_05160 516581 517081 gene locus_tag LOCUS_05170 516581 517081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902326.1 protein_id gnl|my_center|LOCUS_05170 518818 517115 gene locus_tag LOCUS_05180 gene msbA 518818 517115 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419544.1 protein_id gnl|my_center|LOCUS_05180 519072 519368 gene locus_tag LOCUS_05190 519072 519368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 519349 519786 gene locus_tag LOCUS_05200 519349 519786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 520211 521482 gene locus_tag LOCUS_05210 520211 521482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 521577 521648 gene locus_tag LOCUS_t00070 521577 521648 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 521818 522372 gene locus_tag LOCUS_05220 521818 522372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 522512 522967 gene locus_tag LOCUS_05230 522512 522967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 522960 523202 gene locus_tag LOCUS_05240 522960 523202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 523297 524286 gene locus_tag LOCUS_05250 523297 524286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 524283 524918 gene locus_tag LOCUS_05260 524283 524918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 524912 525490 gene locus_tag LOCUS_05270 524912 525490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 525487 526059 gene locus_tag LOCUS_05280 525487 526059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 526056 526313 gene locus_tag LOCUS_05290 526056 526313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 526310 527110 gene locus_tag LOCUS_05300 526310 527110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 527110 527247 gene locus_tag LOCUS_05310 527110 527247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 527330 527596 gene locus_tag LOCUS_05320 527330 527596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 527593 528123 gene locus_tag LOCUS_05330 527593 528123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 528129 528854 gene locus_tag LOCUS_05340 528129 528854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 528870 529103 gene locus_tag LOCUS_05350 528870 529103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 529103 529633 gene locus_tag LOCUS_05360 529103 529633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 529630 530259 gene locus_tag LOCUS_05370 529630 530259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 530261 530452 gene locus_tag LOCUS_05380 530261 530452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 530534 530890 gene locus_tag LOCUS_05390 530534 530890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 530887 531279 gene locus_tag LOCUS_05400 530887 531279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 531281 531556 gene locus_tag LOCUS_05410 531281 531556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 531559 531825 gene locus_tag LOCUS_05420 531559 531825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 531828 532082 gene locus_tag LOCUS_05430 531828 532082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 532079 532549 gene locus_tag LOCUS_05440 532079 532549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 532698 533429 gene locus_tag LOCUS_05450 532698 533429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 533618 534277 gene locus_tag LOCUS_05460 533618 534277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 535289 534318 gene locus_tag LOCUS_05470 535289 534318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 535925 535587 gene locus_tag LOCUS_05480 535925 535587 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_05480 535913 536248 gene locus_tag LOCUS_05490 535913 536248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 536332 536673 gene locus_tag LOCUS_05500 536332 536673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 536666 537700 gene locus_tag LOCUS_05510 536666 537700 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_05510 538075 538392 gene locus_tag LOCUS_05520 538075 538392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 538701 540656 gene locus_tag LOCUS_05530 538701 540656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 540749 542548 gene locus_tag LOCUS_05540 540749 542548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 542785 542573 gene locus_tag LOCUS_05550 542785 542573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 543272 544348 gene locus_tag LOCUS_05560 543272 544348 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_05560 544580 545830 gene locus_tag LOCUS_05570 544580 545830 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902283.1 protein_id gnl|my_center|LOCUS_05570 547804 545912 gene locus_tag LOCUS_05580 547804 545912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 549487 547838 gene locus_tag LOCUS_05590 549487 547838 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_05590 550334 549480 gene locus_tag LOCUS_05600 550334 549480 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456461.1 protein_id gnl|my_center|LOCUS_05600 551811 550483 gene locus_tag LOCUS_05610 551811 550483 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463731.1 protein_id gnl|my_center|LOCUS_05610 552772 551783 gene locus_tag LOCUS_05620 552772 551783 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028170747.1 protein_id gnl|my_center|LOCUS_05620 553467 552769 gene locus_tag LOCUS_05630 553467 552769 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_05630 554276 553464 gene locus_tag LOCUS_05640 554276 553464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_05640 555691 554279 gene locus_tag LOCUS_05650 555691 554279 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965179.1 protein_id gnl|my_center|LOCUS_05650 556803 556471 gene locus_tag LOCUS_05660 556803 556471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 557793 557089 gene locus_tag LOCUS_05670 557793 557089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 557947 560643 gene locus_tag LOCUS_05680 gene ppc 557947 560643 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191560.1 protein_id gnl|my_center|LOCUS_05680 560741 561193 gene locus_tag LOCUS_05690 560741 561193 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289215.1 protein_id gnl|my_center|LOCUS_05690 562595 561219 gene locus_tag LOCUS_05700 562595 561219 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903449.1 protein_id gnl|my_center|LOCUS_05700 563866 562592 gene locus_tag LOCUS_05710 gene glpB 563866 562592 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903448.1 protein_id gnl|my_center|LOCUS_05710 565586 563856 gene locus_tag LOCUS_05720 gene glpA 565586 563856 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903447.1 protein_id gnl|my_center|LOCUS_05720 565936 568479 gene locus_tag LOCUS_05730 565936 568479 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188976661.1 protein_id gnl|my_center|LOCUS_05730 568608 570140 gene locus_tag LOCUS_05740 gene glpK 568608 570140 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903446.1 protein_id gnl|my_center|LOCUS_05740 570144 571226 gene locus_tag LOCUS_05750 570144 571226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903445.1 protein_id gnl|my_center|LOCUS_05750 571289 572464 gene locus_tag LOCUS_05760 571289 572464 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903444.1 protein_id gnl|my_center|LOCUS_05760 573466 572495 gene locus_tag LOCUS_05770 573466 572495 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903967.1 protein_id gnl|my_center|LOCUS_05770 575309 573519 gene locus_tag LOCUS_05780 gene pyk 575309 573519 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902196.1 protein_id gnl|my_center|LOCUS_05780 576369 575410 gene locus_tag LOCUS_05790 gene kdgK1 576369 575410 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_05790 576655 577914 gene locus_tag LOCUS_05800 576655 577914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 577917 579839 gene locus_tag LOCUS_05810 gene htr6 577917 579839 CDS product chemotaxis signal transducer protein Htr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902553.1 protein_id gnl|my_center|LOCUS_05810 579896 580318 gene locus_tag LOCUS_05820 579896 580318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 581353 581616 gene locus_tag LOCUS_05830 581353 581616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 582425 582838 gene locus_tag LOCUS_05840 582425 582838 CDS product DUF5805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289235.1 protein_id gnl|my_center|LOCUS_05840 582835 583872 gene locus_tag LOCUS_05850 582835 583872 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902588.1 protein_id gnl|my_center|LOCUS_05850 584831 584115 gene locus_tag LOCUS_05860 584831 584115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 585860 584874 gene locus_tag LOCUS_05870 585860 584874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 586609 585857 gene locus_tag LOCUS_05880 586609 585857 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_05880 587286 586606 gene locus_tag LOCUS_05890 587286 586606 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_05890 588079 587291 gene locus_tag LOCUS_05900 gene glnH 588079 587291 CDS product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523230.1 protein_id gnl|my_center|LOCUS_05900 589461 588139 gene locus_tag LOCUS_05910 589461 588139 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903110.1 protein_id gnl|my_center|LOCUS_05910 590446 589556 gene locus_tag LOCUS_05920 gene rocF 590446 589556 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_05920 591793 590510 gene locus_tag LOCUS_05930 gene gdhB 591793 590510 CDS product glutamate dehydrogenase GdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902074.1 protein_id gnl|my_center|LOCUS_05930 593322 592516 gene locus_tag LOCUS_05940 593322 592516 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_05940 593863 594588 gene locus_tag LOCUS_05950 593863 594588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 594835 595347 gene locus_tag LOCUS_05960 594835 595347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 595349 597328 gene locus_tag LOCUS_05970 gene nosZ 595349 597328 CDS product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098686.1 protein_id gnl|my_center|LOCUS_05970 597359 598159 gene locus_tag LOCUS_05980 597359 598159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 598156 599541 gene locus_tag LOCUS_05990 598156 599541 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_05990 599528 600535 gene locus_tag LOCUS_06000 599528 600535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021548.1 protein_id gnl|my_center|LOCUS_06000 600532 601476 gene locus_tag LOCUS_06010 600532 601476 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 protein_id gnl|my_center|LOCUS_06010 602324 601479 gene locus_tag LOCUS_06020 602324 601479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902593.1 protein_id gnl|my_center|LOCUS_06020 603518 602415 gene locus_tag LOCUS_06030 603518 602415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902594.1 protein_id gnl|my_center|LOCUS_06030 604523 603690 gene locus_tag LOCUS_06040 604523 603690 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892496.1 protein_id gnl|my_center|LOCUS_06040 604637 605086 gene locus_tag LOCUS_06050 604637 605086 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902409.1 protein_id gnl|my_center|LOCUS_06050 605633 605235 gene locus_tag LOCUS_06060 605633 605235 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902597.1 protein_id gnl|my_center|LOCUS_06060 605927 607243 gene locus_tag LOCUS_06070 605927 607243 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903048.1 protein_id gnl|my_center|LOCUS_06070 607298 608344 gene locus_tag LOCUS_06080 gene dph2 607298 608344 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902598.1 protein_id gnl|my_center|LOCUS_06080 608405 610333 gene locus_tag LOCUS_06090 608405 610333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 610326 610772 gene locus_tag LOCUS_06100 610326 610772 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_06100 610775 611848 gene locus_tag LOCUS_06110 610775 611848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 611945 613504 gene locus_tag LOCUS_06120 611945 613504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 613555 614181 gene locus_tag LOCUS_06130 613555 614181 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902599.1 protein_id gnl|my_center|LOCUS_06130 615836 614178 gene locus_tag LOCUS_06140 615836 614178 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902600.1 protein_id gnl|my_center|LOCUS_06140 616361 615942 gene locus_tag LOCUS_06150 616361 615942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 616498 616848 gene locus_tag LOCUS_06160 616498 616848 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903020.1 protein_id gnl|my_center|LOCUS_06160 616895 617221 gene locus_tag LOCUS_06170 616895 617221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 618269 617223 gene locus_tag LOCUS_06180 gene aglJ 618269 617223 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902752.1 protein_id gnl|my_center|LOCUS_06180 618600 619448 gene locus_tag LOCUS_06190 618600 619448 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903396.1 protein_id gnl|my_center|LOCUS_06190 620893 619439 gene locus_tag LOCUS_06200 620893 619439 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_06200 621873 620896 gene locus_tag LOCUS_06210 621873 620896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 623087 621942 gene locus_tag LOCUS_06220 623087 621942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 623249 624673 gene locus_tag LOCUS_06230 623249 624673 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_06230 626123 624687 gene locus_tag LOCUS_06240 626123 624687 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902753.1 protein_id gnl|my_center|LOCUS_06240 627420 626281 gene locus_tag LOCUS_06250 627420 626281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 629226 627526 gene locus_tag LOCUS_06260 629226 627526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 629460 630464 gene locus_tag LOCUS_06270 629460 630464 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_06270 630467 631762 gene locus_tag LOCUS_06280 630467 631762 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_06280 631802 632905 gene locus_tag LOCUS_06290 631802 632905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 632905 634356 gene locus_tag LOCUS_06300 632905 634356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 635370 634396 gene locus_tag LOCUS_06310 gene aglG 635370 634396 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_06310 635428 638250 gene locus_tag LOCUS_06320 635428 638250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 638564 638385 gene locus_tag LOCUS_06330 638564 638385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 639148 638693 gene locus_tag LOCUS_06340 639148 638693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 639702 639259 gene locus_tag LOCUS_06350 639702 639259 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_06350 640035 639760 gene locus_tag LOCUS_06360 640035 639760 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_06360 640283 641815 gene locus_tag LOCUS_06370 640283 641815 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902613.1 protein_id gnl|my_center|LOCUS_06370 641815 642489 gene locus_tag LOCUS_06380 641815 642489 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902614.1 protein_id gnl|my_center|LOCUS_06380 642553 643563 gene locus_tag LOCUS_06390 gene purM 642553 643563 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902615.1 protein_id gnl|my_center|LOCUS_06390 643780 643601 gene locus_tag LOCUS_06400 643780 643601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 644424 643867 gene locus_tag LOCUS_06410 644424 643867 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902616.1 protein_id gnl|my_center|LOCUS_06410 644851 644480 gene locus_tag LOCUS_06420 644851 644480 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902617.1 protein_id gnl|my_center|LOCUS_06420 645125 645295 gene locus_tag LOCUS_06430 645125 645295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 645389 646111 gene locus_tag LOCUS_06440 gene psmB 645389 646111 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289244.1 protein_id gnl|my_center|LOCUS_06440 646243 647610 gene locus_tag LOCUS_06450 646243 647610 CDS product phosphopentomutase/phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902636.1 protein_id gnl|my_center|LOCUS_06450 647675 648061 gene locus_tag LOCUS_06460 gene cdd 647675 648061 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902631.1 protein_id gnl|my_center|LOCUS_06460 648058 648882 gene locus_tag LOCUS_06470 648058 648882 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902630.1 protein_id gnl|my_center|LOCUS_06470 650291 649122 gene locus_tag LOCUS_06480 650291 649122 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_06480 650970 650437 gene locus_tag LOCUS_06490 650970 650437 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902626.1 protein_id gnl|my_center|LOCUS_06490 651081 651998 gene locus_tag LOCUS_06500 651081 651998 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_06500 652061 652975 gene locus_tag LOCUS_06510 gene rocF 652061 652975 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_06510 655472 653025 gene locus_tag LOCUS_06520 gene gyrA 655472 653025 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902625.1 protein_id gnl|my_center|LOCUS_06520 657397 655469 gene locus_tag LOCUS_06530 gene gyrB 657397 655469 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049928262.1 protein_id gnl|my_center|LOCUS_06530 657536 659926 gene locus_tag LOCUS_06540 657536 659926 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902623.1 protein_id gnl|my_center|LOCUS_06540 659928 661034 gene locus_tag LOCUS_06550 659928 661034 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902622.1 protein_id gnl|my_center|LOCUS_06550 661781 661035 gene locus_tag LOCUS_06560 661781 661035 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902621.1 protein_id gnl|my_center|LOCUS_06560 663510 661846 gene locus_tag LOCUS_06570 gene ligA 663510 661846 CDS product ATP-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902619.1 protein_id gnl|my_center|LOCUS_06570 665996 663549 gene locus_tag LOCUS_06580 665996 663549 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361678.1 protein_id gnl|my_center|LOCUS_06580 667620 665998 gene locus_tag LOCUS_06590 667620 665998 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289232.1 protein_id gnl|my_center|LOCUS_06590 668254 667754 gene locus_tag LOCUS_06600 668254 667754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 668357 668782 gene locus_tag LOCUS_06610 668357 668782 CDS product DUF5793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902637.1 protein_id gnl|my_center|LOCUS_06610 669573 668791 gene locus_tag LOCUS_06620 gene cobB 669573 668791 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846381.1 protein_id gnl|my_center|LOCUS_06620 669795 670943 gene locus_tag LOCUS_06630 gene sucC 669795 670943 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289349.1 protein_id gnl|my_center|LOCUS_06630 670940 671812 gene locus_tag LOCUS_06640 gene sucD 670940 671812 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903125.1 protein_id gnl|my_center|LOCUS_06640 671856 672848 gene locus_tag LOCUS_06650 671856 672848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 673089 673325 gene locus_tag LOCUS_06660 673089 673325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 673591 674661 gene locus_tag LOCUS_06670 673591 674661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 675113 674682 gene locus_tag LOCUS_06680 675113 674682 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942959.1 protein_id gnl|my_center|LOCUS_06680 675174 676076 gene locus_tag LOCUS_06690 675174 676076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902476.1 protein_id gnl|my_center|LOCUS_06690 676077 677972 gene locus_tag LOCUS_06700 676077 677972 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902477.1 protein_id gnl|my_center|LOCUS_06700 677965 679053 gene locus_tag LOCUS_06710 677965 679053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892491.1 protein_id gnl|my_center|LOCUS_06710 679097 680074 gene locus_tag LOCUS_06720 679097 680074 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_06720 680208 680501 gene locus_tag LOCUS_06730 680208 680501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 681009 680509 gene locus_tag LOCUS_06740 681009 680509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 681130 681834 gene locus_tag LOCUS_06750 681130 681834 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_06750 681856 682530 gene locus_tag LOCUS_06760 681856 682530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 682611 683996 gene locus_tag LOCUS_06770 682611 683996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 684033 684827 gene locus_tag LOCUS_06780 684033 684827 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902496.1 protein_id gnl|my_center|LOCUS_06780 684894 685484 gene locus_tag LOCUS_06790 684894 685484 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403206.1 protein_id gnl|my_center|LOCUS_06790 685646 685939 gene locus_tag LOCUS_06800 685646 685939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 685951 686112 gene locus_tag LOCUS_06810 685951 686112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 686271 686519 gene locus_tag LOCUS_06820 686271 686519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 686649 686798 gene locus_tag LOCUS_06830 686649 686798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 686881 687573 gene locus_tag LOCUS_06840 686881 687573 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289175.1 protein_id gnl|my_center|LOCUS_06840 687570 688277 gene locus_tag LOCUS_06850 687570 688277 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421609.1 protein_id gnl|my_center|LOCUS_06850 688270 688740 gene locus_tag LOCUS_06860 688270 688740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 689790 688816 gene locus_tag LOCUS_06870 689790 688816 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904121.1 protein_id gnl|my_center|LOCUS_06870 690596 689787 gene locus_tag LOCUS_06880 690596 689787 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_06880 691717 690593 gene locus_tag LOCUS_06890 691717 690593 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904123.1 protein_id gnl|my_center|LOCUS_06890 691832 692422 gene locus_tag LOCUS_06900 691832 692422 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289287.1 protein_id gnl|my_center|LOCUS_06900 692552 695188 gene locus_tag LOCUS_06910 692552 695188 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902482.1 protein_id gnl|my_center|LOCUS_06910 695226 696989 gene locus_tag LOCUS_06920 695226 696989 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_06920 698479 697025 gene locus_tag LOCUS_06930 698479 697025 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902486.1 protein_id gnl|my_center|LOCUS_06930 698722 699294 gene locus_tag LOCUS_06940 698722 699294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 699619 699317 gene locus_tag LOCUS_06950 699619 699317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903804.1 protein_id gnl|my_center|LOCUS_06950 699978 699616 gene locus_tag LOCUS_06960 699978 699616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 700265 701113 gene locus_tag LOCUS_06970 700265 701113 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903192.1 protein_id gnl|my_center|LOCUS_06970 701928 701155 gene locus_tag LOCUS_06980 701928 701155 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289269.1 protein_id gnl|my_center|LOCUS_06980 702092 702826 gene locus_tag LOCUS_06990 702092 702826 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902893.1 protein_id gnl|my_center|LOCUS_06990 702823 704295 gene locus_tag LOCUS_07000 702823 704295 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902894.1 protein_id gnl|my_center|LOCUS_07000 704332 705153 gene locus_tag LOCUS_07010 gene surE 704332 705153 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902899.1 protein_id gnl|my_center|LOCUS_07010 705161 706084 gene locus_tag LOCUS_07020 705161 706084 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289364.1 protein_id gnl|my_center|LOCUS_07020 706781 706095 gene locus_tag LOCUS_07030 706781 706095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902481.1 protein_id gnl|my_center|LOCUS_07030 707695 706778 gene locus_tag LOCUS_07040 707695 706778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 709064 707814 gene locus_tag LOCUS_07050 709064 707814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 711301 709727 gene locus_tag LOCUS_07060 gene htr7 711301 709727 CDS product chemotaxis signal transducer protein Htr7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903283.1 protein_id gnl|my_center|LOCUS_07060 711585 711304 gene locus_tag LOCUS_07070 711585 711304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903282.1 protein_id gnl|my_center|LOCUS_07070 712218 711820 gene locus_tag LOCUS_07080 712218 711820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 713093 712281 gene locus_tag LOCUS_07090 713093 712281 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_07090 713607 713140 gene locus_tag LOCUS_07100 713607 713140 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_07100 713912 713667 gene locus_tag LOCUS_07110 713912 713667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 714445 714717 gene locus_tag LOCUS_07120 714445 714717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 714795 714869 gene locus_tag LOCUS_t00080 714795 714869 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 715139 716770 gene locus_tag LOCUS_07130 715139 716770 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_07130 717345 716767 gene locus_tag LOCUS_07140 717345 716767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 717882 717430 gene locus_tag LOCUS_07150 717882 717430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089667507.1 protein_id gnl|my_center|LOCUS_07150 718629 717931 gene locus_tag LOCUS_07160 718629 717931 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903169.1 protein_id gnl|my_center|LOCUS_07160 718888 719970 gene locus_tag LOCUS_07170 gene hisC 718888 719970 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289267.1 protein_id gnl|my_center|LOCUS_07170 719967 720473 gene locus_tag LOCUS_07180 719967 720473 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902737.1 protein_id gnl|my_center|LOCUS_07180 720470 721078 gene locus_tag LOCUS_07190 720470 721078 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902736.1 protein_id gnl|my_center|LOCUS_07190 721358 721125 gene locus_tag LOCUS_07200 721358 721125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 721357 721650 gene locus_tag LOCUS_07210 721357 721650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 722211 721651 gene locus_tag LOCUS_07220 722211 721651 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_07220 722355 723002 gene locus_tag LOCUS_07230 gene tpiA 722355 723002 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902734.1 protein_id gnl|my_center|LOCUS_07230 724936 723029 gene locus_tag LOCUS_07240 724936 723029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 725773 725102 gene locus_tag LOCUS_07250 gene bluB 725773 725102 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_07250 725904 726290 gene locus_tag LOCUS_07260 725904 726290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 727658 726297 gene locus_tag LOCUS_07270 gene dinB 727658 726297 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289265.1 protein_id gnl|my_center|LOCUS_07270 728053 728367 gene locus_tag LOCUS_07280 728053 728367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 728940 729470 gene locus_tag LOCUS_07290 728940 729470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 729923 729853 gene locus_tag LOCUS_t00090 729923 729853 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 730752 730063 gene locus_tag LOCUS_07300 730752 730063 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_07300 731805 730765 gene locus_tag LOCUS_07310 731805 730765 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_07310 731910 734135 gene locus_tag LOCUS_07320 731910 734135 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903605.1 protein_id gnl|my_center|LOCUS_07320 734194 734628 gene locus_tag LOCUS_07330 734194 734628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903208.1 protein_id gnl|my_center|LOCUS_07330 734716 735735 gene locus_tag LOCUS_07340 gene asd 734716 735735 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903044.1 protein_id gnl|my_center|LOCUS_07340 735826 736206 gene locus_tag LOCUS_07350 735826 736206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 737160 736207 gene locus_tag LOCUS_07360 737160 736207 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_07360 737377 737898 gene locus_tag LOCUS_07370 737377 737898 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903498.1 protein_id gnl|my_center|LOCUS_07370 737993 739351 gene locus_tag LOCUS_07380 737993 739351 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902866.1 protein_id gnl|my_center|LOCUS_07380 740271 741173 gene locus_tag LOCUS_07390 740271 741173 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 protein_id gnl|my_center|LOCUS_07390 741270 743279 gene locus_tag LOCUS_07400 741270 743279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 744996 743347 gene locus_tag LOCUS_07410 744996 743347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 746142 745261 gene locus_tag LOCUS_07420 746142 745261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 746753 746205 gene locus_tag LOCUS_07430 746753 746205 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_07430 746881 747540 gene locus_tag LOCUS_07440 746881 747540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 748468 747614 gene locus_tag LOCUS_07450 748468 747614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 748892 748521 gene locus_tag LOCUS_07460 748892 748521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 748999 749394 gene locus_tag LOCUS_07470 748999 749394 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289270.1 protein_id gnl|my_center|LOCUS_07470 750732 749449 gene locus_tag LOCUS_07480 750732 749449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 750909 751358 gene locus_tag LOCUS_07490 750909 751358 CDS product DUF5799 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902746.1 protein_id gnl|my_center|LOCUS_07490 751519 751355 gene locus_tag LOCUS_07500 751519 751355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 751624 752406 gene locus_tag LOCUS_07510 gene fba1 751624 752406 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_07510 752410 753537 gene locus_tag LOCUS_07520 752410 753537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 754482 753574 gene locus_tag LOCUS_07530 gene pfkB 754482 753574 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731860.1 protein_id gnl|my_center|LOCUS_07530 755240 754479 gene locus_tag LOCUS_07540 gene rhaR 755240 754479 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_07540 756312 755329 gene locus_tag LOCUS_07550 gene leuB 756312 755329 CDS product bifunctional 3-isopropylmalate/3-methylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870225.1 protein_id gnl|my_center|LOCUS_07550 757489 756749 gene locus_tag LOCUS_07560 757489 756749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 757726 758646 gene locus_tag LOCUS_07570 757726 758646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_07570 759887 759243 gene locus_tag LOCUS_07580 gene leuD 759887 759243 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404878.1 protein_id gnl|my_center|LOCUS_07580 761305 759884 gene locus_tag LOCUS_07590 gene leuC 761305 759884 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404876.1 protein_id gnl|my_center|LOCUS_07590 761568 761302 gene locus_tag LOCUS_07600 761568 761302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 762592 761561 gene locus_tag LOCUS_07610 gene ilvC 762592 761561 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_07610 763184 762585 gene locus_tag LOCUS_07620 gene ilvN 763184 762585 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_07620 764941 763187 gene locus_tag LOCUS_07630 764941 763187 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_07630 766321 765287 gene locus_tag LOCUS_07640 766321 765287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 766631 766960 gene locus_tag LOCUS_07650 766631 766960 CDS product DUF5779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902748.1 protein_id gnl|my_center|LOCUS_07650 767351 767073 gene locus_tag LOCUS_07660 767351 767073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 768157 767471 gene locus_tag LOCUS_07670 768157 767471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 768285 768959 gene locus_tag LOCUS_07680 768285 768959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902751.1 protein_id gnl|my_center|LOCUS_07680 769007 769417 gene locus_tag LOCUS_07690 769007 769417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903839.1 protein_id gnl|my_center|LOCUS_07690 769635 769426 gene locus_tag LOCUS_07700 769635 769426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892500.1 protein_id gnl|my_center|LOCUS_07700 771271 770096 gene locus_tag LOCUS_07710 771271 770096 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_07710 771406 772893 gene locus_tag LOCUS_07720 gene crtI 771406 772893 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903230.1 protein_id gnl|my_center|LOCUS_07720 772897 773781 gene locus_tag LOCUS_07730 772897 773781 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903229.1 protein_id gnl|my_center|LOCUS_07730 773774 774655 gene locus_tag LOCUS_07740 gene cruF 773774 774655 CDS product bisanhydrobacterioruberin hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903228.1 protein_id gnl|my_center|LOCUS_07740 774741 775577 gene locus_tag LOCUS_07750 774741 775577 CDS product HtlC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903270.1 protein_id gnl|my_center|LOCUS_07750 775741 776583 gene locus_tag LOCUS_07760 775741 776583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903271.1 protein_id gnl|my_center|LOCUS_07760 776576 777223 gene locus_tag LOCUS_07770 776576 777223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 777256 777579 gene locus_tag LOCUS_07780 777256 777579 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289371.1 protein_id gnl|my_center|LOCUS_07780 778757 777978 gene locus_tag LOCUS_07790 778757 777978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 779063 779890 gene locus_tag LOCUS_07800 779063 779890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 780240 779968 gene locus_tag LOCUS_07810 780240 779968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 780421 781731 gene locus_tag LOCUS_07820 780421 781731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 781823 782074 gene locus_tag LOCUS_07830 781823 782074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 782181 783191 gene locus_tag LOCUS_07840 782181 783191 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902767.1 protein_id gnl|my_center|LOCUS_07840 784300 783197 gene locus_tag LOCUS_07850 784300 783197 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902659.1 protein_id gnl|my_center|LOCUS_07850 785364 784399 gene locus_tag LOCUS_07860 785364 784399 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_07860 785486 787213 gene locus_tag LOCUS_07870 gene ilvD 785486 787213 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839606.1 protein_id gnl|my_center|LOCUS_07870 787519 787277 gene locus_tag LOCUS_07880 787519 787277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 787845 789197 gene locus_tag LOCUS_07890 787845 789197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 789913 789194 gene locus_tag LOCUS_07900 789913 789194 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902743.1 protein_id gnl|my_center|LOCUS_07900 792539 789963 gene locus_tag LOCUS_07910 792539 789963 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902063.1 protein_id gnl|my_center|LOCUS_07910 792943 792680 gene locus_tag LOCUS_07920 792943 792680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 793089 794174 gene locus_tag LOCUS_07930 793089 794174 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902123.1 protein_id gnl|my_center|LOCUS_07930 794634 794203 gene locus_tag LOCUS_07940 794634 794203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 795669 794737 gene locus_tag LOCUS_07950 795669 794737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903072.1 protein_id gnl|my_center|LOCUS_07950 796844 795666 gene locus_tag LOCUS_07960 gene priS 796844 795666 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_07960 797363 796884 gene locus_tag LOCUS_07970 797363 796884 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892508.1 protein_id gnl|my_center|LOCUS_07970 797436 798578 gene locus_tag LOCUS_07980 797436 798578 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903058.1 protein_id gnl|my_center|LOCUS_07980 799023 798592 gene locus_tag LOCUS_07990 799023 798592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 799114 799965 gene locus_tag LOCUS_08000 799114 799965 CDS product translation initiation factor eIF-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903055.1 protein_id gnl|my_center|LOCUS_08000 801356 800622 gene locus_tag LOCUS_08010 801356 800622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 801434 802483 gene locus_tag LOCUS_08020 801434 802483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 802899 802453 gene locus_tag LOCUS_08030 802899 802453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 804290 802932 gene locus_tag LOCUS_08040 804290 802932 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289330.1 protein_id gnl|my_center|LOCUS_08040 804363 804602 gene locus_tag LOCUS_08050 804363 804602 CDS product DUF5816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903052.1 protein_id gnl|my_center|LOCUS_08050 804718 805050 gene locus_tag LOCUS_08060 804718 805050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089696341.1 protein_id gnl|my_center|LOCUS_08060 805075 805608 gene locus_tag LOCUS_08070 805075 805608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 805675 806589 gene locus_tag LOCUS_08080 805675 806589 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903051.1 protein_id gnl|my_center|LOCUS_08080 806650 807270 gene locus_tag LOCUS_08090 806650 807270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903726.1 protein_id gnl|my_center|LOCUS_08090 807267 807926 gene locus_tag LOCUS_08100 807267 807926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_08100 807968 808174 gene locus_tag LOCUS_08110 807968 808174 CDS product dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289329.1 protein_id gnl|my_center|LOCUS_08110 808549 808175 gene locus_tag LOCUS_08120 808549 808175 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_08120 809920 808649 gene locus_tag LOCUS_08130 gene hisD 809920 808649 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903049.1 protein_id gnl|my_center|LOCUS_08130 810132 811058 gene locus_tag LOCUS_08140 810132 811058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 812270 811089 gene locus_tag LOCUS_08150 812270 811089 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902332.1 protein_id gnl|my_center|LOCUS_08150 814310 812694 gene locus_tag LOCUS_08160 814310 812694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 815592 814483 gene locus_tag LOCUS_08170 815592 814483 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050459751.1 protein_id gnl|my_center|LOCUS_08170 815695 816075 gene locus_tag LOCUS_08180 815695 816075 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_08180 816823 816110 gene locus_tag LOCUS_08190 816823 816110 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903171.1 protein_id gnl|my_center|LOCUS_08190 817885 816917 gene locus_tag LOCUS_08200 817885 816917 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_08200 818030 818902 gene locus_tag LOCUS_08210 818030 818902 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229041.1 protein_id gnl|my_center|LOCUS_08210 818899 819498 gene locus_tag LOCUS_08220 818899 819498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 819571 819750 gene locus_tag LOCUS_08230 819571 819750 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902845.1 protein_id gnl|my_center|LOCUS_08230 819753 820019 gene locus_tag LOCUS_08240 819753 820019 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289285.1 protein_id gnl|my_center|LOCUS_08240 820133 820423 gene locus_tag LOCUS_08250 820133 820423 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902842.1 protein_id gnl|my_center|LOCUS_08250 820420 820776 gene locus_tag LOCUS_08260 820420 820776 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902841.1 protein_id gnl|my_center|LOCUS_08260 820952 821524 gene locus_tag LOCUS_08270 820952 821524 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902840.1 protein_id gnl|my_center|LOCUS_08270 821606 822463 gene locus_tag LOCUS_08280 821606 822463 CDS product 16S ribosomal RNA methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902839.1 protein_id gnl|my_center|LOCUS_08280 822465 823088 gene locus_tag LOCUS_08290 822465 823088 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902837.1 protein_id gnl|my_center|LOCUS_08290 823151 824149 gene locus_tag LOCUS_08300 823151 824149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902836.1 protein_id gnl|my_center|LOCUS_08300 824153 825226 gene locus_tag LOCUS_08310 824153 825226 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_08310 825925 826437 gene locus_tag LOCUS_08320 825925 826437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 827537 826434 gene locus_tag LOCUS_08330 827537 826434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_08330 828240 827557 gene locus_tag LOCUS_08340 828240 827557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901944.1 protein_id gnl|my_center|LOCUS_08340 829730 828237 gene locus_tag LOCUS_08350 829730 828237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 829899 830777 gene locus_tag LOCUS_08360 829899 830777 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903356.1 protein_id gnl|my_center|LOCUS_08360 831790 830774 gene locus_tag LOCUS_08370 831790 830774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 833074 831887 gene locus_tag LOCUS_08380 833074 831887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 833198 834355 gene locus_tag LOCUS_08390 833198 834355 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289314.1 protein_id gnl|my_center|LOCUS_08390 835142 834489 gene locus_tag LOCUS_08400 835142 834489 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904091.1 protein_id gnl|my_center|LOCUS_08400 836600 835146 gene locus_tag LOCUS_08410 836600 835146 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904092.1 protein_id gnl|my_center|LOCUS_08410 836813 837466 gene locus_tag LOCUS_08420 836813 837466 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904095.1 protein_id gnl|my_center|LOCUS_08420 838393 837713 gene locus_tag LOCUS_08430 838393 837713 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_08430 838834 838502 gene locus_tag LOCUS_08440 gene hsmR 838834 838502 CDS product multidrug efflux SMR transporter protein HsmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903382.1 protein_id gnl|my_center|LOCUS_08440 839082 840080 gene locus_tag LOCUS_08450 839082 840080 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_08450 840788 840096 gene locus_tag LOCUS_08460 840788 840096 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902974.1 protein_id gnl|my_center|LOCUS_08460 841118 842578 gene locus_tag LOCUS_08470 841118 842578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 843437 842595 gene locus_tag LOCUS_08480 843437 842595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 843614 844732 gene locus_tag LOCUS_08490 843614 844732 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902335.1 protein_id gnl|my_center|LOCUS_08490 845855 844776 gene locus_tag LOCUS_08500 845855 844776 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257668.1 protein_id gnl|my_center|LOCUS_08500 846895 845852 gene locus_tag LOCUS_08510 846895 845852 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_08510 847030 847785 gene locus_tag LOCUS_08520 847030 847785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 848635 847883 gene locus_tag LOCUS_08530 848635 847883 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_08530 848966 850519 gene locus_tag LOCUS_08540 848966 850519 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902277.1 protein_id gnl|my_center|LOCUS_08540 850516 850788 gene locus_tag LOCUS_08550 850516 850788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 850867 851880 gene locus_tag LOCUS_08560 850867 851880 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 protein_id gnl|my_center|LOCUS_08560 852004 852963 gene locus_tag LOCUS_08570 852004 852963 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919794.1 protein_id gnl|my_center|LOCUS_08570 853097 854179 gene locus_tag LOCUS_08580 853097 854179 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582708.1 protein_id gnl|my_center|LOCUS_08580 854278 855975 gene locus_tag LOCUS_08590 gene malL 854278 855975 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_08590 856055 856825 gene locus_tag LOCUS_08600 856055 856825 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289375.1 protein_id gnl|my_center|LOCUS_08600 856900 857067 gene locus_tag LOCUS_08610 856900 857067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 857157 857321 gene locus_tag LOCUS_08620 857157 857321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 857620 857420 gene locus_tag LOCUS_08630 857620 857420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 858068 857781 gene locus_tag LOCUS_08640 858068 857781 CDS product DUF5789 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289142.1 protein_id gnl|my_center|LOCUS_08640 858202 859293 gene locus_tag LOCUS_08650 858202 859293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902219.1 protein_id gnl|my_center|LOCUS_08650 859414 859740 gene locus_tag LOCUS_08660 859414 859740 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902269.1 protein_id gnl|my_center|LOCUS_08660 859750 860361 gene locus_tag LOCUS_08670 859750 860361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 860722 860342 gene locus_tag LOCUS_08680 860722 860342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 860946 860725 gene locus_tag LOCUS_08690 860946 860725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902953.1 protein_id gnl|my_center|LOCUS_08690 861732 861010 gene locus_tag LOCUS_08700 861732 861010 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902268.1 protein_id gnl|my_center|LOCUS_08700 862102 861734 gene locus_tag LOCUS_08710 862102 861734 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902267.1 protein_id gnl|my_center|LOCUS_08710 862270 863220 gene locus_tag LOCUS_08720 862270 863220 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_08720 863706 863221 gene locus_tag LOCUS_08730 863706 863221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 864293 863826 gene locus_tag LOCUS_08740 864293 863826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902265.1 protein_id gnl|my_center|LOCUS_08740 864882 865064 gene locus_tag LOCUS_08750 864882 865064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 865695 865198 gene locus_tag LOCUS_08760 865695 865198 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_08760 866584 865943 gene locus_tag LOCUS_08770 866584 865943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 867435 866584 gene locus_tag LOCUS_08780 867435 866584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 867967 868887 gene locus_tag LOCUS_08790 gene dapA 867967 868887 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_08790 868884 869633 gene locus_tag LOCUS_08800 gene dapB 868884 869633 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_08800 870129 870959 gene locus_tag LOCUS_08810 870129 870959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 871176 871703 gene locus_tag LOCUS_08820 871176 871703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 871990 873516 gene locus_tag LOCUS_08830 gene dhaS 871990 873516 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_08830 873518 873889 gene locus_tag LOCUS_08840 873518 873889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 874008 874487 gene locus_tag LOCUS_08850 874008 874487 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_08850 874623 875927 gene locus_tag LOCUS_08860 gene lysA 874623 875927 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_08860 875927 877054 gene locus_tag LOCUS_08870 875927 877054 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974707.1 protein_id gnl|my_center|LOCUS_08870 877723 877079 gene locus_tag LOCUS_08880 877723 877079 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_08880 879123 877816 gene locus_tag LOCUS_08890 879123 877816 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902270.1 protein_id gnl|my_center|LOCUS_08890 880599 879217 gene locus_tag LOCUS_08900 gene purB 880599 879217 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289153.1 protein_id gnl|my_center|LOCUS_08900 881797 880730 gene locus_tag LOCUS_08910 881797 880730 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403481.1 protein_id gnl|my_center|LOCUS_08910 882600 882046 gene locus_tag LOCUS_08920 882600 882046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 882744 884324 gene locus_tag LOCUS_08930 882744 884324 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289152.1 protein_id gnl|my_center|LOCUS_08930 884483 885469 gene locus_tag LOCUS_08940 884483 885469 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268239.1 protein_id gnl|my_center|LOCUS_08940 885515 886045 gene locus_tag LOCUS_08950 885515 886045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 886088 886804 gene locus_tag LOCUS_08960 886088 886804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 888183 886924 gene locus_tag LOCUS_08970 888183 886924 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229483.1 protein_id gnl|my_center|LOCUS_08970 888570 888298 gene locus_tag LOCUS_08980 888570 888298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 888565 888759 gene locus_tag LOCUS_08990 888565 888759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 889049 889453 gene locus_tag LOCUS_09000 gene ribH 889049 889453 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902429.1 protein_id gnl|my_center|LOCUS_09000 889656 892100 gene locus_tag LOCUS_09010 gene folP 889656 892100 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902259.1 protein_id gnl|my_center|LOCUS_09010 892237 893730 gene locus_tag LOCUS_09020 gene hemAT 892237 893730 CDS product heme-containing aerotactic transducer HemAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903098.1 protein_id gnl|my_center|LOCUS_09020 893849 894457 gene locus_tag LOCUS_09030 893849 894457 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_09030 896362 894470 gene locus_tag LOCUS_09040 896362 894470 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289321.1 protein_id gnl|my_center|LOCUS_09040 896438 898177 gene locus_tag LOCUS_09050 896438 898177 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 protein_id gnl|my_center|LOCUS_09050 899285 898227 gene locus_tag LOCUS_09060 899285 898227 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902258.1 protein_id gnl|my_center|LOCUS_09060 899417 901195 gene locus_tag LOCUS_09070 899417 901195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 901269 903080 gene locus_tag LOCUS_09080 901269 903080 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_09080 903099 903716 gene locus_tag LOCUS_09090 903099 903716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 904771 903713 gene locus_tag LOCUS_09100 904771 903713 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902254.1 protein_id gnl|my_center|LOCUS_09100 905869 904886 gene locus_tag LOCUS_09110 905869 904886 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_09110 906126 906635 gene locus_tag LOCUS_09120 906126 906635 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903451.1 protein_id gnl|my_center|LOCUS_09120 907720 906749 gene locus_tag LOCUS_09130 907720 906749 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904083.1 protein_id gnl|my_center|LOCUS_09130 912456 907909 gene locus_tag LOCUS_09140 gene gltB 912456 907909 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421590.1 protein_id gnl|my_center|LOCUS_09140 913024 912611 gene locus_tag LOCUS_09150 913024 912611 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980432.1 protein_id gnl|my_center|LOCUS_09150 913496 914479 gene locus_tag LOCUS_09160 913496 914479 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_09160 915927 914473 gene locus_tag LOCUS_09170 gene proS 915927 914473 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902251.1 protein_id gnl|my_center|LOCUS_09170 916829 916044 gene locus_tag LOCUS_09180 916829 916044 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141879.1 protein_id gnl|my_center|LOCUS_09180 917648 916926 gene locus_tag LOCUS_09190 917648 916926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 917730 918065 gene locus_tag LOCUS_09200 917730 918065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 918062 918565 gene locus_tag LOCUS_09210 918062 918565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 918644 919909 gene locus_tag LOCUS_09220 918644 919909 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_09220 920199 919924 gene locus_tag LOCUS_09230 920199 919924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 920517 921575 gene locus_tag LOCUS_09240 920517 921575 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_09240 921737 921582 gene locus_tag LOCUS_09250 921737 921582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 922783 922301 gene locus_tag LOCUS_09260 922783 922301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 923048 924964 gene locus_tag LOCUS_09270 923048 924964 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_09270 925044 925199 gene locus_tag LOCUS_09280 925044 925199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 925220 925468 gene locus_tag LOCUS_09290 