>Feature sequence001 5099 4326 gene locus_tag LOCUS_00010 gene pgl 5099 4326 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_00010 6004 5096 gene locus_tag LOCUS_00020 gene opcA 6004 5096 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_00020 7754 6039 gene locus_tag LOCUS_00030 gene zwf 7754 6039 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976881.1 protein_id gnl|my_center|LOCUS_00030 9385 7754 gene locus_tag LOCUS_00040 9385 7754 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224675.1 protein_id gnl|my_center|LOCUS_00040 10570 9467 gene locus_tag LOCUS_00050 gene tal 10570 9467 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224676.1 protein_id gnl|my_center|LOCUS_00050 12691 10580 gene locus_tag LOCUS_00060 gene tkt 12691 10580 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022841.1 protein_id gnl|my_center|LOCUS_00060 13101 14057 gene locus_tag LOCUS_00070 13101 14057 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_00070 14330 15289 gene locus_tag LOCUS_00080 14330 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 15381 15818 gene locus_tag LOCUS_00090 15381 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15926 16768 gene locus_tag LOCUS_00100 15926 16768 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_00100 17023 18330 gene locus_tag LOCUS_00110 17023 18330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 19665 18352 gene locus_tag LOCUS_00120 19665 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 21308 20322 gene locus_tag LOCUS_00130 21308 20322 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_00130 22313 21399 gene locus_tag LOCUS_00140 22313 21399 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034357836.1 protein_id gnl|my_center|LOCUS_00140 23206 22436 gene locus_tag LOCUS_00150 23206 22436 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_00150 24137 23229 gene locus_tag LOCUS_00160 24137 23229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_00160 25566 24205 gene locus_tag LOCUS_00170 25566 24205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 25814 25605 gene locus_tag LOCUS_00180 25814 25605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25898 26662 gene locus_tag LOCUS_00190 25898 26662 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_00190 26840 28252 gene locus_tag LOCUS_00200 gene sufB 26840 28252 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_00200 28255 29406 gene locus_tag LOCUS_00210 gene sufD 28255 29406 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_00210 29403 29726 gene locus_tag LOCUS_00220 29403 29726 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_00220 29727 30482 gene locus_tag LOCUS_00230 gene sufC 29727 30482 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_00230 30529 31788 gene locus_tag LOCUS_00240 30529 31788 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_00240 31789 32235 gene locus_tag LOCUS_00250 31789 32235 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224701.1 protein_id gnl|my_center|LOCUS_00250 32232 32621 gene locus_tag LOCUS_00260 32232 32621 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_00260 33256 35022 gene locus_tag LOCUS_00270 33256 35022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080066.1 protein_id gnl|my_center|LOCUS_00270 35123 36115 gene locus_tag LOCUS_00280 35123 36115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080068.1 protein_id gnl|my_center|LOCUS_00280 36112 37062 gene locus_tag LOCUS_00290 36112 37062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080070.1 protein_id gnl|my_center|LOCUS_00290 37062 38009 gene locus_tag LOCUS_00300 37062 38009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080073.1 protein_id gnl|my_center|LOCUS_00300 38013 38978 gene locus_tag LOCUS_00310 38013 38978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080075.1 protein_id gnl|my_center|LOCUS_00310 39109 40119 gene locus_tag LOCUS_00320 39109 40119 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972694.1 protein_id gnl|my_center|LOCUS_00320 40455 42899 gene locus_tag LOCUS_00330 40455 42899 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225596.1 protein_id gnl|my_center|LOCUS_00330 43095 43358 gene locus_tag LOCUS_00340 43095 43358 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054261.1 protein_id gnl|my_center|LOCUS_00340 43452 44297 gene locus_tag LOCUS_00350 gene hisG 43452 44297 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_00350 45600 44269 gene locus_tag LOCUS_00360 45600 44269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45500 45835 gene locus_tag LOCUS_00370 45500 45835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 46170 46901 gene locus_tag LOCUS_00380 46170 46901 CDS product acVLRF1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_00380 47270 48112 gene locus_tag LOCUS_00390 47270 48112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226851.1 protein_id gnl|my_center|LOCUS_00390 48109 48951 gene locus_tag LOCUS_00400 48109 48951 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268530.1 protein_id gnl|my_center|LOCUS_00400 48948 50600 gene locus_tag LOCUS_00410 48948 50600 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730601.1 protein_id gnl|my_center|LOCUS_00410 50597 51016 gene locus_tag LOCUS_00420 50597 51016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51013 