925220 925468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 926060 925506 gene locus_tag LOCUS_09300 926060 925506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 927382 926057 gene locus_tag LOCUS_09310 927382 926057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 928279 927557 gene locus_tag LOCUS_09320 928279 927557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 929434 928322 gene locus_tag LOCUS_09330 gene pdhA 929434 928322 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_09330 930073 929801 gene locus_tag LOCUS_09340 930073 929801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 929969 930385 gene locus_tag LOCUS_09350 929969 930385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 930450 931574 gene locus_tag LOCUS_09360 930450 931574 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903788.1 protein_id gnl|my_center|LOCUS_09360 931587 933452 gene locus_tag LOCUS_09370 931587 933452 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903789.1 protein_id gnl|my_center|LOCUS_09370 933442 934584 gene locus_tag LOCUS_09380 933442 934584 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903790.1 protein_id gnl|my_center|LOCUS_09380 934787 936262 gene locus_tag LOCUS_09390 gene arcD 934787 936262 CDS product arginine/ornithine antiporter ArcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904158.1 protein_id gnl|my_center|LOCUS_09390 936413 938236 gene locus_tag LOCUS_09400 936413 938236 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405161.1 protein_id gnl|my_center|LOCUS_09400 938646 938275 gene locus_tag LOCUS_09410 938646 938275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 938687 939895 gene locus_tag LOCUS_09420 938687 939895 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403008.1 protein_id gnl|my_center|LOCUS_09420 940656 939937 gene locus_tag LOCUS_09430 940656 939937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 941047 940667 gene locus_tag LOCUS_09440 941047 940667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 941145 941756 gene locus_tag LOCUS_09450 941145 941756 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_09450 942719 941793 gene locus_tag LOCUS_09460 gene cysK 942719 941793 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_09460 942737 942964 gene locus_tag LOCUS_09470 942737 942964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 943674 942973 gene locus_tag LOCUS_09480 943674 942973 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902474.1 protein_id gnl|my_center|LOCUS_09480 945358 943709 gene locus_tag LOCUS_09490 945358 943709 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_09490 945521 945907 gene locus_tag LOCUS_09500 945521 945907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 945968 947197 gene locus_tag LOCUS_09510 945968 947197 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_09510 947325 948815 gene locus_tag LOCUS_09520 947325 948815 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256148.1 protein_id gnl|my_center|LOCUS_09520 948822 950222 gene locus_tag LOCUS_09530 948822 950222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 951056 950232 gene locus_tag LOCUS_09540 951056 950232 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903273.1 protein_id gnl|my_center|LOCUS_09540 951773 951144 gene locus_tag LOCUS_09550 951773 951144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903275.1 protein_id gnl|my_center|LOCUS_09550 951750 951911 gene locus_tag LOCUS_09560 951750 951911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 951943 953229 gene locus_tag LOCUS_09570 gene aroA 951943 953229 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289296.1 protein_id gnl|my_center|LOCUS_09570 953332 953727 gene locus_tag LOCUS_09580 953332 953727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 953776 954975 gene locus_tag LOCUS_09590 gene aroC 953776 954975 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902889.1 protein_id gnl|my_center|LOCUS_09590 954977 955603 gene locus_tag LOCUS_09600 954977 955603 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902887.1 protein_id gnl|my_center|LOCUS_09600 956146 955604 gene locus_tag LOCUS_09610 956146 955604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 956247 956999 gene locus_tag LOCUS_09620 956247 956999 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902885.1 protein_id gnl|my_center|LOCUS_09620 957025 957110 gene locus_tag LOCUS_t00100 957025 957110 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 957524 958210 gene locus_tag LOCUS_09630 957524 958210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 958691 959953 gene locus_tag LOCUS_09640 958691 959953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 959999 960298 gene locus_tag LOCUS_09650 959999 960298 CDS product DUF5785 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902883.1 protein_id gnl|my_center|LOCUS_09650 960354 960692 gene locus_tag LOCUS_09660 960354 960692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 960801 961574 gene locus_tag LOCUS_09670 960801 961574 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902721.1 protein_id gnl|my_center|LOCUS_09670 961642 962217 gene locus_tag LOCUS_09680 961642 962217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 962305 962772 gene locus_tag LOCUS_09690 962305 962772 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902879.1 protein_id gnl|my_center|LOCUS_09690 962805 962878 gene locus_tag LOCUS_t00110 962805 962878 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 963172 964065 gene locus_tag LOCUS_09700 963172 964065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 964058 964651 gene locus_tag LOCUS_09710 964058 964651 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902741.1 protein_id gnl|my_center|LOCUS_09710 964648 966330 gene locus_tag LOCUS_09720 964648 966330 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902740.1 protein_id gnl|my_center|LOCUS_09720 966459 966863 gene locus_tag LOCUS_09730 gene msrB 966459 966863 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903021.1 protein_id gnl|my_center|LOCUS_09730 966897 967625 gene locus_tag LOCUS_09740 966897 967625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 967855 967598 gene locus_tag LOCUS_09750 967855 967598 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903129.1 protein_id gnl|my_center|LOCUS_09750 968386 967922 gene locus_tag LOCUS_09760 gene ndk 968386 967922 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902835.1 protein_id gnl|my_center|LOCUS_09760 968742 968386 gene locus_tag LOCUS_09770 968742 968386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 968972 968745 gene locus_tag LOCUS_09780 968972 968745 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902833.1 protein_id gnl|my_center|LOCUS_09780 969346 968984 gene locus_tag LOCUS_09790 gene rpl7ae 969346 968984 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902832.1 protein_id gnl|my_center|LOCUS_09790 970573 969560 gene locus_tag LOCUS_09800 gene fabK 970573 969560 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938889.1 protein_id gnl|my_center|LOCUS_09800 970662 972899 gene locus_tag LOCUS_09810 gene tmcA 970662 972899 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289283.1 protein_id gnl|my_center|LOCUS_09810 972896 973393 gene locus_tag LOCUS_09820 972896 973393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 973390 973554 gene locus_tag LOCUS_09830 973390 973554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 973678 975279 gene locus_tag LOCUS_09840 973678 975279 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289110.1 protein_id gnl|my_center|LOCUS_09840 975352 976326 gene locus_tag LOCUS_09850 975352 976326 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_09850 977054 976323 gene locus_tag LOCUS_09860 977054 976323 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_09860 977497 977123 gene locus_tag LOCUS_09870 977497 977123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 979155 977494 gene locus_tag LOCUS_09880 979155 977494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 980812 979148 gene locus_tag LOCUS_09890 980812 979148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 981669 980815 gene locus_tag LOCUS_09900 981669 980815 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391606.1 protein_id gnl|my_center|LOCUS_09900 982204 981875 gene locus_tag LOCUS_09910 982204 981875 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903863.1 protein_id gnl|my_center|LOCUS_09910 983237 982254 gene locus_tag LOCUS_09920 983237 982254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 983373 985820 gene locus_tag LOCUS_09930 983373 985820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 987546 985807 gene locus_tag LOCUS_09940 987546 985807 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902829.1 protein_id gnl|my_center|LOCUS_09940 988217 987702 gene locus_tag LOCUS_09950 988217 987702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 989255 988320 gene locus_tag LOCUS_09960 989255 988320 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 protein_id gnl|my_center|LOCUS_09960 990383 989343 gene locus_tag LOCUS_09970 990383 989343 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902827.1 protein_id gnl|my_center|LOCUS_09970 991893 990388 gene locus_tag LOCUS_09980 991893 990388 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902826.1 protein_id gnl|my_center|LOCUS_09980 993432 991999 gene locus_tag LOCUS_09990 993432 991999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 994413 993661 gene locus_tag LOCUS_10000 994413 993661 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902825.1 protein_id gnl|my_center|LOCUS_10000 995393 994410 gene locus_tag LOCUS_10010 gene mvk 995393 994410 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902824.1 protein_id gnl|my_center|LOCUS_10010 997629 995449 gene locus_tag LOCUS_10020 997629 995449 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838171.1 protein_id gnl|my_center|LOCUS_10020 997862 997626 gene locus_tag LOCUS_10030 997862 997626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 999341 998004 gene locus_tag LOCUS_10040 999341 998004 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_10040 999792 999412 gene locus_tag LOCUS_10050 999792 999412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1000234 999851 gene locus_tag LOCUS_10060 1000234 999851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1001153 1000335 gene locus_tag LOCUS_10070 gene rpsB 1001153 1000335 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902822.1 protein_id gnl|my_center|LOCUS_10070 1002355 1001150 gene locus_tag LOCUS_10080 1002355 1001150 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902821.1 protein_id gnl|my_center|LOCUS_10080 1002531 1002358 gene locus_tag LOCUS_10090 1002531 1002358 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902820.1 protein_id gnl|my_center|LOCUS_10090 1002728 1002528 gene locus_tag LOCUS_10100 1002728 1002528 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902819.1 protein_id gnl|my_center|LOCUS_10100 1003139 1002741 gene locus_tag LOCUS_10110 1003139 1002741 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902818.1 protein_id gnl|my_center|LOCUS_10110 1003570 1003133 gene locus_tag LOCUS_10120 1003570 1003133 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_10120 1003917 1003567 gene locus_tag LOCUS_10130 1003917 1003567 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902816.1 protein_id gnl|my_center|LOCUS_10130 1004026 1003941 gene locus_tag LOCUS_t00120 1004026 1003941 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1004910 1004131 gene locus_tag LOCUS_10140 1004910 1004131 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902815.1 protein_id gnl|my_center|LOCUS_10140 1005303 1004914 gene locus_tag LOCUS_10150 1005303 1004914 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902814.1 protein_id gnl|my_center|LOCUS_10150 1005815 1005300 gene locus_tag LOCUS_10160 1005815 1005300 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902813.1 protein_id gnl|my_center|LOCUS_10160 1006348 1005815 gene locus_tag LOCUS_10170 1006348 1005815 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902812.1 protein_id gnl|my_center|LOCUS_10170 1006454 1006369 gene locus_tag LOCUS_t00130 1006454 1006369 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1006671 1006970 gene locus_tag LOCUS_10180 1006671 1006970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1007135 1008196 gene locus_tag LOCUS_10190 1007135 1008196 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902811.1 protein_id gnl|my_center|LOCUS_10190 1008450 1008259 gene locus_tag LOCUS_10200 1008450 1008259 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903043.1 protein_id gnl|my_center|LOCUS_10200 1009237 1008641 gene locus_tag LOCUS_10210 1009237 1008641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1010103 1009264 gene locus_tag LOCUS_10220 1010103 1009264 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_10220 1010846 1010100 gene locus_tag LOCUS_10230 1010846 1010100 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289327.1 protein_id gnl|my_center|LOCUS_10230 1011838 1010846 gene locus_tag LOCUS_10240 gene cofD 1011838 1010846 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903040.1 protein_id gnl|my_center|LOCUS_10240 1012000 1012539 gene locus_tag LOCUS_10250 1012000 1012539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1013297 1012557 gene locus_tag LOCUS_10260 1013297 1012557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902459.1 protein_id gnl|my_center|LOCUS_10260 1014235 1013294 gene locus_tag LOCUS_10270 1014235 1013294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902458.1 protein_id gnl|my_center|LOCUS_10270 1014746 1014507 gene locus_tag LOCUS_10280 1014746 1014507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1015479 1014778 gene locus_tag LOCUS_10290 1015479 1014778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902457.1 protein_id gnl|my_center|LOCUS_10290 1016867 1015476 gene locus_tag LOCUS_10300 gene cyoE 1016867 1015476 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902456.1 protein_id gnl|my_center|LOCUS_10300 1017010 1017771 gene locus_tag LOCUS_10310 gene coxB 1017010 1017771 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902455.1 protein_id gnl|my_center|LOCUS_10310 1018180 1017959 gene locus_tag LOCUS_10320 1018180 1017959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1019414 1018638 gene locus_tag LOCUS_10330 1019414 1018638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1019537 1019815 gene locus_tag LOCUS_10340 gene srp19 1019537 1019815 CDS product signal recognition particle subunit SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902992.1 protein_id gnl|my_center|LOCUS_10340 1019812 1020039 gene locus_tag LOCUS_10350 1019812 1020039 CDS product H/ACA ribonucleoprotein complex subunit GAR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902991.1 protein_id gnl|my_center|LOCUS_10350 1020115 1021227 gene locus_tag LOCUS_10360 1020115 1021227 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902990.1 protein_id gnl|my_center|LOCUS_10360 1022253 1021246 gene locus_tag LOCUS_10370 1022253 1021246 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902989.1 protein_id gnl|my_center|LOCUS_10370 1022602 1022369 gene locus_tag LOCUS_10380 1022602 1022369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1023080 1023247 gene locus_tag LOCUS_10390 1023080 1023247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1023696 1023283 gene locus_tag LOCUS_10400 1023696 1023283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1023811 1024359 gene locus_tag LOCUS_10410 1023811 1024359 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289316.1 protein_id gnl|my_center|LOCUS_10410 1024446 1025426 gene locus_tag LOCUS_10420 gene fen 1024446 1025426 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902986.1 protein_id gnl|my_center|LOCUS_10420 1026623 1025484 gene locus_tag LOCUS_10430 1026623 1025484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904134.1 protein_id gnl|my_center|LOCUS_10430 1027570 1026641 gene locus_tag LOCUS_10440 1027570 1026641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172776.1 protein_id gnl|my_center|LOCUS_10440 1028631 1027567 gene locus_tag LOCUS_10450 1028631 1027567 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251868.1 protein_id gnl|my_center|LOCUS_10450 1029198 1030604 gene locus_tag LOCUS_10460 1029198 1030604 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_10460 1031428 1030925 gene locus_tag LOCUS_10470 1031428 1030925 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230151.1 protein_id gnl|my_center|LOCUS_10470 1031563 1031883 gene locus_tag LOCUS_10480 1031563 1031883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1032698 1031817 gene locus_tag LOCUS_10490 1032698 1031817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1032787 1034658 gene locus_tag LOCUS_10500 gene gatE 1032787 1034658 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902981.1 protein_id gnl|my_center|LOCUS_10500 1035074 1034655 gene locus_tag LOCUS_10510 1035074 1034655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1035615 1035127 gene locus_tag LOCUS_10520 1035615 1035127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1035915 1038389 gene locus_tag LOCUS_10530 1035915 1038389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1039118 1038393 gene locus_tag LOCUS_10540 1039118 1038393 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289315.1 protein_id gnl|my_center|LOCUS_10540 1039639 1039115 gene locus_tag LOCUS_10550 1039639 1039115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902976.1 protein_id gnl|my_center|LOCUS_10550 1039852 1040862 gene locus_tag LOCUS_10560 1039852 1040862 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_10560 1041002 1041334 gene locus_tag LOCUS_10570 1041002 1041334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1042156 1041446 gene locus_tag LOCUS_10580 gene sop2 1042156 1041446 CDS product sensory rhodopsin II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903286.1 protein_id gnl|my_center|LOCUS_10580 1044483 1042159 gene locus_tag LOCUS_10590 gene htr2 1044483 1042159 CDS product sensory rhodopsin II transducer Htr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903287.1 protein_id gnl|my_center|LOCUS_10590 1044760 1045731 gene locus_tag LOCUS_10600 1044760 1045731 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530136.1 protein_id gnl|my_center|LOCUS_10600 1045812 1046522 gene locus_tag LOCUS_10610 1045812 1046522 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903123.1 protein_id gnl|my_center|LOCUS_10610 1046750 1048087 gene locus_tag LOCUS_10620 1046750 1048087 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903112.1 protein_id gnl|my_center|LOCUS_10620 1049535 1048555 gene locus_tag LOCUS_10630 1049535 1048555 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927239.1 protein_id gnl|my_center|LOCUS_10630 1049760 1050551 gene locus_tag LOCUS_10640 1049760 1050551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1051463 1050609 gene locus_tag LOCUS_10650 1051463 1050609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1051374 1052924 gene locus_tag LOCUS_10660 1051374 1052924 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_10660 1052927 1053232 gene locus_tag LOCUS_10670 1052927 1053232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903115.1 protein_id gnl|my_center|LOCUS_10670 1053372 1055216 gene locus_tag LOCUS_10680 1053372 1055216 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_10680 1055278 1056225 gene locus_tag LOCUS_10690 1055278 1056225 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289348.1 protein_id gnl|my_center|LOCUS_10690 1056725 1056246 gene locus_tag LOCUS_10700 1056725 1056246 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_10700 1057256 1056798 gene locus_tag LOCUS_10710 1057256 1056798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1058315 1057290 gene locus_tag LOCUS_10720 1058315 1057290 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289630.1 protein_id gnl|my_center|LOCUS_10720 1059560 1058337 gene locus_tag LOCUS_10730 1059560 1058337 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903121.1 protein_id gnl|my_center|LOCUS_10730 1060207 1059626 gene locus_tag LOCUS_10740 1060207 1059626 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902461.1 protein_id gnl|my_center|LOCUS_10740 1061551 1060337 gene locus_tag LOCUS_10750 1061551 1060337 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_10750 1061707 1062447 gene locus_tag LOCUS_10760 1061707 1062447 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903715.1 protein_id gnl|my_center|LOCUS_10760 1063568 1062513 gene locus_tag LOCUS_10770 gene htpX 1063568 1062513 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392235.1 protein_id gnl|my_center|LOCUS_10770 1063685 1064782 gene locus_tag LOCUS_10780 1063685 1064782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1064782 1065528 gene locus_tag LOCUS_10790 1064782 1065528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1065525 1066838 gene locus_tag LOCUS_10800 1065525 1066838 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_10800 1066835 1068400 gene locus_tag LOCUS_10810 1066835 1068400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1068451 1069617 gene locus_tag LOCUS_10820 gene coaBC 1068451 1069617 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902383.1 protein_id gnl|my_center|LOCUS_10820 1069769 1070812 gene locus_tag LOCUS_10830 1069769 1070812 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902382.1 protein_id gnl|my_center|LOCUS_10830 1070805 1071080 gene locus_tag LOCUS_10840 1070805 1071080 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902381.1 protein_id gnl|my_center|LOCUS_10840 1071077 1071397 gene locus_tag LOCUS_10850 gene mnhG 1071077 1071397 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_10850 1071394 1071939 gene locus_tag LOCUS_10860 1071394 1071939 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902379.1 protein_id gnl|my_center|LOCUS_10860 1071936 1072409 gene locus_tag LOCUS_10870 1071936 1072409 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902378.1 protein_id gnl|my_center|LOCUS_10870 1072409 1072765 gene locus_tag LOCUS_10880 1072409 1072765 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_10880 1072758 1074251 gene locus_tag LOCUS_10890 1072758 1074251 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289183.1 protein_id gnl|my_center|LOCUS_10890 1074248 1075933 gene locus_tag LOCUS_10900 1074248 1075933 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902375.1 protein_id gnl|my_center|LOCUS_10900 1075933 1077714 gene locus_tag LOCUS_10910 1075933 1077714 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006079023.1 protein_id gnl|my_center|LOCUS_10910 1077892 1078377 gene locus_tag LOCUS_10920 1077892 1078377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1078491 1079069 gene locus_tag LOCUS_10930 1078491 1079069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_10930 1079317 1079835 gene locus_tag LOCUS_10940 1079317 1079835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1079982 1080470 gene locus_tag LOCUS_10950 1079982 1080470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1080467 1082362 gene locus_tag LOCUS_10960 1080467 1082362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1082407 1082976 gene locus_tag LOCUS_10970 gene hpt 1082407 1082976 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_10970 1083112 1083540 gene locus_tag LOCUS_10980 1083112 1083540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1083909 1083832 gene locus_tag LOCUS_t00140 1083909 1083832 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1084468 1083983 gene locus_tag LOCUS_10990 1084468 1083983 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903519.1 protein_id gnl|my_center|LOCUS_10990 1085232 1084465 gene locus_tag LOCUS_11000 1085232 1084465 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903518.1 protein_id gnl|my_center|LOCUS_11000 1085350 1087668 gene locus_tag LOCUS_11010 1085350 1087668 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902370.1 protein_id gnl|my_center|LOCUS_11010 1087998 1087726 gene locus_tag LOCUS_11020 1087998 1087726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289181.1 protein_id gnl|my_center|LOCUS_11020 1088184 1088447 gene locus_tag LOCUS_11030 1088184 1088447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1088587 1088865 gene locus_tag LOCUS_11040 1088587 1088865 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289179.1 protein_id gnl|my_center|LOCUS_11040 1088868 1089041 gene locus_tag LOCUS_11050 1088868 1089041 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902367.1 protein_id gnl|my_center|LOCUS_11050 1089043 1089843 gene locus_tag LOCUS_11060 1089043 1089843 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902366.1 protein_id gnl|my_center|LOCUS_11060 1089874 1090056 gene locus_tag LOCUS_11070 1089874 1090056 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902365.1 protein_id gnl|my_center|LOCUS_11070 1090062 1090820 gene locus_tag LOCUS_11080 1090062 1090820 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902364.1 protein_id gnl|my_center|LOCUS_11080 1090963 1091586 gene locus_tag LOCUS_11090 1090963 1091586 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289178.1 protein_id gnl|my_center|LOCUS_11090 1092494 1091673 gene locus_tag LOCUS_11100 1092494 1091673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1092735 1093154 gene locus_tag LOCUS_11110 1092735 1093154 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227839.1 protein_id gnl|my_center|LOCUS_11110 1094216 1093203 gene locus_tag LOCUS_11120 1094216 1093203 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_11120 1095494 1094322 gene locus_tag LOCUS_11130 1095494 1094322 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902360.1 protein_id gnl|my_center|LOCUS_11130 1095578 1096831 gene locus_tag LOCUS_11140 1095578 1096831 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289176.1 protein_id gnl|my_center|LOCUS_11140 1097025 1096870 gene locus_tag LOCUS_11150 1097025 1096870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1097743 1097063 gene locus_tag LOCUS_11160 1097743 1097063 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892488.1 protein_id gnl|my_center|LOCUS_11160 1097881 1098648 gene locus_tag LOCUS_11170 1097881 1098648 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903130.1 protein_id gnl|my_center|LOCUS_11170 1098695 1098850 gene locus_tag LOCUS_11180 1098695 1098850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1098906 1100069 gene locus_tag LOCUS_11190 1098906 1100069 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266654.1 protein_id gnl|my_center|LOCUS_11190 1100188 1100003 gene locus_tag LOCUS_11200 1100188 1100003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1102054 1100222 gene locus_tag LOCUS_11210 1102054 1100222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1102306 1103427 gene locus_tag LOCUS_11220 1102306 1103427 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902330.1 protein_id gnl|my_center|LOCUS_11220 1103630 1103908 gene locus_tag LOCUS_11230 1103630 1103908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1103961 1104257 gene locus_tag LOCUS_11240 1103961 1104257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1104373 1104606 gene locus_tag LOCUS_11250 1104373 1104606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1104608 1105768 gene locus_tag LOCUS_11260 1104608 1105768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1106431 1105784 gene locus_tag LOCUS_11270 1106431 1105784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1107570 1106497 gene locus_tag LOCUS_11280 1107570 1106497 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902856.1 protein_id gnl|my_center|LOCUS_11280 1107876 1107571 gene locus_tag LOCUS_11290 1107876 1107571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1108403 1107990 gene locus_tag LOCUS_11300 1108403 1107990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1108546 1109232 gene locus_tag LOCUS_11310 1108546 1109232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1109280 1109843 gene locus_tag LOCUS_11320 1109280 1109843 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289385.1 protein_id gnl|my_center|LOCUS_11320 1109969 1110667 gene locus_tag LOCUS_11330 1109969 1110667 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928484.1 protein_id gnl|my_center|LOCUS_11330 1112368 1110677 gene locus_tag LOCUS_11340 1112368 1110677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1112779 1112459 gene locus_tag LOCUS_11350 1112779 1112459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1113185 1114162 gene locus_tag LOCUS_11360 1113185 1114162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1114399 1115334 gene locus_tag LOCUS_11370 1114399 1115334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1115948 1115439 gene locus_tag LOCUS_11380 1115948 1115439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1116202 1117026 gene locus_tag LOCUS_11390 1116202 1117026 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088005.1 protein_id gnl|my_center|LOCUS_11390 1117104 1117838 gene locus_tag LOCUS_11400 1117104 1117838 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892481.1 protein_id gnl|my_center|LOCUS_11400 1118118 1117807 gene locus_tag LOCUS_11410 1118118 1117807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903335.1 protein_id gnl|my_center|LOCUS_11410 1119032 1118115 gene locus_tag LOCUS_11420 gene guaA 1119032 1118115 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903336.1 protein_id gnl|my_center|LOCUS_11420 1120693 1119032 gene locus_tag LOCUS_11430 1120693 1119032 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903337.1 protein_id gnl|my_center|LOCUS_11430 1120962 1120771 gene locus_tag LOCUS_11440 1120962 1120771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1121184 1121011 gene locus_tag LOCUS_11450 1121184 1121011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1121913 1121320 gene locus_tag LOCUS_11460 1121913 1121320 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903340.1 protein_id gnl|my_center|LOCUS_11460 1121974 1122816 gene locus_tag LOCUS_11470 1121974 1122816 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_11470 1124763 1122835 gene locus_tag LOCUS_11480 1124763 1122835 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339215.1 protein_id gnl|my_center|LOCUS_11480 1125771 1124869 gene locus_tag LOCUS_11490 1125771 1124869 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989568.1 protein_id gnl|my_center|LOCUS_11490 1126860 1125820 gene locus_tag LOCUS_11500 1126860 1125820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1128883 1126955 gene locus_tag LOCUS_11510 gene thrS 1128883 1126955 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289388.1 protein_id gnl|my_center|LOCUS_11510 1129508 1128942 gene locus_tag LOCUS_11520 1129508 1128942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1129691 1130122 gene locus_tag LOCUS_11530 1129691 1130122 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_11530 1130232 1130744 gene locus_tag LOCUS_11540 1130232 1130744 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_11540 1130802 1132748 gene locus_tag LOCUS_11550 1130802 1132748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1132830 1133303 gene locus_tag LOCUS_11560 1132830 1133303 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_11560 1134384 1133347 gene locus_tag LOCUS_11570 1134384 1133347 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903344.1 protein_id gnl|my_center|LOCUS_11570 1135391 1134381 gene locus_tag LOCUS_11580 1135391 1134381 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_11580 1136357 1135467 gene locus_tag LOCUS_11590 1136357 1135467 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289389.1 protein_id gnl|my_center|LOCUS_11590 1137094 1136429 gene locus_tag LOCUS_11600 1137094 1136429 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_11600 1138001 1137603 gene locus_tag LOCUS_11610 1138001 1137603 CDS product DUF5802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289390.1 protein_id gnl|my_center|LOCUS_11610 1138118 1138780 gene locus_tag LOCUS_11620 1138118 1138780 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 protein_id gnl|my_center|LOCUS_11620 1138877 1140085 gene locus_tag LOCUS_11630 1138877 1140085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1140157 1140804 gene locus_tag LOCUS_11640 1140157 1140804 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903348.1 protein_id gnl|my_center|LOCUS_11640 1142402 1140837 gene locus_tag LOCUS_11650 1142402 1140837 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 protein_id gnl|my_center|LOCUS_11650 1143262 1142753 gene locus_tag LOCUS_11660 1143262 1142753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1143935 1143336 gene locus_tag LOCUS_11670 1143935 1143336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1144155 1145402 gene locus_tag LOCUS_11680 gene gatD 1144155 1145402 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903349.1 protein_id gnl|my_center|LOCUS_11680 1145496 1146392 gene locus_tag LOCUS_11690 1145496 1146392 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289391.1 protein_id gnl|my_center|LOCUS_11690 1146961 1146647 gene locus_tag LOCUS_11700 1146961 1146647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1150238 1148052 gene locus_tag LOCUS_11710 1150238 1148052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1150621 1152276 gene locus_tag LOCUS_11720 1150621 1152276 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289455.1 protein_id gnl|my_center|LOCUS_11720 1152573 1152295 gene locus_tag LOCUS_11730 1152573 1152295 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289392.1 protein_id gnl|my_center|LOCUS_11730 1154485 1152695 gene locus_tag LOCUS_11740 1154485 1152695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1155723 1154482 gene locus_tag LOCUS_11750 1155723 1154482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1155786 1157000 gene locus_tag LOCUS_11760 1155786 1157000 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289393.1 protein_id gnl|my_center|LOCUS_11760 1158511 1156997 gene locus_tag LOCUS_11770 1158511 1156997 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892520.1 protein_id gnl|my_center|LOCUS_11770 1159352 1158627 gene locus_tag LOCUS_11780 1159352 1158627 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903355.1 protein_id gnl|my_center|LOCUS_11780 1159439 1159660 gene locus_tag LOCUS_11790 1159439 1159660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1160171 1159662 gene locus_tag LOCUS_11800 1160171 1159662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1160417 1160830 gene locus_tag LOCUS_11810 1160417 1160830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1161682 1160837 gene locus_tag LOCUS_11820 1161682 1160837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1161827 1162522 gene locus_tag LOCUS_11830 gene deoC 1161827 1162522 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903361.1 protein_id gnl|my_center|LOCUS_11830 1162573 1163856 gene locus_tag LOCUS_11840 1162573 1163856 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903362.1 protein_id gnl|my_center|LOCUS_11840 1164284 1163898 gene locus_tag LOCUS_11850 1164284 1163898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1165232 1164318 gene locus_tag LOCUS_11860 1165232 1164318 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903363.1 protein_id gnl|my_center|LOCUS_11860 1166166 1165279 gene locus_tag LOCUS_11870 1166166 1165279 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902393.1 protein_id gnl|my_center|LOCUS_11870 1166833 1166297 gene locus_tag LOCUS_11880 1166833 1166297 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903364.1 protein_id gnl|my_center|LOCUS_11880 1168381 1167485 gene locus_tag LOCUS_11890 gene map 1168381 1167485 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903366.1 protein_id gnl|my_center|LOCUS_11890 1169267 1168425 gene locus_tag LOCUS_11900 1169267 1168425 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903371.1 protein_id gnl|my_center|LOCUS_11900 1169418 1170680 gene locus_tag LOCUS_11910 gene icd 1169418 1170680 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903372.1 protein_id gnl|my_center|LOCUS_11910 1171111 1170884 gene locus_tag LOCUS_11920 1171111 1170884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1171193 1171417 gene locus_tag LOCUS_11930 1171193 1171417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1172236 1171439 gene locus_tag LOCUS_11940 1172236 1171439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1172612 1172274 gene locus_tag LOCUS_11950 1172612 1172274 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_11950 1172705 1173229 gene locus_tag LOCUS_11960 1172705 1173229 CDS product DUF5817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903373.1 protein_id gnl|my_center|LOCUS_11960 1173226 1173576 gene locus_tag LOCUS_11970 1173226 1173576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1174818 1173601 gene locus_tag LOCUS_11980 gene hmgA 1174818 1173601 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903374.1 protein_id gnl|my_center|LOCUS_11980 1174900 1176396 gene locus_tag LOCUS_11990 1174900 1176396 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903377.1 protein_id gnl|my_center|LOCUS_11990 1176687 1177823 gene locus_tag LOCUS_12000 gene nadA 1176687 1177823 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903378.1 protein_id gnl|my_center|LOCUS_12000 1177826 1179349 gene locus_tag LOCUS_12010 1177826 1179349 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903379.1 protein_id gnl|my_center|LOCUS_12010 1179349 1180170 gene locus_tag LOCUS_12020 gene nadC 1179349 1180170 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903380.1 protein_id gnl|my_center|LOCUS_12020 1180668 1180177 gene locus_tag LOCUS_12030 1180668 1180177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1181495 1180761 gene locus_tag LOCUS_12040 1181495 1180761 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_12040 1181682 1182350 gene locus_tag LOCUS_12050 1181682 1182350 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024506.1 protein_id gnl|my_center|LOCUS_12050 1183927 1182368 gene locus_tag LOCUS_12060 gene gpmI 1183927 1182368 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903383.1 protein_id gnl|my_center|LOCUS_12060 1183991 1184491 gene locus_tag LOCUS_12070 1183991 1184491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1184627 1185877 gene locus_tag LOCUS_12080 1184627 1185877 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903386.1 protein_id gnl|my_center|LOCUS_12080 1186185 1185883 gene locus_tag LOCUS_12090 1186185 1185883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1186550 1186185 gene locus_tag LOCUS_12100 1186550 1186185 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_12100 1186955 1186620 gene locus_tag LOCUS_12110 1186955 1186620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903389.1 protein_id gnl|my_center|LOCUS_12110 1187261 1187683 gene locus_tag LOCUS_12120 1187261 1187683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1187709 1188764 gene locus_tag LOCUS_12130 1187709 1188764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1189263 1190510 gene locus_tag LOCUS_12140 1189263 1190510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1191428 1190655 gene locus_tag LOCUS_12150 1191428 1190655 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_12150 1191531 1193426 gene locus_tag LOCUS_12160 1191531 1193426 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903390.1 protein_id gnl|my_center|LOCUS_12160 1193496 1193927 gene locus_tag LOCUS_12170 1193496 1193927 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_12170 1194373 1193930 gene locus_tag LOCUS_12180 1194373 1193930 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_12180 1194531 1195244 gene locus_tag LOCUS_12190 1194531 1195244 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_12190 1196431 1195241 gene locus_tag LOCUS_12200 1196431 1195241 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892523.1 protein_id gnl|my_center|LOCUS_12200 1196540 1197391 gene locus_tag LOCUS_12210 1196540 1197391 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903393.1 protein_id gnl|my_center|LOCUS_12210 1197675 1197388 gene locus_tag LOCUS_12220 1197675 1197388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1198273 1197752 gene locus_tag LOCUS_12230 1198273 1197752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1199664 1198429 gene locus_tag LOCUS_12240 1199664 1198429 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289069.1 protein_id gnl|my_center|LOCUS_12240 1199869 1200411 gene locus_tag LOCUS_12250 1199869 1200411 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903498.1 protein_id gnl|my_center|LOCUS_12250 1201028 1200408 gene locus_tag LOCUS_12260 1201028 1200408 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289535.1 protein_id gnl|my_center|LOCUS_12260 1201233 1203158 gene locus_tag LOCUS_12270 1201233 1203158 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133412129.1 protein_id gnl|my_center|LOCUS_12270 1203162 1205678 gene locus_tag LOCUS_12280 1203162 1205678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1205769 1207169 gene locus_tag LOCUS_12290 1205769 1207169 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902068.1 protein_id gnl|my_center|LOCUS_12290 1209089 1207170 gene locus_tag LOCUS_12300 1209089 1207170 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089670226.1 protein_id gnl|my_center|LOCUS_12300 1209903 1209175 gene locus_tag LOCUS_12310 1209903 1209175 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903333.1 protein_id gnl|my_center|LOCUS_12310 1210849 1209908 gene locus_tag LOCUS_12320 1210849 1209908 CDS product PGF-CTERM-anchored ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902993.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12320 1211025 1212095 gene locus_tag LOCUS_12330 gene btuC 1211025 1212095 CDS product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902994.1 protein_id gnl|my_center|LOCUS_12330 1212092 1212925 gene locus_tag LOCUS_12340 1212092 1212925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1212995 1215436 gene locus_tag LOCUS_12350 1212995 1215436 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_12350 1216380 1215463 gene locus_tag LOCUS_12360 1216380 1215463 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_12360 1216264 1216581 gene locus_tag LOCUS_12370 1216264 1216581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1217527 1216652 gene locus_tag LOCUS_12380 1217527 1216652 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_12380 1218101 1217688 gene locus_tag LOCUS_12390 1218101 1217688 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903327.1 protein_id gnl|my_center|LOCUS_12390 1218204 1219250 gene locus_tag LOCUS_12400 gene carA 1218204 1219250 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903326.1 protein_id gnl|my_center|LOCUS_12400 1219299 1219589 gene locus_tag LOCUS_12410 1219299 1219589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1220226 1219600 gene locus_tag LOCUS_12420 1220226 1219600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1223470 1220450 gene locus_tag LOCUS_12430 1223470 1220450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1226832 1223581 gene locus_tag LOCUS_12440 gene carB 1226832 1223581 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903325.1 protein_id gnl|my_center|LOCUS_12440 1227219 1226989 gene locus_tag LOCUS_12450 1227219 1226989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1228068 1227289 gene locus_tag LOCUS_12460 1228068 1227289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1228651 1228118 gene locus_tag LOCUS_12470 1228651 1228118 CDS product DUF5815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903323.1 protein_id gnl|my_center|LOCUS_12470 1229620 1228772 gene locus_tag LOCUS_12480 1229620 1228772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1230114 1229698 gene locus_tag LOCUS_12490 1230114 1229698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903322.1 protein_id gnl|my_center|LOCUS_12490 1231604 1230354 gene locus_tag LOCUS_12500 1231604 1230354 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903320.1 protein_id gnl|my_center|LOCUS_12500 1231726 1232334 gene locus_tag LOCUS_12510 1231726 1232334 CDS product DUF6149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903316.1 protein_id gnl|my_center|LOCUS_12510 1233759 1232398 gene locus_tag LOCUS_12520 1233759 1232398 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903314.1 protein_id gnl|my_center|LOCUS_12520 1235999 1233771 gene locus_tag LOCUS_12530 1235999 1233771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1236123 1236998 gene locus_tag LOCUS_12540 1236123 1236998 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903313.1 protein_id gnl|my_center|LOCUS_12540 1237487 1237035 gene locus_tag LOCUS_12550 1237487 1237035 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_12550 1237592 1238242 gene locus_tag LOCUS_12560 1237592 1238242 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903261.1 protein_id gnl|my_center|LOCUS_12560 1238330 1239220 gene locus_tag LOCUS_12570 1238330 1239220 CDS product EMC3/TMCO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903262.1 protein_id gnl|my_center|LOCUS_12570 1239266 1239844 gene locus_tag LOCUS_12580 1239266 1239844 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_12580 1239849 1240739 gene locus_tag LOCUS_12590 1239849 1240739 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289369.1 protein_id gnl|my_center|LOCUS_12590 1240800 1241420 gene locus_tag LOCUS_12600 1240800 1241420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289318.1 protein_id gnl|my_center|LOCUS_12600 1241466 1241657 gene locus_tag LOCUS_12610 1241466 1241657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1241733 1242413 gene locus_tag LOCUS_12620 1241733 1242413 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902324.1 protein_id gnl|my_center|LOCUS_12620 1242579 1244489 gene locus_tag LOCUS_12630 gene dnaK 1242579 1244489 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_12630 1244951 1245268 gene locus_tag LOCUS_12640 1244951 1245268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1246114 1245305 gene locus_tag LOCUS_12650 1246114 1245305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1246707 1247036 gene locus_tag LOCUS_12660 1246707 1247036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1247636 1247121 gene locus_tag LOCUS_12670 1247636 1247121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1247748 1248902 gene locus_tag LOCUS_12680 gene dnaJ 1247748 1248902 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902321.1 protein_id gnl|my_center|LOCUS_12680 1249190 1248903 gene locus_tag LOCUS_12690 1249190 1248903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1249218 1250036 gene locus_tag LOCUS_12700 1249218 1250036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902320.1 protein_id gnl|my_center|LOCUS_12700 1250186 1250377 gene locus_tag LOCUS_12710 1250186 1250377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903213.1 protein_id gnl|my_center|LOCUS_12710 1251328 1250579 gene locus_tag LOCUS_12720 1251328 1250579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1251456 1252121 gene locus_tag LOCUS_12730 1251456 1252121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1252757 1252137 gene locus_tag LOCUS_12740 1252757 1252137 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289184.1 protein_id gnl|my_center|LOCUS_12740 1252809 1253084 gene locus_tag LOCUS_12750 1252809 1253084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1253212 1254285 gene locus_tag LOCUS_12760 1253212 1254285 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902152.1 protein_id gnl|my_center|LOCUS_12760 1255676 1254333 gene locus_tag LOCUS_12770 1255676 1254333 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_12770 1256554 1256021 gene locus_tag LOCUS_12780 1256554 1256021 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902148.1 protein_id gnl|my_center|LOCUS_12780 1256852 1257211 gene locus_tag LOCUS_12790 1256852 1257211 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902147.1 protein_id gnl|my_center|LOCUS_12790 1257849 1257295 gene locus_tag LOCUS_12800 1257849 1257295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902146.1 protein_id gnl|my_center|LOCUS_12800 1258438 1257842 gene locus_tag LOCUS_12810 gene rnhA 1258438 1257842 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902145.1 protein_id gnl|my_center|LOCUS_12810 1258881 1258486 gene locus_tag LOCUS_12820 1258881 1258486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1258982 1260271 gene locus_tag LOCUS_12830 gene nreA 1258982 1260271 CDS product DNA repair protein NreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289141.1 protein_id gnl|my_center|LOCUS_12830 1261180 1260314 gene locus_tag LOCUS_12840 1261180 1260314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1261624 1262052 gene locus_tag LOCUS_12850 1261624 1262052 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890456.1 protein_id gnl|my_center|LOCUS_12850 1263053 1262199 gene locus_tag LOCUS_12860 1263053 1262199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1263860 1263785 gene locus_tag LOCUS_t00150 1263860 1263785 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1264507 1263941 gene locus_tag LOCUS_12870 gene fxsA 1264507 1263941 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903399.1 protein_id gnl|my_center|LOCUS_12870 1265957 1264581 gene locus_tag LOCUS_12880 1265957 1264581 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_12880 1266039 1267652 gene locus_tag LOCUS_12890 1266039 1267652 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289401.1 protein_id gnl|my_center|LOCUS_12890 1267723 1268535 gene locus_tag LOCUS_12900 1267723 1268535 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903396.1 protein_id gnl|my_center|LOCUS_12900 1269641 1268712 gene locus_tag LOCUS_12910 gene mptA 1269641 1268712 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903394.1 protein_id gnl|my_center|LOCUS_12910 1270337 1269738 gene locus_tag LOCUS_12920 1270337 1269738 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_12920 1271448 1270411 gene locus_tag LOCUS_12930 1271448 1270411 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903402.1 protein_id gnl|my_center|LOCUS_12930 1271558 1272643 gene locus_tag LOCUS_12940 1271558 1272643 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903403.1 protein_id gnl|my_center|LOCUS_12940 1272701 1273633 gene locus_tag LOCUS_12950 1272701 1273633 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 protein_id gnl|my_center|LOCUS_12950 1273800 1274348 gene locus_tag LOCUS_12960 1273800 1274348 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289404.1 protein_id gnl|my_center|LOCUS_12960 1274388 1275176 gene locus_tag LOCUS_12970 1274388 1275176 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_12970 1275231 1275572 gene locus_tag LOCUS_12980 1275231 1275572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903405.1 protein_id gnl|my_center|LOCUS_12980 1275840 1277687 gene locus_tag LOCUS_12990 1275840 1277687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1277800 1278840 gene locus_tag LOCUS_13000 1277800 1278840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903753.1 protein_id gnl|my_center|LOCUS_13000 1278840 1280297 gene locus_tag LOCUS_13010 1278840 1280297 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903752.1 protein_id gnl|my_center|LOCUS_13010 1280294 1281505 gene locus_tag LOCUS_13020 1280294 1281505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903751.1 protein_id gnl|my_center|LOCUS_13020 1281498 1282835 gene locus_tag LOCUS_13030 1281498 1282835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903750.1 protein_id gnl|my_center|LOCUS_13030 1282828 1283235 gene locus_tag LOCUS_13040 1282828 1283235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1283273 1283797 gene locus_tag LOCUS_13050 1283273 1283797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1283940 1284024 gene locus_tag LOCUS_t00160 1283940 1284024 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1284282 1284794 gene locus_tag LOCUS_13060 1284282 1284794 CDS product DUF5813 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903410.1 protein_id gnl|my_center|LOCUS_13060 1285066 1284836 gene locus_tag LOCUS_13070 1285066 1284836 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903411.1 protein_id gnl|my_center|LOCUS_13070 1285755 1285069 gene locus_tag LOCUS_13080 1285755 1285069 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_13080 1285896 1286126 gene locus_tag LOCUS_13090 1285896 1286126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1286179 1286499 gene locus_tag LOCUS_13100 1286179 1286499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1287083 1286496 gene locus_tag LOCUS_13110 gene tmk 1287083 1286496 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903416.1 protein_id gnl|my_center|LOCUS_13110 1287223 1288122 gene locus_tag LOCUS_13120 1287223 1288122 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892525.1 protein_id gnl|my_center|LOCUS_13120 1288260 1289441 gene locus_tag LOCUS_13130 1288260 1289441 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289408.1 protein_id gnl|my_center|LOCUS_13130 1289419 1290195 gene locus_tag LOCUS_13140 1289419 1290195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1290195 1290818 gene locus_tag LOCUS_13150 gene cofC 1290195 1290818 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903420.1 protein_id gnl|my_center|LOCUS_13150 1290825 1291958 gene locus_tag LOCUS_13160 gene cofG 1290825 1291958 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892527.1 protein_id gnl|my_center|LOCUS_13160 1293512 1292160 gene locus_tag LOCUS_13170 gene cofH 1293512 1292160 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903422.1 protein_id gnl|my_center|LOCUS_13170 1294635 1293619 gene locus_tag LOCUS_13180 1294635 1293619 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903678.1 protein_id gnl|my_center|LOCUS_13180 1294787 1295821 gene locus_tag LOCUS_13190 1294787 1295821 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289411.1 protein_id gnl|my_center|LOCUS_13190 1296820 1295846 gene locus_tag LOCUS_13200 1296820 1295846 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_13200 