52020 gene locus_tag LOCUS_00430 51013 52020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52257 53855 gene locus_tag LOCUS_00440 52257 53855 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_00440 53971 54192 gene locus_tag LOCUS_00450 53971 54192 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_00450 54344 55186 gene locus_tag LOCUS_00460 54344 55186 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_00460 55632 57530 gene locus_tag LOCUS_00470 55632 57530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_00470 58420 57515 gene locus_tag LOCUS_00480 58420 57515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 58440 59201 gene locus_tag LOCUS_00490 58440 59201 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_00490 59198 60142 gene locus_tag LOCUS_00500 59198 60142 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_00500 60207 61133 gene locus_tag LOCUS_00510 60207 61133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61859 61239 gene locus_tag LOCUS_00520 61859 61239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 63649 62069 gene locus_tag LOCUS_00530 63649 62069 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_00530 64110 65819 gene locus_tag LOCUS_00540 64110 65819 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_00540 65988 66911 gene locus_tag LOCUS_00550 65988 66911 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109004014.1 protein_id gnl|my_center|LOCUS_00550 66929 68446 gene locus_tag LOCUS_00560 gene glpK 66929 68446 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226257.1 protein_id gnl|my_center|LOCUS_00560 69471 68485 gene locus_tag LOCUS_00570 69471 68485 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00570 69386 69583 gene locus_tag LOCUS_00580 69386 69583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 70018 71007 gene locus_tag LOCUS_00590 gene moaA 70018 71007 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_00590 71119 71376 gene locus_tag LOCUS_00600 71119 71376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 71756 71484 gene locus_tag LOCUS_00610 71756 71484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 72451 71753 gene locus_tag LOCUS_00620 72451 71753 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_00620 73021 72698 gene locus_tag LOCUS_00630 73021 72698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 73120 73332 gene locus_tag LOCUS_00640 73120 73332 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_00640 73451 73774 gene locus_tag LOCUS_00650 73451 73774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75286 73916 gene locus_tag LOCUS_00660 75286 73916 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_00660 76785 75283 gene locus_tag LOCUS_00670 76785 75283 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_00670 76863 77567 gene locus_tag LOCUS_00680 gene fabG 76863 77567 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_00680 77569 78336 gene locus_tag LOCUS_00690 gene fabI 77569 78336 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226770.1 protein_id gnl|my_center|LOCUS_00690 79363 78407 gene locus_tag LOCUS_00700 79363 78407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 80451 79504 gene locus_tag LOCUS_00710 80451 79504 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285031.1 protein_id gnl|my_center|LOCUS_00710 80586 81296 gene locus_tag LOCUS_00720 80586 81296 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_00720 81307 81864 gene locus_tag LOCUS_00730 81307 81864 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_00730 81872 82642 gene locus_tag LOCUS_00740 81872 82642 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_00740 82722 83465 gene locus_tag LOCUS_00750 82722 83465 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388471.1 protein_id gnl|my_center|LOCUS_00750 83560 84783 gene locus_tag LOCUS_00760 gene mshC 83560 84783 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_00760 85373 84819 gene locus_tag LOCUS_00770 gene def 85373 84819 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_00770 85708 87084 gene locus_tag LOCUS_00780 85708 87084 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085590.1 protein_id gnl|my_center|LOCUS_00780 87416 87027 gene locus_tag LOCUS_00790 87416 87027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 87355 89472 gene locus_tag LOCUS_00800 87355 89472 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223026.1 protein_id gnl|my_center|LOCUS_00800 89469 90962 gene locus_tag LOCUS_00810 89469 90962 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223027.1 protein_id gnl|my_center|LOCUS_00810 90959 93454 gene locus_tag LOCUS_00820 gene nirB 90959 93454 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223029.1 protein_id gnl|my_center|LOCUS_00820 93451 93864 gene locus_tag LOCUS_00830 93451 93864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 94078 95274 gene locus_tag LOCUS_00840 94078 95274 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_00840 95271 96122 gene locus_tag LOCUS_00850 95271 96122 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891750.1 protein_id gnl|my_center|LOCUS_00850 97065 96211 gene locus_tag LOCUS_00860 gene parJ 97065 96211 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00860 97281 100751 gene locus_tag LOCUS_00870 gene metH 97281 100751 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_00870 100920 101567 gene locus_tag LOCUS_00880 100920 101567 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_00880 101679 102179 gene locus_tag LOCUS_00890 101679 102179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_00890 102484 103485 gene locus_tag LOCUS_00900 102484 103485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_00900 103532 105286 gene locus_tag LOCUS_00910 103532 105286 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_00910 105365 106378 gene locus_tag LOCUS_00920 105365 106378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_00920 106375 107460 gene locus_tag LOCUS_00930 106375 107460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_00930 107549 108610 gene locus_tag LOCUS_00940 107549 108610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 109389 108706 gene locus_tag LOCUS_00950 109389 108706 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_00950 110669 109386 gene locus_tag LOCUS_00960 110669 109386 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_00960 111742 110801 gene locus_tag LOCUS_00970 111742 110801 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_00970 111985 111752 gene locus_tag LOCUS_00980 111985 111752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 111879 113012 gene locus_tag LOCUS_00990 111879 113012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00990 113424 114794 gene locus_tag LOCUS_01000 113424 114794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 116439 114850 gene locus_tag LOCUS_01010 116439 114850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 117638 116544 gene locus_tag LOCUS_01020 117638 116544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 117809 118687 gene locus_tag LOCUS_01030 117809 118687 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_01030 118908 120671 gene locus_tag LOCUS_01040 gene arc 118908 120671 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_01040 121074 122195 gene locus_tag LOCUS_01050 121074 122195 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 protein_id gnl|my_center|LOCUS_01050 122237 122434 gene locus_tag LOCUS_01060 122237 122434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 122469 123968 gene locus_tag LOCUS_01070 gene dop 122469 123968 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_01070 124200 125618 gene locus_tag LOCUS_01080 124200 125618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 125955 126164 gene locus_tag LOCUS_01090 125955 126164 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_01090 127054 127857 gene locus_tag LOCUS_01100 gene prcB 127054 127857 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_01100 127903 128745 gene locus_tag LOCUS_01110 gene prcA 127903 128745 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_01110 128832 130190 gene locus_tag LOCUS_01120 gene pafA 128832 130190 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_01120 130386 131378 gene locus_tag LOCUS_01130 130386 131378 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_01130 131395 132072 gene locus_tag LOCUS_01140 131395 132072 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971473.1 protein_id gnl|my_center|LOCUS_01140 132105 132563 gene locus_tag LOCUS_01150 132105 132563 CDS product DUF3291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640509.1 protein_id gnl|my_center|LOCUS_01150 133688 132621 gene locus_tag LOCUS_01160 133688 132621 CDS product DUF3866 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805204.1 protein_id gnl|my_center|LOCUS_01160 133797 134744 gene locus_tag LOCUS_01170 133797 134744 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226715.1 protein_id gnl|my_center|LOCUS_01170 134741 135700 gene locus_tag LOCUS_01180 134741 135700 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_01180 135697 135984 gene locus_tag LOCUS_01190 135697 135984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 136053 136355 gene locus_tag LOCUS_01200 136053 136355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 136414 137286 gene locus_tag LOCUS_01210 gene tatC 136414 137286 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226711.1 protein_id gnl|my_center|LOCUS_01210 137415 140147 gene locus_tag LOCUS_01220 137415 140147 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_01220 141079 140129 gene locus_tag LOCUS_01230 141079 140129 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_01230 142560 141118 gene locus_tag LOCUS_01240 142560 141118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 142744 143844 gene locus_tag LOCUS_01250 142744 143844 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226703.1 protein_id gnl|my_center|LOCUS_01250 144052 144357 gene locus_tag LOCUS_01260 144052 144357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 145178 144258 gene locus_tag LOCUS_01270 145178 144258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 145370 146689 gene locus_tag LOCUS_01280 145370 146689 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227055.1 protein_id gnl|my_center|LOCUS_01280 146782 148437 gene locus_tag LOCUS_01290 146782 148437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 148452 149114 gene locus_tag LOCUS_01300 148452 149114 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695789.1 protein_id