1296950 1297825 gene locus_tag LOCUS_13210 1296950 1297825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1297825 1298490 gene locus_tag LOCUS_13220 1297825 1298490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902481.1 protein_id gnl|my_center|LOCUS_13220 1298542 1298796 gene locus_tag LOCUS_13230 gene purS 1298542 1298796 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903429.1 protein_id gnl|my_center|LOCUS_13230 1298849 1299526 gene locus_tag LOCUS_13240 gene purQ 1298849 1299526 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903428.1 protein_id gnl|my_center|LOCUS_13240 1299987 1300949 gene locus_tag LOCUS_13250 1299987 1300949 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943338.1 protein_id gnl|my_center|LOCUS_13250 1300952 1301668 gene locus_tag LOCUS_13260 1300952 1301668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_13260 1301668 1302432 gene locus_tag LOCUS_13270 gene tcyC 1301668 1302432 CDS product cystine ABC transporter ATP-binding protein TcyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246629.1 protein_id gnl|my_center|LOCUS_13270 1302514 1303242 gene locus_tag LOCUS_13280 1302514 1303242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1304692 1303514 gene locus_tag LOCUS_13290 1304692 1303514 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903425.1 protein_id gnl|my_center|LOCUS_13290 1305036 1304629 gene locus_tag LOCUS_13300 1305036 1304629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1306897 1305110 gene locus_tag LOCUS_13310 gene arcS 1306897 1305110 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903438.1 protein_id gnl|my_center|LOCUS_13310 1307270 1308415 gene locus_tag LOCUS_13320 1307270 1308415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1308481 1309356 gene locus_tag LOCUS_13330 1308481 1309356 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119394.1 protein_id gnl|my_center|LOCUS_13330 1310852 1309380 gene locus_tag LOCUS_13340 gene tgtA 1310852 1309380 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903439.1 protein_id gnl|my_center|LOCUS_13340 1311230 1310973 gene locus_tag LOCUS_13350 1311230 1310973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1311820 1311275 gene locus_tag LOCUS_13360 1311820 1311275 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903441.1 protein_id gnl|my_center|LOCUS_13360 1313966 1311861 gene locus_tag LOCUS_13370 1313966 1311861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1314691 1314095 gene locus_tag LOCUS_13380 gene trmY 1314691 1314095 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903455.1 protein_id gnl|my_center|LOCUS_13380 1314853 1315317 gene locus_tag LOCUS_13390 1314853 1315317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1315381 1315797 gene locus_tag LOCUS_13400 1315381 1315797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1315931 1317451 gene locus_tag LOCUS_13410 1315931 1317451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1317701 1317628 gene locus_tag LOCUS_t00170 1317701 1317628 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1317759 1318259 gene locus_tag LOCUS_13420 1317759 1318259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1318383 1319555 gene locus_tag LOCUS_13430 1318383 1319555 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226810.1 protein_id gnl|my_center|LOCUS_13430 1319558 1320490 gene locus_tag LOCUS_13440 1319558 1320490 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_13440 1320483 1321478 gene locus_tag LOCUS_13450 1320483 1321478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1321527 1323860 gene locus_tag LOCUS_13460 1321527 1323860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901946.1 protein_id gnl|my_center|LOCUS_13460 1323925 1324395 gene locus_tag LOCUS_13470 1323925 1324395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1324388 1324882 gene locus_tag LOCUS_13480 1324388 1324882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1326195 1324888 gene locus_tag LOCUS_13490 gene aglM 1326195 1324888 CDS product UDP-glucose 6-dehydrogenase AglM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901982.1 protein_id gnl|my_center|LOCUS_13490 1326284 1327039 gene locus_tag LOCUS_13500 gene aglF 1326284 1327039 CDS product UTP--glucose-1-phosphate uridylyltransferase AglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901983.1 protein_id gnl|my_center|LOCUS_13500 1327353 1328768 gene locus_tag LOCUS_13510 1327353 1328768 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901950.1 protein_id gnl|my_center|LOCUS_13510 1328982 1330169 gene locus_tag LOCUS_13520 1328982 1330169 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289088.1 protein_id gnl|my_center|LOCUS_13520 1332387 1330597 gene locus_tag LOCUS_13530 gene glmS 1332387 1330597 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901947.1 protein_id gnl|my_center|LOCUS_13530 1333496 1332387 gene locus_tag LOCUS_13540 1333496 1332387 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901948.1 protein_id gnl|my_center|LOCUS_13540 1334597 1333737 gene locus_tag LOCUS_13550 gene cheF1 1334597 1333737 CDS product chemotaxis protein CheF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902684.1 protein_id gnl|my_center|LOCUS_13550 1334763 1336742 gene locus_tag LOCUS_13560 gene acs 1334763 1336742 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_13560 1336883 1338571 gene locus_tag LOCUS_13570 1336883 1338571 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902709.1 protein_id gnl|my_center|LOCUS_13570 1338642 1340636 gene locus_tag LOCUS_13580 gene acs 1338642 1340636 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902710.1 protein_id gnl|my_center|LOCUS_13580 1340681 1341115 gene locus_tag LOCUS_13590 1340681 1341115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1341112 1342782 gene locus_tag LOCUS_13600 1341112 1342782 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941186.1 protein_id gnl|my_center|LOCUS_13600 1342787 1343260 gene locus_tag LOCUS_13610 1342787 1343260 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_13610 1343313 1343528 gene locus_tag LOCUS_13620 1343313 1343528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 1343743 1343967 gene locus_tag LOCUS_13630 1343743 1343967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1345201 1344335 gene locus_tag LOCUS_13640 gene cheF1 1345201 1344335 CDS product chemotaxis protein CheF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902684.1 protein_id gnl|my_center|LOCUS_13640 1345393 1345998 gene locus_tag LOCUS_13650 1345393 1345998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1346825 1346013 gene locus_tag LOCUS_13660 1346825 1346013 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761882.1 protein_id gnl|my_center|LOCUS_13660 1346915 1348024 gene locus_tag LOCUS_13670 1346915 1348024 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_13670 1348091 1349368 gene locus_tag LOCUS_13680 1348091 1349368 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903457.1 protein_id gnl|my_center|LOCUS_13680 1349427 1350062 gene locus_tag LOCUS_13690 gene rnhB 1349427 1350062 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903458.1 protein_id gnl|my_center|LOCUS_13690 1351813 1350212 gene locus_tag LOCUS_13700 1351813 1350212 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903461.1 protein_id gnl|my_center|LOCUS_13700 1352697 1351810 gene locus_tag LOCUS_13710 gene secF 1352697 1351810 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903462.1 protein_id gnl|my_center|LOCUS_13710 1352799 1353113 gene locus_tag LOCUS_13720 1352799 1353113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1353661 1353137 gene locus_tag LOCUS_13730 1353661 1353137 CDS product DUF5812 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903463.1 protein_id gnl|my_center|LOCUS_13730 1354239 1353700 gene locus_tag LOCUS_13740 1354239 1353700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903464.1 protein_id gnl|my_center|LOCUS_13740 1354464 1354249 gene locus_tag LOCUS_13750 1354464 1354249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1354366 1355676 gene locus_tag LOCUS_13760 1354366 1355676 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903465.1 protein_id gnl|my_center|LOCUS_13760 1355700 1356842 gene locus_tag LOCUS_13770 1355700 1356842 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903466.1 protein_id gnl|my_center|LOCUS_13770 1356899 1357045 gene locus_tag LOCUS_13780 1356899 1357045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1357500 1357042 gene locus_tag LOCUS_13790 1357500 1357042 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289414.1 protein_id gnl|my_center|LOCUS_13790 1357740 1357501 gene locus_tag LOCUS_13800 1357740 1357501 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903468.1 protein_id gnl|my_center|LOCUS_13800 1357877 1358503 gene locus_tag LOCUS_13810 1357877 1358503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1358598 1360403 gene locus_tag LOCUS_13820 gene infB 1358598 1360403 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903469.1 protein_id gnl|my_center|LOCUS_13820 1360453 1360632 gene locus_tag LOCUS_13830 1360453 1360632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1360693 1360887 gene locus_tag LOCUS_13840 1360693 1360887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1361027 1361359 gene locus_tag LOCUS_13850 1361027 1361359 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_13850 1361802 1361449 gene locus_tag LOCUS_13860 1361802 1361449 CDS product DUF5811 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903470.1 protein_id gnl|my_center|LOCUS_13860 1362354 1361884 gene locus_tag LOCUS_13870 1362354 1361884 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903471.1 protein_id gnl|my_center|LOCUS_13870 1363611 1362397 gene locus_tag LOCUS_13880 1363611 1362397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1365082 1363916 gene locus_tag LOCUS_13890 1365082 1363916 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903472.1 protein_id gnl|my_center|LOCUS_13890 1367075 1365285 gene locus_tag LOCUS_13900 gene pepF 1367075 1365285 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289415.1 protein_id gnl|my_center|LOCUS_13900 1367948 1367121 gene locus_tag LOCUS_13910 gene truA 1367948 1367121 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903475.1 protein_id gnl|my_center|LOCUS_13910 1368044 1368550 gene locus_tag LOCUS_13920 1368044 1368550 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_13920 1369050 1368619 gene locus_tag LOCUS_13930 1369050 1368619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1370410 1369103 gene locus_tag LOCUS_13940 gene hisS 1370410 1369103 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903476.1 protein_id gnl|my_center|LOCUS_13940 1370667 1371332 gene locus_tag LOCUS_13950 1370667 1371332 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878025.1 protein_id gnl|my_center|LOCUS_13950 1371985 1371368 gene locus_tag LOCUS_13960 1371985 1371368 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903477.1 protein_id gnl|my_center|LOCUS_13960 1372330 1371986 gene locus_tag LOCUS_13970 1372330 1371986 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903478.1 protein_id gnl|my_center|LOCUS_13970 1372879 1372418 gene locus_tag LOCUS_13980 1372879 1372418 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903479.1 protein_id gnl|my_center|LOCUS_13980 1374028 1372994 gene locus_tag LOCUS_13990 1374028 1372994 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902103.1 protein_id gnl|my_center|LOCUS_13990 1374125 1374991 gene locus_tag LOCUS_14000 gene thiL 1374125 1374991 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903480.1 protein_id gnl|my_center|LOCUS_14000 1376266 1375022 gene locus_tag LOCUS_14010 1376266 1375022 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_14010 1376610 1376362 gene locus_tag LOCUS_14020 1376610 1376362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903482.1 protein_id gnl|my_center|LOCUS_14020 1377030 1377716 gene locus_tag LOCUS_14030 gene pyrH 1377030 1377716 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903483.1 protein_id gnl|my_center|LOCUS_14030 1377717 1379354 gene locus_tag LOCUS_14040 gene lysS 1377717 1379354 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903484.1 protein_id gnl|my_center|LOCUS_14040 1379582 1379406 gene locus_tag LOCUS_14050 1379582 1379406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1380541 1379645 gene locus_tag LOCUS_14060 1380541 1379645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1380643 1382409 gene locus_tag LOCUS_14070 1380643 1382409 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903485.1 protein_id gnl|my_center|LOCUS_14070 1382454 1384193 gene locus_tag LOCUS_14080 gene argS 1382454 1384193 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_14080 1385050 1384259 gene locus_tag LOCUS_14090 1385050 1384259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1385180 1385878 gene locus_tag LOCUS_14100 1385180 1385878 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902033.1 protein_id gnl|my_center|LOCUS_14100 1386750 1385932 gene locus_tag LOCUS_14110 1386750 1385932 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903571.1 protein_id gnl|my_center|LOCUS_14110 1387065 1388321 gene locus_tag LOCUS_14120 gene prf1 1387065 1388321 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289438.1 protein_id gnl|my_center|LOCUS_14120 1388831 1388439 gene locus_tag LOCUS_14130 1388831 1388439 CDS product DUF6276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903574.1 protein_id gnl|my_center|LOCUS_14130 1389580 1388888 gene locus_tag LOCUS_14140 1389580 1388888 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903575.1 protein_id gnl|my_center|LOCUS_14140 1390389 1389688 gene locus_tag LOCUS_14150 1390389 1389688 CDS product bacteriorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903069.1 protein_id gnl|my_center|LOCUS_14150 1391955 1390534 gene locus_tag LOCUS_14160 1391955 1390534 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903578.1 protein_id gnl|my_center|LOCUS_14160 1393718 1391958 gene locus_tag LOCUS_14170 1393718 1391958 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903579.1 protein_id gnl|my_center|LOCUS_14170 1394044 1393721 gene locus_tag LOCUS_14180 1394044 1393721 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903580.1 protein_id gnl|my_center|LOCUS_14180 1395114 1394041 gene locus_tag LOCUS_14190 1395114 1394041 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903581.1 protein_id gnl|my_center|LOCUS_14190 1395695 1395111 gene locus_tag LOCUS_14200 1395695 1395111 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_14200 1395978 1395718 gene locus_tag LOCUS_14210 1395978 1395718 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289441.1 protein_id gnl|my_center|LOCUS_14210 1398425 1396197 gene locus_tag LOCUS_14220 1398425 1396197 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903584.1 protein_id gnl|my_center|LOCUS_14220 1398744 1398412 gene locus_tag LOCUS_14230 gene ahaH 1398744 1398412 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903585.1 protein_id gnl|my_center|LOCUS_14230 1398860 1399480 gene locus_tag LOCUS_14240 1398860 1399480 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289442.1 protein_id gnl|my_center|LOCUS_14240 1400862 1399666 gene locus_tag LOCUS_14250 1400862 1399666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903587.1 protein_id gnl|my_center|LOCUS_14250 1401053 1402147 gene locus_tag LOCUS_14260 1401053 1402147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_14260 1402233 1403024 gene locus_tag LOCUS_14270 1402233 1403024 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_14270 1403024 1403974 gene locus_tag LOCUS_14280 1403024 1403974 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903590.1 protein_id gnl|my_center|LOCUS_14280 1404036 1404878 gene locus_tag LOCUS_14290 1404036 1404878 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903592.1 protein_id gnl|my_center|LOCUS_14290 1404924 1405484 gene locus_tag LOCUS_14300 1404924 1405484 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903833.1 protein_id gnl|my_center|LOCUS_14300 1405484 1405906 gene locus_tag LOCUS_14310 1405484 1405906 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903834.1 protein_id gnl|my_center|LOCUS_14310 1405903 1406526 gene locus_tag LOCUS_14320 1405903 1406526 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903223.1 protein_id gnl|my_center|LOCUS_14320 1406949 1406584 gene locus_tag LOCUS_14330 1406949 1406584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1408237 1407167 gene locus_tag LOCUS_14340 1408237 1407167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1409089 1408274 gene locus_tag LOCUS_14350 1409089 1408274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1409311 1410204 gene locus_tag LOCUS_14360 1409311 1410204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1410319 1411062 gene locus_tag LOCUS_14370 1410319 1411062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902086.1 protein_id gnl|my_center|LOCUS_14370 1412130 1411084 gene locus_tag LOCUS_14380 1412130 1411084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289510.1 protein_id gnl|my_center|LOCUS_14380 1412819 1412253 gene locus_tag LOCUS_14390 1412819 1412253 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903836.1 protein_id gnl|my_center|LOCUS_14390 1413398 1412820 gene locus_tag LOCUS_14400 1413398 1412820 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903837.1 protein_id gnl|my_center|LOCUS_14400 1414304 1413453 gene locus_tag LOCUS_14410 1414304 1413453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1414472 1415824 gene locus_tag LOCUS_14420 1414472 1415824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1415936 1416895 gene locus_tag LOCUS_14430 1415936 1416895 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966751.1 protein_id gnl|my_center|LOCUS_14430 1416892 1418106 gene locus_tag LOCUS_14440 1416892 1418106 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195809.1 protein_id gnl|my_center|LOCUS_14440 1418103 1418861 gene locus_tag LOCUS_14450 1418103 1418861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185996.1 protein_id gnl|my_center|LOCUS_14450 1418858 1419601 gene locus_tag LOCUS_14460 1418858 1419601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_14460 1419602 1420285 gene locus_tag LOCUS_14470 1419602 1420285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 1420692 1420294 gene locus_tag LOCUS_14480 1420692 1420294 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878487.1 protein_id gnl|my_center|LOCUS_14480 1422210 1420801 gene locus_tag LOCUS_14490 1422210 1420801 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903838.1 protein_id gnl|my_center|LOCUS_14490 1422758 1422327 gene locus_tag LOCUS_14500 1422758 1422327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1423006 1423926 gene locus_tag LOCUS_14510 1423006 1423926 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707531.1 protein_id gnl|my_center|LOCUS_14510 1423936 1424349 gene locus_tag LOCUS_14520 1423936 1424349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1424403 1425053 gene locus_tag LOCUS_14530 gene eda 1424403 1425053 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_14530 1425626 1425105 gene locus_tag LOCUS_14540 1425626 1425105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1427801 1426491 gene locus_tag LOCUS_14550 gene ftsY 1427801 1426491 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903840.1 protein_id gnl|my_center|LOCUS_14550 1428269 1427808 gene locus_tag LOCUS_14560 1428269 1427808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1428439 1428266 gene locus_tag LOCUS_14570 1428439 1428266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1429673 1429008 gene locus_tag LOCUS_14580 1429673 1429008 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903842.1 protein_id gnl|my_center|LOCUS_14580 1429954 1429676 gene locus_tag LOCUS_14590 1429954 1429676 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903843.1 protein_id gnl|my_center|LOCUS_14590 1430106 1429954 gene locus_tag LOCUS_14600 1430106 1429954 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903844.1 protein_id gnl|my_center|LOCUS_14600 1430293 1430745 gene locus_tag LOCUS_14610 1430293 1430745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1431554 1430742 gene locus_tag LOCUS_14620 1431554 1430742 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902664.1 protein_id gnl|my_center|LOCUS_14620 1432374 1431811 gene locus_tag LOCUS_14630 gene thpR 1432374 1431811 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_14630 1432859 1432578 gene locus_tag LOCUS_14640 1432859 1432578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1432944 1433672 gene locus_tag LOCUS_14650 1432944 1433672 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903845.1 protein_id gnl|my_center|LOCUS_14650 1433669 1433959 gene locus_tag LOCUS_14660 1433669 1433959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1434024 1434482 gene locus_tag LOCUS_14670 1434024 1434482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1434566 1435813 gene locus_tag LOCUS_14680 1434566 1435813 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903847.1 protein_id gnl|my_center|LOCUS_14680 1435925 1436464 gene locus_tag LOCUS_14690 1435925 1436464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1436912 1436481 gene locus_tag LOCUS_14700 1436912 1436481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1436805 1437101 gene locus_tag LOCUS_14710 1436805 1437101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1437123 1437551 gene locus_tag LOCUS_14720 1437123 1437551 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903848.1 protein_id gnl|my_center|LOCUS_14720 1437608 1438087 gene locus_tag LOCUS_14730 1437608 1438087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14730 1440406 1438397 gene locus_tag LOCUS_14740 1440406 1438397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1440530 1441456 gene locus_tag LOCUS_14750 1440530 1441456 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902421.1 protein_id gnl|my_center|LOCUS_14750 1441458 1442534 gene locus_tag LOCUS_14760 1441458 1442534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289196.1 protein_id gnl|my_center|LOCUS_14760 1442930 1442613 gene locus_tag LOCUS_14770 1442930 1442613 CDS product DUF5783 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289487.1 protein_id gnl|my_center|LOCUS_14770 1443206 1442973 gene locus_tag LOCUS_14780 1443206 1442973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1444766 1443303 gene locus_tag LOCUS_14790 1444766 1443303 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_14790 1445390 1444842 gene locus_tag LOCUS_14800 1445390 1444842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1445667 1445395 gene locus_tag LOCUS_14810 1445667 1445395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1445853 1446578 gene locus_tag LOCUS_14820 1445853 1446578 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_14820 1447398 1446610 gene locus_tag LOCUS_14830 1447398 1446610 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903740.1 protein_id gnl|my_center|LOCUS_14830 1448159 1447398 gene locus_tag LOCUS_14840 gene cobA 1448159 1447398 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903739.1 protein_id gnl|my_center|LOCUS_14840 1449322 1448156 gene locus_tag LOCUS_14850 gene hemC 1449322 1448156 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903738.1 protein_id gnl|my_center|LOCUS_14850 1449720 1449379 gene locus_tag LOCUS_14860 1449720 1449379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1450259 1449714 gene locus_tag LOCUS_14870 1450259 1449714 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289436.1 protein_id gnl|my_center|LOCUS_14870 1450776 1450402 gene locus_tag LOCUS_14880 1450776 1450402 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903744.1 protein_id gnl|my_center|LOCUS_14880 1450922 1451446 gene locus_tag LOCUS_14890 1450922 1451446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1451936 1451463 gene locus_tag LOCUS_14900 1451936 1451463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1452085 1452657 gene locus_tag LOCUS_14910 1452085 1452657 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086598.1 protein_id gnl|my_center|LOCUS_14910 1452851 1452684 gene locus_tag LOCUS_14920 1452851 1452684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1452995 1453132 gene locus_tag LOCUS_14930 1452995 1453132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1453212 1454192 gene locus_tag LOCUS_14940 gene twy1 1453212 1454192 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903569.1 protein_id gnl|my_center|LOCUS_14940 1454339 1455088 gene locus_tag LOCUS_14950 1454339 1455088 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289437.1 protein_id gnl|my_center|LOCUS_14950 1455075 1455749 gene locus_tag LOCUS_14960 gene ribB 1455075 1455749 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903567.1 protein_id gnl|my_center|LOCUS_14960 1456118 1455888 gene locus_tag LOCUS_14970 1456118 1455888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1456332 1457264 gene locus_tag LOCUS_14980 1456332 1457264 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903564.1 protein_id gnl|my_center|LOCUS_14980 1457944 1457285 gene locus_tag LOCUS_14990 1457944 1457285 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903563.1 protein_id gnl|my_center|LOCUS_14990 1459213 1458038 gene locus_tag LOCUS_15000 gene dgoD 1459213 1458038 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975371.1 protein_id gnl|my_center|LOCUS_15000 1460321 1459437 gene locus_tag LOCUS_15010 1460321 1459437 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902504.1 protein_id gnl|my_center|LOCUS_15010 1460411 1460968 gene locus_tag LOCUS_15020 1460411 1460968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 1461319 1461017 gene locus_tag LOCUS_15030 1461319 1461017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1462646 1461438 gene locus_tag LOCUS_15040 gene metX 1462646 1461438 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289504.1 protein_id gnl|my_center|LOCUS_15040 1463929 1462643 gene locus_tag LOCUS_15050 1463929 1462643 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_15050 1464073 1465026 gene locus_tag LOCUS_15060 1464073 1465026 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_15060 1466689 1465076 gene locus_tag LOCUS_15070 1466689 1465076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1468080 1466692 gene locus_tag LOCUS_15080 1468080 1466692 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_15080 1468682 1468083 gene locus_tag LOCUS_15090 1468682 1468083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1471459 1468682 gene locus_tag LOCUS_15100 1471459 1468682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1471763 1473028 gene locus_tag LOCUS_15110 1471763 1473028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1473085 1473360 gene locus_tag LOCUS_15120 1473085 1473360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1473456 1474394 gene locus_tag LOCUS_15130 1473456 1474394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903775.1 protein_id gnl|my_center|LOCUS_15130 1474391 1475395 gene locus_tag LOCUS_15140 1474391 1475395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1477758 1475560 gene locus_tag LOCUS_15150 1477758 1475560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1479994 1477916 gene locus_tag LOCUS_15160 gene ligA 1479994 1477916 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403650.1 protein_id gnl|my_center|LOCUS_15160 1480407 1480138 gene locus_tag LOCUS_15170 1480407 1480138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1481698 1480595 gene locus_tag LOCUS_15180 1481698 1480595 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888750.1 protein_id gnl|my_center|LOCUS_15180 1482468 1481995 gene locus_tag LOCUS_15190 1482468 1481995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1482606 1483232 gene locus_tag LOCUS_15200 1482606 1483232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1483266 1485011 gene locus_tag LOCUS_15210 1483266 1485011 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903778.1 protein_id gnl|my_center|LOCUS_15210 1485835 1485119 gene locus_tag LOCUS_15220 1485835 1485119 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828730.1 protein_id gnl|my_center|LOCUS_15220 1486098 1487054 gene locus_tag LOCUS_15230 1486098 1487054 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289100.1 protein_id gnl|my_center|LOCUS_15230 1487340 1487594 gene locus_tag LOCUS_15240 1487340 1487594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1488325 1489770 gene locus_tag LOCUS_15250 1488325 1489770 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_15250 1490441 1491523 gene locus_tag LOCUS_15260 1490441 1491523 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479977.1 protein_id gnl|my_center|LOCUS_15260 1491568 1492434 gene locus_tag LOCUS_15270 1491568 1492434 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892496.1 protein_id gnl|my_center|LOCUS_15270 1492562 1493737 gene locus_tag LOCUS_15280 1492562 1493737 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050532079.1 protein_id gnl|my_center|LOCUS_15280 1493878 1495185 gene locus_tag LOCUS_15290 1493878 1495185 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_15290 1495226 1496440 gene locus_tag LOCUS_15300 1495226 1496440 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902643.1 protein_id gnl|my_center|LOCUS_15300 1498302 1496614 gene locus_tag LOCUS_15310 1498302 1496614 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_15310 1499498 1498572 gene locus_tag LOCUS_15320 1499498 1498572 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389603.1 protein_id gnl|my_center|LOCUS_15320 1499912 1503316 gene locus_tag LOCUS_15330 1499912 1503316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1503320 1504045 gene locus_tag LOCUS_15340 1503320 1504045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1504324 1504130 gene locus_tag LOCUS_15350 1504324 1504130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1504784 1505824 gene locus_tag LOCUS_15360 1504784 1505824 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903331.1 protein_id gnl|my_center|LOCUS_15360 1506190 1506963 gene locus_tag LOCUS_15370 1506190 1506963 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903146.1 protein_id gnl|my_center|LOCUS_15370 1507040 1507507 gene locus_tag LOCUS_15380 1507040 1507507 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583738.1 protein_id gnl|my_center|LOCUS_15380 1508290 1507532 gene locus_tag LOCUS_15390 1508290 1507532 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_15390 1509082 1508357 gene locus_tag LOCUS_15400 1509082 1508357 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903144.1 protein_id gnl|my_center|LOCUS_15400 1512968 1509072 gene locus_tag LOCUS_15410 gene cobN 1512968 1509072 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289354.1 protein_id gnl|my_center|LOCUS_15410 1513004 1515160 gene locus_tag LOCUS_15420 1513004 1515160 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903142.1 protein_id gnl|my_center|LOCUS_15420 1515226 1515432 gene locus_tag LOCUS_15430 1515226 1515432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1515432 1516142 gene locus_tag LOCUS_15440 1515432 1516142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1516841 1516155 gene locus_tag LOCUS_15450 1516841 1516155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1518262 1516991 gene locus_tag LOCUS_15460 1518262 1516991 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903141.1 protein_id gnl|my_center|LOCUS_15460 1518626 1518255 gene locus_tag LOCUS_15470 1518626 1518255 CDS product DUF3209 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903140.1 protein_id gnl|my_center|LOCUS_15470 1519874 1518651 gene locus_tag LOCUS_15480 1519874 1518651 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289353.1 protein_id gnl|my_center|LOCUS_15480 1520530 1519871 gene locus_tag LOCUS_15490 1520530 1519871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903138.1 protein_id gnl|my_center|LOCUS_15490 1520799 1520527 gene locus_tag LOCUS_15500 1520799 1520527 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903137.1 protein_id gnl|my_center|LOCUS_15500 1521521 1520799 gene locus_tag LOCUS_15510 1521521 1520799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1521556 1521948 gene locus_tag LOCUS_15520 1521556 1521948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1522837 1521911 gene locus_tag LOCUS_15530 1522837 1521911 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903135.1 protein_id gnl|my_center|LOCUS_15530 1523179 1524111 gene locus_tag LOCUS_15540 1523179 1524111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1525090 1524326 gene locus_tag LOCUS_15550 1525090 1524326 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967180.1 protein_id gnl|my_center|LOCUS_15550 1526218 1525247 gene locus_tag LOCUS_15560 gene cbiG 1526218 1525247 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903134.1 protein_id gnl|my_center|LOCUS_15560 1527472 1526594 gene locus_tag LOCUS_15570 1527472 1526594 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903133.1 protein_id gnl|my_center|LOCUS_15570 1528262 1527465 gene locus_tag LOCUS_15580 1528262 1527465 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903132.1 protein_id gnl|my_center|LOCUS_15580 1528897 1528259 gene locus_tag LOCUS_15590 gene cbiT 1528897 1528259 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903131.1 protein_id gnl|my_center|LOCUS_15590 1530517 1528967 gene locus_tag LOCUS_15600 1530517 1528967 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037583.1 protein_id gnl|my_center|LOCUS_15600 1532669 1530609 gene locus_tag LOCUS_15610 gene uvrB 1532669 1530609 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903784.1 protein_id gnl|my_center|LOCUS_15610 1532875 1533468 gene locus_tag LOCUS_15620 1532875 1533468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1534125 1533514 gene locus_tag LOCUS_15630 1534125 1533514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903785.1 protein_id gnl|my_center|LOCUS_15630 1536735 1534972 gene locus_tag LOCUS_15640 1536735 1534972 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_15640 1537169 1536828 gene locus_tag LOCUS_15650 1537169 1536828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1537405 1537593 gene locus_tag LOCUS_15660 1537405 1537593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1537642 1538319 gene locus_tag LOCUS_15670 1537642 1538319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1538354 1538427 gene locus_tag LOCUS_t00180 1538354 1538427 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1538746 1538973 gene locus_tag LOCUS_15680 1538746 1538973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1539879 1539010 gene locus_tag LOCUS_15690 1539879 1539010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289519.1 protein_id gnl|my_center|LOCUS_15690 1540218 1539991 gene locus_tag LOCUS_15700 1540218 1539991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15700 1540564 1540385 gene locus_tag LOCUS_15710 1540564 1540385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1540985 1540677 gene locus_tag LOCUS_15720 1540985 1540677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1541059 1541478 gene locus_tag LOCUS_15730 1541059 1541478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1542767 1541625 gene locus_tag LOCUS_15740 1542767 1541625 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064526.1 protein_id gnl|my_center|LOCUS_15740 1544238 1543006 gene locus_tag LOCUS_15750 1544238 1543006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1545678 1544383 gene locus_tag LOCUS_15760 1545678 1544383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1546244 1545675 gene locus_tag LOCUS_15770 1546244 1545675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005553844.1 protein_id gnl|my_center|LOCUS_15770 1547321 1546656 gene locus_tag LOCUS_15780 1547321 1546656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1547494 1548075 gene locus_tag LOCUS_15790 1547494 1548075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1548141 1549400 gene locus_tag LOCUS_15800 1548141 1549400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1550515 1550440 gene locus_tag LOCUS_t00190 1550515 1550440 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1550855 1550562 gene locus_tag LOCUS_15810 1550855 1550562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence02 1104 796 gene locus_tag LOCUS_15820 1104 796 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903872.1 protein_id gnl|my_center|LOCUS_15820 1353 1550 gene locus_tag LOCUS_15830 1353 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1655 2707 gene locus_tag LOCUS_15840 1655 2707 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903871.1 protein_id gnl|my_center|LOCUS_15840 2729 3226 gene locus_tag LOCUS_15850 2729 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 5002 3260 gene locus_tag LOCUS_15860 gene pheT 5002 3260 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903870.1 protein_id gnl|my_center|LOCUS_15860 6513 5002 gene locus_tag LOCUS_15870 6513 5002 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903869.1 protein_id gnl|my_center|LOCUS_15870 8438 6789 gene locus_tag LOCUS_15880 8438 6789 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903639.1 protein_id gnl|my_center|LOCUS_15880 9580 8570 gene locus_tag LOCUS_15890 gene endA 9580 8570 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903640.1 protein_id gnl|my_center|LOCUS_15890 10390 9668 gene locus_tag LOCUS_15900 10390 9668 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903641.1 protein_id gnl|my_center|LOCUS_15900 10509 11165 gene locus_tag LOCUS_15910 10509 11165 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_15910 11612 11373 gene locus_tag LOCUS_15920 11612 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 14187 11818 gene locus_tag LOCUS_15930 14187 11818 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903642.1 protein_id gnl|my_center|LOCUS_15930 14376 15209 gene locus_tag LOCUS_15940 14376 15209 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066520.1 protein_id gnl|my_center|LOCUS_15940 15332 15105 gene locus_tag LOCUS_15950 15332 15105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 15397 16293 gene locus_tag LOCUS_15960 gene lipA 15397 16293 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_15960 16411 17676 gene locus_tag LOCUS_15970 16411 17676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 17673 18143 gene locus_tag LOCUS_15980 17673 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 18145 18483 gene locus_tag LOCUS_15990 18145 18483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 18656 19762 gene locus_tag LOCUS_16000 gene pdhA 18656 19762 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_16000 19759 20757 gene locus_tag LOCUS_16010 19759 20757 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_16010 20761 22404 gene locus_tag LOCUS_16020 20761 22404 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903647.1 protein_id gnl|my_center|LOCUS_16020 22460 22858 gene locus_tag LOCUS_16030 22460 22858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 22898 24316 gene locus_tag LOCUS_16040 gene lpdA 22898 24316 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_16040 24457 25086 gene locus_tag LOCUS_16050 24457 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 25172 26011 gene locus_tag LOCUS_16060 25172 26011 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 protein_id gnl|my_center|LOCUS_16060 26087 26902 gene locus_tag LOCUS_16070 gene pheA 26087 26902 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903649.1 protein_id gnl|my_center|LOCUS_16070 26965 27372 gene locus_tag LOCUS_16080 26965 27372 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112905282.1 protein_id gnl|my_center|LOCUS_16080 27375 27827 gene locus_tag LOCUS_16090 gene bcp 27375 27827 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_16090 30547 27860 gene locus_tag LOCUS_16100 gene leuS 30547 27860 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903650.1 protein_id gnl|my_center|LOCUS_16100 32092 30701 gene locus_tag LOCUS_16110 32092 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 32121 32423 gene locus_tag LOCUS_16120 32121 32423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 32423 32590 gene locus_tag LOCUS_16130 32423 32590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 32634 32855 gene locus_tag LOCUS_16140 32634 32855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 33851 32856 gene locus_tag LOCUS_16150 33851 32856 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289464.1 protein_id gnl|my_center|LOCUS_16150 34143 33877 gene locus_tag LOCUS_16160 34143 33877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 34024 34791 gene locus_tag LOCUS_16170 34024 34791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 36809 35145 gene locus_tag LOCUS_16180 gene thsB 36809 35145 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361694.1 protein_id gnl|my_center|LOCUS_16180 37388 36999 gene locus_tag LOCUS_16190 37388 36999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 37506 40316 gene locus_tag LOCUS_16200 gene mutS 37506 40316 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902083.1 protein_id gnl|my_center|LOCUS_16200 41003 40326 gene locus_tag LOCUS_16210 41003 40326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 41163 41411 gene locus_tag LOCUS_16220 41163 41411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 42210 41491 gene locus_tag LOCUS_16230 gene nucS 42210 41491 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902082.1 protein_id gnl|my_center|LOCUS_16230 42657 42220 gene locus_tag LOCUS_16240 42657 42220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 42843 43130 gene locus_tag LOCUS_16250 42843 43130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 43240 44535 gene locus_tag LOCUS_16260 43240 44535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 44536 45549 gene locus_tag LOCUS_16270 44536 45549 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_16270 45622 46461 gene locus_tag LOCUS_16280 45622 46461 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547992.1 protein_id gnl|my_center|LOCUS_16280 46468 46653 gene locus_tag LOCUS_16290 46468 46653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 46728 46865 gene locus_tag LOCUS_16300 46728 46865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 47036 47773 gene locus_tag LOCUS_16310 47036 47773 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903867.1 protein_id gnl|my_center|LOCUS_16310 48278 47802 gene locus_tag LOCUS_16320 48278 47802 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_16320 48536 48372 gene locus_tag LOCUS_16330 48536 48372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 49367 48591 gene locus_tag LOCUS_16340 49367 48591 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903861.1 protein_id gnl|my_center|LOCUS_16340 49514 49801 gene locus_tag LOCUS_16350 49514 49801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360936.1 protein_id gnl|my_center|LOCUS_16350 50329 49919 gene locus_tag LOCUS_16360 50329 49919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 51012 50326 gene locus_tag LOCUS_16370 51012 50326 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_16370 51793 51086 gene locus_tag LOCUS_16380 51793 51086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892529.1 protein_id gnl|my_center|LOCUS_16380 52734 51844 gene locus_tag LOCUS_16390 52734 51844 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903490.1 protein_id gnl|my_center|LOCUS_16390 52888 53901 gene locus_tag LOCUS_16400 52888 53901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 53926 54978 gene locus_tag LOCUS_16410 53926 54978 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_16410 56450 55401 gene locus_tag LOCUS_16420 gene radA 56450 55401 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289511.1 protein_id gnl|my_center|LOCUS_16420 56879 56592 gene locus_tag LOCUS_16430 56879 56592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 57666 57049 gene locus_tag LOCUS_16440 57666 57049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_16440 58921 58049 gene locus_tag LOCUS_16450 gene htpX 58921 58049 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_16450 59050 59943 gene locus_tag LOCUS_16460 59050 59943 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707196.1 protein_id gnl|my_center|LOCUS_16460 60029 61174 gene locus_tag LOCUS_16470 60029 61174 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903850.1 protein_id gnl|my_center|LOCUS_16470 61167 62207 gene locus_tag LOCUS_16480 61167 62207 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903851.1 protein_id gnl|my_center|LOCUS_16480 64129 62390 gene locus_tag LOCUS_16490 64129 62390 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289512.1 protein_id gnl|my_center|LOCUS_16490 64278 64472 gene locus_tag LOCUS_16500 64278 64472 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_16500 64823 64530 gene locus_tag LOCUS_16510 64823 64530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 65149 64820 gene locus_tag LOCUS_16520 65149 64820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 65495 65151 gene locus_tag LOCUS_16530 65495 65151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 65595 66578 gene locus_tag LOCUS_16540 65595 66578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 66799 66584 gene locus_tag LOCUS_16550 66799 66584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289513.1 protein_id gnl|my_center|LOCUS_16550 66910 67896 gene locus_tag LOCUS_16560 66910 67896 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901996.1 protein_id gnl|my_center|LOCUS_16560 67951 68889 gene locus_tag LOCUS_16570 67951 68889 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903859.1 protein_id gnl|my_center|LOCUS_16570 68886 69620 gene locus_tag LOCUS_16580 68886 69620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903860.1 protein_id gnl|my_center|LOCUS_16580 69780 69607 gene locus_tag LOCUS_16590 69780 69607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 69884 70909 gene locus_tag LOCUS_16600 69884 70909 CDS product DUF5784 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289319.1 protein_id gnl|my_center|LOCUS_16600 71051 72046 gene locus_tag LOCUS_16610 71051 72046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 72178 73875 gene locus_tag LOCUS_16620 gene thsA 72178 73875 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_16620 74183 74407 gene locus_tag LOCUS_16630 74183 74407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 74874 74416 gene locus_tag LOCUS_16640 74874 74416 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880029.1 protein_id gnl|my_center|LOCUS_16640 76347 74914 gene locus_tag LOCUS_16650 76347 74914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 76895 76350 gene locus_tag LOCUS_16660 76895 76350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 77498 76941 gene locus_tag LOCUS_16670 77498 76941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 77805 77506 gene locus_tag LOCUS_16680 77805 77506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 78106 78651 gene locus_tag LOCUS_16690 78106 78651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 79494 78652 gene locus_tag LOCUS_16700 79494 78652 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_16700 80872 79571 gene locus_tag LOCUS_16710 80872 79571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 81183 80869 gene locus_tag LOCUS_16720 81183 80869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 81722 81195 gene locus_tag LOCUS_16730 gene cgi121 81722 81195 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903768.1 protein_id gnl|my_center|LOCUS_16730 84124 81722 gene locus_tag LOCUS_16740 84124 81722 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903767.1 protein_id gnl|my_center|LOCUS_16740 84240 84485 gene locus_tag LOCUS_16750 84240 84485 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903766.1 protein_id gnl|my_center|LOCUS_16750 84921 84475 gene locus_tag LOCUS_16760 84921 84475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 85033 86475 gene locus_tag LOCUS_16770 85033 86475 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903796.1 protein_id gnl|my_center|LOCUS_16770 86903 86517 gene locus_tag LOCUS_16780 86903 86517 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_16780 87071 87856 gene locus_tag LOCUS_16790 87071 87856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903794.1 protein_id gnl|my_center|LOCUS_16790 89031 87904 gene locus_tag LOCUS_16800 89031 87904 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903688.1 protein_id gnl|my_center|LOCUS_16800 91205 89115 gene locus_tag LOCUS_16810 91205 89115 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903687.1 protein_id gnl|my_center|LOCUS_16810 91334 92215 gene locus_tag LOCUS_16820 gene larE 91334 92215 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878066.1 protein_id gnl|my_center|LOCUS_16820 92438 92710 gene locus_tag LOCUS_16830 92438 92710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 93447 92818 gene locus_tag LOCUS_16840 93447 92818 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888032.1 protein_id gnl|my_center|LOCUS_16840 95068 93449 gene locus_tag LOCUS_16850 95068 93449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 95173 97371 gene locus_tag LOCUS_16860 gene tatC 95173 97371 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903685.1 protein_id gnl|my_center|LOCUS_16860 97642 97818 gene locus_tag LOCUS_16870 97642 97818 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903684.1 protein_id gnl|my_center|LOCUS_16870 97808 98506 gene locus_tag LOCUS_16880 97808 98506 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903683.1 protein_id gnl|my_center|LOCUS_16880 99316 98525 gene locus_tag LOCUS_16890 99316 98525 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903682.1 protein_id gnl|my_center|LOCUS_16890 99400 99603 gene locus_tag LOCUS_16900 99400 99603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 99618 100703 gene locus_tag LOCUS_16910 gene nirK 99618 100703 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_16910 100833 101603 gene locus_tag LOCUS_16920 100833 101603 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903677.1 protein_id gnl|my_center|LOCUS_16920 101610 102506 gene locus_tag LOCUS_16930 101610 102506 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_16930 102543 103154 gene locus_tag LOCUS_16940 102543 103154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 104102 103158 gene locus_tag LOCUS_16950 104102 103158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 104295 104813 gene locus_tag LOCUS_16960 gene hjc 104295 104813 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903673.1 protein_id gnl|my_center|LOCUS_16960 105479 104832 gene locus_tag LOCUS_16970 105479 104832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 105609 105818 gene locus_tag LOCUS_16980 105609 105818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 106891 105815 gene locus_tag LOCUS_16990 gene priL 106891 105815 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_16990 107173 107325 gene locus_tag LOCUS_17000 107173 107325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 107496 109019 gene locus_tag LOCUS_17010 107496 109019 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_17010 109546 109091 gene locus_tag LOCUS_17020 109546 109091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 111177 109900 gene locus_tag LOCUS_17030 111177 109900 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903672.1 protein_id gnl|my_center|LOCUS_17030 112241 111222 gene locus_tag LOCUS_17040 112241 111222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 113642 112344 gene locus_tag LOCUS_17050 113642 112344 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903671.1 protein_id gnl|my_center|LOCUS_17050 113856 114998 gene locus_tag LOCUS_17060 113856 114998 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957570.1 protein_id gnl|my_center|LOCUS_17060 115067 115915 gene locus_tag LOCUS_17070 gene hisG 115067 115915 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903669.1 protein_id gnl|my_center|LOCUS_17070 116509 116120 gene locus_tag LOCUS_17080 116509 116120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 116534 117628 gene locus_tag LOCUS_17090 116534 117628 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289469.1 protein_id gnl|my_center|LOCUS_17090 118434 117895 gene locus_tag LOCUS_17100 118434 117895 CDS product DUF359 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289421.1 protein_id gnl|my_center|LOCUS_17100 118633 118436 gene locus_tag LOCUS_17110 118633 118436 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_17110 119211 118633 gene locus_tag LOCUS_17120 119211 118633 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903510.1 protein_id gnl|my_center|LOCUS_17120 119592 119215 gene locus_tag LOCUS_17130 119592 119215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903511.1 protein_id gnl|my_center|LOCUS_17130 120821 119592 gene locus_tag LOCUS_17140 120821 119592 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903512.1 protein_id gnl|my_center|LOCUS_17140 121209 122096 gene locus_tag LOCUS_17150 121209 122096 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_17150 122542 122039 gene locus_tag LOCUS_17160 122542 122039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 122453 123403 gene locus_tag LOCUS_17170 122453 123403 CDS product DUF5787 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892531.1 protein_id gnl|my_center|LOCUS_17170 123718 123422 gene locus_tag LOCUS_17180 123718 123422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 124656 123781 gene locus_tag LOCUS_17190 124656 123781 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903514.1 protein_id gnl|my_center|LOCUS_17190 124976 124701 gene locus_tag LOCUS_17200 124976 124701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 126408 125059 gene locus_tag LOCUS_17210 126408 125059 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289423.1 protein_id gnl|my_center|LOCUS_17210 126527 128128 gene locus_tag LOCUS_17220 126527 128128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 128217 128687 gene locus_tag LOCUS_17230 128217 128687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 128788 129921 gene locus_tag LOCUS_17240 128788 129921 