gnl|my_center|LOCUS_01300 149405 150112 gene locus_tag LOCUS_01310 149405 150112 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_01310 150155 150436 gene locus_tag LOCUS_01320 150155 150436 CDS product muconolactone Delta-isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729505.1 protein_id gnl|my_center|LOCUS_01320 150483 151388 gene locus_tag LOCUS_01330 150483 151388 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028478.1 protein_id gnl|my_center|LOCUS_01330 151421 151819 gene locus_tag LOCUS_01340 151421 151819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 151931 152173 gene locus_tag LOCUS_01350 151931 152173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 152939 152649 gene locus_tag LOCUS_01360 152939 152649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 153310 152936 gene locus_tag LOCUS_01370 153310 152936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 153741 153382 gene locus_tag LOCUS_01380 153741 153382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 153869 154714 gene locus_tag LOCUS_01390 153869 154714 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_01390 154723 154923 gene locus_tag LOCUS_01400 154723 154923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 155024 155224 gene locus_tag LOCUS_01410 155024 155224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 155483 156145 gene locus_tag LOCUS_01420 155483 156145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083291.1 protein_id gnl|my_center|LOCUS_01420 156174 156980 gene locus_tag LOCUS_01430 156174 156980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_01430 156977 160009 gene locus_tag LOCUS_01440 156977 160009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 160863 160036 gene locus_tag LOCUS_01450 gene erm(O) 160863 160036 CDS product 23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(O) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030647.1 protein_id gnl|my_center|LOCUS_01450 162032 161208 gene locus_tag LOCUS_01460 gene hypB 162032 161208 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 protein_id gnl|my_center|LOCUS_01460 162373 162035 gene locus_tag LOCUS_01470 162373 162035 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 protein_id gnl|my_center|LOCUS_01470 163572 162496 gene locus_tag LOCUS_01480 163572 162496 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728263.1 protein_id gnl|my_center|LOCUS_01480 163759 164295 gene locus_tag LOCUS_01490 163759 164295 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728264.1 protein_id gnl|my_center|LOCUS_01490 164430 165401 gene locus_tag LOCUS_01500 164430 165401 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 protein_id gnl|my_center|LOCUS_01500 165504 167111 gene locus_tag LOCUS_01510 165504 167111 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 protein_id gnl|my_center|LOCUS_01510 167135 167947 gene locus_tag LOCUS_01520 167135 167947 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893635.1 protein_id gnl|my_center|LOCUS_01520 167944 169272 gene locus_tag LOCUS_01530 167944 169272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728267.1 protein_id gnl|my_center|LOCUS_01530 169275 169634 gene locus_tag LOCUS_01540 169275 169634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258622.1 protein_id gnl|my_center|LOCUS_01540 169652 170593 gene locus_tag LOCUS_01550 169652 170593 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728268.1 protein_id gnl|my_center|LOCUS_01550 170554 171783 gene locus_tag LOCUS_01560 170554 171783 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 protein_id gnl|my_center|LOCUS_01560 171956 174331 gene locus_tag LOCUS_01570 gene hypF 171956 174331 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 protein_id gnl|my_center|LOCUS_01570 174334 174603 gene locus_tag LOCUS_01580 174334 174603 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_01580 174600 175352 gene locus_tag LOCUS_01590 174600 175352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894092.1 protein_id gnl|my_center|LOCUS_01590 175349 176020 gene locus_tag LOCUS_01600 175349 176020 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894091.1 protein_id gnl|my_center|LOCUS_01600 176056 177204 gene locus_tag LOCUS_01610 gene hypE 176056 177204 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728538.1 protein_id gnl|my_center|LOCUS_01610 177232 177504 gene locus_tag LOCUS_01620 gene hypC 177232 177504 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 protein_id gnl|my_center|LOCUS_01620 177597 178730 gene locus_tag LOCUS_01630 gene hypD 177597 178730 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_01630 178727 179500 gene locus_tag LOCUS_01640 178727 179500 CDS product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 protein_id gnl|my_center|LOCUS_01640 179550 179645 gene locus_tag LOCUS_t00010 179550 179645 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 179678 181510 gene locus_tag LOCUS_01650 gene selB 179678 181510 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226942.1 protein_id gnl|my_center|LOCUS_01650 182603 182133 gene locus_tag LOCUS_01660 gene rraA 182603 182133 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731282.1 protein_id gnl|my_center|LOCUS_01660 183640 182717 gene locus_tag LOCUS_01670 183640 182717 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_01670 