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289424.1 protein_id gnl|my_center|LOCUS_17240 130528 130061 gene locus_tag LOCUS_17250 130528 130061 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618872.1 protein_id gnl|my_center|LOCUS_17250 130791 130937 gene locus_tag LOCUS_17260 130791 130937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 131026 131478 gene locus_tag LOCUS_17270 131026 131478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 133379 131475 gene locus_tag LOCUS_17280 133379 131475 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289426.1 protein_id gnl|my_center|LOCUS_17280 134440 133493 gene locus_tag LOCUS_17290 134440 133493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 135384 134476 gene locus_tag LOCUS_17300 135384 134476 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_17300 135492 135935 gene locus_tag LOCUS_17310 135492 135935 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903209.1 protein_id gnl|my_center|LOCUS_17310 136015 137397 gene locus_tag LOCUS_17320 gene serS 136015 137397 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903523.1 protein_id gnl|my_center|LOCUS_17320 137509 138219 gene locus_tag LOCUS_17330 137509 138219 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_17330 138627 138247 gene locus_tag LOCUS_17340 138627 138247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 140294 138624 gene locus_tag LOCUS_17350 140294 138624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 140382 140897 gene locus_tag LOCUS_17360 140382 140897 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289427.1 protein_id gnl|my_center|LOCUS_17360 142140 141067 gene locus_tag LOCUS_17370 142140 141067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 143409 142504 gene locus_tag LOCUS_17380 143409 142504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 144083 143460 gene locus_tag LOCUS_17390 144083 143460 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903529.1 protein_id gnl|my_center|LOCUS_17390 144241 145710 gene locus_tag LOCUS_17400 144241 145710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 146006 146191 gene locus_tag LOCUS_17410 146006 146191 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903530.1 protein_id gnl|my_center|LOCUS_17410 146188 146739 gene locus_tag LOCUS_17420 146188 146739 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_17420 146954 147406 gene locus_tag LOCUS_17430 146954 147406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 147483 148070 gene locus_tag LOCUS_17440 147483 148070 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903532.1 protein_id gnl|my_center|LOCUS_17440 148462 148097 gene locus_tag LOCUS_17450 148462 148097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 148634 149281 gene locus_tag LOCUS_17460 gene hisH 148634 149281 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903536.1 protein_id gnl|my_center|LOCUS_17460 149306 150154 gene locus_tag LOCUS_17470 149306 150154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902223.1 protein_id gnl|my_center|LOCUS_17470 150151 150885 gene locus_tag LOCUS_17480 150151 150885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 151473 151126 gene locus_tag LOCUS_17490 151473 151126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289430.1 protein_id gnl|my_center|LOCUS_17490 151612 153294 gene locus_tag LOCUS_17500 151612 153294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 154371 153691 gene locus_tag LOCUS_17510 154371 153691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 154671 155774 gene locus_tag LOCUS_17520 154671 155774 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903537.1 protein_id gnl|my_center|LOCUS_17520 156247 155837 gene locus_tag LOCUS_17530 156247 155837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 156348 157784 gene locus_tag LOCUS_17540 156348 157784 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421525.1 protein_id gnl|my_center|LOCUS_17540 157856 159091 gene locus_tag LOCUS_17550 157856 159091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 159088 159984 gene locus_tag LOCUS_17560 159088 159984 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289431.1 protein_id gnl|my_center|LOCUS_17560 161348 159993 gene locus_tag LOCUS_17570 gene glnA 161348 159993 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060929.1 protein_id gnl|my_center|LOCUS_17570 161475 161933 gene locus_tag LOCUS_17580 gene lrp 161475 161933 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_17580 162074 162670 gene locus_tag LOCUS_17590 162074 162670 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902501.1 protein_id gnl|my_center|LOCUS_17590 162667 164154 gene locus_tag LOCUS_17600 162667 164154 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_17600 164748 164203 gene locus_tag LOCUS_17610 164748 164203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 164846 165130 gene locus_tag LOCUS_17620 164846 165130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 165401 165985 gene locus_tag LOCUS_17630 165401 165985 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903176.1 protein_id gnl|my_center|LOCUS_17630 167508 165988 gene locus_tag LOCUS_17640 167508 165988 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_17640 166153 166231 gene locus_tag LOCUS_t00200 166153 166231 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 168134 167640 gene locus_tag LOCUS_17650 168134 167640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 168305 169165 gene locus_tag LOCUS_17660 168305 169165 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903620.1 protein_id gnl|my_center|LOCUS_17660 169860 169144 gene locus_tag LOCUS_17670 169860 169144 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_17670 170624 169857 gene locus_tag LOCUS_17680 170624 169857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 171466 170657 gene locus_tag LOCUS_17690 171466 170657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903619.1 protein_id gnl|my_center|LOCUS_17690 171798 171463 gene locus_tag LOCUS_17700 171798 171463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903618.1 protein_id gnl|my_center|LOCUS_17700 172242 171970 gene locus_tag LOCUS_17710 172242 171970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 174340 172244 gene locus_tag LOCUS_17720 174340 172244 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_17720 174496 175647 gene locus_tag LOCUS_17730 174496 175647 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289225.1 protein_id gnl|my_center|LOCUS_17730 175647 177977 gene locus_tag LOCUS_17740 gene htr6 175647 177977 CDS product chemotaxis signal transducer protein Htr6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902553.1 protein_id gnl|my_center|LOCUS_17740 178272 178200 gene locus_tag LOCUS_t00210 178272 178200 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 180193 178328 gene locus_tag LOCUS_17750 180193 178328 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903944.1 protein_id gnl|my_center|LOCUS_17750 180180 180518 gene locus_tag LOCUS_17760 180180 180518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 182660 180552 gene locus_tag LOCUS_17770 182660 180552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 184785 182740 gene locus_tag LOCUS_17780 184785 182740 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289450.1 protein_id gnl|my_center|LOCUS_17780 185072 185494 gene locus_tag LOCUS_17790 185072 185494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 185989 185624 gene locus_tag LOCUS_17800 185989 185624 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_17800 186090 187295 gene locus_tag LOCUS_17810 186090 187295 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903606.1 protein_id gnl|my_center|LOCUS_17810 188010 187297 gene locus_tag LOCUS_17820 188010 187297 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226101.1 protein_id gnl|my_center|LOCUS_17820 188318 188034 gene locus_tag LOCUS_17830 188318 188034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 189204 188356 gene locus_tag LOCUS_17840 189204 188356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 189380 189307 gene locus_tag LOCUS_t00220 189380 189307 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 189549 190001 gene locus_tag LOCUS_17850 189549 190001 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289448.1 protein_id gnl|my_center|LOCUS_17850 190427 189993 gene locus_tag LOCUS_17860 190427 189993 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903601.1 protein_id gnl|my_center|LOCUS_17860 190561 190989 gene locus_tag LOCUS_17870 190561 190989 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144047.1 protein_id gnl|my_center|LOCUS_17870 191650 191036 gene locus_tag LOCUS_17880 191650 191036 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903600.1 protein_id gnl|my_center|LOCUS_17880 192595 191651 gene locus_tag LOCUS_17890 192595 191651 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289447.1 protein_id gnl|my_center|LOCUS_17890 192780 193064 gene locus_tag LOCUS_17900 192780 193064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 193147 194142 gene locus_tag LOCUS_17910 193147 194142 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903598.1 protein_id gnl|my_center|LOCUS_17910 194946 194164 gene locus_tag LOCUS_17920 194946 194164 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903597.1 protein_id gnl|my_center|LOCUS_17920 195467 195015 gene locus_tag LOCUS_17930 195467 195015 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289446.1 protein_id gnl|my_center|LOCUS_17930 195613 197067 gene locus_tag LOCUS_17940 195613 197067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902996.1 protein_id gnl|my_center|LOCUS_17940 197199 197561 gene locus_tag LOCUS_17950 197199 197561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 198190 198477 gene locus_tag LOCUS_17960 198190 198477 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_17960 198881 198537 gene locus_tag LOCUS_17970 198881 198537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 199518 198874 gene locus_tag LOCUS_17980 199518 198874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 200170 199511 gene locus_tag LOCUS_17990 200170 199511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 200768 200319 gene locus_tag LOCUS_18000 200768 200319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 201546 201250 gene locus_tag LOCUS_18010 201546 201250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 202643 201546 gene locus_tag LOCUS_18020 202643 201546 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903593.1 protein_id gnl|my_center|LOCUS_18020 203195 202689 gene locus_tag LOCUS_18030 203195 202689 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903897.1 protein_id gnl|my_center|LOCUS_18030 204576 203227 gene locus_tag LOCUS_18040 204576 203227 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_18040 204705 205733 gene locus_tag LOCUS_18050 204705 205733 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289444.1 protein_id gnl|my_center|LOCUS_18050 205833 206672 gene locus_tag LOCUS_18060 205833 206672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 206993 206664 gene locus_tag LOCUS_18070 206993 206664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 207101 207616 gene locus_tag LOCUS_18080 207101 207616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 208018 207620 gene locus_tag LOCUS_18090 208018 207620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256057.1 protein_id gnl|my_center|LOCUS_18090 209323 208232 gene locus_tag LOCUS_18100 209323 208232 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903831.1 protein_id gnl|my_center|LOCUS_18100 209652 210335 gene locus_tag LOCUS_18110 209652 210335 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902398.1 protein_id gnl|my_center|LOCUS_18110 210901 210392 gene locus_tag LOCUS_18120 210901 210392 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289508.1 protein_id gnl|my_center|LOCUS_18120 210968 211939 gene locus_tag LOCUS_18130 210968 211939 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838058.1 protein_id gnl|my_center|LOCUS_18130 212670 211918 gene locus_tag LOCUS_18140 212670 211918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 212747 214924 gene locus_tag LOCUS_18150 212747 214924 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903824.1 protein_id gnl|my_center|LOCUS_18150 215076 215699 gene locus_tag LOCUS_18160 215076 215699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 215939 216136 gene locus_tag LOCUS_18170 215939 216136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 216568 216089 gene locus_tag LOCUS_18180 216568 216089 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_18180 216664 217296 gene locus_tag LOCUS_18190 gene serB 216664 217296 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360913.1 protein_id gnl|my_center|LOCUS_18190 218867 217569 gene locus_tag LOCUS_18200 218867 217569 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903810.1 protein_id gnl|my_center|LOCUS_18200 220824 219256 gene locus_tag LOCUS_18210 220824 219256 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289503.1 protein_id gnl|my_center|LOCUS_18210 220913 221623 gene locus_tag LOCUS_18220 220913 221623 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903805.1 protein_id gnl|my_center|LOCUS_18220 221755 222405 gene locus_tag LOCUS_18230 221755 222405 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903805.1 protein_id gnl|my_center|LOCUS_18230 224051 222477 gene locus_tag LOCUS_18240 gene orc7 224051 222477 CDS product DNA replication protein Orc7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903800.1 protein_id gnl|my_center|LOCUS_18240 224988 225629 gene locus_tag LOCUS_18250 224988 225629 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289501.1 protein_id gnl|my_center|LOCUS_18250 225634 226017 gene locus_tag LOCUS_18260 225634 226017 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289500.1 protein_id gnl|my_center|LOCUS_18260 226017 226703 gene locus_tag LOCUS_18270 226017 226703 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903797.1 protein_id gnl|my_center|LOCUS_18270 227995 227081 gene locus_tag LOCUS_18280 gene mdh 227995 227081 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903765.1 protein_id gnl|my_center|LOCUS_18280 228123 228935 gene locus_tag LOCUS_18290 228123 228935 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903764.1 protein_id gnl|my_center|LOCUS_18290 231451 228932 gene locus_tag LOCUS_18300 231451 228932 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903758.1 protein_id gnl|my_center|LOCUS_18300 232117 231518 gene locus_tag LOCUS_18310 232117 231518 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289491.1 protein_id gnl|my_center|LOCUS_18310 233854 232118 gene locus_tag LOCUS_18320 gene glyS 233854 232118 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903756.1 protein_id gnl|my_center|LOCUS_18320 234696 233851 gene locus_tag LOCUS_18330 234696 233851 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903755.1 protein_id gnl|my_center|LOCUS_18330 235070 235237 gene locus_tag LOCUS_18340 235070 235237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 235386 236972 gene locus_tag LOCUS_18350 gene serA 235386 236972 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903813.1 protein_id gnl|my_center|LOCUS_18350 241500 237313 gene locus_tag LOCUS_18360 241500 237313 CDS product DNA-directed DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903745.1 protein_id gnl|my_center|LOCUS_18360 241924 241502 gene locus_tag LOCUS_18370 241924 241502 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903746.1 protein_id gnl|my_center|LOCUS_18370 242649 242113 gene locus_tag LOCUS_18380 242649 242113 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289507.1 protein_id gnl|my_center|LOCUS_18380 242851 242663 gene locus_tag LOCUS_18390 242851 242663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 243010 244104 gene locus_tag LOCUS_18400 243010 244104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903588.1 protein_id gnl|my_center|LOCUS_18400 244263 245027 gene locus_tag LOCUS_18410 244263 245027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 245428 246690 gene locus_tag LOCUS_18420 245428 246690 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903821.1 protein_id gnl|my_center|LOCUS_18420 246695 248194 gene locus_tag LOCUS_18430 gene argH 246695 248194 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903820.1 protein_id gnl|my_center|LOCUS_18430 248360 248524 gene locus_tag LOCUS_18440 gene lysW 248360 248524 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_18440 248609 249505 gene locus_tag LOCUS_18450 gene lysX 248609 249505 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_18450 249502 250539 gene locus_tag LOCUS_18460 gene argC 249502 250539 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_18460 250558 251418 gene locus_tag LOCUS_18470 250558 251418 CDS product [LysW]-aminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888059.1 protein_id gnl|my_center|LOCUS_18470 251415 252542 gene locus_tag LOCUS_18480 251415 252542 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_18480 252539 253600 gene locus_tag LOCUS_18490 252539 253600 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888052.1 protein_id gnl|my_center|LOCUS_18490 253602 254498 gene locus_tag LOCUS_18500 gene argF 253602 254498 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_18500 255552 254809 gene locus_tag LOCUS_18510 255552 254809 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902346.1 protein_id gnl|my_center|LOCUS_18510 256607 255630 gene locus_tag LOCUS_18520 256607 255630 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528105.1 protein_id gnl|my_center|LOCUS_18520 257047 257436 gene locus_tag LOCUS_18530 257047 257436 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871026.1 protein_id gnl|my_center|LOCUS_18530 257514 258890 gene locus_tag LOCUS_18540 gene thrC 257514 258890 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903816.1 protein_id gnl|my_center|LOCUS_18540 259165 258983 gene locus_tag LOCUS_18550 259165 258983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 259088 259789 gene locus_tag LOCUS_18560 259088 259789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 259786 260760 gene locus_tag LOCUS_18570 259786 260760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 261165 260767 gene locus_tag LOCUS_18580 261165 260767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 261367 262542 gene locus_tag LOCUS_18590 261367 262542 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903772.1 protein_id gnl|my_center|LOCUS_18590 263225 262557 gene locus_tag LOCUS_18600 gene fer 263225 262557 CDS product ferredoxin Fer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903573.1 protein_id gnl|my_center|LOCUS_18600 264014 263316 gene locus_tag LOCUS_18610 264014 263316 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903770.1 protein_id gnl|my_center|LOCUS_18610 264705 264097 gene locus_tag LOCUS_18620 gene purO 264705 264097 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903769.1 protein_id gnl|my_center|LOCUS_18620 264875 264947 gene locus_tag LOCUS_t00230 264875 264947 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 265123 265554 gene locus_tag LOCUS_18630 265123 265554 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289398.1 protein_id gnl|my_center|LOCUS_18630 266789 265596 gene locus_tag LOCUS_18640 266789 265596 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904113.1 protein_id gnl|my_center|LOCUS_18640 266947 268110 gene locus_tag LOCUS_18650 266947 268110 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902635.1 protein_id gnl|my_center|LOCUS_18650 268283 269839 gene locus_tag LOCUS_18660 268283 269839 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902634.1 protein_id gnl|my_center|LOCUS_18660 269836 271116 gene locus_tag LOCUS_18670 269836 271116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902633.1 protein_id gnl|my_center|LOCUS_18670 271109 272173 gene locus_tag LOCUS_18680 271109 272173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902632.1 protein_id gnl|my_center|LOCUS_18680 272310 274988 gene locus_tag LOCUS_18690 gene leuS 272310 274988 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903650.1 protein_id gnl|my_center|LOCUS_18690 275438 274989 gene locus_tag LOCUS_18700 275438 274989 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902479.1 protein_id gnl|my_center|LOCUS_18700 275737 275447 gene locus_tag LOCUS_18710 275737 275447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 275830 276462 gene locus_tag LOCUS_18720 275830 276462 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496558.1 protein_id gnl|my_center|LOCUS_18720 276555 277982 gene locus_tag LOCUS_18730 276555 277982 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904188.1 protein_id gnl|my_center|LOCUS_18730 277982 278266 gene locus_tag LOCUS_18740 277982 278266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 278327 278494 gene locus_tag LOCUS_18750 278327 278494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 278638 278949 gene locus_tag LOCUS_18760 278638 278949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 279788 279051 gene locus_tag LOCUS_18770 279788 279051 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289293.1 protein_id gnl|my_center|LOCUS_18770 280256 281272 gene locus_tag LOCUS_18780 280256 281272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 281316 281690 gene locus_tag LOCUS_18790 281316 281690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 282415 281687 gene locus_tag LOCUS_18800 282415 281687 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289457.1 protein_id gnl|my_center|LOCUS_18800 282886 282458 gene locus_tag LOCUS_18810 282886 282458 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_18810 283544 282921 gene locus_tag LOCUS_18820 283544 282921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 283545 283820 gene locus_tag LOCUS_18830 283545 283820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 283907 287110 gene locus_tag LOCUS_18840 gene ileS 283907 287110 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903625.1 protein_id gnl|my_center|LOCUS_18840 288086 287232 gene locus_tag LOCUS_18850 288086 287232 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903634.1 protein_id gnl|my_center|LOCUS_18850 288324 289433 gene locus_tag LOCUS_18860 288324 289433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 290284 289481 gene locus_tag LOCUS_18870 290284 289481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903635.1 protein_id gnl|my_center|LOCUS_18870 291623 290286 gene locus_tag LOCUS_18880 291623 290286 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903735.1 protein_id gnl|my_center|LOCUS_18880 291900 293906 gene locus_tag LOCUS_18890 291900 293906 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_18890 294227 295549 gene locus_tag LOCUS_18900 294227 295549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 296065 297831 gene locus_tag LOCUS_18910 296065 297831 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_18910 299425 298097 gene locus_tag LOCUS_18920 299425 298097 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_18920 300268 299624 gene locus_tag LOCUS_18930 300268 299624 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902689.1 protein_id gnl|my_center|LOCUS_18930 301640 300309 gene locus_tag LOCUS_18940 301640 300309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088976.1 protein_id gnl|my_center|LOCUS_18940 302246 301788 gene locus_tag LOCUS_18950 gene lrp 302246 301788 CDS product HTH-type transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903541.1 protein_id gnl|my_center|LOCUS_18950 302618 302256 gene locus_tag LOCUS_18960 302618 302256 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_18960 303939 302611 gene locus_tag LOCUS_18970 303939 302611 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256890.1 protein_id gnl|my_center|LOCUS_18970 304404 306014 gene locus_tag LOCUS_18980 304404 306014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 306014 307363 gene locus_tag LOCUS_18990 306014 307363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 307913 307431 gene locus_tag LOCUS_19000 307913 307431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 309166 307910 gene locus_tag LOCUS_19010 309166 307910 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902121.1 protein_id gnl|my_center|LOCUS_19010 309690 309163 gene locus_tag LOCUS_19020 309690 309163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 310382 309687 gene locus_tag LOCUS_19030 310382 309687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 311634 310708 gene locus_tag LOCUS_19040 gene hemB 311634 310708 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903732.1 protein_id gnl|my_center|LOCUS_19040 312463 311735 gene locus_tag LOCUS_19050 312463 311735 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902530.1 protein_id gnl|my_center|LOCUS_19050 312852 313601 gene locus_tag LOCUS_19060 312852 313601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 313915 313712 gene locus_tag LOCUS_19070 313915 313712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 316049 313962 gene locus_tag LOCUS_19080 316049 313962 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289484.1 protein_id gnl|my_center|LOCUS_19080 316193 316813 gene locus_tag LOCUS_19090 316193 316813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289482.1 protein_id gnl|my_center|LOCUS_19090 316932 317594 gene locus_tag LOCUS_19100 316932 317594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289480.1 protein_id gnl|my_center|LOCUS_19100 318141 318074 gene locus_tag LOCUS_t00240 318141 318074 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 318725 318216 gene locus_tag LOCUS_19110 318725 318216 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903723.1 protein_id gnl|my_center|LOCUS_19110 319003 318725 gene locus_tag LOCUS_19120 319003 318725 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903722.1 protein_id gnl|my_center|LOCUS_19120 319144 320490 gene locus_tag LOCUS_19130 319144 320490 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903721.1 protein_id gnl|my_center|LOCUS_19130 321178 320966 gene locus_tag LOCUS_19140 321178 320966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 321302 321616 gene locus_tag LOCUS_19150 321302 321616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 321647 322060 gene locus_tag LOCUS_19160 321647 322060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 322161 322367 gene locus_tag LOCUS_19170 322161 322367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 323632 322364 gene locus_tag LOCUS_19180 323632 322364 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021002.1 protein_id gnl|my_center|LOCUS_19180 323778 324074 gene locus_tag LOCUS_19190 323778 324074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 324074 325048 gene locus_tag LOCUS_19200 324074 325048 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_19200 325224 327119 gene locus_tag LOCUS_19210 325224 327119 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_19210 327762 327163 gene locus_tag LOCUS_19220 327762 327163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 328442 327759 gene locus_tag LOCUS_19230 328442 327759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 328618 328833 gene locus_tag LOCUS_19240 328618 328833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 329902 328838 gene locus_tag LOCUS_19250 329902 328838 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903720.1 protein_id gnl|my_center|LOCUS_19250 329877 330068 gene locus_tag LOCUS_19260 329877 330068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 330164 330445 gene locus_tag LOCUS_19270 330164 330445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903776.1 protein_id gnl|my_center|LOCUS_19270 331225 330527 gene locus_tag LOCUS_19280 331225 330527 CDS product DUF5828 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903719.1 protein_id gnl|my_center|LOCUS_19280 331484 332176 gene locus_tag LOCUS_19290 331484 332176 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902372.1 protein_id gnl|my_center|LOCUS_19290 332376 333425 gene locus_tag LOCUS_19300 332376 333425 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902359.1 protein_id gnl|my_center|LOCUS_19300 333514 333975 gene locus_tag LOCUS_19310 333514 333975 CDS product DUF1850 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902358.1 protein_id gnl|my_center|LOCUS_19310 333972 336680 gene locus_tag LOCUS_19320 333972 336680 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902357.1 protein_id gnl|my_center|LOCUS_19320 336721 337398 gene locus_tag LOCUS_19330 gene upp 336721 337398 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903718.1 protein_id gnl|my_center|LOCUS_19330 337617 338099 gene locus_tag LOCUS_19340 337617 338099 CDS product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903792.1 protein_id gnl|my_center|LOCUS_19340 338146 338730 gene locus_tag LOCUS_19350 338146 338730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289498.1 protein_id gnl|my_center|LOCUS_19350 340516 339200 gene locus_tag LOCUS_19360 gene glmM 340516 339200 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_19360 340836 340600 gene locus_tag LOCUS_19370 340836 340600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 340835 341521 gene locus_tag LOCUS_19380 gene rpiA 340835 341521 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903689.1 protein_id gnl|my_center|LOCUS_19380 341737 341570 gene locus_tag LOCUS_19390 341737 341570 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903690.1 protein_id gnl|my_center|LOCUS_19390 342026 342790 gene locus_tag LOCUS_19400 gene larB 342026 342790 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_19400 343070 343354 gene locus_tag LOCUS_19410 343070 343354 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_19410 343446 344843 gene locus_tag LOCUS_19420 343446 344843 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903692.1 protein_id gnl|my_center|LOCUS_19420 344887 345651 gene locus_tag LOCUS_19430 344887 345651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903387.1 protein_id gnl|my_center|LOCUS_19430 345654 347300 gene locus_tag LOCUS_19440 345654 347300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 347914 347339 gene locus_tag LOCUS_19450 347914 347339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 348337 347999 gene locus_tag LOCUS_19460 348337 347999 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903693.1 protein_id gnl|my_center|LOCUS_19460 348609 348409 gene locus_tag LOCUS_19470 348609 348409 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289475.1 protein_id gnl|my_center|LOCUS_19470 348689 349666 gene locus_tag LOCUS_19480 348689 349666 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903695.1 protein_id gnl|my_center|LOCUS_19480 349759 350388 gene locus_tag LOCUS_19490 349759 350388 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289264.1 protein_id gnl|my_center|LOCUS_19490 350453 353236 gene locus_tag LOCUS_19500 gene alaS 350453 353236 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903698.1 protein_id gnl|my_center|LOCUS_19500 353587 353778 gene locus_tag LOCUS_19510 353587 353778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 355659 353797 gene locus_tag LOCUS_19520 355659 353797 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289426.1 protein_id gnl|my_center|LOCUS_19520 355742 356503 gene locus_tag LOCUS_19530 gene pcaD 355742 356503 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194488.1 protein_id gnl|my_center|LOCUS_19530 356546 357133 gene locus_tag LOCUS_19540 gene hisB 356546 357133 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903709.1 protein_id gnl|my_center|LOCUS_19540 357209 357712 gene locus_tag LOCUS_19550 357209 357712 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289478.1 protein_id gnl|my_center|LOCUS_19550 357712 358047 gene locus_tag LOCUS_19560 357712 358047 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061340.1 protein_id gnl|my_center|LOCUS_19560 358111 358713 gene locus_tag LOCUS_19570 358111 358713 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903713.1 protein_id gnl|my_center|LOCUS_19570 359805 358720 gene locus_tag LOCUS_19580 359805 358720 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903976.1 protein_id gnl|my_center|LOCUS_19580 361016 359844 gene locus_tag LOCUS_19590 361016 359844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 362075 361131 gene locus_tag LOCUS_19600 gene kdgK1 362075 361131 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_19600 364308 362155 gene locus_tag LOCUS_19610 gene mutL 364308 362155 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902072.1 protein_id gnl|my_center|LOCUS_19610 364443 364586 gene locus_tag LOCUS_19620 364443 364586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 364736 365992 gene locus_tag LOCUS_19630 364736 365992 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902285.1 protein_id gnl|my_center|LOCUS_19630 366085 366591 gene locus_tag LOCUS_19640 366085 366591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 366602 366856 gene locus_tag LOCUS_19650 366602 366856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 367320 366871 gene locus_tag LOCUS_19660 367320 366871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 367701 367390 gene locus_tag LOCUS_19670 367701 367390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289278.1 protein_id gnl|my_center|LOCUS_19670 368086 367703 gene locus_tag LOCUS_19680 368086 367703 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_19680 369622 368438 gene locus_tag LOCUS_19690 369622 368438 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902315.1 protein_id gnl|my_center|LOCUS_19690 370523 369684 gene locus_tag LOCUS_19700 370523 369684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 371476 370631 gene locus_tag LOCUS_19710 371476 370631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 372512 371496 gene locus_tag LOCUS_19720 372512 371496 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_19720 375575 373158 gene locus_tag LOCUS_19730 375575 373158 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535906.1 protein_id gnl|my_center|LOCUS_19730 377910 375970 gene locus_tag LOCUS_19740 377910 375970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 380750 377985 gene locus_tag LOCUS_19750 gene mutS 380750 377985 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902076.1 protein_id gnl|my_center|LOCUS_19750 380856 381248 gene locus_tag LOCUS_19760 380856 381248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 381858 381256 gene locus_tag LOCUS_19770 381858 381256 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229674.1 protein_id gnl|my_center|LOCUS_19770 382010 385732 gene locus_tag LOCUS_19780 382010 385732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 386463 385729 gene locus_tag LOCUS_19790 gene hisA 386463 385729 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903708.1 protein_id gnl|my_center|LOCUS_19790 386574 387491 gene locus_tag LOCUS_19800 386574 387491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 387558 388766 gene locus_tag LOCUS_19810 387558 388766 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_19810 388892 389281 gene locus_tag LOCUS_19820 gene fer2 388892 389281 CDS product ferredoxin Fer2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903707.1 protein_id gnl|my_center|LOCUS_19820 389384 390406 gene locus_tag LOCUS_19830 389384 390406 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289477.1 protein_id gnl|my_center|LOCUS_19830 390454 390816 gene locus_tag LOCUS_19840 gene hisI 390454 390816 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903699.1 protein_id gnl|my_center|LOCUS_19840 390816 391967 gene locus_tag LOCUS_19850 390816 391967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903638.1 protein_id gnl|my_center|LOCUS_19850 393331 391952 gene locus_tag LOCUS_19860 gene glmM 393331 391952 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903637.1 protein_id gnl|my_center|LOCUS_19860 393419 393970 gene locus_tag LOCUS_19870 gene pyrE 393419 393970 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_19870 394056 394304 gene locus_tag LOCUS_19880 394056 394304 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903557.1 protein_id gnl|my_center|LOCUS_19880 395331 394363 gene locus_tag LOCUS_19890 395331 394363 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289434.1 protein_id gnl|my_center|LOCUS_19890 395461 396726 gene locus_tag LOCUS_19900 395461 396726 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903554.1 protein_id gnl|my_center|LOCUS_19900 396844 397050 gene locus_tag LOCUS_19910 396844 397050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 397095 397310 gene locus_tag LOCUS_19920 397095 397310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 398371 397307 gene locus_tag LOCUS_19930 398371 397307 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903552.1 protein_id gnl|my_center|LOCUS_19930 399588 398632 gene locus_tag LOCUS_19940 399588 398632 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903551.1 protein_id gnl|my_center|LOCUS_19940 399640 399939 gene locus_tag LOCUS_19950 399640 399939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 401197 399947 gene locus_tag LOCUS_19960 401197 399947 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903549.1 protein_id gnl|my_center|LOCUS_19960 401404 402549 gene locus_tag LOCUS_19970 gene citZ 401404 402549 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903548.1 protein_id gnl|my_center|LOCUS_19970 404336 402705 gene locus_tag LOCUS_19980 404336 402705 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902419.1 protein_id gnl|my_center|LOCUS_19980 404624 405835 gene locus_tag LOCUS_19990 gene ilvA 404624 405835 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903546.1 protein_id gnl|my_center|LOCUS_19990 406011 406214 gene locus_tag LOCUS_20000 406011 406214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 406244 406325 gene locus_tag LOCUS_t00250 406244 406325 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 406674 408152 gene locus_tag LOCUS_20010 406674 408152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 408553 408182 gene locus_tag LOCUS_20020 408553 408182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 409491 408613 gene locus_tag LOCUS_20030 409491 408613 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_20030 409483 410211 gene locus_tag LOCUS_20040 409483 410211 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903909.1 protein_id gnl|my_center|LOCUS_20040 411307 410234 gene locus_tag LOCUS_20050 411307 410234 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539819.1 protein_id gnl|my_center|LOCUS_20050 412279 411350 gene locus_tag LOCUS_20060 gene rnz 412279 411350 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903662.1 protein_id gnl|my_center|LOCUS_20060 412658 413458 gene locus_tag LOCUS_20070 412658 413458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 413820 414485 gene locus_tag LOCUS_20080 413820 414485 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289405.1 protein_id gnl|my_center|LOCUS_20080 414872 415348 gene locus_tag LOCUS_20090 414872 415348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289420.1 protein_id gnl|my_center|LOCUS_20090 417059 415356 gene locus_tag LOCUS_20100 gene mpcT 417059 415356 CDS product chemotaxis signal transducer protein MpcT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902217.1 protein_id gnl|my_center|LOCUS_20100 417989 417192 gene locus_tag LOCUS_20110 417989 417192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447223.1 protein_id gnl|my_center|LOCUS_20110 418874 418203 gene locus_tag LOCUS_20120 gene rdgB 418874 418203 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903503.1 protein_id gnl|my_center|LOCUS_20120 419260 418985 gene locus_tag LOCUS_20130 419260 418985 CDS product DUF5808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903504.1 protein_id gnl|my_center|LOCUS_20130 421139 419478 gene locus_tag LOCUS_20140 421139 419478 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903505.1 protein_id gnl|my_center|LOCUS_20140 421283 421149 gene locus_tag LOCUS_20150 421283 421149 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903506.1 protein_id gnl|my_center|LOCUS_20150 421592 421284 gene locus_tag LOCUS_20160 421592 421284 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903507.1 protein_id gnl|my_center|LOCUS_20160 422782 421775 gene locus_tag LOCUS_20170 422782 421775 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903663.1 protein_id gnl|my_center|LOCUS_20170 423374 423303 gene locus_tag LOCUS_t00260 423374 423303 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 423585 424418 gene locus_tag LOCUS_20180 423585 424418 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903494.1 protein_id gnl|my_center|LOCUS_20180 425217 424441 gene locus_tag LOCUS_20190 425217 424441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 425930 425256 gene locus_tag LOCUS_20200 425930 425256 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903495.1 protein_id gnl|my_center|LOCUS_20200 425991 426647 gene locus_tag LOCUS_20210 425991 426647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289417.1 protein_id gnl|my_center|LOCUS_20210 426715 426786 gene locus_tag LOCUS_t00270 426715 426786 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 427581 427817 gene locus_tag LOCUS_20220 427581 427817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 427814 428077 gene locus_tag LOCUS_20230 427814 428077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 428590 428150 gene locus_tag LOCUS_20240 428590 428150 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903814.1 protein_id gnl|my_center|LOCUS_20240 429266 428718 gene locus_tag LOCUS_20250 429266 428718 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903653.1 protein_id gnl|my_center|LOCUS_20250 430359 429385 gene locus_tag LOCUS_20260 430359 429385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 431797 430748 gene locus_tag LOCUS_20270 431797 430748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 433008 432073 gene locus_tag LOCUS_20280 gene rio1 433008 432073 CDS product serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_20280 433338 433051 gene locus_tag LOCUS_20290 gene eif1A 433338 433051 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903658.1 protein_id gnl|my_center|LOCUS_20290 435105 433582 gene locus_tag LOCUS_20300 435105 433582 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_20300 435294 436010 gene locus_tag LOCUS_20310 435294 436010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 436848 436012 gene locus_tag LOCUS_20320 436848 436012 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903562.1 protein_id gnl|my_center|LOCUS_20320 437891 436920 gene locus_tag LOCUS_20330 437891 436920 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869212.1 protein_id gnl|my_center|LOCUS_20330 438032 439321 gene locus_tag LOCUS_20340 438032 439321 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_20340 439353 440270 gene locus_tag LOCUS_20350 439353 440270 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_20350 440267 441376 gene locus_tag LOCUS_20360 440267 441376 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391162.1 protein_id gnl|my_center|LOCUS_20360 441369 442181 gene locus_tag LOCUS_20370 441369 442181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_20370 442178 442900 gene locus_tag LOCUS_20380 442178 442900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_20380 443018 443428 gene locus_tag LOCUS_20390 443018 443428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 443467 443712 gene locus_tag LOCUS_20400 443467 443712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 444770 443724 gene locus_tag LOCUS_20410 444770 443724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 446864 444888 gene locus_tag LOCUS_20420 446864 444888 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903661.1 protein_id gnl|my_center|LOCUS_20420 447030 447530 gene locus_tag LOCUS_20430 447030 447530 CDS product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 protein_id gnl|my_center|LOCUS_20430 447608 447955 gene locus_tag LOCUS_20440 447608 447955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 448018 448785 gene locus_tag LOCUS_20450 448018 448785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 448868 449386 gene locus_tag LOCUS_20460 448868 449386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 449852 449415 gene locus_tag LOCUS_20470 449852 449415 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289494.1 protein_id gnl|my_center|LOCUS_20470 450855 449857 gene locus_tag LOCUS_20480 450855 449857 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289495.1 protein_id gnl|my_center|LOCUS_20480 451138 451293 gene locus_tag LOCUS_20490 451138 451293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 451356 452282 gene locus_tag LOCUS_20500 451356 452282 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289328.1 protein_id gnl|my_center|LOCUS_20500 452994 452320 gene locus_tag LOCUS_20510 452994 452320 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361074.1 protein_id gnl|my_center|LOCUS_20510 454416 453031 gene locus_tag LOCUS_20520 gene thiD 454416 453031 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903947.1 protein_id gnl|my_center|LOCUS_20520 454539 454703 gene locus_tag LOCUS_20530 454539 454703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 455581 454709 gene locus_tag LOCUS_20540 455581 454709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 457949 455631 gene locus_tag LOCUS_20550 457949 455631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 458477 458184 gene locus_tag LOCUS_20560 gene yciH 458477 458184 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_20560 460753 458522 gene locus_tag LOCUS_20570 460753 458522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 461724 460750 gene locus_tag LOCUS_20580 461724 460750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 462800 461721 gene locus_tag LOCUS_20590 462800 461721 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_20590 463144 462875 gene locus_tag LOCUS_20600 463144 462875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 463909 463226 gene locus_tag LOCUS_20610 463909 463226 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289497.1 protein_id gnl|my_center|LOCUS_20610 464036 465415 gene locus_tag LOCUS_20620 464036 465415 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289493.1 protein_id gnl|my_center|LOCUS_20620 465514 465732 gene locus_tag LOCUS_20630 465514 465732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 466666 465689 gene locus_tag LOCUS_20640 gene mer 466666 465689 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_20640 467426 466653 gene locus_tag LOCUS_20650 467426 466653 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903932.1 protein_id gnl|my_center|LOCUS_20650 468024 467536 gene locus_tag LOCUS_20660 468024 467536 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909013.1 protein_id gnl|my_center|LOCUS_20660 468401 468099 gene locus_tag LOCUS_20670 468401 468099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_20670 469170 468517 gene locus_tag LOCUS_20680 469170 468517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 469863 469789 gene locus_tag LOCUS_t00280 469863 469789 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 469986 469914 gene locus_tag LOCUS_t00290 469986 469914 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 470499 470179 gene locus_tag LOCUS_20690 470499 470179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 470490 472055 gene locus_tag LOCUS_20700 470490 472055 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755883.1 protein_id gnl|my_center|LOCUS_20700 472057 473883 gene locus_tag LOCUS_20710 gene rpoB 472057 473883 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903997.1 protein_id gnl|my_center|LOCUS_20710 473880 476789 gene locus_tag LOCUS_20720 473880 476789 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903996.1 protein_id gnl|my_center|LOCUS_20720 476792 477979 gene locus_tag LOCUS_20730 gene rpoA2 476792 477979 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903995.1 protein_id gnl|my_center|LOCUS_20730 477979 478404 gene locus_tag LOCUS_20740 477979 478404 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903994.1 protein_id gnl|my_center|LOCUS_20740 480849 478462 gene locus_tag LOCUS_20750 gene htr18 480849 478462 CDS product chemotaxis signal transducer protein Htr18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289229.1 protein_id gnl|my_center|LOCUS_20750 481312 481749 gene locus_tag LOCUS_20760 481312 481749 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903993.1 protein_id gnl|my_center|LOCUS_20760 481752 482372 gene locus_tag LOCUS_20770 481752 482372 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903992.1 protein_id gnl|my_center|LOCUS_20770 482588 483790 gene locus_tag LOCUS_20780 482588 483790 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_20780 483865 484446 gene locus_tag LOCUS_20790 483865 484446 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931542.1 protein_id gnl|my_center|LOCUS_20790 484443 485147 gene locus_tag LOCUS_20800 484443 485147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903729.1 protein_id gnl|my_center|LOCUS_20800 485141 485851 gene locus_tag LOCUS_20810 485141 485851 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289483.1 protein_id gnl|my_center|LOCUS_20810 488997 485899 gene locus_tag LOCUS_20820 488997 485899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 489853 489149 gene locus_tag LOCUS_20830 489853 489149 CDS product DUF5781 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903991.1 protein_id gnl|my_center|LOCUS_20830 489788 489973 gene locus_tag LOCUS_20840 489788 489973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 491200 490007 gene locus_tag LOCUS_20850 491200 490007 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902556.1 protein_id gnl|my_center|LOCUS_20850 491404 493590 gene locus_tag LOCUS_20860 491404 493590 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903990.1 protein_id gnl|my_center|LOCUS_20860 494817 493762 gene locus_tag LOCUS_20870 494817 493762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 494968 495189 gene locus_tag LOCUS_20880 494968 495189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 495269 495802 gene locus_tag LOCUS_20890 495269 495802 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361009.1 protein_id gnl|my_center|LOCUS_20890 495799 496743 gene locus_tag LOCUS_20900 495799 496743 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903987.1 protein_id gnl|my_center|LOCUS_20900 497019 498284 gene locus_tag LOCUS_20910 gene tuf 497019 498284 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903986.1 protein_id gnl|my_center|LOCUS_20910 498288 498599 gene locus_tag LOCUS_20920 gene rpsJ 498288 498599 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903985.1 protein_id gnl|my_center|LOCUS_20920 498738 498809 gene locus_tag LOCUS_t00300 498738 498809 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 499401 500300 gene locus_tag LOCUS_20930 499401 500300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 500574 500738 gene locus_tag LOCUS_20940 500574 500738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 502401 501082 gene locus_tag LOCUS_20950 502401 501082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 504248 502398 gene locus_tag LOCUS_20960 504248 502398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 505715 504579 gene locus_tag LOCUS_20970 505715 504579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 506582 505965 gene locus_tag LOCUS_20980 gene engB 506582 505965 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903933.1 protein_id gnl|my_center|LOCUS_20980 506730 508010 gene locus_tag LOCUS_20990 506730 508010 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289527.1 protein_id gnl|my_center|LOCUS_20990 508072 508782 gene locus_tag LOCUS_21000 508072 508782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 509951 508956 gene locus_tag LOCUS_21010 509951 508956 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903937.1 protein_id gnl|my_center|LOCUS_21010 510046 510363 gene locus_tag LOCUS_21020 510046 510363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 510467 510598 gene locus_tag LOCUS_21030 510467 510598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 512541 510604 gene locus_tag LOCUS_21040 512541 510604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 512900 512604 gene locus_tag LOCUS_21050 gene hisE 512900 512604 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903939.1 protein_id gnl|my_center|LOCUS_21050 513530 512937 gene locus_tag LOCUS_21060 gene pdxT 513530 512937 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903941.1 protein_id gnl|my_center|LOCUS_21060 513697 514731 gene locus_tag LOCUS_21070 513697 514731 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289530.1 protein_id gnl|my_center|LOCUS_21070 515306 514728 gene locus_tag LOCUS_21080 515306 514728 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289529.1 protein_id gnl|my_center|LOCUS_21080 516783 515578 gene locus_tag LOCUS_21090 gene pgk 516783 515578 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902880.1 protein_id gnl|my_center|LOCUS_21090 518108 517104 gene locus_tag LOCUS_21100 gene gap 518108 517104 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403953.1 protein_id gnl|my_center|LOCUS_21100 518310 518696 gene locus_tag LOCUS_21110 518310 518696 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902021.1 protein_id gnl|my_center|LOCUS_21110 519612 518749 gene locus_tag LOCUS_21120 519612 518749 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902022.1 protein_id gnl|my_center|LOCUS_21120 519789 520220 gene locus_tag LOCUS_21130 519789 520220 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903106.1 protein_id gnl|my_center|LOCUS_21130 520475 520278 gene locus_tag LOCUS_21140 520475 520278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 521255 520722 gene locus_tag LOCUS_21150 521255 520722 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902023.1 protein_id gnl|my_center|LOCUS_21150 521481 522473 gene locus_tag LOCUS_21160 521481 522473 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903696.1 protein_id gnl|my_center|LOCUS_21160 522582 523049 gene locus_tag LOCUS_21170 522582 523049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 524135 523083 gene locus_tag LOCUS_21180 gene trmB 524135 523083 CDS product transcriptional regulator TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892507.1 protein_id gnl|my_center|LOCUS_21180 524311 526329 gene locus_tag LOCUS_21190 524311 526329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 527645 526479 gene locus_tag LOCUS_21200 527645 526479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904134.1 protein_id gnl|my_center|LOCUS_21200 529834 527738 gene locus_tag LOCUS_21210 529834 527738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 530015 531325 gene locus_tag LOCUS_21220 530015 531325 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867301.1 protein_id gnl|my_center|LOCUS_21220 531335 532297 gene locus_tag LOCUS_21230 531335 532297 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146501.1 protein_id gnl|my_center|LOCUS_21230 532297 533376 gene locus_tag LOCUS_21240 532297 533376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 533849 533373 gene locus_tag LOCUS_21250 533849 533373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 534749 534027 gene locus_tag LOCUS_21260 gene aglF 534749 534027 CDS product UTP--glucose-1-phosphate uridylyltransferase AglF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901983.1 protein_id gnl|my_center|LOCUS_21260 534777 534983 gene locus_tag LOCUS_21270 534777 534983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 534926 535210 gene locus_tag LOCUS_21280 534926 535210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 535321 536061 gene locus_tag LOCUS_21290 535321 536061 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080615.1 protein_id gnl|my_center|LOCUS_21290 536422 536228 gene locus_tag LOCUS_21300 536422 536228 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_21300 536628 536425 gene locus_tag LOCUS_21310 536628 536425 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_21310 536843 538039 gene locus_tag LOCUS_21320 536843 538039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 538092 538619 gene locus_tag LOCUS_21330 538092 538619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903670.1 protein_id gnl|my_center|LOCUS_21330 541676 538611 gene locus_tag LOCUS_21340 541676 538611 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_21340 542211 541882 gene locus_tag LOCUS_21350 542211 541882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 542686 542318 gene locus_tag LOCUS_21360 542686 542318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 543129 542884 gene locus_tag LOCUS_21370 543129 542884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 543797 543234 gene locus_tag LOCUS_21380 543797 543234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 544808 544341 gene locus_tag LOCUS_21390 544808 544341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 545620 544988 gene locus_tag LOCUS_21400 545620 544988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 545982 547166 gene locus_tag LOCUS_21410 545982 547166 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890475.1 protein_id gnl|my_center|LOCUS_21410 547367 547179 gene locus_tag LOCUS_21420 547367 547179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 548317 548018 gene locus_tag LOCUS_21430 548317 548018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 548466 548756 gene locus_tag LOCUS_21440 548466 548756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 550706 549804 gene locus_tag LOCUS_21450 550706 549804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 550759 551709 gene locus_tag LOCUS_21460 550759 551709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 551768 552376 gene locus_tag LOCUS_21470 551768 552376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 552995 552408 gene locus_tag LOCUS_21480 552995 552408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 553644 553045 gene locus_tag LOCUS_21490 553644 553045 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890465.1 protein_id gnl|my_center|LOCUS_21490 555514 554756 gene locus_tag LOCUS_21500 555514 554756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 555963 555520 gene locus_tag LOCUS_21510 555963 555520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 556616 555960 gene locus_tag LOCUS_21520 556616 555960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 558820 556775 gene locus_tag LOCUS_21530 558820 556775 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_21530 559610 559032 gene locus_tag LOCUS_21540 559610 559032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 559744 559671 gene locus_tag LOCUS_t00310 559744 559671 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 560545 560471 gene locus_tag LOCUS_t00320 560545 560471 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 560774 560625 gene locus_tag LOCUS_21550 560774 560625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 560730 561218 gene locus_tag LOCUS_21560 560730 561218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 561258 563180 gene locus_tag LOCUS_21570 561258 563180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_21570 563905 563474 gene locus_tag LOCUS_21580 563905 563474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 564050 564493 gene locus_tag LOCUS_21590 564050 564493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 565152 564568 gene locus_tag LOCUS_21600 565152 564568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 565465 565199 gene locus_tag LOCUS_21610 565465 565199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 568040 565470 gene locus_tag LOCUS_21620 568040 565470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 568816 568037 gene locus_tag LOCUS_21630 568816 568037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 568934 569458 gene locus_tag LOCUS_21640 568934 569458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 570069 569623 gene locus_tag LOCUS_21650 570069 569623 CDS product DUF5790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902043.1 protein_id gnl|my_center|LOCUS_21650 571281 570175 gene locus_tag LOCUS_21660 571281 570175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 571703 571356 gene locus_tag LOCUS_21670 571703 571356 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902044.1 protein_id gnl|my_center|LOCUS_21670 571778 572551 gene locus_tag LOCUS_21680 gene azf 571778 572551 CDS product NAD-dependent glucose-6-phosphate dehydrogenase Azf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289099.1 protein_id gnl|my_center|LOCUS_21680 573193 572576 gene locus_tag LOCUS_21690 573193 572576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902048.1 protein_id gnl|my_center|LOCUS_21690 573279 573671 gene locus_tag LOCUS_21700 573279 573671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 574006 573934 gene locus_tag LOCUS_t00330 574006 573934 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 574133 574612 gene locus_tag LOCUS_21710 574133 574612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 574805 576271 gene locus_tag LOCUS_21720 574805 576271 CDS product single-stranded DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902049.1 protein_id gnl|my_center|LOCUS_21720 576327 576764 gene locus_tag LOCUS_21730 576327 576764 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902050.1 protein_id gnl|my_center|LOCUS_21730 576765 577772 gene locus_tag LOCUS_21740 576765 577772 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902051.1 protein_id gnl|my_center|LOCUS_21740 579151 577751 gene locus_tag LOCUS_21750 gene cca 579151 577751 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902052.1 protein_id gnl|my_center|LOCUS_21750 579246 579321 gene locus_tag LOCUS_t00340 579246 579321 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 579498 579572 gene locus_tag LOCUS_t00350 579498 579572 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 579745 579975 gene locus_tag LOCUS_21760 579745 579975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 579972 580169 gene locus_tag LOCUS_21770 579972 580169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 580166 580309 gene locus_tag LOCUS_21780 580166 580309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 580312 582072 gene locus_tag LOCUS_21790 580312 582072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 582339 583235 gene locus_tag LOCUS_21800 582339 583235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 583647 583267 gene locus_tag LOCUS_21810 583647 583267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 584983 583808 gene locus_tag LOCUS_21820 584983 583808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 585770 584976 gene locus_tag LOCUS_21830 585770 584976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 586318 585767 gene locus_tag LOCUS_21840 586318 585767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 588154 586325 gene locus_tag LOCUS_21850 588154 586325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 588381 588151 gene locus_tag LOCUS_21860 588381 588151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 588890 588387 gene locus_tag LOCUS_21870 588890 588387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 589416 588934 gene locus_tag LOCUS_21880 589416 588934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 589915 590169 gene locus_tag LOCUS_21890 589915 590169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 590269 591291 gene locus_tag LOCUS_21900 590269 591291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 591651 591292 gene locus_tag LOCUS_21910 591651 591292 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209476515.1 protein_id gnl|my_center|LOCUS_21910 592080 591787 gene locus_tag LOCUS_21920 592080 591787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 592403 592098 gene locus_tag LOCUS_21930 592403 592098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 592822 593859 gene locus_tag LOCUS_21940 592822 593859 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902703.1 protein_id gnl|my_center|LOCUS_21940 594422 594012 gene locus_tag LOCUS_21950 gene nikR 594422 594012 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870053.1 protein_id gnl|my_center|LOCUS_21950 594543 595181 gene locus_tag LOCUS_21960 594543 595181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21960 595181 595495 gene locus_tag LOCUS_21970 595181 595495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21970 595499 596290 gene locus_tag LOCUS_21980 gene cbiQ 595499 596290 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023916.1 protein_id gnl|my_center|LOCUS_21980 596287 597099 gene locus_tag LOCUS_21990 596287 597099 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060749.1 protein_id gnl|my_center|LOCUS_21990 597668 597141 gene locus_tag LOCUS_22000 597668 597141 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_22000 597806 598795 gene locus_tag LOCUS_22010 597806 598795 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086031.1 protein_id gnl|my_center|LOCUS_22010 598878 599249 gene locus_tag LOCUS_22020 598878 599249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 599509 601269 gene locus_tag LOCUS_22030 599509 601269 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858956.1 protein_id gnl|my_center|LOCUS_22030 603634 601352 gene locus_tag LOCUS_22040 603634 601352 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_22040 603810 604382 gene locus_tag LOCUS_22050 603810 604382 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250156.1 protein_id gnl|my_center|LOCUS_22050 605534 605037 gene locus_tag LOCUS_22060 605534 605037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 605667 606017 gene locus_tag LOCUS_22070 605667 606017 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_22070 606046 606345 gene locus_tag LOCUS_22080 606046 606345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 606427 608268 gene locus_tag LOCUS_22090 606427 608268 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903960.1 protein_id gnl|my_center|LOCUS_22090 609395 608283 gene locus_tag LOCUS_22100 gene mthRnl 609395 608283 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_22100 609492 610166 gene locus_tag LOCUS_22110 609492 610166 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879429.1 protein_id gnl|my_center|LOCUS_22110 610417 610163 gene locus_tag LOCUS_22120 610417 610163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 610529 611020 gene locus_tag LOCUS_22130 610529 611020 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 protein_id gnl|my_center|LOCUS_22130 612088 611024 gene locus_tag LOCUS_22140 612088 611024 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_22140 612281 613240 gene locus_tag LOCUS_22150 612281 613240 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_22150 613773 613357 gene locus_tag LOCUS_22160 613773 613357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 613884 614537 gene locus_tag LOCUS_22170 613884 614537 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902018.1 protein_id gnl|my_center|LOCUS_22170 614539 615162 gene locus_tag LOCUS_22180 614539 615162 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_22180 615224 615955 gene locus_tag LOCUS_22190 615224 615955 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902016.1 protein_id gnl|my_center|LOCUS_22190 616398 615952 gene locus_tag LOCUS_22200 616398 615952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 616474 617541 gene locus_tag LOCUS_22210 616474 617541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_22210 617912 617553 gene locus_tag LOCUS_22220 gene crcB 617912 617553 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_22220 618295 617912 gene locus_tag LOCUS_22230 618295 617912 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903409.1 protein_id gnl|my_center|LOCUS_22230 618645 618298 gene locus_tag LOCUS_22240 618645 618298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 618950 620911 gene locus_tag LOCUS_22250 618950 620911 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_22250 620956 621573 gene locus_tag LOCUS_22260 620956 621573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904053.1 protein_id gnl|my_center|LOCUS_22260 621790 622893 gene locus_tag LOCUS_22270 621790 622893 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922354.1 protein_id gnl|my_center|LOCUS_22270 622969 624264 gene locus_tag LOCUS_22280 622969 624264 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838397.1 protein_id gnl|my_center|LOCUS_22280 625033 624287 gene locus_tag LOCUS_22290 625033 624287 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902621.1 protein_id gnl|my_center|LOCUS_22290 625132 626268 gene locus_tag LOCUS_22300 625132 626268 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903606.1 protein_id gnl|my_center|LOCUS_22300 626449 627303 gene locus_tag LOCUS_22310 626449 627303 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775202.1 protein_id gnl|my_center|LOCUS_22310 627621 627322 gene locus_tag LOCUS_22320 627621 627322 CDS product CPCC family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877836.1 protein_id gnl|my_center|LOCUS_22320 627980 627696 gene locus_tag LOCUS_22330 627980 627696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 629178 628015 gene locus_tag LOCUS_22340 629178 628015 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903900.1 protein_id gnl|my_center|LOCUS_22340 629313 630110 gene locus_tag LOCUS_22350 629313 630110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 631473 630118 gene locus_tag LOCUS_22360 631473 630118 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_22360 632923 631466 gene locus_tag LOCUS_22370 632923 631466 CDS product Hvo_1808 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903899.1 protein_id gnl|my_center|LOCUS_22370 633071 633643 gene locus_tag LOCUS_22380 633071 633643 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903898.1 protein_id gnl|my_center|LOCUS_22380 634566 633712 gene locus_tag LOCUS_22390 634566 633712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903896.1 protein_id gnl|my_center|LOCUS_22390 634902 635804 gene locus_tag LOCUS_22400 634902 635804 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903895.1 protein_id gnl|my_center|LOCUS_22400 635829 637160 gene locus_tag LOCUS_22410 635829 637160 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903894.1 protein_id gnl|my_center|LOCUS_22410 637517 637152 gene locus_tag LOCUS_22420 637517 637152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 638446 637517 gene locus_tag LOCUS_22430 638446 637517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903892.1 protein_id gnl|my_center|LOCUS_22430 639525 638443 gene locus_tag LOCUS_22440 639525 638443 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903891.1 protein_id gnl|my_center|LOCUS_22440 641273 639546 gene locus_tag LOCUS_22450 641273 639546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289523.1 protein_id gnl|my_center|LOCUS_22450 644043 641371 gene locus_tag LOCUS_22460 644043 641371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903889.1 protein_id gnl|my_center|LOCUS_22460 644130 644648 gene locus_tag LOCUS_22470 644130 644648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903888.1 protein_id gnl|my_center|LOCUS_22470 645107 644682 gene locus_tag LOCUS_22480 645107 644682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 645847 645119 gene locus_tag LOCUS_22490 645847 645119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 645963 646334 gene locus_tag LOCUS_22500 645963 646334 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289522.1 protein_id gnl|my_center|LOCUS_22500 646331 646852 gene locus_tag LOCUS_22510 646331 646852 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903885.1 protein_id gnl|my_center|LOCUS_22510 647289 646849 gene locus_tag LOCUS_22520 647289 646849 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903884.1 protein_id gnl|my_center|LOCUS_22520 647414 647878 gene locus_tag LOCUS_22530 647414 647878 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289521.1 protein_id gnl|my_center|LOCUS_22530 647922 649010 gene locus_tag LOCUS_22540 647922 649010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903882.1 protein_id gnl|my_center|LOCUS_22540 649122 649574 gene locus_tag LOCUS_22550 649122 649574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 650007 649576 gene locus_tag LOCUS_22560 650007 649576 CDS product DUF5807 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289520.1 protein_id gnl|my_center|LOCUS_22560 650112 650534 gene locus_tag LOCUS_22570 650112 650534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 651438 650560 gene locus_tag LOCUS_22580 gene cheF2 651438 650560 CDS product chemotaxis protein CheF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902685.1 protein_id gnl|my_center|LOCUS_22580 651967 651539 gene locus_tag LOCUS_22590 651967 651539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 652362 651973 gene locus_tag LOCUS_22600 652362 651973 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903878.1 protein_id gnl|my_center|LOCUS_22600 653278 652415 gene locus_tag LOCUS_22610 gene cheF1 653278 652415 CDS product chemotaxis protein CheF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902684.1 protein_id gnl|my_center|LOCUS_22610 654570 653338 gene locus_tag LOCUS_22620 654570 653338 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289252.1 protein_id gnl|my_center|LOCUS_22620 655386 654577 gene locus_tag LOCUS_22630 gene cheR 655386 654577 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289253.1 protein_id gnl|my_center|LOCUS_22630 657374 655383 gene locus_tag LOCUS_22640 gene cheA 657374 655383 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902690.1 protein_id gnl|my_center|LOCUS_22640 658486 657377 gene locus_tag LOCUS_22650 gene cheB 658486 657377 CDS product protein-glutamate methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902691.1 protein_id gnl|my_center|LOCUS_22650 658657 659091 gene locus_tag LOCUS_22660 658657 659091 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902693.1 protein_id gnl|my_center|LOCUS_22660 659180 659905 gene locus_tag LOCUS_22670 659180 659905 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_22670 660061 660396 gene locus_tag LOCUS_22680 660061 660396 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902668.1 protein_id gnl|my_center|LOCUS_22680 660474 660755 gene locus_tag LOCUS_22690 660474 660755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902669.1 protein_id gnl|my_center|LOCUS_22690 661130 661723 gene locus_tag LOCUS_22700 661130 661723 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289250.1 protein_id gnl|my_center|LOCUS_22700 662055 662681 gene locus_tag LOCUS_22710 662055 662681 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289250.1 protein_id gnl|my_center|LOCUS_22710 662772 663347 gene locus_tag LOCUS_22720 662772 663347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902694.1 protein_id gnl|my_center|LOCUS_22720 663477 663959 gene locus_tag LOCUS_22730 663477 663959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 663956 666019 gene locus_tag LOCUS_22740 663956 666019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 666106 666465 gene locus_tag LOCUS_22750 gene cheY 666106 666465 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902692.1 protein_id gnl|my_center|LOCUS_22750 666466 667683 gene locus_tag LOCUS_22760 666466 667683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 667683 668204 gene locus_tag LOCUS_22770 667683 668204 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_22770 668445 670115 gene locus_tag LOCUS_22780 668445 670115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 670099 670536 gene locus_tag LOCUS_22790 670099 670536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 670538 670990 gene locus_tag LOCUS_22800 670538 670990 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902674.1 protein_id gnl|my_center|LOCUS_22800 670987 671748 gene locus_tag LOCUS_22810 670987 671748 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902673.1 protein_id gnl|my_center|LOCUS_22810 671763 673436 gene locus_tag LOCUS_22820 671763 673436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 673439 675187 gene locus_tag LOCUS_22830 gene flaJ 673439 675187 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902671.1 protein_id gnl|my_center|LOCUS_22830 676551 675454 gene locus_tag LOCUS_22840 676551 675454 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903903.1 protein_id gnl|my_center|LOCUS_22840 676763 677719 gene locus_tag LOCUS_22850 676763 677719 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903908.1 protein_id gnl|my_center|LOCUS_22850 678187 677738 gene locus_tag LOCUS_22860 678187 677738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 678332 678916 gene locus_tag LOCUS_22870 678332 678916 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903910.1 protein_id gnl|my_center|LOCUS_22870 678964 679548 gene locus_tag LOCUS_22880 678964 679548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 679637 679711 gene locus_tag LOCUS_t00360 679637 679711 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 680062 680946 gene locus_tag LOCUS_22890 680062 680946 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903859.1 protein_id gnl|my_center|LOCUS_22890 681002 681904 gene locus_tag LOCUS_22900 681002 681904 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969289.1 protein_id gnl|my_center|LOCUS_22900 682017 683411 gene locus_tag LOCUS_22910 682017 683411 CDS product selenium-binding family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977998.1 protein_id gnl|my_center|LOCUS_22910 683434 683751 gene locus_tag LOCUS_22920 683434 683751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 684143 683763 gene locus_tag LOCUS_22930 684143 683763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 684216 684548 gene locus_tag LOCUS_22940 684216 684548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 684604 685932 gene locus_tag LOCUS_22950 684604 685932 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902386.1 protein_id gnl|my_center|LOCUS_22950 687086 686397 gene locus_tag LOCUS_22960 687086 686397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 687570 687196 gene locus_tag LOCUS_22970 687570 687196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 687749 688006 gene locus_tag LOCUS_22980 687749 688006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 688229 688678 gene locus_tag LOCUS_22990 688229 688678 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904153.1 protein_id gnl|my_center|LOCUS_22990 688678 689460 gene locus_tag LOCUS_23000 688678 689460 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_23000 689480 690178 gene locus_tag LOCUS_23010 gene queC 689480 690178 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904151.1 protein_id gnl|my_center|LOCUS_23010 690597 690226 gene locus_tag LOCUS_23020 690597 690226 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186317.1 protein_id gnl|my_center|LOCUS_23020 690934 690656 gene locus_tag LOCUS_23030 690934 690656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 691801 691142 gene locus_tag LOCUS_23040 691801 691142 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902596.1 protein_id gnl|my_center|LOCUS_23040 692485 692024 gene locus_tag LOCUS_23050 692485 692024 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903920.1 protein_id gnl|my_center|LOCUS_23050 692648 694621 gene locus_tag LOCUS_23060 692648 694621 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903922.1 protein_id gnl|my_center|LOCUS_23060 695216 695719 gene locus_tag LOCUS_23070 gene rimI 695216 695719 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289526.1 protein_id gnl|my_center|LOCUS_23070 695868 696344 gene locus_tag LOCUS_23080 695868 696344 CDS product DUF5810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903924.1 protein_id gnl|my_center|LOCUS_23080 696368 696781 gene locus_tag LOCUS_23090 696368 696781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 696781 697194 gene locus_tag LOCUS_23100 696781 697194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 697191 697733 gene locus_tag LOCUS_23110 697191 697733 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903927.1 protein_id gnl|my_center|LOCUS_23110 697772 698158 gene locus_tag LOCUS_23120 697772 698158 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903929.1 protein_id gnl|my_center|LOCUS_23120 698449 699234 gene locus_tag LOCUS_23130 698449 699234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 700282 699278 gene locus_tag LOCUS_23140 700282 699278 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_23140 700614 701765 gene locus_tag LOCUS_23150 700614 701765 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903858.1 protein_id gnl|my_center|LOCUS_23150 701825 702946 gene locus_tag LOCUS_23160 gene pstC 701825 702946 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903857.1 protein_id gnl|my_center|LOCUS_23160 702943 705597 gene locus_tag LOCUS_23170 702943 705597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 705590 706531 gene locus_tag LOCUS_23180 gene pstB 705590 706531 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903855.1 protein_id gnl|my_center|LOCUS_23180 706535 707212 gene locus_tag LOCUS_23190 gene phoU 706535 707212 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_23190 707215 708276 gene locus_tag LOCUS_23200 707215 708276 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_23200 708318 708953 gene locus_tag LOCUS_23210 gene thiE 708318 708953 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_23210 708969 709235 gene locus_tag LOCUS_23220 708969 709235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 709771 709517 gene locus_tag LOCUS_23230 709771 709517 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776425.1 protein_id gnl|my_center|LOCUS_23230 709904 710797 gene locus_tag LOCUS_23240 709904 710797 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_23240 710881 711957 gene locus_tag LOCUS_23250 710881 711957 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902333.1 protein_id gnl|my_center|LOCUS_23250 711997 712785 gene locus_tag LOCUS_23260 711997 712785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 713093 712791 gene locus_tag LOCUS_23270 713093 712791 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036296.1 protein_id gnl|my_center|LOCUS_23270 713386 713565 gene locus_tag LOCUS_23280 713386 713565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 714829 713594 gene locus_tag LOCUS_23290 714829 713594 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903876.1 protein_id gnl|my_center|LOCUS_23290 715544 715239 gene locus_tag LOCUS_23300 715544 715239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 716634 715771 gene locus_tag LOCUS_23310 716634 715771 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289496.1 protein_id gnl|my_center|LOCUS_23310 716900 717694 gene locus_tag LOCUS_23320 716900 717694 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903787.1 protein_id gnl|my_center|LOCUS_23320 718734 717730 gene locus_tag LOCUS_23330 718734 717730 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190913.1 protein_id gnl|my_center|LOCUS_23330 719880 718798 gene locus_tag LOCUS_23340 719880 718798 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289531.1 protein_id gnl|my_center|LOCUS_23340 720423 719962 gene locus_tag LOCUS_23350 720423 719962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 720510 720884 gene locus_tag LOCUS_23360 720510 720884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 721407 720898 gene locus_tag LOCUS_23370 721407 720898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 723337 721391 gene locus_tag LOCUS_23380 723337 721391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 724035 723334 gene locus_tag LOCUS_23390 724035 723334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 725080 724097 gene locus_tag LOCUS_23400 725080 724097 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_23400 726122 725148 gene locus_tag LOCUS_23410 726122 725148 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825317.1 protein_id gnl|my_center|LOCUS_23410 728296 726164 gene locus_tag LOCUS_23420 728296 726164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 730257 728350 gene locus_tag LOCUS_23430 730257 728350 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_23430 731260 730493 gene locus_tag LOCUS_23440 731260 730493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 734321 731343 gene locus_tag LOCUS_23450 gene uvrA 734321 731343 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903972.1 protein_id gnl|my_center|LOCUS_23450 734457 735035 gene locus_tag LOCUS_23460 734457 735035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903971.1 protein_id gnl|my_center|LOCUS_23460 735165 736487 gene locus_tag LOCUS_23470 735165 736487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 737913 736513 gene locus_tag LOCUS_23480 737913 736513 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903965.1 protein_id gnl|my_center|LOCUS_23480 738284 737910 gene locus_tag LOCUS_23490 738284 737910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 738490 738329 gene locus_tag LOCUS_23500 738490 738329 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903942.1 protein_id gnl|my_center|LOCUS_23500 738606 738872 gene locus_tag LOCUS_23510 gene trxA 738606 738872 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903943.1 protein_id gnl|my_center|LOCUS_23510 739672 738920 gene locus_tag LOCUS_23520 739672 738920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 740679 740011 gene locus_tag LOCUS_23530 gene npdG 740679 740011 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903948.1 protein_id gnl|my_center|LOCUS_23530 741118 740729 gene locus_tag LOCUS_23540 741118 740729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 742065 741184 gene locus_tag LOCUS_23550 742065 741184 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_23550 742498 742085 gene locus_tag LOCUS_23560 742498 742085 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903950.1 protein_id gnl|my_center|LOCUS_23560 742529 743050 gene locus_tag LOCUS_23570 742529 743050 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903951.1 protein_id gnl|my_center|LOCUS_23570 743119 743334 gene locus_tag LOCUS_23580 743119 743334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 745222 743393 gene locus_tag LOCUS_23590 745222 743393 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903953.1 protein_id gnl|my_center|LOCUS_23590 745521 745225 gene locus_tag LOCUS_23600 745521 745225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903954.1 protein_id gnl|my_center|LOCUS_23600 745647 745910 gene locus_tag LOCUS_23610 745647 745910 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903955.1 protein_id gnl|my_center|LOCUS_23610 746514 745957 gene locus_tag LOCUS_23620 746514 745957 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902791.1 protein_id gnl|my_center|LOCUS_23620 747337 746516 gene locus_tag LOCUS_23630 747337 746516 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902790.1 protein_id gnl|my_center|LOCUS_23630 749315 747438 gene locus_tag LOCUS_23640 749315 747438 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903956.1 protein_id gnl|my_center|LOCUS_23640 749745 749422 gene locus_tag LOCUS_23650 749745 749422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 749811 750893 gene locus_tag LOCUS_23660 gene argE 749811 750893 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973005.1 protein_id gnl|my_center|LOCUS_23660 750992 752494 gene locus_tag LOCUS_23670 750992 752494 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903957.1 protein_id gnl|my_center|LOCUS_23670 752584 753570 gene locus_tag LOCUS_23680 752584 753570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 753653 754468 gene locus_tag LOCUS_23690 gene moeB 753653 754468 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902012.1 protein_id gnl|my_center|LOCUS_23690 754564 754935 gene locus_tag LOCUS_23700 754564 754935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 755843 754932 gene locus_tag LOCUS_23710 755843 754932 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_23710 755939 756418 gene locus_tag LOCUS_23720 755939 756418 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903982.1 protein_id gnl|my_center|LOCUS_23720 756894 756445 gene locus_tag LOCUS_23730 756894 756445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 756968 757369 gene locus_tag LOCUS_23740 gene sepF 756968 757369 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903980.1 protein_id gnl|my_center|LOCUS_23740 757491 758435 gene locus_tag LOCUS_23750 757491 758435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 protein_id gnl|my_center|LOCUS_23750 758432 759199 gene locus_tag LOCUS_23760 758432 759199 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420864.1 protein_id gnl|my_center|LOCUS_23760 759994 759602 gene locus_tag LOCUS_23770 759994 759602 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903979.1 protein_id gnl|my_center|LOCUS_23770 760887 760033 gene locus_tag LOCUS_23780 760887 760033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903978.1 protein_id gnl|my_center|LOCUS_23780 760943 762343 gene locus_tag LOCUS_23790 760943 762343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 762727 763401 gene locus_tag LOCUS_23800 762727 763401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 763766 764059 gene locus_tag LOCUS_23810 763766 764059 CDS product DUF6432 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903977.1 protein_id gnl|my_center|LOCUS_23810 765251 764073 gene locus_tag LOCUS_23820 765251 764073 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890416.1 protein_id gnl|my_center|LOCUS_23820 765322 765924 gene locus_tag LOCUS_23830 765322 765924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903785.1 protein_id gnl|my_center|LOCUS_23830 767531 765921 gene locus_tag LOCUS_23840 767531 765921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903388.1 protein_id gnl|my_center|LOCUS_23840 768268 767528 gene locus_tag LOCUS_23850 768268 767528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903387.1 protein_id gnl|my_center|LOCUS_23850 769708 768338 gene locus_tag LOCUS_23860 769708 768338 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903984.1 protein_id gnl|my_center|LOCUS_23860 770059 769775 gene locus_tag LOCUS_23870 770059 769775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903983.1 protein_id gnl|my_center|LOCUS_23870 770188 771768 gene locus_tag LOCUS_23880 gene bat 770188 771768 CDS product bacterioopsin transcriptional activator Bat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903066.1 protein_id gnl|my_center|LOCUS_23880 772024 772995 gene locus_tag LOCUS_23890 772024 772995 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903227.1 protein_id gnl|my_center|LOCUS_23890 773044 773769 gene locus_tag LOCUS_23900 gene crtY 773044 773769 CDS product lycopene beta-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289440.1 protein_id gnl|my_center|LOCUS_23900 773760 774791 gene locus_tag LOCUS_23910 773760 774791 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289439.1 protein_id gnl|my_center|LOCUS_23910 775231 774818 gene locus_tag LOCUS_23920 775231 774818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 775850 775260 gene locus_tag LOCUS_23930 775850 775260 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902087.1 protein_id gnl|my_center|LOCUS_23930 776109 778055 gene locus_tag LOCUS_23940 776109 778055 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_23940 778092 778457 gene locus_tag LOCUS_23950 778092 778457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 778858 778472 gene locus_tag LOCUS_23960 778858 778472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 779168 778851 gene locus_tag LOCUS_23970 779168 778851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 779582 779214 gene locus_tag LOCUS_23980 779582 779214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 779674 780075 gene locus_tag LOCUS_23990 779674 780075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 780373 780101 gene locus_tag LOCUS_24000 780373 780101 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023978.1 protein_id gnl|my_center|LOCUS_24000 780526 781500 gene locus_tag LOCUS_24010 780526 781500 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_24010 781590 782372 gene locus_tag LOCUS_24020 781590 782372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 782648 782388 gene locus_tag LOCUS_24030 782648 782388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 782885 783670 gene locus_tag LOCUS_24040 782885 783670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 783909 784928 gene locus_tag LOCUS_24050 783909 784928 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902609.1 protein_id gnl|my_center|LOCUS_24050 785778 784951 gene locus_tag LOCUS_24060 785778 784951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 786151 785825 gene locus_tag LOCUS_24070 786151 785825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 786985 786263 gene locus_tag LOCUS_24080 786985 786263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 787872 786988 gene locus_tag LOCUS_24090 787872 786988 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079927.1 protein_id gnl|my_center|LOCUS_24090 787999 788958 gene locus_tag LOCUS_24100 787999 788958 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902421.1 protein_id gnl|my_center|LOCUS_24100 788951 789997 gene locus_tag LOCUS_24110 788951 789997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 789987 789894 gene locus_tag LOCUS_t00370 789987 789894 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 790561 790031 gene locus_tag LOCUS_24120 790561 790031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 790775 793120 gene locus_tag LOCUS_24130 790775 793120 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050033811.1 protein_id gnl|my_center|LOCUS_24130 794481 793165 gene locus_tag LOCUS_24140 794481 793165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 795655 794474 gene locus_tag LOCUS_24150 795655 794474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_24150 796692 795655 gene locus_tag LOCUS_24160 796692 795655 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_24160 797649 796696 gene locus_tag LOCUS_24170 797649 796696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_24170 799608 797659 gene locus_tag LOCUS_24180 799608 797659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 800464 800042 gene locus_tag LOCUS_24190 800464 800042 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902585.1 protein_id gnl|my_center|LOCUS_24190 802051 801143 gene locus_tag LOCUS_24200 802051 801143 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902089.1 protein_id gnl|my_center|LOCUS_24200 802908 804140 gene locus_tag LOCUS_24210 802908 804140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 805332 804145 gene locus_tag LOCUS_24220 805332 804145 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903039.1 protein_id gnl|my_center|LOCUS_24220 805855 805436 gene locus_tag LOCUS_24230 805855 805436 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_24230 806376 805852 gene locus_tag LOCUS_24240 gene msrA 806376 805852 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421586.1 protein_id gnl|my_center|LOCUS_24240 808078 806441 gene locus_tag LOCUS_24250 808078 806441 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_24250 808167 808844 gene locus_tag LOCUS_24260 808167 808844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 808979 809455 gene locus_tag LOCUS_24270 808979 809455 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289517.1 protein_id gnl|my_center|LOCUS_24270 809734 810528 gene locus_tag LOCUS_24280 809734 810528 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902091.1 protein_id gnl|my_center|LOCUS_24280 811040 810612 gene locus_tag LOCUS_24290 811040 810612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 812203 811454 gene locus_tag LOCUS_24300 812203 811454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 812408 812725 gene locus_tag LOCUS_24310 812408 812725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 812766 813599 gene locus_tag LOCUS_24320 812766 813599 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902092.1 protein_id gnl|my_center|LOCUS_24320 813648 814439 gene locus_tag LOCUS_24330 813648 814439 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289114.1 protein_id gnl|my_center|LOCUS_24330 815001 814417 gene locus_tag LOCUS_24340 815001 814417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 815425 814994 gene locus_tag LOCUS_24350 815425 814994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 816256 815465 gene locus_tag LOCUS_24360 816256 815465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 816392 816147 gene locus_tag LOCUS_24370 816392 816147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 817309 816659 gene locus_tag LOCUS_24380 817309 816659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289115.1 protein_id gnl|my_center|LOCUS_24380 818889 817411 gene locus_tag LOCUS_24390 gene crtD 818889 817411 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_24390 819120 820085 gene locus_tag LOCUS_24400 819120 820085 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260258.1 protein_id gnl|my_center|LOCUS_24400 820064 820873 gene locus_tag LOCUS_24410 820064 820873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902323.1 protein_id gnl|my_center|LOCUS_24410 820962 821957 gene locus_tag LOCUS_24420 820962 821957 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902098.1 protein_id gnl|my_center|LOCUS_24420 823297 822059 gene locus_tag LOCUS_24430 gene ftsZ 823297 822059 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_24430 823476 823300 gene locus_tag LOCUS_24440 823476 823300 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902100.1 protein_id gnl|my_center|LOCUS_24440 824340 823714 gene locus_tag LOCUS_24450 824340 823714 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289117.1 protein_id gnl|my_center|LOCUS_24450 824606 824680 gene locus_tag LOCUS_t00380 824606 824680 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 825998 824817 gene locus_tag LOCUS_24460 825998 824817 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_24460 826523 827512 gene locus_tag LOCUS_24470 826523 827512 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_24470 828620 828285 gene locus_tag LOCUS_24480 828620 828285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 830218 829502 gene locus_tag LOCUS_24490 830218 829502 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_24490 830952 830215 gene locus_tag LOCUS_24500 830952 830215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24500 832070 830949 gene locus_tag LOCUS_24510 832070 830949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 832950 832063 gene locus_tag LOCUS_24520 832950 832063 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089183.1 protein_id gnl|my_center|LOCUS_24520 834312 832954 gene locus_tag LOCUS_24530 834312 832954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089186.1 protein_id gnl|my_center|LOCUS_24530 834526 835665 gene locus_tag LOCUS_24540 834526 835665 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902861.1 protein_id gnl|my_center|LOCUS_24540 836153 835710 gene locus_tag LOCUS_24550 836153 835710 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_24550 836034 836264 gene locus_tag LOCUS_24560 836034 836264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 836425 837240 gene locus_tag LOCUS_24570 836425 837240 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902972.1 protein_id gnl|my_center|LOCUS_24570 837975 837280 gene locus_tag LOCUS_24580 837975 837280 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_24580 838142 839359 gene locus_tag LOCUS_24590 838142 839359 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229261.1 protein_id gnl|my_center|LOCUS_24590 841350 839386 gene locus_tag LOCUS_24600 841350 839386 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902952.1 protein_id gnl|my_center|LOCUS_24600 842588 841518 gene locus_tag LOCUS_24610 842588 841518 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_24610 843426 842632 gene locus_tag LOCUS_24620 843426 842632 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_24620 843597 845252 gene locus_tag LOCUS_24630 843597 845252 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_24630 845400 846461 gene locus_tag LOCUS_24640 845400 846461 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403481.1 protein_id gnl|my_center|LOCUS_24640 847310 846495 gene locus_tag LOCUS_24650 847310 846495 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618766.1 protein_id gnl|my_center|LOCUS_24650 848874 847405 gene locus_tag LOCUS_24660 848874 847405 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903877.1 protein_id gnl|my_center|LOCUS_24660 848957 850120 gene locus_tag LOCUS_24670 848957 850120 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289518.1 protein_id gnl|my_center|LOCUS_24670 850951 850181 gene locus_tag LOCUS_24680 850951 850181 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_24680 851102 852229 gene locus_tag LOCUS_24690 851102 852229 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268699.1 protein_id gnl|my_center|LOCUS_24690 852345 853643 gene locus_tag LOCUS_24700 852345 853643 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259389.1 protein_id gnl|my_center|LOCUS_24700 857125 854075 gene locus_tag LOCUS_24710 857125 854075 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903811.1 protein_id gnl|my_center|LOCUS_24710 857227 857607 gene locus_tag LOCUS_24720 gene gloA 857227 857607 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 protein_id gnl|my_center|LOCUS_24720 858957 857650 gene locus_tag LOCUS_24730 858957 857650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 859370 860134 gene locus_tag LOCUS_24740 859370 860134 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_24740 860971 860618 gene locus_tag LOCUS_24750 860971 860618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 861051 863051 gene locus_tag LOCUS_24760 861051 863051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 863171 867712 gene locus_tag LOCUS_24770 863171 867712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 867832 868707 gene locus_tag LOCUS_24780 867832 868707 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289150.1 protein_id gnl|my_center|LOCUS_24780 868836 869165 gene locus_tag LOCUS_24790 868836 869165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 870252 869176 gene locus_tag LOCUS_24800 870252 869176 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_24800 870373 871863 gene locus_tag LOCUS_24810 gene malQ 870373 871863 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259030.1 protein_id gnl|my_center|LOCUS_24810 872721 871870 gene locus_tag LOCUS_24820 872721 871870 CDS product translation initiation factor eIF-2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903055.1 protein_id gnl|my_center|LOCUS_24820 874030 872810 gene locus_tag LOCUS_24830 874030 872810 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421552.1 protein_id gnl|my_center|LOCUS_24830 875059 874283 gene locus_tag LOCUS_24840 875059 874283 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902034.1 protein_id gnl|my_center|LOCUS_24840 875833 875156 gene locus_tag LOCUS_24850 875833 875156 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902033.1 protein_id gnl|my_center|LOCUS_24850 876579 875920 gene locus_tag LOCUS_24860 876579 875920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 876866 879055 gene locus_tag LOCUS_24870 876866 879055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 879045 880937 gene locus_tag LOCUS_24880 879045 880937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 880934 881659 gene locus_tag LOCUS_24890 880934 881659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 881652 882098 gene locus_tag LOCUS_24900 881652 882098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 882095 882799 gene locus_tag LOCUS_24910 882095 882799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 882792 883196 gene locus_tag LOCUS_24920 882792 883196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 883193 883726 gene locus_tag LOCUS_24930 883193 883726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 884296 883784 gene locus_tag LOCUS_24940 884296 883784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 884443 886047 gene locus_tag LOCUS_24950 884443 886047 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256609.1 protein_id gnl|my_center|LOCUS_24950 886116 886931 gene locus_tag LOCUS_24960 886116 886931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 887244 887477 gene locus_tag LOCUS_24970 887244 887477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 888240 887683 gene locus_tag LOCUS_24980 888240 887683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 889004 888237 gene locus_tag LOCUS_24990 889004 888237 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_24990 890543 889065 gene locus_tag LOCUS_25000 890543 889065 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903150.1 protein_id gnl|my_center|LOCUS_25000 890619 890888 gene locus_tag LOCUS_25010 890619 890888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 891564 890914 gene locus_tag LOCUS_25020 891564 890914 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892603.1 protein_id gnl|my_center|LOCUS_25020 892350 891634 gene locus_tag LOCUS_25030 gene cbiZ 892350 891634 CDS product adenosylcobinamide amidohydrolase CbiZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903156.1 protein_id gnl|my_center|LOCUS_25030 893401 892343 gene locus_tag LOCUS_25040 gene cobD 893401 892343 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903155.1 protein_id gnl|my_center|LOCUS_25040 894004 893459 gene locus_tag LOCUS_25050 894004 893459 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535909.1 protein_id gnl|my_center|LOCUS_25050 894807 894004 gene locus_tag LOCUS_25060 gene cobS 894807 894004 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289358.1 protein_id gnl|my_center|LOCUS_25060 895721 894798 gene locus_tag LOCUS_25070 895721 894798 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903152.1 protein_id gnl|my_center|LOCUS_25070 896353 895715 gene locus_tag LOCUS_25080 896353 895715 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892512.1 protein_id gnl|my_center|LOCUS_25080 896551 896931 gene locus_tag LOCUS_25090 896551 896931 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903290.1 protein_id gnl|my_center|LOCUS_25090 896934 897737 gene locus_tag LOCUS_25100 gene speB 896934 897737 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903289.1 protein_id gnl|my_center|LOCUS_25100 898798 897773 gene locus_tag LOCUS_25110 898798 897773 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289630.1 protein_id gnl|my_center|LOCUS_25110 898904 899890 gene locus_tag LOCUS_25120 898904 899890 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028646.1 protein_id gnl|my_center|LOCUS_25120 900008 900775 gene locus_tag LOCUS_25130 900008 900775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 900827 901594 gene locus_tag LOCUS_25140 900827 901594 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903288.1 protein_id gnl|my_center|LOCUS_25140 901599 902162 gene locus_tag LOCUS_25150 901599 902162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 902492 902163 gene locus_tag LOCUS_25160 902492 902163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 903174 902482 gene locus_tag LOCUS_25170 903174 902482 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522683.1 protein_id gnl|my_center|LOCUS_25170 903308 904315 gene locus_tag LOCUS_25180 903308 904315 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_25180 904433 905434 gene locus_tag LOCUS_25190 904433 905434 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903351.1 protein_id gnl|my_center|LOCUS_25190 905484 905954 gene locus_tag LOCUS_25200 905484 905954 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289136.1 protein_id gnl|my_center|LOCUS_25200 906772 905951 gene locus_tag LOCUS_25210 906772 905951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 908899 906773 gene locus_tag LOCUS_25220 gene lonB 908899 906773 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902178.1 protein_id gnl|my_center|LOCUS_25220 909070 909636 gene locus_tag LOCUS_25230 909070 909636 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902177.1 protein_id gnl|my_center|LOCUS_25230 