183781 184695 gene locus_tag LOCUS_01680 183781 184695 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 protein_id gnl|my_center|LOCUS_01680 185319 184861 gene locus_tag LOCUS_01690 185319 184861 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_01690 187029 185356 gene locus_tag LOCUS_01700 187029 185356 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742163.1 protein_id gnl|my_center|LOCUS_01700 187942 187031 gene locus_tag LOCUS_01710 187942 187031 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971611.1 protein_id gnl|my_center|LOCUS_01710 188859 187939 gene locus_tag LOCUS_01720 188859 187939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_01720 189594 189740 gene locus_tag LOCUS_01730 189594 189740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 190355 189867 gene locus_tag LOCUS_01740 190355 189867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 190640 191101 gene locus_tag LOCUS_01750 190640 191101 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_01750 191176 193659 gene locus_tag LOCUS_01760 191176 193659 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449606.1 protein_id gnl|my_center|LOCUS_01760 194409 194137 gene locus_tag LOCUS_01770 194409 194137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 194327 196060 gene locus_tag LOCUS_01780 gene lnt 194327 196060 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086490.1 protein_id gnl|my_center|LOCUS_01780 196060 196812 gene locus_tag LOCUS_01790 196060 196812 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_01790 197710 198279 gene locus_tag LOCUS_01800 197710 198279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 198967 198623 gene locus_tag LOCUS_01810 198967 198623 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_01810 200443 199097 gene locus_tag LOCUS_01820 200443 199097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_01820 201243 200440 gene locus_tag LOCUS_01830 201243 200440 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_01830 202021 201410 gene locus_tag LOCUS_01840 202021 201410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 202686 202090 gene locus_tag LOCUS_01850 202686 202090 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_01850 203714 202767 gene locus_tag LOCUS_01860 203714 202767 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226779.1 protein_id gnl|my_center|LOCUS_01860 204673 203711 gene locus_tag LOCUS_01870 204673 203711 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_01870 205697 204678 gene locus_tag LOCUS_01880 205697 204678 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_01880 205587 205943 gene locus_tag LOCUS_01890 205587 205943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 205918 206655 gene locus_tag LOCUS_01900 205918 206655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 207129 210008 gene locus_tag LOCUS_01910 207129 210008 CDS product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 protein_id gnl|my_center|LOCUS_01910 210005 210457 gene locus_tag LOCUS_01920 210005 210457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 210454 212028 gene locus_tag LOCUS_01930 210454 212028 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892272.1 protein_id gnl|my_center|LOCUS_01930 212025 212711 gene locus_tag LOCUS_01940 212025 212711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 212708 213019 gene locus_tag LOCUS_01950 212708 213019 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972188.1 protein_id gnl|my_center|LOCUS_01950 213009 213389 gene locus_tag LOCUS_01960 gene mnhG 213009 213389 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 protein_id gnl|my_center|LOCUS_01960 214467 213718 gene locus_tag LOCUS_01970 214467 213718 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286332.1 protein_id gnl|my_center|LOCUS_01970 214539 215585 gene locus_tag LOCUS_01980 214539 215585 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_01980 215819 216451 gene locus_tag LOCUS_01990 215819 216451 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230026.1 protein_id gnl|my_center|LOCUS_01990 217045 216533 gene locus_tag LOCUS_02000 217045 216533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 217249 220431 gene locus_tag LOCUS_02010 217249 220431 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224450.1 protein_id gnl|my_center|LOCUS_02010 220536 221969 gene locus_tag LOCUS_02020 gene purB 220536 221969 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_02020 222339 223103 gene locus_tag LOCUS_02030 222339 223103 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_02030 224245 223229 gene locus_tag LOCUS_02040 224245 223229 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_02040 224600 224262 gene locus_tag LOCUS_02050 224600 224262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 225878 224793 gene locus_tag LOCUS_02060 225878 224793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 227494 226214 gene locus_tag LOCUS_02070 227494 226214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 228279 229343 gene locus_tag LOCUS_02080 228279 229343 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226556.1 protein_id gnl|my_center|LOCUS_02080 229676 230590 gene locus_tag LOCUS_02090 229676 230590 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_02090 230631 231500 gene