909636 910412 gene locus_tag LOCUS_25240 909636 910412 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289134.1 protein_id gnl|my_center|LOCUS_25240 910492 912960 gene locus_tag LOCUS_25250 910492 912960 CDS product DUF5059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902140.1 protein_id gnl|my_center|LOCUS_25250 913400 914233 gene locus_tag LOCUS_25260 913400 914233 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902247.1 protein_id gnl|my_center|LOCUS_25260 914356 915669 gene locus_tag LOCUS_25270 914356 915669 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903232.1 protein_id gnl|my_center|LOCUS_25270 916812 915781 gene locus_tag LOCUS_25280 916812 915781 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903186.1 protein_id gnl|my_center|LOCUS_25280 917334 916906 gene locus_tag LOCUS_25290 917334 916906 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_25290 917448 917750 gene locus_tag LOCUS_25300 917448 917750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 918318 917770 gene locus_tag LOCUS_25310 gene hpt 918318 917770 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902373.1 protein_id gnl|my_center|LOCUS_25310 919957 918434 gene locus_tag LOCUS_25320 gene crtI 919957 918434 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289373.1 protein_id gnl|my_center|LOCUS_25320 920107 921171 gene locus_tag LOCUS_25330 920107 921171 CDS product Brp/Blh family beta-carotene 15,15'-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289335.1 protein_id gnl|my_center|LOCUS_25330 921250 922440 gene locus_tag LOCUS_25340 921250 922440 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749467.1 protein_id gnl|my_center|LOCUS_25340 923905 922526 gene locus_tag LOCUS_25350 923905 922526 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904150.1 protein_id gnl|my_center|LOCUS_25350 925549 923960 gene locus_tag LOCUS_25360 925549 923960 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084107.1 protein_id gnl|my_center|LOCUS_25360 926313 925669 gene locus_tag LOCUS_25370 926313 925669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 928947 926515 gene locus_tag LOCUS_25380 gene cosT 928947 926515 CDS product chemotaxis signal transducer protein CosT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903284.1 protein_id gnl|my_center|LOCUS_25380 929928 928954 gene locus_tag LOCUS_25390 929928 928954 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903285.1 protein_id gnl|my_center|LOCUS_25390 930606 931667 gene locus_tag LOCUS_25400 930606 931667 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905873.1 protein_id gnl|my_center|LOCUS_25400 932005 932661 gene locus_tag LOCUS_25410 932005 932661 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361597.1 protein_id gnl|my_center|LOCUS_25410 932658 933257 gene locus_tag LOCUS_25420 932658 933257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 933266 933901 gene locus_tag LOCUS_25430 933266 933901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 935590 933950 gene locus_tag LOCUS_25440 935590 933950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 936903 935716 gene locus_tag LOCUS_25450 936903 935716 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903276.1 protein_id gnl|my_center|LOCUS_25450 937493 936996 gene locus_tag LOCUS_25460 937493 936996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 937624 938439 gene locus_tag LOCUS_25470 gene trpC 937624 938439 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902180.1 protein_id gnl|my_center|LOCUS_25470 938436 939749 gene locus_tag LOCUS_25480 gene trpB 938436 939749 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902181.1 protein_id gnl|my_center|LOCUS_25480 939749 940579 gene locus_tag LOCUS_25490 gene trpA 939749 940579 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902182.1 protein_id gnl|my_center|LOCUS_25490 940606 941409 gene locus_tag LOCUS_25500 940606 941409 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902183.1 protein_id gnl|my_center|LOCUS_25500 942662 941406 gene locus_tag LOCUS_25510 942662 941406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 942904 944070 gene locus_tag LOCUS_25520 942904 944070 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902185.1 protein_id gnl|my_center|LOCUS_25520 944522 944106 gene locus_tag LOCUS_25530 944522 944106 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289138.1 protein_id gnl|my_center|LOCUS_25530 945296 944607 gene locus_tag LOCUS_25540 945296 944607 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289139.1 protein_id gnl|my_center|LOCUS_25540 946361 945333 gene locus_tag LOCUS_25550 946361 945333 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903126.1 protein_id gnl|my_center|LOCUS_25550 947448 946483 gene locus_tag LOCUS_25560 947448 946483 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_25560 948548 947706 gene locus_tag LOCUS_25570 948548 947706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 950657 948840 gene locus_tag LOCUS_25580 950657 948840 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902190.1 protein_id gnl|my_center|LOCUS_25580 952444 950726 gene locus_tag LOCUS_25590 952444 950726 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902165.1 protein_id gnl|my_center|LOCUS_25590 952593 952931 gene locus_tag LOCUS_25600 952593 952931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 954445 952991 gene locus_tag LOCUS_25610 954445 952991 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903565.1 protein_id gnl|my_center|LOCUS_25610 956629 954707 gene locus_tag LOCUS_25620 956629 954707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_25620 957496 956699 gene locus_tag LOCUS_25630 957496 956699 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361083.1 protein_id gnl|my_center|LOCUS_25630 957602 957760 gene locus_tag LOCUS_25640 957602 957760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 957760 958281 gene locus_tag LOCUS_25650 957760 958281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 959415 958312 gene locus_tag LOCUS_25660 959415 958312 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049926525.1 protein_id gnl|my_center|LOCUS_25660 960201 959416 gene locus_tag LOCUS_25670 960201 959416 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289131.1 protein_id gnl|my_center|LOCUS_25670 960892 960272 gene locus_tag LOCUS_25680 960892 960272 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902159.1 protein_id gnl|my_center|LOCUS_25680 961532 961062 gene locus_tag LOCUS_25690 961532 961062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902158.1 protein_id gnl|my_center|LOCUS_25690 962767 961565 gene locus_tag LOCUS_25700 962767 961565 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289129.1 protein_id gnl|my_center|LOCUS_25700 962821 962991 gene locus_tag LOCUS_25710 962821 962991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 964077 962992 gene locus_tag LOCUS_25720 964077 962992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902155.1 protein_id gnl|my_center|LOCUS_25720 965334 964150 gene locus_tag LOCUS_25730 965334 964150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 966274 965384 gene locus_tag LOCUS_25740 966274 965384 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_25740 966771 966271 gene locus_tag LOCUS_25750 966771 966271 CDS product DUF5791 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289128.1 protein_id gnl|my_center|LOCUS_25750 968291 966750 gene locus_tag LOCUS_25760 968291 966750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 969743 968475 gene locus_tag LOCUS_25770 969743 968475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 970600 969740 gene locus_tag LOCUS_25780 970600 969740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 971025 970609 gene locus_tag LOCUS_25790 971025 970609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 971446 970985 gene locus_tag LOCUS_25800 971446 970985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 973226 971481 gene locus_tag LOCUS_25810 973226 971481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 975088 973223 gene locus_tag LOCUS_25820 975088 973223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 975554 975081 gene locus_tag LOCUS_25830 975554 975081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 976066 975551 gene locus_tag LOCUS_25840 976066 975551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 976459 976827 gene locus_tag LOCUS_25850 976459 976827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 976912 978150 gene locus_tag LOCUS_25860 gene mre11 976912 978150 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902340.1 protein_id gnl|my_center|LOCUS_25860 978164 980839 gene locus_tag LOCUS_25870 gene rad50 978164 980839 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_25870 981287 980865 gene locus_tag LOCUS_25880 981287 980865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 981719 981315 gene locus_tag LOCUS_25890 981719 981315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 981951 981760 gene locus_tag LOCUS_25900 981951 981760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 982059 984866 gene locus_tag LOCUS_25910 982059 984866 CDS product DNA polymerase elongation subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902345.1 protein_id gnl|my_center|LOCUS_25910 984992 985924 gene locus_tag LOCUS_25920 984992 985924 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902347.1 protein_id gnl|my_center|LOCUS_25920 985961 987391 gene locus_tag LOCUS_25930 gene sufB 985961 987391 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902348.1 protein_id gnl|my_center|LOCUS_25930 987394 988605 gene locus_tag LOCUS_25940 gene sufD 987394 988605 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902349.1 protein_id gnl|my_center|LOCUS_25940 990431 988800 gene locus_tag LOCUS_25950 990431 988800 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975019.1 protein_id gnl|my_center|LOCUS_25950 990682 991164 gene locus_tag LOCUS_25960 990682 991164 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892592.1 protein_id gnl|my_center|LOCUS_25960 991161 991595 gene locus_tag LOCUS_25970 991161 991595 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902351.1 protein_id gnl|my_center|LOCUS_25970 991655 991727 gene locus_tag LOCUS_t00390 991655 991727 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 992108 992836 gene locus_tag LOCUS_25980 992108 992836 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902448.1 protein_id gnl|my_center|LOCUS_25980 993034 992837 gene locus_tag LOCUS_25990 993034 992837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 993321 994037 gene locus_tag LOCUS_26000 993321 994037 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289173.1 protein_id gnl|my_center|LOCUS_26000 994730 994032 gene locus_tag LOCUS_26010 994730 994032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 995658 994768 gene locus_tag LOCUS_26020 995658 994768 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902245.1 protein_id gnl|my_center|LOCUS_26020 997769 995925 gene locus_tag LOCUS_26030 997769 995925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 997884 998057 gene locus_tag LOCUS_26040 997884 998057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 998084 998515 gene locus_tag LOCUS_26050 998084 998515 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902246.1 protein_id gnl|my_center|LOCUS_26050 1000148 998589 gene locus_tag LOCUS_26060 gene thsA 1000148 998589 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892611.1 protein_id gnl|my_center|LOCUS_26060 1000324 1001133 gene locus_tag LOCUS_26070 1000324 1001133 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902174.1 protein_id gnl|my_center|LOCUS_26070 1002085 1001180 gene locus_tag LOCUS_26080 1002085 1001180 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902173.1 protein_id gnl|my_center|LOCUS_26080 1002883 1002179 gene locus_tag LOCUS_26090 1002883 1002179 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289133.1 protein_id gnl|my_center|LOCUS_26090 1003133 1003402 gene locus_tag LOCUS_26100 1003133 1003402 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902171.1 protein_id gnl|my_center|LOCUS_26100 1003412 1004197 gene locus_tag LOCUS_26110 1003412 1004197 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902170.1 protein_id gnl|my_center|LOCUS_26110 1004231 1004974 gene locus_tag LOCUS_26120 1004231 1004974 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902169.1 protein_id gnl|my_center|LOCUS_26120 1005375 1004977 gene locus_tag LOCUS_26130 1005375 1004977 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902168.1 protein_id gnl|my_center|LOCUS_26130 1005629 1005871 gene locus_tag LOCUS_26140 1005629 1005871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902191.1 protein_id gnl|my_center|LOCUS_26140 1006069 1007949 gene locus_tag LOCUS_26150 1006069 1007949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 1008606 1008001 gene locus_tag LOCUS_26160 1008606 1008001 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902192.1 protein_id gnl|my_center|LOCUS_26160 1009844 1008657 gene locus_tag LOCUS_26170 1009844 1008657 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902193.1 protein_id gnl|my_center|LOCUS_26170 1010512 1009916 gene locus_tag LOCUS_26180 1010512 1009916 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902194.1 protein_id gnl|my_center|LOCUS_26180 1010953 1010585 gene locus_tag LOCUS_26190 1010953 1010585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1013149 1010999 gene locus_tag LOCUS_26200 gene metG 1013149 1010999 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902197.1 protein_id gnl|my_center|LOCUS_26200 1013792 1013214 gene locus_tag LOCUS_26210 1013792 1013214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1014989 1013937 gene locus_tag LOCUS_26220 gene mfnA 1014989 1013937 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902198.1 protein_id gnl|my_center|LOCUS_26220 1016035 1015133 gene locus_tag LOCUS_26230 1016035 1015133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1018403 1016094 gene locus_tag LOCUS_26240 gene ppsA 1018403 1016094 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902200.1 protein_id gnl|my_center|LOCUS_26240 1019481 1018525 gene locus_tag LOCUS_26250 1019481 1018525 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902202.1 protein_id gnl|my_center|LOCUS_26250 1019571 1020320 gene locus_tag LOCUS_26260 1019571 1020320 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902141.1 protein_id gnl|my_center|LOCUS_26260 1020317 1022869 gene locus_tag LOCUS_26270 1020317 1022869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1024526 1022877 gene locus_tag LOCUS_26280 gene hutH 1024526 1022877 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289292.1 protein_id gnl|my_center|LOCUS_26280 1025785 1024523 gene locus_tag LOCUS_26290 gene hutI 1025785 1024523 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902875.1 protein_id gnl|my_center|LOCUS_26290 1026705 1025782 gene locus_tag LOCUS_26300 gene hutG 1026705 1025782 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902874.1 protein_id gnl|my_center|LOCUS_26300 1028450 1026702 gene locus_tag LOCUS_26310 gene hutU 1028450 1026702 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902873.1 protein_id gnl|my_center|LOCUS_26310 1028532 1029176 gene locus_tag LOCUS_26320 1028532 1029176 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902872.1 protein_id gnl|my_center|LOCUS_26320 1030592 1029171 gene locus_tag LOCUS_26330 1030592 1029171 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289401.1 protein_id gnl|my_center|LOCUS_26330 1030746 1031678 gene locus_tag LOCUS_26340 1030746 1031678 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_26340 1031811 1032299 gene locus_tag LOCUS_26350 1031811 1032299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 1032481 1033242 gene locus_tag LOCUS_26360 1032481 1033242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 1033911 1033261 gene locus_tag LOCUS_26370 1033911 1033261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 1034804 1033908 gene locus_tag LOCUS_26380 1034804 1033908 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902138.1 protein_id gnl|my_center|LOCUS_26380 1035391 1034804 gene locus_tag LOCUS_26390 gene dcd 1035391 1034804 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902137.1 protein_id gnl|my_center|LOCUS_26390 1036616 1035483 gene locus_tag LOCUS_26400 1036616 1035483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 1037024 1037362 gene locus_tag LOCUS_26410 gene pth2 1037024 1037362 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902135.1 protein_id gnl|my_center|LOCUS_26410 1037432 1038166 gene locus_tag LOCUS_26420 gene psmA 1037432 1038166 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902078.1 protein_id gnl|my_center|LOCUS_26420 1038166 1038858 gene locus_tag LOCUS_26430 gene psmB 1038166 1038858 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289244.1 protein_id gnl|my_center|LOCUS_26430 1039311 1038916 gene locus_tag LOCUS_26440 1039311 1038916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1041013 1039520 gene locus_tag LOCUS_26450 1041013 1039520 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403779.1 protein_id gnl|my_center|LOCUS_26450 1041796 1041029 gene locus_tag LOCUS_26460 1041796 1041029 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993682.1 protein_id gnl|my_center|LOCUS_26460 1042452 1041793 gene locus_tag LOCUS_26470 gene tenA 1042452 1041793 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144509.1 protein_id gnl|my_center|LOCUS_26470 1042656 1043579 gene locus_tag LOCUS_26480 1042656 1043579 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251147.1 protein_id gnl|my_center|LOCUS_26480 1044573 1043602 gene locus_tag LOCUS_26490 1044573 1043602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1044733 1046136 gene locus_tag LOCUS_26500 1044733 1046136 CDS product TIGR00366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879035.1 protein_id gnl|my_center|LOCUS_26500 1046215 1047564 gene locus_tag LOCUS_26510 1046215 1047564 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902096.1 protein_id gnl|my_center|LOCUS_26510 1047854 1049236 gene locus_tag LOCUS_26520 gene truD 1047854 1049236 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902134.1 protein_id gnl|my_center|LOCUS_26520 1049307 1050002 gene locus_tag LOCUS_26530 1049307 1050002 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902203.1 protein_id gnl|my_center|LOCUS_26530 1050394 1051056 gene locus_tag LOCUS_26540 1050394 1051056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903184.1 protein_id gnl|my_center|LOCUS_26540 1051614 1051345 gene locus_tag LOCUS_26550 1051614 1051345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 1054158 1051906 gene locus_tag LOCUS_26560 1054158 1051906 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903183.1 protein_id gnl|my_center|LOCUS_26560 1056261 1054330 gene locus_tag LOCUS_26570 1056261 1054330 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902678.1 protein_id gnl|my_center|LOCUS_26570 1056426 1056513 gene locus_tag LOCUS_t00400 1056426 1056513 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1056925 1057725 gene locus_tag LOCUS_26580 1056925 1057725 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081258.1 protein_id gnl|my_center|LOCUS_26580 1057729 1058409 gene locus_tag LOCUS_26590 1057729 1058409 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937694.1 protein_id gnl|my_center|LOCUS_26590 1058406 1059158 gene locus_tag LOCUS_26600 1058406 1059158 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_26600 1059162 1060142 gene locus_tag LOCUS_26610 1059162 1060142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1061660 1060143 gene locus_tag LOCUS_26620 1061660 1060143 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_26620 1061822 1062307 gene locus_tag LOCUS_26630 1061822 1062307 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903451.1 protein_id gnl|my_center|LOCUS_26630 1062360 1063067 gene locus_tag LOCUS_26640 1062360 1063067 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289362.1 protein_id gnl|my_center|LOCUS_26640 1063710 1063189 gene locus_tag LOCUS_26650 1063710 1063189 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209000318.1 protein_id gnl|my_center|LOCUS_26650 1065362 1064025 gene locus_tag LOCUS_26660 gene hmgB 1065362 1064025 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_26660 1066147 1065461 gene locus_tag LOCUS_26670 1066147 1065461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 1066329 1067078 gene locus_tag LOCUS_26680 1066329 1067078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 1069109 1067112 gene locus_tag LOCUS_26690 1069109 1067112 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289361.1 protein_id gnl|my_center|LOCUS_26690 1069737 1069156 gene locus_tag LOCUS_26700 1069737 1069156 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903173.1 protein_id gnl|my_center|LOCUS_26700 1069950 1070258 gene locus_tag LOCUS_26710 1069950 1070258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 1071477 1070260 gene locus_tag LOCUS_26720 1071477 1070260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1072486 1071578 gene locus_tag LOCUS_26730 gene pdxS 1072486 1071578 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903311.1 protein_id gnl|my_center|LOCUS_26730 1072653 1073423 gene locus_tag LOCUS_26740 1072653 1073423 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903310.1 protein_id gnl|my_center|LOCUS_26740 1073634 1073458 gene locus_tag LOCUS_26750 1073634 1073458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 1076400 1073728 gene locus_tag LOCUS_26760 1076400 1073728 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903904.1 protein_id gnl|my_center|LOCUS_26760 1076637 1078334 gene locus_tag LOCUS_26770 1076637 1078334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 1079423 1078518 gene locus_tag LOCUS_26780 1079423 1078518 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892517.1 protein_id gnl|my_center|LOCUS_26780 1079939 1080868 gene locus_tag LOCUS_26790 1079939 1080868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1081736 1080939 gene locus_tag LOCUS_26800 1081736 1080939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 1082973 1082458 gene locus_tag LOCUS_26810 1082973 1082458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 1084514 1082988 gene locus_tag LOCUS_26820 1084514 1082988 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903305.1 protein_id gnl|my_center|LOCUS_26820 1084725 1084516 gene locus_tag LOCUS_26830 1084725 1084516 CDS product DUF3311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903304.1 protein_id gnl|my_center|LOCUS_26830 1085145 1084801 gene locus_tag LOCUS_26840 1085145 1084801 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810814.1 protein_id gnl|my_center|LOCUS_26840 1085197 1085907 gene locus_tag LOCUS_26850 1085197 1085907 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_26850 1086087 1087424 gene locus_tag LOCUS_26860 gene dnaG 1086087 1087424 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289379.1 protein_id gnl|my_center|LOCUS_26860 1087837 1087421 gene locus_tag LOCUS_26870 1087837 1087421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1089192 1087834 gene locus_tag LOCUS_26880 1089192 1087834 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289378.1 protein_id gnl|my_center|LOCUS_26880 1089252 1089896 gene locus_tag LOCUS_26890 1089252 1089896 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289377.1 protein_id gnl|my_center|LOCUS_26890 1090811 1089897 gene locus_tag LOCUS_26900 gene uppS 1090811 1089897 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903300.1 protein_id gnl|my_center|LOCUS_26900 1090939 1091133 gene locus_tag LOCUS_26910 1090939 1091133 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_26910 1091136 1091330 gene locus_tag LOCUS_26920 1091136 1091330 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289092.1 protein_id gnl|my_center|LOCUS_26920 1091504 1091914 gene locus_tag LOCUS_26930 1091504 1091914 CDS product DUF5778 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903299.1 protein_id gnl|my_center|LOCUS_26930 1092210 1091920 gene locus_tag LOCUS_26940 1092210 1091920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1092312 1093367 gene locus_tag LOCUS_26950 1092312 1093367 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903298.1 protein_id gnl|my_center|LOCUS_26950 1093414 1094061 gene locus_tag LOCUS_26960 1093414 1094061 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903297.1 protein_id gnl|my_center|LOCUS_26960 1094058 1095404 gene locus_tag LOCUS_26970 gene hemA 1094058 1095404 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903296.1 protein_id gnl|my_center|LOCUS_26970 1095446 1095724 gene locus_tag LOCUS_26980 1095446 1095724 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903295.1 protein_id gnl|my_center|LOCUS_26980 1095735 1096154 gene locus_tag LOCUS_26990 1095735 1096154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1096263 1096910 gene locus_tag LOCUS_27000 1096263 1096910 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903294.1 protein_id gnl|my_center|LOCUS_27000 1097824 1096898 gene locus_tag LOCUS_27010 1097824 1096898 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151112700.1 protein_id gnl|my_center|LOCUS_27010 1097935 1098711 gene locus_tag LOCUS_27020 1097935 1098711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 1098711 1099115 gene locus_tag LOCUS_27030 1098711 1099115 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903293.1 protein_id gnl|my_center|LOCUS_27030 1099134 1100852 gene locus_tag LOCUS_27040 1099134 1100852 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_27040 1101400 1100873 gene locus_tag LOCUS_27050 1101400 1100873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 1102338 1101568 gene locus_tag LOCUS_27060 1102338 1101568 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_27060 1102602 1104095 gene locus_tag LOCUS_27070 1102602 1104095 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_27070 1104102 1104512 gene locus_tag LOCUS_27080 1104102 1104512 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902960.1 protein_id gnl|my_center|LOCUS_27080 1105456 1104509 gene locus_tag LOCUS_27090 1105456 1104509 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_27090 1105542 1105626 gene locus_tag LOCUS_t00410 1105542 1105626 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1107555 1105699 gene locus_tag LOCUS_27100 1107555 1105699 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902126.1 protein_id gnl|my_center|LOCUS_27100 1108180 1107611 gene locus_tag LOCUS_27110 1108180 1107611 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902125.1 protein_id gnl|my_center|LOCUS_27110 1109347 1108250 gene locus_tag LOCUS_27120 1109347 1108250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 1109966 1109418 gene locus_tag LOCUS_27130 1109966 1109418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1109979 1110395 gene locus_tag LOCUS_27140 1109979 1110395 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289124.1 protein_id gnl|my_center|LOCUS_27140 1110589 1112097 gene locus_tag LOCUS_27150 1110589 1112097 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_27150 1113134 1112166 gene locus_tag LOCUS_27160 1113134 1112166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 1113863 1113564 gene locus_tag LOCUS_27170 1113863 1113564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1116416 1113963 gene locus_tag LOCUS_27180 1116416 1113963 CDS product bacterio-opsin activator domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289108.1 protein_id gnl|my_center|LOCUS_27180 1117181 1116507 gene locus_tag LOCUS_27190 1117181 1116507 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902025.1 protein_id gnl|my_center|LOCUS_27190 1117686 1117225 gene locus_tag LOCUS_27200 1117686 1117225 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_27200 1118001 1118510 gene locus_tag LOCUS_27210 1118001 1118510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1118583 1118915 gene locus_tag LOCUS_27220 1118583 1118915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1119205 1118969 gene locus_tag LOCUS_27230 1119205 1118969 CDS product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902128.1 protein_id gnl|my_center|LOCUS_27230 1119599 1119210 gene locus_tag LOCUS_27240 1119599 1119210 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902129.1 protein_id gnl|my_center|LOCUS_27240 1119757 1120161 gene locus_tag LOCUS_27250 1119757 1120161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 1120492 1120175 gene locus_tag LOCUS_27260 1120492 1120175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1121131 1120622 gene locus_tag LOCUS_27270 1121131 1120622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1121457 1121128 gene locus_tag LOCUS_27280 1121457 1121128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 1121589 1122425 gene locus_tag LOCUS_27290 1121589 1122425 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902142.1 protein_id gnl|my_center|LOCUS_27290 1122487 1123215 gene locus_tag LOCUS_27300 1122487 1123215 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902133.1 protein_id gnl|my_center|LOCUS_27300 1124119 1123475 gene locus_tag LOCUS_27310 1124119 1123475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1124195 1124503 gene locus_tag LOCUS_27320 1124195 1124503 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289127.1 protein_id gnl|my_center|LOCUS_27320 1124530 1124664 gene locus_tag LOCUS_27330 1124530 1124664 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902130.1 protein_id gnl|my_center|LOCUS_27330 1124763 1125014 gene locus_tag LOCUS_27340 1124763 1125014 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289126.1 protein_id gnl|my_center|LOCUS_27340 1125638 1125039 gene locus_tag LOCUS_27350 1125638 1125039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902733.1 protein_id gnl|my_center|LOCUS_27350 1125717 1126358 gene locus_tag LOCUS_27360 1125717 1126358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903726.1 protein_id gnl|my_center|LOCUS_27360 1126376 1126981 gene locus_tag LOCUS_27370 1126376 1126981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903725.1 protein_id gnl|my_center|LOCUS_27370 1127220 1129982 gene locus_tag LOCUS_27380 1127220 1129982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1130187 1130501 gene locus_tag LOCUS_27390 1130187 1130501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1130582 1131343 gene locus_tag LOCUS_27400 1130582 1131343 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289160.1 protein_id gnl|my_center|LOCUS_27400 1131512 1132342 gene locus_tag LOCUS_27410 gene hop 1131512 1132342 CDS product halorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902090.1 protein_id gnl|my_center|LOCUS_27410 1132475 1132657 gene locus_tag LOCUS_27420 1132475 1132657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1134375 1133071 gene locus_tag LOCUS_27430 gene aspS 1134375 1133071 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_27430 1134566 1135465 gene locus_tag LOCUS_27440 1134566 1135465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 1135462 1136211 gene locus_tag LOCUS_27450 1135462 1136211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1136208 1136780 gene locus_tag LOCUS_27460 1136208 1136780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1136930 1137421 gene locus_tag LOCUS_27470 1136930 1137421 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902895.1 protein_id gnl|my_center|LOCUS_27470 1137548 1138012 gene locus_tag LOCUS_27480 1137548 1138012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 1138015 1140219 gene locus_tag LOCUS_27490 1138015 1140219 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404998.1 protein_id gnl|my_center|LOCUS_27490 1140933 1140220 gene locus_tag LOCUS_27500 1140933 1140220 CDS product putative phosphoglycerol geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902143.1 protein_id gnl|my_center|LOCUS_27500 1141088 1141564 gene locus_tag LOCUS_27510 1141088 1141564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1141584 1142033 gene locus_tag LOCUS_27520 1141584 1142033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1142030 1142221 gene locus_tag LOCUS_27530 1142030 1142221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1144717 1142234 gene locus_tag LOCUS_27540 1144717 1142234 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_27540 1144944 1145489 gene locus_tag LOCUS_27550 1144944 1145489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1145621 1145956 gene locus_tag LOCUS_27560 1145621 1145956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 1147527 1146010 gene locus_tag LOCUS_27570 gene gatB 1147527 1146010 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902210.1 protein_id gnl|my_center|LOCUS_27570 1147636 1148427 gene locus_tag LOCUS_27580 1147636 1148427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 1148460 1148807 gene locus_tag LOCUS_27590 1148460 1148807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 1148829 1152416 gene locus_tag LOCUS_27600 gene smc 1148829 1152416 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902208.1 protein_id gnl|my_center|LOCUS_27600 1152409 1153434 gene locus_tag LOCUS_27610 1152409 1153434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 1153516 1154619 gene locus_tag LOCUS_27620 1153516 1154619 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_27620 1155291 1154641 gene locus_tag LOCUS_27630 1155291 1154641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1155576 1155340 gene locus_tag LOCUS_27640 1155576 1155340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1155670 1155921 gene locus_tag LOCUS_27650 1155670 1155921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 1156641 1155943 gene locus_tag LOCUS_27660 1156641 1155943 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_27660 1156992 1156747 gene locus_tag LOCUS_27670 1156992 1156747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1157637 1157206 gene locus_tag LOCUS_27680 1157637 1157206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1158087 1157650 gene locus_tag LOCUS_27690 1158087 1157650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 1158280 1158870 gene locus_tag LOCUS_27700 1158280 1158870 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289247.1 protein_id gnl|my_center|LOCUS_27700 1159356 1160366 gene locus_tag LOCUS_27710 1159356 1160366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903193.1 protein_id gnl|my_center|LOCUS_27710 1161084 1160533 gene locus_tag LOCUS_27720 1161084 1160533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1160974 1161633 gene locus_tag LOCUS_27730 1160974 1161633 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903195.1 protein_id gnl|my_center|LOCUS_27730 1164187 1161611 gene locus_tag LOCUS_27740 1164187 1161611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1164462 1165982 gene locus_tag LOCUS_27750 1164462 1165982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 1166026 1166316 gene locus_tag LOCUS_27760 1166026 1166316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1169512 1166399 gene locus_tag LOCUS_27770 1169512 1166399 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903197.1 protein_id gnl|my_center|LOCUS_27770 1170086 1170646 gene locus_tag LOCUS_27780 1170086 1170646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1170684 1171367 gene locus_tag LOCUS_27790 1170684 1171367 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902495.1 protein_id gnl|my_center|LOCUS_27790 1171647 1173278 gene locus_tag LOCUS_27800 1171647 1173278 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903224.1 protein_id gnl|my_center|LOCUS_27800 1173795 1173298 gene locus_tag LOCUS_27810 1173795 1173298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 1174733 1173801 gene locus_tag LOCUS_27820 gene mch 1174733 1173801 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903231.1 protein_id gnl|my_center|LOCUS_27820 1175090 1174758 gene locus_tag LOCUS_27830 1175090 1174758 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_27830 1175838 1175188 gene locus_tag LOCUS_27840 1175838 1175188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1177470 1176067 gene locus_tag LOCUS_27850 1177470 1176067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1177943 1177872 gene locus_tag LOCUS_t00420 1177943 1177872 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1178292 1179137 gene locus_tag LOCUS_27860 1178292 1179137 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903233.1 protein_id gnl|my_center|LOCUS_27860 1179142 1180158 gene locus_tag LOCUS_27870 1179142 1180158 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903234.1 protein_id gnl|my_center|LOCUS_27870 1180162 1180902 gene locus_tag LOCUS_27880 gene rpl4p 1180162 1180902 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_27880 1180899 1181156 gene locus_tag LOCUS_27890 1180899 1181156 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903236.1 protein_id gnl|my_center|LOCUS_27890 1181159 1181881 gene locus_tag LOCUS_27900 1181159 1181881 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903237.1 protein_id gnl|my_center|LOCUS_27900 1181878 1182300 gene locus_tag LOCUS_27910 1181878 1182300 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903238.1 protein_id gnl|my_center|LOCUS_27910 1182303 1182770 gene locus_tag LOCUS_27920 1182303 1182770 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903239.1 protein_id gnl|my_center|LOCUS_27920 1182770 1183687 gene locus_tag LOCUS_27930 1182770 1183687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1183684 1183899 gene locus_tag LOCUS_27940 gene rpmC 1183684 1183899 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903241.1 protein_id gnl|my_center|LOCUS_27940 1183899 1184183 gene locus_tag LOCUS_27950 1183899 1184183 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903242.1 protein_id gnl|my_center|LOCUS_27950 1184174 1184512 gene locus_tag LOCUS_27960 1184174 1184512 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903243.1 protein_id gnl|my_center|LOCUS_27960 1184512 1184910 gene locus_tag LOCUS_27970 1184512 1184910 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903244.1 protein_id gnl|my_center|LOCUS_27970 1184915 1185277 gene locus_tag LOCUS_27980 gene rplX 1184915 1185277 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903245.1 protein_id gnl|my_center|LOCUS_27980 1185274 1185978 gene locus_tag LOCUS_27990 1185274 1185978 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903246.1 protein_id gnl|my_center|LOCUS_27990 1185975 1186508 gene locus_tag LOCUS_28000 1185975 1186508 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903247.1 protein_id gnl|my_center|LOCUS_28000 1186505 1186690 gene locus_tag LOCUS_28010 1186505 1186690 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903248.1 protein_id gnl|my_center|LOCUS_28010 1186693 1187085 gene locus_tag LOCUS_28020 1186693 1187085 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903249.1 protein_id gnl|my_center|LOCUS_28020 1187088 1187624 gene locus_tag LOCUS_28030 1187088 1187624 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903250.1 protein_id gnl|my_center|LOCUS_28030 1187624 1188346 gene locus_tag LOCUS_28040 1187624 1188346 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903251.1 protein_id gnl|my_center|LOCUS_28040 1188346 1188795 gene locus_tag LOCUS_28050 1188346 1188795 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_28050 1188939 1189358 gene locus_tag LOCUS_28060 1188939 1189358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 1189355 1189993 gene locus_tag LOCUS_28070 1189355 1189993 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903254.1 protein_id gnl|my_center|LOCUS_28070 1189993 1190457 gene locus_tag LOCUS_28080 1189993 1190457 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117363797.1 protein_id gnl|my_center|LOCUS_28080 1190457 1190954 gene locus_tag LOCUS_28090 1190457 1190954 CDS product uL15m family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903256.1 protein_id gnl|my_center|LOCUS_28090 1190961 1192424 gene locus_tag LOCUS_28100 gene secY 1190961 1192424 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903257.1 protein_id gnl|my_center|LOCUS_28100 1193645 1192932 gene locus_tag LOCUS_28110 1193645 1192932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 1194189 1195124 gene locus_tag LOCUS_28120 1194189 1195124 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_28120 1195250 1196446 gene locus_tag LOCUS_28130 1195250 1196446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 1196710 1198275 gene locus_tag LOCUS_28140 1196710 1198275 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_28140 1198281 1199741 gene locus_tag LOCUS_28150 1198281 1199741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1199835 1200938 gene locus_tag LOCUS_28160 1199835 1200938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1202311 1201244 gene locus_tag LOCUS_28170 1202311 1201244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1203462 1202314 gene locus_tag LOCUS_28180 1203462 1202314 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_28180 1204655 1203471 gene locus_tag LOCUS_28190 1204655 1203471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1205269 1206327 gene locus_tag LOCUS_28200 1205269 1206327 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_28200 1207439 1206297 gene locus_tag LOCUS_28210 1207439 1206297 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_28210 1207973 1208875 gene locus_tag LOCUS_28220 1207973 1208875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1209606 1209250 gene locus_tag LOCUS_28230 1209606 1209250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 1212482 1213240 gene locus_tag LOCUS_28240 1212482 1213240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1213394 1215052 gene locus_tag LOCUS_28250 1213394 1215052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1215536 1216246 gene locus_tag LOCUS_28260 1215536 1216246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 1216301 1216483 gene locus_tag LOCUS_28270 1216301 1216483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 1217231 1218562 gene locus_tag LOCUS_28280 gene trkA 1217231 1218562 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878341.1 protein_id gnl|my_center|LOCUS_28280 1218620 1218931 gene locus_tag LOCUS_28290 1218620 1218931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1219031 1219738 gene locus_tag LOCUS_28300 gene phoU 1219031 1219738 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892486.1 protein_id gnl|my_center|LOCUS_28300 1220792 1220049 gene locus_tag LOCUS_28310 gene radB 1220792 1220049 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903214.1 protein_id gnl|my_center|LOCUS_28310 1221644 1220814 gene locus_tag LOCUS_28320 1221644 1220814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1221808 1222575 gene locus_tag LOCUS_28330 1221808 1222575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249621.1 protein_id gnl|my_center|LOCUS_28330 1223870 1222578 gene locus_tag LOCUS_28340 gene larC 1223870 1222578 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_28340 1224362 1223946 gene locus_tag LOCUS_28350 1224362 1223946 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_28350 1224563 1226788 gene locus_tag LOCUS_28360 1224563 1226788 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_28360 1226976 1227989 gene locus_tag LOCUS_28370 1226976 1227989 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_28370 1229150 1228008 gene locus_tag LOCUS_28380 1229150 1228008 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903212.1 protein_id gnl|my_center|LOCUS_28380 1229259 1229579 gene locus_tag LOCUS_28390 1229259 1229579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 1229760 1230251 gene locus_tag LOCUS_28400 1229760 1230251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1230614 1230261 gene locus_tag LOCUS_28410 1230614 1230261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1230953 1230879 gene locus_tag LOCUS_t00430 1230953 1230879 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1231132 1232127 gene locus_tag LOCUS_28420 gene trpD 1231132 1232127 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903202.1 protein_id gnl|my_center|LOCUS_28420 1232124 1232768 gene locus_tag LOCUS_28430 1232124 1232768 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_28430 1232765 1234375 gene locus_tag LOCUS_28440 gene trpE 1232765 1234375 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903200.1 protein_id gnl|my_center|LOCUS_28440 1234372 1234995 gene locus_tag LOCUS_28450 gene trpG 1234372 1234995 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903199.1 protein_id gnl|my_center|LOCUS_28450 1235180 1234992 gene locus_tag LOCUS_28460 1235180 1234992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1235296 1235511 gene locus_tag LOCUS_28470 1235296 1235511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 1236346 1235513 gene locus_tag LOCUS_28480 gene pyrF 1236346 1235513 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903220.1 protein_id gnl|my_center|LOCUS_28480 1236468 1236950 gene locus_tag LOCUS_28490 1236468 1236950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1237353 1237009 gene locus_tag LOCUS_28500 1237353 1237009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903219.1 protein_id gnl|my_center|LOCUS_28500 1237793 1237353 gene locus_tag LOCUS_28510 1237793 1237353 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903218.1 protein_id gnl|my_center|LOCUS_28510 1237884 1238255 gene locus_tag LOCUS_28520 1237884 1238255 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903217.1 protein_id gnl|my_center|LOCUS_28520 1239308 1238310 gene locus_tag LOCUS_28530 1239308 1238310 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902294.1 protein_id gnl|my_center|LOCUS_28530 1239810 1240625 gene locus_tag LOCUS_28540 1239810 1240625 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 protein_id gnl|my_center|LOCUS_28540 1240743 1241609 gene locus_tag LOCUS_28550 gene pstC 1240743 1241609 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902292.1 protein_id gnl|my_center|LOCUS_28550 1241629 1243329 gene locus_tag LOCUS_28560 gene pstA 1241629 1243329 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902291.1 protein_id gnl|my_center|LOCUS_28560 1243333 1244232 gene locus_tag LOCUS_28570 gene pstB 1243333 1244232 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902290.1 protein_id gnl|my_center|LOCUS_28570 1245107 1244262 gene locus_tag LOCUS_28580 1245107 1244262 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903172.1 protein_id gnl|my_center|LOCUS_28580 1245607 1245161 gene locus_tag LOCUS_28590 1245607 1245161 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289360.1 protein_id gnl|my_center|LOCUS_28590 1245770 1247563 gene locus_tag LOCUS_28600 1245770 1247563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 1247708 1248799 gene locus_tag LOCUS_28610 gene gcvT 1247708 1248799 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_28610 1248796 1249179 gene locus_tag LOCUS_28620 gene gcvH 1248796 1249179 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903167.1 protein_id gnl|my_center|LOCUS_28620 1249288 1250631 gene locus_tag LOCUS_28630 gene gcvPA 1249288 1250631 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903166.1 protein_id gnl|my_center|LOCUS_28630 1250714 1252135 gene locus_tag LOCUS_28640 gene gcvPB 1250714 1252135 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903165.1 protein_id gnl|my_center|LOCUS_28640 1252272 1256099 gene locus_tag LOCUS_28650 1252272 1256099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1256506 1256096 gene locus_tag LOCUS_28660 1256506 1256096 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022813.1 protein_id gnl|my_center|LOCUS_28660 1256706 1256503 gene locus_tag LOCUS_28670 1256706 1256503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1256945 1256775 gene locus_tag LOCUS_28680 1256945 1256775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 1257037 1257705 gene locus_tag LOCUS_28690 1257037 1257705 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840003.1 protein_id gnl|my_center|LOCUS_28690 1257832 1258368 gene locus_tag LOCUS_28700 1257832 1258368 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289350.1 protein_id gnl|my_center|LOCUS_28700 1258468 1259442 gene locus_tag LOCUS_28710 gene mvaD 1258468 1259442 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_28710 1259533 1259940 gene locus_tag LOCUS_28720 1259533 1259940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1260844 1260134 gene locus_tag LOCUS_28730 1260844 1260134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 1261014 1262159 gene locus_tag LOCUS_28740 1261014 1262159 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_28740 1262501 1262289 gene locus_tag LOCUS_28750 1262501 1262289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1263666 1262680 gene locus_tag LOCUS_28760 1263666 1262680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1264565 1263663 gene locus_tag LOCUS_28770 1264565 1263663 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890515.1 protein_id gnl|my_center|LOCUS_28770 1264739 1265224 gene locus_tag LOCUS_28780 1264739 1265224 CDS product FlaD/FlaE family flagellar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902677.1 protein_id gnl|my_center|LOCUS_28780 1265366 1266460 gene locus_tag LOCUS_28790 1265366 1266460 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902067.1 protein_id gnl|my_center|LOCUS_28790 1266642 1266457 gene locus_tag LOCUS_28800 1266642 1266457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 1266854 1268344 gene locus_tag LOCUS_28810 1266854 1268344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1268929 1271040 gene locus_tag LOCUS_28820 1268929 1271040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1272422 1271085 gene locus_tag LOCUS_28830 1272422 1271085 CDS product glycoside hydrolase family 68 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965080.1 protein_id gnl|my_center|LOCUS_28830 1272795 1272568 gene locus_tag LOCUS_28840 1272795 1272568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289403.1 protein_id gnl|my_center|LOCUS_28840 1272947 1273993 gene locus_tag LOCUS_28850 1272947 1273993 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289210.1 protein_id gnl|my_center|LOCUS_28850 1274534 1274076 gene locus_tag LOCUS_28860 1274534 1274076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 1274626 1275867 gene locus_tag LOCUS_28870 1274626 1275867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1275919 1276323 gene locus_tag LOCUS_28880 1275919 1276323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1276378 1276725 gene locus_tag LOCUS_28890 1276378 1276725 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902750.1 protein_id gnl|my_center|LOCUS_28890 1276825 1277439 gene locus_tag LOCUS_28900 1276825 1277439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 1277873 1277460 gene locus_tag LOCUS_28910 1277873 1277460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 1278528 1277968 gene locus_tag LOCUS_28920 1278528 1277968 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227885.1 protein_id gnl|my_center|LOCUS_28920 1279373 1278624 gene locus_tag LOCUS_28930 1279373 1278624 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_28930 1279647 1280411 gene locus_tag LOCUS_28940 1279647 1280411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1280678 1280600 gene locus_tag LOCUS_t00440 1280678 1280600 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1280995 1280726 gene locus_tag LOCUS_28950 1280995 1280726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 1281144 1282091 gene locus_tag LOCUS_28960 1281144 1282091 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_28960 1283691 1282141 gene locus_tag LOCUS_28970 1283691 1282141 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289203.1 protein_id gnl|my_center|LOCUS_28970 1285227 1283692 gene locus_tag LOCUS_28980 1285227 1283692 CDS product NuoM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902442.1 protein_id gnl|my_center|LOCUS_28980 1287324 1285228 gene locus_tag LOCUS_28990 gene nuoL 1287324 1285228 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902441.1 protein_id gnl|my_center|LOCUS_28990 1287630 1287328 gene locus_tag LOCUS_29000 gene nuoK 1287630 1287328 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902440.1 protein_id gnl|my_center|LOCUS_29000 1288025 1287627 gene locus_tag LOCUS_29010 1288025 1287627 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289202.1 protein_id gnl|my_center|LOCUS_29010 1288441 1288022 gene locus_tag LOCUS_29020 1288441 1288022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1289041 1288580 gene locus_tag LOCUS_29030 1289041 1288580 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902437.1 protein_id gnl|my_center|LOCUS_29030 1290128 1289088 gene locus_tag LOCUS_29040 1290128 1289088 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289200.1 protein_id gnl|my_center|LOCUS_29040 1291810 1290128 gene locus_tag LOCUS_29050 1291810 1290128 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902435.1 protein_id gnl|my_center|LOCUS_29050 1292509 1291817 gene locus_tag LOCUS_29060 1292509 1291817 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902434.1 protein_id gnl|my_center|LOCUS_29060 1292915 1292502 gene locus_tag LOCUS_29070 1292915 1292502 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902433.1 protein_id gnl|my_center|LOCUS_29070 1293721 1293071 gene locus_tag LOCUS_29080 gene purE 1293721 1293071 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902432.1 protein_id gnl|my_center|LOCUS_29080 1294190 1293768 gene locus_tag LOCUS_29090 1294190 1293768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 1295811 1294204 gene locus_tag LOCUS_29100 1295811 1294204 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869171.1 protein_id gnl|my_center|LOCUS_29100 1295906 1297207 gene locus_tag LOCUS_29110 1295906 1297207 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902546.1 protein_id gnl|my_center|LOCUS_29110 1297298 1298872 gene locus_tag LOCUS_29120 1297298 1298872 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361675.1 protein_id gnl|my_center|LOCUS_29120 1300807 1298894 gene locus_tag LOCUS_29130 1300807 1298894 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_29130 1300902 1301399 gene locus_tag LOCUS_29140 1300902 1301399 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902543.1 protein_id gnl|my_center|LOCUS_29140 1301396 1301824 gene locus_tag LOCUS_29150 1301396 1301824 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902542.1 protein_id gnl|my_center|LOCUS_29150 1301919 1302629 gene locus_tag LOCUS_29160 1301919 1302629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 1303139 1302729 gene locus_tag LOCUS_29170 1303139 1302729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 1303388 1303654 gene locus_tag LOCUS_29180 1303388 1303654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 1304907 1303747 gene locus_tag LOCUS_29190 1304907 1303747 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902428.1 protein_id gnl|my_center|LOCUS_29190 1305317 1304904 gene locus_tag LOCUS_29200 gene ribH 1305317 1304904 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902429.1 protein_id gnl|my_center|LOCUS_29200 1305446 1307443 gene locus_tag LOCUS_29210 1305446 1307443 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903516.1 protein_id gnl|my_center|LOCUS_29210 1307469 1308614 gene locus_tag LOCUS_29220 1307469 1308614 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892490.1 protein_id gnl|my_center|LOCUS_29220 1308691 1309134 gene locus_tag LOCUS_29230 1308691 1309134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 1309652 1309161 gene locus_tag LOCUS_29240 1309652 1309161 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_29240 1310397 1309756 gene locus_tag LOCUS_29250 1310397 1309756 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902549.1 protein_id gnl|my_center|LOCUS_29250 1310620 1310390 gene locus_tag LOCUS_29260 1310620 1310390 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289224.1 protein_id gnl|my_center|LOCUS_29260 1311738 1310617 gene locus_tag LOCUS_29270 1311738 1310617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902551.1 protein_id gnl|my_center|LOCUS_29270 1312209 1311739 gene locus_tag LOCUS_29280 1312209 1311739 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902552.1 protein_id gnl|my_center|LOCUS_29280 1312578 1314269 gene locus_tag LOCUS_29290 1312578 1314269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1314417 1316141 gene locus_tag LOCUS_29300 1314417 1316141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1316893 1316150 gene locus_tag LOCUS_29310 1316893 1316150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1317329 1316886 gene locus_tag LOCUS_29320 1317329 1316886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1318302 1317319 gene locus_tag LOCUS_29330 1318302 1317319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 1318877 1318290 gene locus_tag LOCUS_29340 1318877 1318290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 1319424 1318879 gene locus_tag LOCUS_29350 1319424 1318879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 1319696 1319767 gene locus_tag LOCUS_t00450 1319696 1319767 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1320087 1320566 gene locus_tag LOCUS_29360 1320087 1320566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 1320706 1321158 gene locus_tag LOCUS_29370 1320706 1321158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1321508 1322665 gene locus_tag LOCUS_29380 1321508 1322665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 1322668 1323096 gene locus_tag LOCUS_29390 1322668 1323096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 1323106 1323726 gene locus_tag LOCUS_29400 1323106 1323726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1324430 1324744 gene locus_tag LOCUS_29410 1324430 1324744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 1324744 1325205 gene locus_tag LOCUS_29420 1324744 1325205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 1325209 1326012 gene locus_tag LOCUS_29430 1325209 1326012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 1326032 1326229 gene locus_tag LOCUS_29440 1326032 1326229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 1326226 1326693 gene locus_tag LOCUS_29450 1326226 1326693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1326695 1327582 gene locus_tag LOCUS_29460 1326695 1327582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 1327902 1328234 gene locus_tag LOCUS_29470 1327902 1328234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1328234 1328749 gene locus_tag LOCUS_29480 1328234 1328749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 1328750 1329370 gene locus_tag LOCUS_29490 1328750 1329370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 1329367 1329495 gene locus_tag LOCUS_29500 1329367 1329495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1329485 1329775 gene locus_tag LOCUS_29510 1329485 1329775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1329768 1329944 gene locus_tag LOCUS_29520 1329768 1329944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1329941 1330393 gene locus_tag LOCUS_29530 1329941 1330393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 1331054 1330749 gene locus_tag LOCUS_29540 1331054 1330749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1331545 1332201 gene locus_tag LOCUS_29550 1331545 1332201 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031837637.1 protein_id gnl|my_center|LOCUS_29550 1333623 1333276 gene locus_tag LOCUS_29560 1333623 1333276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 1333944 1333627 gene locus_tag LOCUS_29570 1333944 1333627 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008526012.1 protein_id gnl|my_center|LOCUS_29570 1334115 1334273 gene locus_tag LOCUS_29580 1334115 1334273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 1334357 1334683 gene locus_tag LOCUS_29590 1334357 1334683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 1334676 1334906 gene locus_tag LOCUS_29600 1334676 1334906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 1334903 1335580 gene locus_tag LOCUS_29610 1334903 1335580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29610 1335652 1335912 gene locus_tag LOCUS_29620 1335652 1335912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29620 1336526 1340314 gene locus_tag LOCUS_29630 1336526 1340314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1340812 1340465 gene locus_tag LOCUS_29640 gene rpl12p 1340812 1340465 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902793.1 protein_id gnl|my_center|LOCUS_29640 1341873 1340830 gene locus_tag LOCUS_29650 1341873 1340830 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902794.1 protein_id gnl|my_center|LOCUS_29650 1342513 1341875 gene locus_tag LOCUS_29660 1342513 1341875 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902795.1 protein_id gnl|my_center|LOCUS_29660 1343240 1342752 gene locus_tag LOCUS_29670 1343240 1342752 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902796.1 protein_id gnl|my_center|LOCUS_29670 1343579 1343379 gene locus_tag LOCUS_29680 1343579 1343379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902797.1 protein_id gnl|my_center|LOCUS_29680 1343738 1344847 gene locus_tag LOCUS_29690 1343738 1344847 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902798.1 protein_id gnl|my_center|LOCUS_29690 1344997 1345374 gene locus_tag LOCUS_29700 1344997 1345374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 1345470 1346198 gene locus_tag LOCUS_29710 1345470 1346198 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902800.1 protein_id gnl|my_center|LOCUS_29710 1346629 1349367 gene locus_tag LOCUS_29720 1346629 1349367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 1349955 1352708 gene locus_tag LOCUS_29730 1349955 1352708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 1352856 1353857 gene locus_tag LOCUS_29740 gene artA 1352856 1353857 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904000.1 protein_id gnl|my_center|LOCUS_29740 1354660 1353881 gene locus_tag LOCUS_29750 gene dph5 1354660 1353881 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289280.1 protein_id gnl|my_center|LOCUS_29750 1354736 1355716 gene locus_tag LOCUS_29760 1354736 1355716 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902803.1 protein_id gnl|my_center|LOCUS_29760 1355804 1356217 gene locus_tag LOCUS_29770 1355804 1356217 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064295.1 protein_id gnl|my_center|LOCUS_29770 1356296 1356369 gene locus_tag LOCUS_t00460 1356296 1356369 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1356631 1356945 gene locus_tag LOCUS_29780 1356631 1356945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903983.1 protein_id gnl|my_center|LOCUS_29780 1358037 1356997 gene locus_tag LOCUS_29790 1358037 1356997 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259025.1 protein_id gnl|my_center|LOCUS_29790 1358833 1358198 gene locus_tag LOCUS_29800 1358833 1358198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 1359130 1358888 gene locus_tag LOCUS_29810 1359130 1358888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 1360036 1359173 gene locus_tag LOCUS_29820 1360036 1359173 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902453.1 protein_id gnl|my_center|LOCUS_29820 1360001 1361542 gene locus_tag LOCUS_29830 1360001 1361542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902642.1 protein_id gnl|my_center|LOCUS_29830 1361539 1361850 gene locus_tag LOCUS_29840 1361539 1361850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902641.1 protein_id gnl|my_center|LOCUS_29840 1361924 1362214 gene locus_tag LOCUS_29850 1361924 1362214 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902601.1 protein_id gnl|my_center|LOCUS_29850 1363065 1362217 gene locus_tag LOCUS_29860 1363065 1362217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 1364179 1363364 gene locus_tag LOCUS_29870 gene hisF 1364179 1363364 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902602.1 protein_id gnl|my_center|LOCUS_29870 1364297 1364488 gene locus_tag LOCUS_29880 1364297 1364488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1364717 1365793 gene locus_tag LOCUS_29890 1364717 1365793 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_29890 1365797 1367014 gene locus_tag LOCUS_29900 1365797 1367014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 1369252 1367015 gene locus_tag LOCUS_29910 gene purL 1369252 1367015 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902605.1 protein_id gnl|my_center|LOCUS_29910 1369570 1369935 gene locus_tag LOCUS_29920 1369570 1369935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1370327 1370001 gene locus_tag LOCUS_29930 1370327 1370001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 1371076 1370519 gene locus_tag LOCUS_29940 1371076 1370519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1371145 1371378 gene locus_tag LOCUS_29950 1371145 1371378 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963400.1 protein_id gnl|my_center|LOCUS_29950 1371375 1371689 gene locus_tag LOCUS_29960 1371375 1371689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 1372043 1371771 gene locus_tag LOCUS_29970 1372043 1371771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 1372369 1372040 gene locus_tag LOCUS_29980 1372369 1372040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 1372414 1373727 gene locus_tag LOCUS_29990 1372414 1373727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1374025 1373729 gene locus_tag LOCUS_30000 1374025 1373729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903804.1 protein_id gnl|my_center|LOCUS_30000 1374481 1374182 gene locus_tag LOCUS_30010 1374481 1374182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1374861 1374484 gene locus_tag LOCUS_30020 1374861 1374484 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136360906.1 protein_id gnl|my_center|LOCUS_30020 1375049 1376224 gene locus_tag LOCUS_30030 1375049 1376224 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902857.1 protein_id gnl|my_center|LOCUS_30030 1376496 1377476 gene locus_tag LOCUS_30040 1376496 1377476 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084319.1 protein_id gnl|my_center|LOCUS_30040 1377823 1378137 gene locus_tag LOCUS_30050 1377823 1378137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 1378134 1379369 gene locus_tag LOCUS_30060 1378134 1379369 CDS product TIGR04347 family pseudo-SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902854.1 protein_id gnl|my_center|LOCUS_30060 1379618 1380304 gene locus_tag LOCUS_30070 1379618 1380304 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_30070 1380304 1381398 gene locus_tag LOCUS_30080 1380304 1381398 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902607.1 protein_id gnl|my_center|LOCUS_30080 1381880 1381404 gene locus_tag LOCUS_30090 1381880 1381404 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_30090 1382898 1381924 gene locus_tag LOCUS_30100 1382898 1381924 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_30100 1383125 1383403 gene locus_tag LOCUS_30110 gene gatC 1383125 1383403 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_30110 1383404 1384681 gene locus_tag LOCUS_30120 gene gatA 1383404 1384681 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902611.1 protein_id gnl|my_center|LOCUS_30120 1384728 1385873 gene locus_tag LOCUS_30130 gene htpX 1384728 1385873 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_30130 1385870 1386097 gene locus_tag LOCUS_30140 1385870 1386097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1387233 1386130 gene locus_tag LOCUS_30150 1387233 1386130 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289190.1 protein_id gnl|my_center|LOCUS_30150 1387354 1388676 gene locus_tag LOCUS_30160 1387354 1388676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 1389850 1388699 gene locus_tag LOCUS_30170 1389850 1388699 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902406.1 protein_id gnl|my_center|LOCUS_30170 1389956 1390243 gene locus_tag LOCUS_30180 1389956 1390243 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902407.1 protein_id gnl|my_center|LOCUS_30180 1390290 1390544 gene locus_tag LOCUS_30190 1390290 1390544 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902408.1 protein_id gnl|my_center|LOCUS_30190 1390541 1391422 gene locus_tag LOCUS_30200 1390541 1391422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 1391808 1391734 gene locus_tag LOCUS_t00470 1391808 1391734 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1392158 1391883 gene locus_tag LOCUS_30210 1392158 1391883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 1392238 1392651 gene locus_tag LOCUS_30220 1392238 1392651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1395121 1393451 gene locus_tag LOCUS_30230 1395121 1393451 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970088.1 protein_id gnl|my_center|LOCUS_30230 1395217 1395819 gene locus_tag LOCUS_30240 1395217 1395819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 1396423 1397286 gene locus_tag LOCUS_30250 1396423 1397286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 1397621 1398385 gene locus_tag LOCUS_30260 1397621 1398385 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255197.1 protein_id gnl|my_center|LOCUS_30260 1399324 1399722 gene locus_tag LOCUS_30270 1399324 1399722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1400799 1399753 gene locus_tag LOCUS_30280 1400799 1399753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 1401206 1400796 gene locus_tag LOCUS_30290 1401206 1400796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 1401865 1401203 gene locus_tag LOCUS_30300 gene fdh3B 1401865 1401203 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453840.1 protein_id gnl|my_center|LOCUS_30300 1405323 1401877 gene locus_tag LOCUS_30310 1405323 1401877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 1405512 1407647 gene locus_tag LOCUS_30320 1405512 1407647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1407644 1408270 gene locus_tag LOCUS_30330 1407644 1408270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1408511 1408278 gene locus_tag LOCUS_30340 1408511 1408278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 1408779 1408504 gene locus_tag LOCUS_30350 1408779 1408504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1408961 1408779 gene locus_tag LOCUS_30360 1408961 1408779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1409025 1410242 gene locus_tag LOCUS_30370 1409025 1410242 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902557.1 protein_id gnl|my_center|LOCUS_30370 1410817 1410473 gene locus_tag LOCUS_30380 1410817 1410473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 1411220 1410954 gene locus_tag LOCUS_30390 1411220 1410954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 1412057 1411269 gene locus_tag LOCUS_30400 1412057 1411269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 1413826 1412054 gene locus_tag LOCUS_30410 1413826 1412054 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_30410 1413913 1414518 gene locus_tag LOCUS_30420 1413913 1414518 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902576.1 protein_id gnl|my_center|LOCUS_30420 1415265 1414546 gene locus_tag LOCUS_30430 1415265 1414546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 1415372 1416454 gene locus_tag LOCUS_30440 gene moaA 1415372 1416454 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289091.1 protein_id gnl|my_center|LOCUS_30440 1416506 1417591 gene locus_tag LOCUS_30450 1416506 1417591 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057197.1 protein_id gnl|my_center|LOCUS_30450 1417646 1418659 gene locus_tag LOCUS_30460 1417646 1418659 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662722.1 protein_id gnl|my_center|LOCUS_30460 1420596 1418674 gene locus_tag LOCUS_30470 1420596 1418674 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902249.1 protein_id gnl|my_center|LOCUS_30470 1420771 1420953 gene locus_tag LOCUS_30480 1420771 1420953 CDS product DUF5786 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289220.1 protein_id gnl|my_center|LOCUS_30480 1421365 1420970 gene locus_tag LOCUS_30490 1421365 1420970 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289157.1 protein_id gnl|my_center|LOCUS_30490 1421635 1421393 gene locus_tag LOCUS_30500 1421635 1421393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1421768 1422232 gene locus_tag LOCUS_30510 1421768 1422232 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903865.1 protein_id gnl|my_center|LOCUS_30510 1422716 1422306 gene locus_tag LOCUS_30520 1422716 1422306 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902412.1 protein_id gnl|my_center|LOCUS_30520 1423135 1422761 gene locus_tag LOCUS_30530 1423135 1422761 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902485.1 protein_id gnl|my_center|LOCUS_30530 1423366 1424061 gene locus_tag LOCUS_30540 1423366 1424061 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_30540 1424332 1425501 gene locus_tag LOCUS_30550 1424332 1425501 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902627.1 protein_id gnl|my_center|LOCUS_30550 1426905 1425682 gene locus_tag LOCUS_30560 1426905 1425682 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903607.1 protein_id gnl|my_center|LOCUS_30560 1428854 1426965 gene locus_tag LOCUS_30570 1428854 1426965 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902014.1 protein_id gnl|my_center|LOCUS_30570 1430065 1428842 gene locus_tag LOCUS_30580 1430065 1428842 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151112700.1 protein_id gnl|my_center|LOCUS_30580 1430345 1431571 gene locus_tag LOCUS_30590 1430345 1431571 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902792.1 protein_id gnl|my_center|LOCUS_30590 1432543 1431566 gene locus_tag LOCUS_30600 gene corA 1432543 1431566 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_30600 1432710 1432540 gene locus_tag LOCUS_30610 1432710 1432540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 1433395 1432754 gene locus_tag LOCUS_30620 1433395 1432754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 1434979 1433501 gene locus_tag LOCUS_30630 gene cysS 1434979 1433501 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902789.1 protein_id gnl|my_center|LOCUS_30630 1435511 1435026 gene locus_tag LOCUS_30640 1435511 1435026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1435723 1435881 gene locus_tag LOCUS_30650 1435723 1435881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1435996 1436877 gene locus_tag LOCUS_30660 1435996 1436877 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902785.1 protein_id gnl|my_center|LOCUS_30660 1437332 1436874 gene locus_tag LOCUS_30670 1437332 1436874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1437989 1437366 gene locus_tag LOCUS_30680 1437989 1437366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1439014 1437986 gene locus_tag LOCUS_30690 gene htpX 1439014 1437986 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_30690 1439166 1440242 gene locus_tag LOCUS_30700 1439166 1440242 CDS product DR2241 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902784.1 protein_id gnl|my_center|LOCUS_30700 1440814 1440251 gene locus_tag LOCUS_30710 1440814 1440251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 1441042 1440848 gene locus_tag LOCUS_30720 1441042 1440848 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902783.1 protein_id gnl|my_center|LOCUS_30720 1442533 1441157 gene locus_tag LOCUS_30730 1442533 1441157 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902782.1 protein_id gnl|my_center|LOCUS_30730 1442712 1443017 gene locus_tag LOCUS_30740 1442712 1443017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289276.1 protein_id gnl|my_center|LOCUS_30740 1445561 1443027 gene locus_tag LOCUS_30750 1445561 1443027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1445597 1446046 gene locus_tag LOCUS_30760 1445597 1446046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 1446110 1446361 gene locus_tag LOCUS_30770 1446110 1446361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1446530 1448314 gene locus_tag LOCUS_30780 gene ctaD 1446530 1448314 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902450.1 protein_id gnl|my_center|LOCUS_30780 1448531 1448797 gene locus_tag LOCUS_30790 1448531 1448797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 1450506 1448803 gene locus_tag LOCUS_30800 1450506 1448803 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289204.1 protein_id gnl|my_center|LOCUS_30800 1451397 1450582 gene locus_tag LOCUS_30810 1451397 1450582 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902445.1 protein_id gnl|my_center|LOCUS_30810 1453085 1451412 gene locus_tag LOCUS_30820 1453085 1451412 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902444.1 protein_id gnl|my_center|LOCUS_30820 1453549 1453121 gene locus_tag LOCUS_30830 gene lrpA1 1453549 1453121 CDS product HTH-type transcriptional regulator LrpA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902807.1 protein_id gnl|my_center|LOCUS_30830 1454573 1453635 gene locus_tag LOCUS_30840 1454573 1453635 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902808.1 protein_id gnl|my_center|LOCUS_30840 1456475 1454577 gene locus_tag LOCUS_30850 1456475 1454577 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289282.1 protein_id gnl|my_center|LOCUS_30850 1456743 1457462 gene locus_tag LOCUS_30860 1456743 1457462 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902515.1 protein_id gnl|my_center|LOCUS_30860 1457493 1457714 gene locus_tag LOCUS_30870 1457493 1457714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 1458530 1457733 gene locus_tag LOCUS_30880 1458530 1457733 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222607811.1 protein_id gnl|my_center|LOCUS_30880 1459149 1460477 gene locus_tag LOCUS_30890 1459149 1460477 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289079.1 protein_id gnl|my_center|LOCUS_30890 1462477 1461323 gene locus_tag LOCUS_30900 1462477 1461323 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289146.1 protein_id gnl|my_center|LOCUS_30900 1462604 1463377 gene locus_tag LOCUS_30910 1462604 1463377 CDS product DUF6517 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289418.1 protein_id gnl|my_center|LOCUS_30910 1465096 1463444 gene locus_tag LOCUS_30920 1465096 1463444 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980180.1 protein_id gnl|my_center|LOCUS_30920 1465801 1465199 gene locus_tag LOCUS_30930 1465801 1465199 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902689.1 protein_id gnl|my_center|LOCUS_30930 1466571 1465903 gene locus_tag LOCUS_30940 1466571 1465903 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_30940 1467659 1466622 gene locus_tag LOCUS_30950 1467659 1466622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 1467828 1468013 gene locus_tag LOCUS_30960 1467828 1468013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 1468842 1468252 gene locus_tag LOCUS_30970 1468842 1468252 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_30970 1469250 1468918 gene locus_tag LOCUS_30980 1469250 1468918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 1469368 1469862 gene locus_tag LOCUS_30990 1469368 1469862 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_30990 1469859 1471004 gene locus_tag LOCUS_31000 1469859 1471004 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_31000 1471142 1473634 gene locus_tag LOCUS_31010 1471142 1473634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 1473631 1475667 gene locus_tag LOCUS_31020 1473631 1475667 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_31020 1475725 1476249 gene locus_tag LOCUS_31030 1475725 1476249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 1476252 1476824 gene locus_tag LOCUS_31040 1476252 1476824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1476818 1477717 gene locus_tag LOCUS_31050 1476818 1477717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 1477714 1478178 gene locus_tag LOCUS_31060 1477714 1478178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 1478175 1478930 gene locus_tag LOCUS_31070 1478175 1478930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 1479442 1479678 gene locus_tag LOCUS_31080 1479442 1479678 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902916.1 protein_id gnl|my_center|LOCUS_31080 1479854 1480117 gene locus_tag LOCUS_31090 1479854 1480117 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892515.1 protein_id gnl|my_center|LOCUS_31090 >Feature sequence03 1078 887 gene locus_tag LOCUS_31100 1078 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3375 3004 gene locus_tag LOCUS_31110 3375 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3628 3822 gene locus_tag LOCUS_31120 3628 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 5429 3774 gene locus_tag LOCUS_31130 5429 3774 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485392.1 protein_id gnl|my_center|LOCUS_31130 7708 5810 gene locus_tag LOCUS_31140 7708 5810 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485392.1 protein_id gnl|my_center|LOCUS_31140 7987 9177 gene locus_tag LOCUS_31150 7987 9177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 protein_id gnl|my_center|LOCUS_31150 9368 10336 gene locus_tag LOCUS_31160 9368 10336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_31160 11409 11191 gene locus_tag LOCUS_31170 11409 11191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 12238 11558 gene locus_tag LOCUS_31180 12238 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 12271 12582 gene locus_tag LOCUS_31190 12271 12582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 12643 13320 gene locus_tag LOCUS_31200 12643 13320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 15134 13665 gene locus_tag LOCUS_31210 gene secY 15134 13665 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903257.1 protein_id gnl|my_center|LOCUS_31210 16002 15325 gene locus_tag LOCUS_31220 16002 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 16939 16085 gene locus_tag LOCUS_31230 16939 16085 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902584.1 protein_id gnl|my_center|LOCUS_31230 17095 18033 gene locus_tag LOCUS_31240 17095 18033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902458.1 protein_id gnl|my_center|LOCUS_31240 18030 18773 gene locus_tag LOCUS_31250 18030 18773 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902459.1 protein_id gnl|my_center|LOCUS_31250 19125 18877 gene locus_tag LOCUS_31260 19125 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 20965 19187 gene locus_tag LOCUS_31270 20965 19187 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904164.1 protein_id gnl|my_center|LOCUS_31270 21723 20968 gene locus_tag LOCUS_31280 21723 20968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904163.1 protein_id gnl|my_center|LOCUS_31280 22739 22455 gene locus_tag LOCUS_31290 22739 22455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 24083 23253 gene locus_tag LOCUS_31300 24083 23253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 24239 24853 gene locus_tag LOCUS_31310 24239 24853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31310 26113 26259 gene locus_tag LOCUS_31320 26113 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 27730 26741 gene locus_tag LOCUS_31330 27730 26741 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_31330 28395 28889 gene locus_tag LOCUS_31340 28395 28889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 29576 30304 gene locus_tag LOCUS_31350 29576 30304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 31076 30489 gene locus_tag LOCUS_31360 31076 30489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 31525 32769 gene locus_tag LOCUS_31370 31525 32769 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902524.1 protein_id gnl|my_center|LOCUS_31370 33864 33088 gene locus_tag LOCUS_31380 gene hisJ 33864 33088 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_31380 34619 33864 gene locus_tag LOCUS_31390 34619 33864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 35590 34781 gene locus_tag LOCUS_31400 35590 34781 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776846.1 protein_id gnl|my_center|LOCUS_31400 37335 35590 gene locus_tag LOCUS_31410 37335 35590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776847.1 protein_id gnl|my_center|LOCUS_31410 38191 37337 gene locus_tag LOCUS_31420 38191 37337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776848.1 protein_id gnl|my_center|LOCUS_31420 39747 38356 gene locus_tag LOCUS_31430 39747 38356 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289330.1 protein_id gnl|my_center|LOCUS_31430 40873 39962 gene locus_tag LOCUS_31440 40873 39962 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146742.1 protein_id gnl|my_center|LOCUS_31440 42340 41234 gene locus_tag LOCUS_31450 42340 41234 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904119.1 protein_id gnl|my_center|LOCUS_31450 42513 43685 gene locus_tag LOCUS_31460 42513 43685 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_31460 43814 44323 gene locus_tag LOCUS_31470 43814 44323 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157849921.1 protein_id gnl|my_center|LOCUS_31470 44497 44733 gene locus_tag LOCUS_31480 44497 44733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 44893 45660 gene locus_tag LOCUS_31490 44893 45660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 45657 49340 gene locus_tag LOCUS_31500 45657 49340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 49337 49918 gene locus_tag LOCUS_31510 49337 49918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 49915 53757 gene locus_tag LOCUS_31520 49915 53757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 53805 54737 gene locus_tag LOCUS_31530 53805 54737 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289741.1 protein_id gnl|my_center|LOCUS_31530 54734 55546 gene locus_tag LOCUS_31540 54734 55546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 55632 56312 gene locus_tag LOCUS_31550 55632 56312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 56305 58026 gene locus_tag LOCUS_31560 56305 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 58163 62416 gene locus_tag LOCUS_31570 gene pglX 58163 62416 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_31570 62420 64612 gene locus_tag LOCUS_31580 62420 64612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 64687 68883 gene locus_tag LOCUS_31590 gene pglX 64687 68883 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_31590 68966 71881 gene locus_tag LOCUS_31600 68966 71881 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890482.1 protein_id gnl|my_center|LOCUS_31600 72056 75172 gene locus_tag LOCUS_31610 72056 75172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 75165 78809 gene locus_tag LOCUS_31620 75165 78809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 80400 79606 gene locus_tag LOCUS_31630 gene phnE 80400 79606 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104070585.1 protein_id gnl|my_center|LOCUS_31630 81215 80400 gene locus_tag LOCUS_31640 gene phnE 81215 80400 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368504.1 protein_id gnl|my_center|LOCUS_31640 82036 81221 gene locus_tag LOCUS_31650 gene phnC 82036 81221 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939222.1 protein_id gnl|my_center|LOCUS_31650 83185 82052 gene locus_tag LOCUS_31660 83185 82052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 83530 84831 gene locus_tag LOCUS_31670 83530 84831 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361690.1 protein_id gnl|my_center|LOCUS_31670 84953 85744 gene locus_tag LOCUS_31680 84953 85744 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902496.1 protein_id gnl|my_center|LOCUS_31680 86708 85797 gene locus_tag LOCUS_31690 86708 85797 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903351.1 protein_id gnl|my_center|LOCUS_31690 88141 87002 gene locus_tag LOCUS_31700 88141 87002 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904134.1 protein_id gnl|my_center|LOCUS_31700 89054 88152 gene locus_tag LOCUS_31710 89054 88152 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892710.1 protein_id gnl|my_center|LOCUS_31710 89940 89056 gene locus_tag LOCUS_31720 89940 89056 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904132.1 protein_id gnl|my_center|LOCUS_31720 91256 89940 gene locus_tag LOCUS_31730 91256 89940 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904131.1 protein_id gnl|my_center|LOCUS_31730 91590 92708 gene locus_tag LOCUS_31740 91590 92708 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728729.1 protein_id gnl|my_center|LOCUS_31740 93014 92847 gene locus_tag LOCUS_31750 93014 92847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 93130 94299 gene locus_tag LOCUS_31760 93130 94299 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902466.1 protein_id gnl|my_center|LOCUS_31760 94296 94763 gene locus_tag LOCUS_31770 94296 94763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 95479 96666 gene locus_tag LOCUS_31780 95479 96666 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289079.1 protein_id gnl|my_center|LOCUS_31780 97076 97570 gene locus_tag LOCUS_31790 97076 97570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 97574 99079 gene locus_tag LOCUS_31800 97574 99079 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111317.1 protein_id gnl|my_center|LOCUS_31800 99076 100479 gene locus_tag LOCUS_31810 99076 100479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 100650 102332 gene locus_tag LOCUS_31820 gene acsA 100650 102332 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862052.1 protein_id gnl|my_center|LOCUS_31820 102409 103545 gene locus_tag LOCUS_31830 102409 103545 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878464.1 protein_id gnl|my_center|LOCUS_31830 103545 105329 gene locus_tag LOCUS_31840 103545 105329 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903116.1 protein_id gnl|my_center|LOCUS_31840 105332 107050 gene locus_tag LOCUS_31850 105332 107050 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049952164.1 protein_id gnl|my_center|LOCUS_31850 107054 107518 gene locus_tag LOCUS_31860 107054 107518 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902425.1 protein_id gnl|my_center|LOCUS_31860 108294 107560 gene locus_tag LOCUS_31870 108294 107560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 109158 108325 gene locus_tag LOCUS_31880 109158 108325 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289197.1 protein_id gnl|my_center|LOCUS_31880 109375 110250 gene locus_tag LOCUS_31890 109375 110250 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013535.1 protein_id gnl|my_center|LOCUS_31890 110945 110247 gene locus_tag LOCUS_31900 110945 110247 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_31900 111776 111102 gene locus_tag LOCUS_31910 111776 111102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 111865 112806 gene locus_tag LOCUS_31920 gene paaG 111865 112806 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889012.1 protein_id gnl|my_center|LOCUS_31920 112812 113339 gene locus_tag LOCUS_31930 112812 113339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 113339 114172 gene locus_tag LOCUS_31940 113339 114172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 114165 114599 gene locus_tag LOCUS_31950 114165 114599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 114596 114763 gene locus_tag LOCUS_31960 114596 114763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 116324 114873 gene locus_tag LOCUS_31970 gene dhaS 116324 114873 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399332.1 protein_id gnl|my_center|LOCUS_31970 116930 116472 gene locus_tag LOCUS_31980 116930 116472 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_31980 117029 117424 gene locus_tag LOCUS_31990 117029 117424 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_31990 118717 117428 gene locus_tag LOCUS_32000 118717 117428 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_32000 118849 120021 gene locus_tag LOCUS_32010 118849 120021 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_32010 120018 121454 gene locus_tag LOCUS_32020 120018 121454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 122606 121464 gene locus_tag LOCUS_32030 122606 121464 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_32030 122985 123350 gene locus_tag LOCUS_32040 122985 123350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 124008 124895 gene locus_tag LOCUS_32050 124008 124895 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083218.1 protein_id gnl|my_center|LOCUS_32050 124892 125704 gene locus_tag LOCUS_32060 124892 125704 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_32060 126580 125810 gene locus_tag LOCUS_32070 126580 125810 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904162.1 protein_id gnl|my_center|LOCUS_32070 126693 127022 gene locus_tag LOCUS_32080 126693 127022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 127549 127079 gene locus_tag LOCUS_32090 gene mce 127549 127079 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172482.1 protein_id gnl|my_center|LOCUS_32090 127744 130593 gene locus_tag LOCUS_32100 127744 130593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 130723 131970 gene locus_tag LOCUS_32110 130723 131970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055677.1 protein_id gnl|my_center|LOCUS_32110 131979 134003 gene locus_tag LOCUS_32120 131979 134003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810078.1 protein_id gnl|my_center|LOCUS_32120 133996 134760 gene locus_tag LOCUS_32130 133996 134760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_32130 134757 135479 gene locus_tag LOCUS_32140 134757 135479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_32140 136454 135738 gene locus_tag LOCUS_32150 136454 135738 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_32150 138707 137577 gene locus_tag LOCUS_32160 138707 137577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904134.1 protein_id gnl|my_center|LOCUS_32160 138838 140055 gene locus_tag LOCUS_32170 138838 140055 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972893.1 protein_id gnl|my_center|LOCUS_32170 140100 140804 gene locus_tag LOCUS_32180 140100 140804 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119307.1 protein_id gnl|my_center|LOCUS_32180 142415 140844 gene locus_tag LOCUS_32190 gene nagZ 142415 140844 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_32190 143408 142491 gene locus_tag LOCUS_32200 143408 142491 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972375.1 protein_id gnl|my_center|LOCUS_32200 144267 143410 gene locus_tag LOCUS_32210 144267 143410 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_32210 145888 144521 gene locus_tag LOCUS_32220 145888 144521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 146134 147141 gene locus_tag LOCUS_32230 146134 147141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 147376 148524 gene locus_tag LOCUS_32240 gene dgoD 147376 148524 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_32240 148577 149323 gene locus_tag LOCUS_32250 148577 149323 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_32250 149779 150837 gene locus_tag LOCUS_32260 149779 150837 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902286.1 protein_id gnl|my_center|LOCUS_32260 151806 151222 gene locus_tag LOCUS_32270 151806 151222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 152485 151808 gene locus_tag LOCUS_32280 152485 151808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 152632 153993 gene locus_tag LOCUS_32290 152632 153993 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902563.1 protein_id gnl|my_center|LOCUS_32290 154129 154800 gene locus_tag LOCUS_32300 gene npdG 154129 154800 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903948.1 protein_id gnl|my_center|LOCUS_32300 156914 154914 gene locus_tag LOCUS_32310 156914 154914 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_32310 157352 156969 gene locus_tag LOCUS_32320 157352 156969 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073919.1 protein_id gnl|my_center|LOCUS_32320 158603 157587 gene locus_tag LOCUS_32330 158603 157587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 159958 158690 gene locus_tag LOCUS_32340 159958 158690 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_32340 161032 160070 gene locus_tag LOCUS_32350 161032 160070 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965631.1 protein_id gnl|my_center|LOCUS_32350 162797 161094 gene locus_tag LOCUS_32360 162797 161094 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_32360 163846 165090 gene locus_tag LOCUS_32370 163846 165090 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537683.1 protein_id gnl|my_center|LOCUS_32370 165278 166396 gene locus_tag LOCUS_32380 165278 166396 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902330.1 protein_id gnl|my_center|LOCUS_32380 166692 167789 gene locus_tag LOCUS_32390 166692 167789 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532983.1 protein_id gnl|my_center|LOCUS_32390 167786 169093 gene locus_tag LOCUS_32400 167786 169093 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_32400 169086 169913 gene locus_tag LOCUS_32410 169086 169913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_32410 169910 170614 gene locus_tag LOCUS_32420 169910 170614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_32420 171296 172444 gene locus_tag LOCUS_32430 gene pdhA 171296 172444 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535910.1 protein_id gnl|my_center|LOCUS_32430 172441 173457 gene locus_tag LOCUS_32440 172441 173457 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_32440 173459 174991 gene locus_tag LOCUS_32450 173459 174991 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903647.1 protein_id gnl|my_center|LOCUS_32450 174991 176424 gene locus_tag LOCUS_32460 gene lpdA 174991 176424 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903648.1 protein_id gnl|my_center|LOCUS_32460 177437 177066 gene locus_tag LOCUS_32470 177437 177066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 178028 178363 gene locus_tag LOCUS_32480 178028 178363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 179061 178447 gene locus_tag LOCUS_32490 179061 178447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904053.1 protein_id gnl|my_center|LOCUS_32490 180072 179176 gene locus_tag LOCUS_32500 180072 179176 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839436.1 protein_id gnl|my_center|LOCUS_32500 180772 180356 gene locus_tag LOCUS_32510 180772 180356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 180830 181120 gene locus_tag LOCUS_32520 180830 181120 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869817.1 protein_id gnl|my_center|LOCUS_32520 181127 181708 gene locus_tag LOCUS_32530 181127 181708 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878134.1 protein_id gnl|my_center|LOCUS_32530 181869 182171 gene locus_tag LOCUS_32540 181869 182171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 182660 183010 gene locus_tag LOCUS_32550 182660 183010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 183108 184064 gene locus_tag LOCUS_32560 183108 184064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 184227 185255 gene locus_tag LOCUS_32570 184227 185255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 185815 185342 gene locus_tag LOCUS_32580 185815 185342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 185909 186598 gene locus_tag LOCUS_32590 185909 186598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 187431 186667 gene locus_tag LOCUS_32600 187431 186667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903978.1 protein_id gnl|my_center|LOCUS_32600 188292 188038 gene locus_tag LOCUS_32610 188292 188038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32610 188919 188395 gene locus_tag LOCUS_32620 188919 188395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 191084 190164 gene locus_tag LOCUS_32630 191084 190164 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902767.1 protein_id gnl|my_center|LOCUS_32630 192366 191965 gene locus_tag LOCUS_32640 192366 191965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289733.1 protein_id gnl|my_center|LOCUS_32640 193236 192367 gene locus_tag LOCUS_32650 193236 192367 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289734.1 protein_id gnl|my_center|LOCUS_32650 193482 194690 gene locus_tag LOCUS_32660 193482 194690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 194687 194863 gene locus_tag LOCUS_32670 194687 194863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 195157 196251 gene locus_tag LOCUS_32680 195157 196251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 196251 197099 gene locus_tag LOCUS_32690 196251 197099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 197597 197145 gene locus_tag LOCUS_32700 197597 197145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 198068 198418 gene locus_tag LOCUS_32710 198068 198418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 198586 199104 gene locus_tag LOCUS_32720 198586 199104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 200237 199314 gene locus_tag LOCUS_32730 200237 199314 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902500.1 protein_id gnl|my_center|LOCUS_32730 200345 201550 gene locus_tag LOCUS_32740 200345 201550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903232.1 protein_id gnl|my_center|LOCUS_32740 203153 203950 gene locus_tag LOCUS_32750 203153 203950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 204041 204493 gene locus_tag LOCUS_32760 204041 204493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 205780 205493 gene locus_tag LOCUS_32770 205780 205493 CDS product amphi-Trp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903036.1 protein_id gnl|my_center|LOCUS_32770 205967 206824 gene locus_tag LOCUS_32780 gene cofE 205967 206824 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_32780 207989 206910 gene locus_tag LOCUS_32790 207989 206910 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902333.1 protein_id gnl|my_center|LOCUS_32790 208620 209489 gene locus_tag LOCUS_32800 208620 209489 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289734.1 protein_id gnl|my_center|LOCUS_32800 209486 209887 gene locus_tag LOCUS_32810 209486 209887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289733.1 protein_id gnl|my_center|LOCUS_32810 211399 210170 gene locus_tag LOCUS_32820 211399 210170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 212748 212491 gene locus_tag LOCUS_32830 212748 212491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 213253 214587 gene locus_tag LOCUS_32840 gene trkA 213253 214587 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404994.1 protein_id gnl|my_center|LOCUS_32840 214670 216238 gene locus_tag LOCUS_32850 214670 216238 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404995.1 protein_id gnl|my_center|LOCUS_32850 216383 216646 gene locus_tag LOCUS_32860 216383 216646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 217515 216643 gene locus_tag LOCUS_32870 217515 216643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 217726 218163 gene locus_tag LOCUS_32880 217726 218163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 218156 220429 gene locus_tag LOCUS_32890 218156 220429 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892477.1 protein_id gnl|my_center|LOCUS_32890 221809 220667 gene locus_tag LOCUS_32900 221809 220667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 222477 221812 gene locus_tag LOCUS_32910 222477 221812 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902929.1 protein_id gnl|my_center|LOCUS_32910 224221 222596 gene locus_tag LOCUS_32920 224221 222596 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903259.1 protein_id gnl|my_center|LOCUS_32920 224928 224242 gene locus_tag LOCUS_32930 224928 224242 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_32930 225427 224984 gene locus_tag LOCUS_32940 225427 224984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 225779 225429 gene locus_tag LOCUS_32950 225779 225429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 227004 226132 gene locus_tag LOCUS_32960 227004 226132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 227464 228183 gene locus_tag LOCUS_32970 227464 228183 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902932.1 protein_id gnl|my_center|LOCUS_32970 228435 229145 gene locus_tag LOCUS_32980 228435 229145 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902085.1 protein_id gnl|my_center|LOCUS_32980 229404 231017 gene locus_tag LOCUS_32990 229404 231017 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_32990 231017 231238 gene locus_tag LOCUS_33000 231017 231238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902930.1 protein_id gnl|my_center|LOCUS_33000 232333 232145 gene locus_tag LOCUS_33010 232333 232145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 232250 232657 gene locus_tag LOCUS_33020 232250 232657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 232764 233582 gene locus_tag LOCUS_33030 232764 233582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 233837 235321 gene locus_tag LOCUS_33040 233837 235321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 235257 235523 gene locus_tag LOCUS_33050 235257 235523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 236512 235865 gene locus_tag LOCUS_33060 236512 235865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 237015 236824 gene locus_tag LOCUS_33070 237015 236824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 237912 237070 gene locus_tag LOCUS_33080 237912 237070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33080 238272 238126 gene locus_tag LOCUS_33090 238272 238126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 238516 238337 gene locus_tag LOCUS_33100 238516 238337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 239381 238461 gene locus_tag LOCUS_33110 239381 238461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33110 >Feature sequence04 52 342 gene locus_tag LOCUS_33120 52 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 339 653 gene locus_tag LOCUS_33130 339 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 644 850 gene locus_tag LOCUS_33140 644 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 847 1077 gene locus_tag LOCUS_33150 847 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 1610 1891 gene locus_tag LOCUS_33160 1610 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903282.1 protein_id gnl|my_center|LOCUS_33160 1894 3468 gene locus_tag LOCUS_33170 gene htr7 1894 3468 CDS product chemotaxis signal transducer protein Htr7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903283.1 protein_id gnl|my_center|LOCUS_33170 3702 3851 gene locus_tag LOCUS_33180 3702 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 3844 4047 gene locus_tag LOCUS_33190 3844 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 4040 4228 gene locus_tag LOCUS_33200 4040 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 4222 4431 gene locus_tag LOCUS_33210 4222 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 4506 5192 gene locus_tag LOCUS_33220 4506 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 5225 6124 gene locus_tag LOCUS_33230 5225 6124 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_33230 6131 6586 gene locus_tag LOCUS_33240 6131 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 6663 6965 gene locus_tag LOCUS_33250 6663 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 6955 7242 gene locus_tag LOCUS_33260 6955 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 7610 7221 gene locus_tag LOCUS_33270 7610 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 7717 8157 gene locus_tag LOCUS_33280 7717 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 8265 8660 gene locus_tag LOCUS_33290 8265 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 8786 9610 gene locus_tag LOCUS_33300 8786 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 9674 9943 gene locus_tag LOCUS_33310 9674 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 10247 11269 gene locus_tag LOCUS_33320 10247 11269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 13421 12012 gene locus_tag LOCUS_33330 13421 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 15035 14052 gene locus_tag LOCUS_33340 15035 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 15776 15519 gene locus_tag LOCUS_33350 15776 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 16365 16625 gene locus_tag LOCUS_33360 16365 16625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 17199 17429 gene locus_tag LOCUS_33370 17199 17429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 17426 17833 gene locus_tag LOCUS_33380 17426 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 17974 17843 gene locus_tag LOCUS_33390 17974 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 19615 18140 gene locus_tag LOCUS_33400 19615 18140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 20835 19696 gene locus_tag LOCUS_33410 20835 19696 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080048.1 protein_id gnl|my_center|LOCUS_33410 21808 20894 gene locus_tag LOCUS_33420 21808 20894 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 protein_id gnl|my_center|LOCUS_33420 22712 21810 gene locus_tag LOCUS_33430 22712 21810 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066678.1 protein_id gnl|my_center|LOCUS_33430 24071 22737 gene locus_tag LOCUS_33440 24071 22737 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244086.1 protein_id gnl|my_center|LOCUS_33440 24999 24202 gene locus_tag LOCUS_33450 24999 24202 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_33450 25318 25067 gene locus_tag LOCUS_33460 25318 25067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 26201 25266 gene locus_tag LOCUS_33470 26201 25266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903912.1 protein_id gnl|my_center|LOCUS_33470 27313 26201 gene locus_tag LOCUS_33480 27313 26201 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903913.1 protein_id gnl|my_center|LOCUS_33480 28479 27319 gene locus_tag LOCUS_33490 28479 27319 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903914.1 protein_id gnl|my_center|LOCUS_33490 29466 28630 gene locus_tag LOCUS_33500 29466 28630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903915.1 protein_id gnl|my_center|LOCUS_33500 29739 29503 gene locus_tag LOCUS_33510 29739 29503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 30200 30379 gene locus_tag LOCUS_33520 30200 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 32050 30815 gene locus_tag LOCUS_33530 32050 30815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 32388 32074 gene locus_tag LOCUS_33540 32388 32074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 32598 33947 gene locus_tag LOCUS_33550 32598 33947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 34056 34676 gene locus_tag LOCUS_33560 34056 34676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 34744 35040 gene locus_tag LOCUS_33570 34744 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 35145 35483 gene locus_tag LOCUS_33580 35145 35483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 36396 36220 gene locus_tag LOCUS_33590 36396 36220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 36656 36411 gene locus_tag LOCUS_33600 36656 36411 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901973.1 protein_id gnl|my_center|LOCUS_33600 37000 36758 gene locus_tag LOCUS_33610 37000 36758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 37084 37344 gene locus_tag LOCUS_33620 37084 37344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 38631 38780 gene locus_tag LOCUS_33630 38631 38780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 39306 39097 gene locus_tag LOCUS_33640 39306 39097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 39355 39561 gene locus_tag LOCUS_33650 39355 39561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 40110 39649 gene locus_tag LOCUS_33660 40110 39649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 40716 40516 gene locus_tag LOCUS_33670 40716 40516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 40911 40756 gene locus_tag LOCUS_33680 40911 40756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 41171 41710 gene locus_tag LOCUS_33690 41171 41710 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437688.1 protein_id gnl|my_center|LOCUS_33690 42239 41814 gene locus_tag LOCUS_33700 42239 41814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 42512 43705 gene locus_tag LOCUS_33710 42512 43705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 43881 45122 gene locus_tag LOCUS_33720 43881 45122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 45218 45562 gene locus_tag LOCUS_33730 45218 45562 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892503.1 protein_id gnl|my_center|LOCUS_33730 45564 45899 gene locus_tag LOCUS_33740 45564 45899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 46405 45896 gene locus_tag LOCUS_33750 46405 45896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 46672 46849 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cacgcacaccgggtttccggtgaaa 47451 48659 gene locus_tag LOCUS_33760 gene orc4 47451 48659 CDS product DNA replication protein Orc4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006183330.1 protein_id gnl|my_center|LOCUS_33760 48956 49174 gene locus_tag LOCUS_33770 48956 49174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 49680 50108 gene locus_tag LOCUS_33780 49680 50108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 50239 50511 gene locus_tag LOCUS_33790 50239 50511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 51492 50581 gene locus_tag LOCUS_33800 51492 50581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 51650 55642 gene locus_tag LOCUS_33810 51650 55642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 55639 56085 gene locus_tag LOCUS_33820 55639 56085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 56278 56622 gene locus_tag LOCUS_33830 56278 56622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 56731 57951 gene locus_tag LOCUS_33840 56731 57951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 57978 58370 gene locus_tag LOCUS_33850 57978 58370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 58446 59042 gene locus_tag LOCUS_33860 58446 59042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 59103 59477 gene locus_tag LOCUS_33870 59103 59477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 59474 59920 gene locus_tag LOCUS_33880 59474 59920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 60027 60275 gene locus_tag LOCUS_33890 60027 60275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 60282 60902 gene locus_tag LOCUS_33900 60282 60902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 61066 61488 gene locus_tag LOCUS_33910 61066 61488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 61561 62304 gene locus_tag LOCUS_33920 61561 62304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 62625 63455 gene locus_tag LOCUS_33930 62625 63455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 63461 63994 gene locus_tag LOCUS_33940 63461 63994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 64183 65058 gene locus_tag LOCUS_33950 64183 65058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 65718 65182 gene locus_tag LOCUS_33960 65718 65182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 66364 65765 gene locus_tag LOCUS_33970 66364 65765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 66770 67219 gene locus_tag LOCUS_33980 66770 67219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 67677 67312 gene locus_tag LOCUS_33990 67677 67312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 67939 67670 gene locus_tag LOCUS_34000 67939 67670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 68035 69858 gene locus_tag LOCUS_34010 68035 69858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 70638 70168 gene locus_tag LOCUS_34020 70638 70168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 71467 70877 gene locus_tag LOCUS_34030 71467 70877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 72079 71528 gene locus_tag LOCUS_34040 72079 71528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 72857 72216 gene locus_tag LOCUS_34050 72857 72216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 73127 74080 gene locus_tag LOCUS_34060 73127 74080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 74319 74636 gene locus_tag LOCUS_34070 74319 74636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 75191 74940 gene locus_tag LOCUS_34080 75191 74940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 75463 75188 gene locus_tag LOCUS_34090 75463 75188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 75639 76229 gene locus_tag LOCUS_34100 75639 76229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 76918 77448 gene locus_tag LOCUS_34110 76918 77448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 77540 78295 gene locus_tag LOCUS_34120 77540 78295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 79473 78571 gene locus_tag LOCUS_34130 79473 78571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 80584 80012 gene locus_tag LOCUS_34140 80584 80012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 81636 81379 gene locus_tag LOCUS_34150 81636 81379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 81734 82342 gene locus_tag LOCUS_34160 81734 82342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 82455 82688 gene locus_tag LOCUS_34170 82455 82688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 83275 82871 gene locus_tag LOCUS_34180 83275 82871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 83836 83426 gene locus_tag LOCUS_34190 83836 83426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 84590 84123 gene locus_tag LOCUS_34200 84590 84123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 85529 85278 gene locus_tag LOCUS_34210 85529 85278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 85715 85909 gene locus_tag LOCUS_34220 85715 85909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 86659 86315 gene locus_tag LOCUS_34230 86659 86315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 87899 88456 gene locus_tag LOCUS_34240 87899 88456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 89287 90411 gene locus_tag LOCUS_34250 89287 90411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 90625 90969 gene locus_tag LOCUS_34260 90625 90969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 91287 91670 gene locus_tag LOCUS_34270 91287 91670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 92316 91720 gene locus_tag LOCUS_34280 92316 91720 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890465.1 protein_id gnl|my_center|LOCUS_34280 92488 92784 gene locus_tag LOCUS_34290 92488 92784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 92810 93217 gene locus_tag LOCUS_34300 92810 93217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 93490 93879 gene locus_tag LOCUS_34310 93490 93879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 94100 93876 gene locus_tag LOCUS_34320 94100 93876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 94131 94610 gene locus_tag LOCUS_34330 94131 94610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34330 94857 97988 gene locus_tag LOCUS_34340 94857 97988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34340 98185 98943 gene locus_tag LOCUS_34350 98185 98943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 >Feature sequence05 1180 143 gene locus_tag LOCUS_34360 1180 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 2016 3497 gene locus_tag LOCUS_34370 2016 3497 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173362416.1 protein_id gnl|my_center|LOCUS_34370 4324 4106 gene locus_tag LOCUS_34380 4324 4106 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901974.1 protein_id gnl|my_center|LOCUS_34380 4579 4358 gene locus_tag LOCUS_34390 4579 4358 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901973.1 protein_id gnl|my_center|LOCUS_34390 5342 5797 gene locus_tag LOCUS_34400 5342 5797 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890504.1 protein_id gnl|my_center|LOCUS_34400 5801 7873 gene locus_tag LOCUS_34410 5801 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 7870 8706 gene locus_tag LOCUS_34420 7870 8706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 8709 10418 gene locus_tag LOCUS_34430 8709 10418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 10418 13672 gene locus_tag LOCUS_34440 10418 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 13678 14052 gene locus_tag LOCUS_34450 13678 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 14049 14528 gene locus_tag LOCUS_34460 14049 14528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 14525 15262 gene locus_tag LOCUS_34470 14525 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 15259 17463 gene locus_tag LOCUS_34480 15259 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 19513 18434 gene locus_tag LOCUS_34490 19513 18434 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_34490 20387 19878 gene locus_tag LOCUS_34500 20387 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289744.1 protein_id gnl|my_center|LOCUS_34500 20980 20384 gene locus_tag LOCUS_34510 20980 20384 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289745.1 protein_id gnl|my_center|LOCUS_34510 22716 21577 gene locus_tag LOCUS_34520 22716 21577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 23547 23227 gene locus_tag LOCUS_34530 23547 23227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 23919 23704 gene locus_tag LOCUS_34540 23919 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 25075 24008 gene locus_tag LOCUS_34550 25075 24008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 25518 25219 gene locus_tag LOCUS_34560 25518 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 26406 26053 gene locus_tag LOCUS_34570 26406 26053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 27258 26893 gene locus_tag LOCUS_34580 27258 26893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 27553 28833 gene locus_tag LOCUS_34590 27553 28833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 29145 30212 gene locus_tag LOCUS_34600 29145 30212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 30209 30367 gene locus_tag LOCUS_34610 30209 30367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 30789 30950 gene locus_tag LOCUS_34620 30789 30950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 31063 35040 gene locus_tag LOCUS_34630 31063 35040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 35129 38743 gene locus_tag LOCUS_34640 35129 38743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 38740 40554 gene locus_tag LOCUS_34650 38740 40554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 40570 41427 gene locus_tag LOCUS_34660 40570 41427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 42219 41440 gene locus_tag LOCUS_34670 42219 41440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 42393 44645 gene locus_tag LOCUS_34680 42393 44645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 44776 45786 gene locus_tag LOCUS_34690 44776 45786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 45903 46307 gene locus_tag LOCUS_34700 45903 46307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 46476 46985 gene locus_tag LOCUS_34710 46476 46985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 47040 47618 gene locus_tag LOCUS_34720 47040 47618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 47883 48464 gene locus_tag LOCUS_34730 47883 48464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 49090 48770 gene locus_tag LOCUS_34740 49090 48770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 49827 49423 gene locus_tag LOCUS_34750 49827 49423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 50194 51048 gene locus_tag LOCUS_34760 50194 51048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 51352 52509 gene locus_tag LOCUS_34770 51352 52509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 52512 53444 gene locus_tag LOCUS_34780 52512 53444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 53451 54377 gene locus_tag LOCUS_34790 53451 54377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 55172 54858 gene locus_tag LOCUS_34800 55172 54858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 55601 55350 gene locus_tag LOCUS_34810 55601 55350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 55894 55598 gene locus_tag LOCUS_34820 55894 55598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 56055 56279 gene locus_tag LOCUS_34830 56055 56279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 56499 56248 gene locus_tag LOCUS_34840 56499 56248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 56864 57181 gene locus_tag LOCUS_34850 56864 57181 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_34850 57246 57545 gene locus_tag LOCUS_34860 57246 57545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 57545 57757 gene locus_tag LOCUS_34870 57545 57757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 58039 58920 gene locus_tag LOCUS_34880 58039 58920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 59283 60437 gene locus_tag LOCUS_34890 59283 60437 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081422761.1 protein_id gnl|my_center|LOCUS_34890 60719 60477 gene locus_tag LOCUS_34900 60719 60477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 60854 61939 gene locus_tag LOCUS_34910 60854 61939 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974144.1 protein_id gnl|my_center|LOCUS_34910 62536 62108 gene locus_tag LOCUS_34920 62536 62108 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904050.1 protein_id gnl|my_center|LOCUS_34920 62805 62536 gene locus_tag LOCUS_34930 62805 62536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 62999 63232 gene locus_tag LOCUS_34940 62999 63232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 65368 63770 gene locus_tag LOCUS_34950 65368 63770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 67074 65881 gene locus_tag LOCUS_34960 67074 65881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 68234 67071 gene locus_tag LOCUS_34970 68234 67071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 68790 68545 gene locus_tag LOCUS_34980 68790 68545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 70156 69392 gene locus_tag LOCUS_34990 70156 69392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_34990 70785 70153 gene locus_tag LOCUS_35000 70785 70153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 72067 70979 gene locus_tag LOCUS_35010 72067 70979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 73065 72178 gene locus_tag LOCUS_35020 73065 72178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 78528 73090 gene locus_tag LOCUS_35030 78528 73090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 78989 79183 gene locus_tag LOCUS_35040 78989 79183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 79207 79572 gene locus_tag LOCUS_35050 79207 79572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 79786 80031 gene locus_tag LOCUS_35060 79786 80031 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771148.1 protein_id gnl|my_center|LOCUS_35060 80021 80512 gene locus_tag LOCUS_35070 80021 80512 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_35070 81526 80513 gene locus_tag LOCUS_35080 81526 80513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 82177 81593 gene locus_tag LOCUS_35090 82177 81593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 82645 82322 gene locus_tag LOCUS_35100 82645 82322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 >Feature sequence06 437 153 gene locus_tag LOCUS_35110 437 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 540 884 gene locus_tag LOCUS_35120 540 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 1358 2137 gene locus_tag LOCUS_35130 1358 2137 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890515.1 protein_id gnl|my_center|LOCUS_35130 2130 2501 gene locus_tag LOCUS_35140 2130 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 2507 2692 gene locus_tag LOCUS_35150 2507 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 3385 4614 gene locus_tag LOCUS_35160 gene orc8 3385 4614 CDS product DNA replication protein Orc8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902884.1 protein_id gnl|my_center|LOCUS_35160 5172 9608 gene locus_tag LOCUS_35170 5172 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 9742 9957 gene locus_tag LOCUS_35180 9742 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35180 10583 11614 gene locus_tag LOCUS_35190 10583 11614 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890429.1 protein_id gnl|my_center|LOCUS_35190 12092 12595 gene locus_tag LOCUS_35200 12092 12595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 12576 12890 gene locus_tag LOCUS_35210 12576 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 12905 13999 gene locus_tag LOCUS_35220 12905 13999 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904064.1 protein_id gnl|my_center|LOCUS_35220 13992 15068 gene locus_tag LOCUS_35230 13992 15068 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662722.1 protein_id gnl|my_center|LOCUS_35230 15065 15586 gene locus_tag LOCUS_35240 15065 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 16102 16236 gene locus_tag LOCUS_35250 16102 16236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 16874 16515 gene locus_tag LOCUS_35260 16874 16515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904060.1 protein_id gnl|my_center|LOCUS_35260 17347 16925 gene locus_tag LOCUS_35270 17347 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 17686 17375 gene locus_tag LOCUS_35280 17686 17375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 18380 17970 gene locus_tag LOCUS_35290 18380 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 18693 18535 gene locus_tag LOCUS_35300 18693 18535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 19625 18807 gene locus_tag LOCUS_35310 19625 18807 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904059.1 protein_id gnl|my_center|LOCUS_35310 20275 19625 gene locus_tag LOCUS_35320 gene kdpC 20275 19625 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904058.1 protein_id gnl|my_center|LOCUS_35320 22434 20275 gene locus_tag LOCUS_35330 gene kdpB 22434 20275 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904057.1 protein_id gnl|my_center|LOCUS_35330 24184 22436 gene locus_tag LOCUS_35340 gene kdpA 24184 22436 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904056.1 protein_id gnl|my_center|LOCUS_35340 24522 25226 gene locus_tag LOCUS_35350 24522 25226 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904055.1 protein_id gnl|my_center|LOCUS_35350 27242 25290 gene locus_tag LOCUS_35360 27242 25290 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135662706.1 protein_id gnl|my_center|LOCUS_35360 27903 27301 gene locus_tag LOCUS_35370 27903 27301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904053.1 protein_id gnl|my_center|LOCUS_35370 28217 28050 gene locus_tag LOCUS_35380 28217 28050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 29415 28276 gene locus_tag LOCUS_35390 29415 28276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 30083 29418 gene locus_tag LOCUS_35400 30083 29418 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902929.1 protein_id gnl|my_center|LOCUS_35400 31732 30203 gene locus_tag LOCUS_35410 31732 30203 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903259.1 protein_id gnl|my_center|LOCUS_35410 32186 32941 gene locus_tag LOCUS_35420 32186 32941 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902932.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35420 32919 33329 gene locus_tag LOCUS_35430 32919 33329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 33761 33420 gene locus_tag LOCUS_35440 33761 33420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 34335 33910 gene locus_tag LOCUS_35450 34335 33910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 34775 36394 gene locus_tag LOCUS_35460 34775 36394 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902931.1 protein_id gnl|my_center|LOCUS_35460 36394 36594 gene locus_tag LOCUS_35470 36394 36594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902930.1 protein_id gnl|my_center|LOCUS_35470 36640 37308 gene locus_tag LOCUS_35480 36640 37308 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902929.1 protein_id gnl|my_center|LOCUS_35480 37476 37643 gene locus_tag LOCUS_35490 37476 37643 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289549.1 protein_id gnl|my_center|LOCUS_35490 38259 38690 gene locus_tag LOCUS_35500 38259 38690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35500 39170 38928 gene locus_tag LOCUS_35510 39170 38928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 40058 39234 gene locus_tag LOCUS_35520 40058 39234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 40388 40116 gene locus_tag LOCUS_35530 40388 40116 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890479.1 protein_id gnl|my_center|LOCUS_35530 40882 40442 gene locus_tag LOCUS_35540 40882 40442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 41367 40969 gene locus_tag LOCUS_35550 41367 40969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 41750 41364 gene locus_tag LOCUS_35560 41750 41364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 42725 41826 gene locus_tag LOCUS_35570 42725 41826 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_35570 42969 42781 gene locus_tag LOCUS_35580 42969 42781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 43913 43593 gene locus_tag LOCUS_35590 43913 43593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 44551 43910 gene locus_tag LOCUS_35600 44551 43910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 44884 44663 gene locus_tag LOCUS_35610 44884 44663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 45098 44781 gene locus_tag LOCUS_35620 45098 44781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 45759 45397 gene locus_tag LOCUS_35630 45759 45397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 46447 45794 gene locus_tag LOCUS_35640 46447 45794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 47544 46444 gene locus_tag LOCUS_35650 47544 46444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 48882 47647 gene locus_tag LOCUS_35660 48882 47647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 <51599 48879 gene locus_tag LOCUS_35670 <51599 48879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289308.1:thrombospondin type 3 repeat-containing protein >Feature sequence07 278 415 gene locus_tag LOCUS_35680 278 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 448 1038 gene locus_tag LOCUS_35690 448 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 1049 1792 gene locus_tag LOCUS_35700 1049 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 1831 2334 gene locus_tag LOCUS_35710 1831 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 2572 2817 gene locus_tag LOCUS_35720 2572 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 3833 4084 gene locus_tag LOCUS_35730 3833 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 4465 4208 gene locus_tag LOCUS_35740 4465 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 4851 4462 gene locus_tag LOCUS_35750 4851 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 5753 5148 gene locus_tag LOCUS_35760 5753 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 6684 7439 gene locus_tag LOCUS_35770 6684 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 8143 7916 gene locus_tag LOCUS_35780 8143 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 8224 8439 gene locus_tag LOCUS_35790 8224 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 8716 8480 gene locus_tag LOCUS_35800 8716 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 9273 8950 gene locus_tag LOCUS_35810 9273 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 9681 9887 gene locus_tag LOCUS_35820 9681 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 9971 10168 gene locus_tag LOCUS_35830 9971 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 10161 10322 gene locus_tag LOCUS_35840 10161 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 10699 10379 gene locus_tag LOCUS_35850 10699 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 12030 10939 gene locus_tag LOCUS_35860 12030 10939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289492.1 protein_id gnl|my_center|LOCUS_35860 12923 12033 gene locus_tag LOCUS_35870 12923 12033 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_35870 13870 12920 gene locus_tag LOCUS_35880 13870 12920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024132.1 protein_id gnl|my_center|LOCUS_35880 15399 13876 gene locus_tag LOCUS_35890 15399 13876 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022987.1 protein_id gnl|my_center|LOCUS_35890 17040 15556 gene locus_tag LOCUS_35900 17040 15556 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990685.1 protein_id gnl|my_center|LOCUS_35900 18393 17359 gene locus_tag LOCUS_35910 18393 17359 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903914.1 protein_id gnl|my_center|LOCUS_35910 19430 18597 gene locus_tag LOCUS_35920 19430 18597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 19766 19488 gene locus_tag LOCUS_35930 19766 19488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 19888 20214 gene locus_tag LOCUS_35940 19888 20214 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902522.1 protein_id gnl|my_center|LOCUS_35940 20845 21717 gene locus_tag LOCUS_35950 20845 21717 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289734.1 protein_id gnl|my_center|LOCUS_35950 21714 22106 gene locus_tag LOCUS_35960 21714 22106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 24085 24351 gene locus_tag LOCUS_35970 24085 24351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 24327 24641 gene locus_tag LOCUS_35980 24327 24641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 25663 25442 gene locus_tag LOCUS_35990 25663 25442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 26956 26777 gene locus_tag LOCUS_36000 26956 26777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 27432 28532 gene locus_tag LOCUS_36010 27432 28532 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_36010 28519 29325 gene locus_tag LOCUS_36020 28519 29325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 29918 29727 gene locus_tag LOCUS_36030 29918 29727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 31223 30765 gene locus_tag LOCUS_36040 31223 30765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 32959 31610 gene locus_tag LOCUS_36050 32959 31610 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 protein_id gnl|my_center|LOCUS_36050 34340 33210 gene locus_tag LOCUS_36060 34340 33210 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064319.1 protein_id gnl|my_center|LOCUS_36060 35013 34330 gene locus_tag LOCUS_36070 35013 34330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901944.1 protein_id gnl|my_center|LOCUS_36070 36427 35069 gene locus_tag LOCUS_36080 36427 35069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 37300 37833 gene locus_tag LOCUS_36090 37300 37833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 39447 39184 gene locus_tag LOCUS_36100 39447 39184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36100 39801 39526 gene locus_tag LOCUS_36110 39801 39526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 40076 40267 gene locus_tag LOCUS_36120 40076 40267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 40434 43451 gene locus_tag LOCUS_36130 40434 43451 CDS product type 2 lanthipeptide synthetase LanM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370929.1 protein_id gnl|my_center|LOCUS_36130 44309 45331 gene locus_tag LOCUS_36140 44309 45331 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890429.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence08 439 170 gene locus_tag LOCUS_36150 439 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 562 888 gene locus_tag LOCUS_36160 562 888 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902522.1 protein_id gnl|my_center|LOCUS_36160 1241 1825 gene locus_tag LOCUS_36170 1241 1825 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289745.1 protein_id gnl|my_center|LOCUS_36170 1835 2365 gene locus_tag LOCUS_36180 1835 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289744.1 protein_id gnl|my_center|LOCUS_36180 2698 3525 gene locus_tag LOCUS_36190 2698 3525 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289734.1 protein_id gnl|my_center|LOCUS_36190 3526 3939 gene locus_tag LOCUS_36200 3526 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289733.1 protein_id gnl|my_center|LOCUS_36200 4521 5372 gene locus_tag LOCUS_36210 4521 5372 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070807659.1 protein_id gnl|my_center|LOCUS_36210 5374 7809 gene locus_tag LOCUS_36220 5374 7809 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903632.1 protein_id gnl|my_center|LOCUS_36220 8485 7970 gene locus_tag LOCUS_36230 8485 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36230 9768 8770 gene locus_tag LOCUS_36240 9768 8770 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890413.1 protein_id gnl|my_center|LOCUS_36240 11131 9758 gene locus_tag LOCUS_36250 11131 9758 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890412.1 protein_id gnl|my_center|LOCUS_36250 11789 12334 gene locus_tag LOCUS_36260 11789 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 12768 13370 gene locus_tag LOCUS_36270 12768 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36270 13879 13613 gene locus_tag LOCUS_36280 13879 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 13987 14178 gene locus_tag LOCUS_36290 13987 14178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 15907 16746 gene locus_tag LOCUS_36300 15907 16746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 17467 16796 gene locus_tag LOCUS_36310 17467 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 18081 17806 gene locus_tag LOCUS_36320 18081 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 19016 18480 gene locus_tag LOCUS_36330 19016 18480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 21747 19087 gene locus_tag LOCUS_36340 21747 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 22915 21788 gene locus_tag LOCUS_36350 22915 21788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 23482 22925 gene locus_tag LOCUS_36360 23482 22925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 24281 24784 gene locus_tag LOCUS_36370 24281 24784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 24873 25541 gene locus_tag LOCUS_36380 24873 25541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 26007 26339 gene locus_tag LOCUS_36390 26007 26339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36390 26871 26650 gene locus_tag LOCUS_36400 26871 26650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 27278 27024 gene locus_tag LOCUS_36410 27278 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 28166 27342 gene locus_tag LOCUS_36420 28166 27342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 29186 28746 gene locus_tag LOCUS_36430 29186 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 29293 29661 gene locus_tag LOCUS_36440 29293 29661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 29684 29893 gene locus_tag LOCUS_36450 29684 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 31030 30131 gene locus_tag LOCUS_36460 31030 30131 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_36460 31772 31086 gene locus_tag LOCUS_36470 31772 31086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 32787 32509 gene locus_tag LOCUS_36480 32787 32509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 32684 33658 gene locus_tag LOCUS_36490 32684 33658 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903905.1 protein_id gnl|my_center|LOCUS_36490 33836 33702 gene locus_tag LOCUS_36500 33836 33702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 33955 34368 gene locus_tag LOCUS_36510 33955 34368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 35137 34445 gene locus_tag LOCUS_36520 35137 34445 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_36520 35534 35319 gene locus_tag LOCUS_36530 35534 35319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 35730 35527 gene locus_tag LOCUS_36540 35730 35527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 36018 35788 gene locus_tag LOCUS_36550 36018 35788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 36221 36015 gene locus_tag LOCUS_36560 36221 36015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 36526 36212 gene locus_tag LOCUS_36570 36526 36212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 36813 36523 gene locus_tag LOCUS_36580 36813 36523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 37057 37737 gene locus_tag LOCUS_36590 37057 37737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 38169 37834 gene locus_tag LOCUS_36600 38169 37834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 38812 38285 gene locus_tag LOCUS_36610 38812 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 39375 38809 gene locus_tag LOCUS_36620 39375 38809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 39385 39564 gene locus_tag LOCUS_36630 39385 39564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 39939 39631 gene locus_tag LOCUS_36640 39939 39631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 40949 40107 gene locus_tag LOCUS_36650 40949 40107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 41957 41010 gene locus_tag LOCUS_36660 41957 41010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 >Feature sequence09 1199 177 gene locus_tag LOCUS_36670 1199 177 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890429.1 protein_id gnl|my_center|LOCUS_36670 1538 3001 gene locus_tag LOCUS_36680 1538 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 7632 3100 gene locus_tag LOCUS_36690 7632 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 8185 9114 gene locus_tag LOCUS_36700 8185 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 9136 9441 gene locus_tag LOCUS_36710 9136 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 9847 9521 gene locus_tag LOCUS_36720 9847 9521 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903037.1 protein_id gnl|my_center|LOCUS_36720 9969 10253 gene locus_tag LOCUS_36730 9969 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 10304 11134 gene locus_tag LOCUS_36740 10304 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 11202 11789 gene locus_tag LOCUS_36750 11202 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 11871 12881 gene locus_tag LOCUS_36760 11871 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 12975 13097 gene locus_tag LOCUS_36770 12975 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 13247 13492 gene locus_tag LOCUS_36780 13247 13492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 13688 15079 gene locus_tag LOCUS_36790 13688 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 15195 15452 gene locus_tag LOCUS_36800 15195 15452 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901973.1 protein_id gnl|my_center|LOCUS_36800 15464 15709 gene locus_tag LOCUS_36810 15464 15709 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901974.1 protein_id gnl|my_center|LOCUS_36810 15781 16029 gene locus_tag LOCUS_36820 15781 16029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 17577 16762 gene locus_tag LOCUS_36830 17577 16762 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460928.1 protein_id gnl|my_center|LOCUS_36830 19103 17856 gene locus_tag LOCUS_36840 19103 17856 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014902978.1 protein_id gnl|my_center|LOCUS_36840 19230 20882 gene locus_tag LOCUS_36850 19230 20882 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_36850 20900 21853 gene locus_tag LOCUS_36860 20900 21853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812302.1 protein_id gnl|my_center|LOCUS_36860 21853 22761 gene locus_tag LOCUS_36870 21853 22761 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_36870 22758 24893 gene locus_tag LOCUS_36880 22758 24893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 25465 24908 gene locus_tag LOCUS_36890 25465 24908 CDS product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903981.1 protein_id gnl|my_center|LOCUS_36890 25449 25622 gene locus_tag LOCUS_36900 25449 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 26154 26471 gene locus_tag LOCUS_36910 26154 26471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 27032 26484 gene locus_tag LOCUS_36920 27032 26484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 27225 27590 gene locus_tag LOCUS_36930 27225 27590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 27798 28007 gene locus_tag LOCUS_36940 27798 28007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 28647 29792 gene locus_tag LOCUS_36950 28647 29792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence10 3269 2856 gene locus_tag LOCUS_36960 3269 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 3574 3269 gene locus_tag LOCUS_36970 3574 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 3959 3576 gene locus_tag LOCUS_36980 3959 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 5647 3959 gene locus_tag LOCUS_36990 5647 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 6162 5644 gene locus_tag LOCUS_37000 6162 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 6988 6164 gene locus_tag LOCUS_37010 6988 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 7590 6988 gene locus_tag LOCUS_37020 7590 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 7931 7587 gene locus_tag LOCUS_37030 7931 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 8221 7928 gene locus_tag LOCUS_37040 8221 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 8637 8251 gene locus_tag LOCUS_37050 8637 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 8836 9072 gene locus_tag LOCUS_37060 8836 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 9059 9676 gene locus_tag LOCUS_37070 9059 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 9673 10596 gene locus_tag LOCUS_37080 9673 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 10744 11526 gene locus_tag LOCUS_37090 10744 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 11523 12431 gene locus_tag LOCUS_37100 11523 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 12431 13609 gene locus_tag LOCUS_37110 12431 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 13599 13997 gene locus_tag LOCUS_37120 13599 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 14025 14702 gene locus_tag LOCUS_37130 14025 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 15431 14745 gene locus_tag LOCUS_37140 15431 14745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 15816 15631 gene locus_tag LOCUS_37150 15816 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 16137 16334 gene locus_tag LOCUS_37160 16137 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892499.1 protein_id gnl|my_center|LOCUS_37160 16753 16478 gene locus_tag LOCUS_37170 16753 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 17283 18107 gene locus_tag LOCUS_37180 17283 18107 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225439919.1 protein_id gnl|my_center|LOCUS_37180 18104 18484 gene locus_tag LOCUS_37190 18104 18484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 18831 18601 gene locus_tag LOCUS_37200 18831 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 22059 19201 gene locus_tag LOCUS_37210 22059 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 22474 22827 gene locus_tag LOCUS_37220 22474 22827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 23403 23029 gene locus_tag LOCUS_37230 23403 23029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 23675 23400 gene locus_tag LOCUS_37240 23675 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 23826 24143 gene locus_tag LOCUS_37250 23826 24143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 24303 24632 gene locus_tag LOCUS_37260 24303 24632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 24629 24892 gene locus_tag LOCUS_37270 24629 24892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 26258 25350 gene locus_tag LOCUS_37280 26258 25350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence11 2295 622 gene locus_tag LOCUS_37290 2295 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 3137 2298 gene locus_tag LOCUS_37300 3137 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 5200 3134 gene locus_tag LOCUS_37310 5200 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 5548 5210 gene locus_tag LOCUS_37320 5548 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 7196 6189 gene locus_tag LOCUS_37330 7196 6189 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289079.1 protein_id gnl|my_center|LOCUS_37330 8196 9431 gene locus_tag LOCUS_37340 8196 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 9428 11179 gene locus_tag LOCUS_37350 9428 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 12042 11659 gene locus_tag LOCUS_37360 12042 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 12896 12327 gene locus_tag LOCUS_37370 12896 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 13186 12908 gene locus_tag LOCUS_37380 13186 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 13493 13287 gene locus_tag LOCUS_37390 13493 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 16239 13585 gene locus_tag LOCUS_37400 16239 13585 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207707612.1 protein_id gnl|my_center|LOCUS_37400 16418 17023 gene locus_tag LOCUS_37410 16418 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 17016 17201 gene locus_tag LOCUS_37420 17016 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 18017 17349 gene locus_tag LOCUS_37430 18017 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 21480 18274 gene locus_tag LOCUS_37440 21480 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 21754 23502 gene locus_tag LOCUS_37450 21754 23502 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398544.1 protein_id gnl|my_center|LOCUS_37450 23495 24652 gene locus_tag LOCUS_37460 23495 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 24784 25821 gene locus_tag LOCUS_37470 24784 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence12 948 1814 gene locus_tag LOCUS_37480 948 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 2551 1799 gene locus_tag LOCUS_37490 2551 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3585 2626 gene locus_tag LOCUS_37500 3585 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 3975 3766 gene locus_tag LOCUS_37510 3975 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 4285 4022 gene locus_tag LOCUS_37520 4285 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904231.1 protein_id gnl|my_center|LOCUS_37520 5012 4407 gene locus_tag LOCUS_37530 5012 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 5016 5168 gene locus_tag LOCUS_37540 5016 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 6355 5318 gene locus_tag LOCUS_37550 6355 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 6884 6486 gene locus_tag LOCUS_37560 6884 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 7126 6881 gene locus_tag LOCUS_37570 7126 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 8949 7723 gene locus_tag LOCUS_37580 8949 7723 CDS product orc1/cdc6 family replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289079.1 protein_id gnl|my_center|LOCUS_37580 10473 9343 gene locus_tag LOCUS_37590 10473 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 10814 10473 gene locus_tag LOCUS_37600 10814 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 11515 11970 gene locus_tag LOCUS_37610 11515 11970 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890504.1 protein_id gnl|my_center|LOCUS_37610 11980 14070 gene locus_tag LOCUS_37620 11980 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 14169 14888 gene locus_tag LOCUS_37630 14169 14888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 14891 16600 gene locus_tag LOCUS_37640 14891 16600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence13 96 1028 gene locus_tag LOCUS_37650 96 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 1039 1782 gene locus_tag LOCUS_37660 1039 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 2136 3230 gene locus_tag LOCUS_37670 2136 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 3717 3448 gene locus_tag LOCUS_37680 3717 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 4605 3781 gene locus_tag LOCUS_37690 4605 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 4959 4663 gene locus_tag LOCUS_37700 4959 4663 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890479.1 protein_id gnl|my_center|LOCUS_37700 5429 4989 gene locus_tag LOCUS_37710 5429 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 5533 5904 gene locus_tag LOCUS_37720 5533 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 6368 5913 gene locus_tag LOCUS_37730 6368 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 7274 6375 gene locus_tag LOCUS_37740 7274 6375 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904212.1 protein_id gnl|my_center|LOCUS_37740 8016 7330 gene locus_tag LOCUS_37750 8016 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 10199 8409 gene locus_tag LOCUS_37760 10199 8409 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_37760 10610 10395 gene locus_tag LOCUS_37770 10610 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 10806 10603 gene locus_tag LOCUS_37780 10806 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 11443 11039 gene locus_tag LOCUS_37790 11443 11039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 11692 11462 gene locus_tag LOCUS_37800 11692 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 11895 11689 gene locus_tag LOCUS_37810 11895 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 12200 11886 gene locus_tag LOCUS_37820 12200 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 12487 12197 gene locus_tag LOCUS_37830 12487 12197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence14 315 500 gene locus_tag LOCUS_37840 315 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 1750 1088 gene locus_tag LOCUS_37850 1750 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 2336 1881 gene locus_tag LOCUS_37860 2336 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 3591 2437 gene locus_tag LOCUS_37870 3591 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3862 4509 gene locus_tag LOCUS_37880 3862 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 5752 4700 gene locus_tag LOCUS_37890 gene orc1 5752 4700 CDS product DNA replication protein Orc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904037.1 protein_id gnl|my_center|LOCUS_37890 7060 5888 gene locus_tag LOCUS_37900 7060 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 7513 7193 gene locus_tag LOCUS_37910 7513 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 7654 10534 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagatggacccttgtggggttgaagc 11950 10751 gene locus_tag LOCUS_37920 11950 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 >Feature sequence15 1841 702 gene locus_tag LOCUS_37930 1841 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 3624 3445 gene locus_tag LOCUS_37940 3624 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 4176 3931 gene locus_tag LOCUS_37950 4176 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 4260 4520 gene locus_tag LOCUS_37960 4260 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 6300 4639 gene locus_tag LOCUS_37970 6300 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 7514 6501 gene locus_tag LOCUS_37980 7514 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 8168 7581 gene locus_tag LOCUS_37990 8168 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 8710 9222 gene locus_tag LOCUS_38000 8710 9222 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933324.1 protein_id gnl|my_center|LOCUS_38000 9666 9526 gene locus_tag LOCUS_38010 9666 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 10258 10061 gene locus_tag LOCUS_38020 10258 10061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 10461 10799 gene locus_tag LOCUS_38030 10461 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 11173 10838 gene locus_tag LOCUS_38040 11173 10838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 >Feature sequence16 <1 2970 gene locus_tag LOCUS_38050 <1 2970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein 2989 4062 gene locus_tag LOCUS_38060 2989 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence17 511 2727 gene locus_tag LOCUS_38070 511 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3841 4206 gene locus_tag LOCUS_38080 3841 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 >Feature sequence18 511 2727 gene locus_tag LOCUS_38090 511 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 3841 4206 gene locus_tag LOCUS_38100 3841 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 >Feature sequence19 659 132 gene locus_tag LOCUS_38110 659 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 1423 656 gene locus_tag LOCUS_38120 1423 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 1926 1462 gene locus_tag LOCUS_38130 1926 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 2642 1962 gene locus_tag LOCUS_38140 2642 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 >Feature sequence20 936 1616 gene locus_tag LOCUS_38150 936 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1652 2116 gene locus_tag LOCUS_38160 1652 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2155 2922 gene locus_tag LOCUS_38170 2155 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 2919 3446 gene locus_tag LOCUS_38180 2919 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence21 1066 737 gene locus_tag LOCUS_38190 1066 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_38190 1252 2124 gene locus_tag LOCUS_38200 1252 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 2199 2951 gene locus_tag LOCUS_38210 2199 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence22 1029 715 gene locus_tag LOCUS_38220 1029 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904196.1 protein_id gnl|my_center|LOCUS_38220 1143 2102 gene locus_tag LOCUS_38230 1143 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 2177 2929 gene locus_tag LOCUS_38240 2177 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence23 >Feature sequence24 641 129 gene locus_tag LOCUS_38250 641 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1361 810 gene locus_tag LOCUS_38260 1361 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 >Feature sequence25 >Feature sequence26 >Feature sequence27 >Feature sequence28 >Feature sequence29 >Feature sequence30 >Feature sequence31 >Feature sequence32 >Feature sequence33 597 124 gene locus_tag LOCUS_38270 597 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 >Feature sequence34 597 124 gene locus_tag LOCUS_38280 597 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 >Feature sequence35 >Feature sequence36 357 190 gene locus_tag LOCUS_38290 357 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 >Feature sequence37 >Feature sequence38 256 185 gene locus_tag LOCUS_t00480 256 185 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38