locus_tag LOCUS_02100 230631 231500 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392394.1 protein_id gnl|my_center|LOCUS_02100 231508 232311 gene locus_tag LOCUS_02110 231508 232311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228482.1 protein_id gnl|my_center|LOCUS_02110 232495 233742 gene locus_tag LOCUS_02120 232495 233742 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_02120 234388 233816 gene locus_tag LOCUS_02130 234388 233816 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_02130 235893 234868 gene locus_tag LOCUS_02140 235893 234868 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228127.1 protein_id gnl|my_center|LOCUS_02140 237352 236132 gene locus_tag LOCUS_02150 237352 236132 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031719.1 protein_id gnl|my_center|LOCUS_02150 237699 238658 gene locus_tag LOCUS_02160 237699 238658 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_02160 238782 239648 gene locus_tag LOCUS_02170 238782 239648 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230390.1 protein_id gnl|my_center|LOCUS_02170 240906 239737 gene locus_tag LOCUS_02180 240906 239737 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630264.1 protein_id gnl|my_center|LOCUS_02180 241165 243444 gene locus_tag LOCUS_02190 241165 243444 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_02190 243705 245270 gene locus_tag LOCUS_02200 243705 245270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 246029 246661 gene locus_tag LOCUS_02210 246029 246661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 246658 247032 gene locus_tag LOCUS_02220 246658 247032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 248672 247314 gene locus_tag LOCUS_02230 gene argG 248672 247314 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972108.1 protein_id gnl|my_center|LOCUS_02230 249823 248888 gene locus_tag LOCUS_02240 249823 248888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 249994 251256 gene locus_tag LOCUS_02250 249994 251256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 252618 251413 gene locus_tag LOCUS_02260 252618 251413 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226315.1 protein_id gnl|my_center|LOCUS_02260 252801 253322 gene locus_tag LOCUS_02270 252801 253322 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_02270 255018 253936 gene locus_tag LOCUS_02280 255018 253936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 255359 256660 gene locus_tag LOCUS_02290 255359 256660 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222583.1 protein_id gnl|my_center|LOCUS_02290 256874 257533 gene locus_tag LOCUS_02300 256874 257533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 257965 257591 gene locus_tag LOCUS_02310 257965 257591 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_02310 258780 258106 gene locus_tag LOCUS_02320 258780 258106 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222882.1 protein_id gnl|my_center|LOCUS_02320 259904 258777 gene locus_tag LOCUS_02330 259904 258777 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_02330 260125 260598 gene locus_tag LOCUS_02340 260125 260598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 262986 260692 gene locus_tag LOCUS_02350 262986 260692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 263640 263074 gene locus_tag LOCUS_02360 263640 263074 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_02360 264052 263630 gene locus_tag LOCUS_02370 264052 263630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 264926 264408 gene locus_tag LOCUS_02380 264926 264408 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031191.1 protein_id gnl|my_center|LOCUS_02380 265579 265031 gene locus_tag LOCUS_02390 265579 265031 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972196.1 protein_id gnl|my_center|LOCUS_02390 267237 266074 gene locus_tag LOCUS_02400 267237 266074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 267353 268396 gene locus_tag LOCUS_02410 267353 268396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 269646 268750 gene locus_tag LOCUS_02420 269646 268750 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_02420 270934 269750 gene locus_tag LOCUS_02430 270934 269750 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227969.1 protein_id gnl|my_center|LOCUS_02430 271904 271446 gene locus_tag LOCUS_02440 271904 271446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 272335 271925 gene locus_tag LOCUS_02450 272335 271925 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_02450 273524 272586 gene locus_tag LOCUS_02460 273524 272586 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 protein_id gnl|my_center|LOCUS_02460 273661 274002 gene locus_tag LOCUS_02470 273661 274002 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413663.1 protein_id gnl|my_center|LOCUS_02470 274698 274021 gene locus_tag LOCUS_02480 274698 274021 CDS product TioE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230388.1 protein_id gnl|my_center|LOCUS_02480 274798 275967 gene locus_tag LOCUS_02490 274798 275967 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889604.1 protein_id gnl|my_center|LOCUS_02490 276337 276023 gene locus_tag LOCUS_02500 gene sugE 276337 276023 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921272.1 protein_id gnl|my_center|LOCUS_02500 276803 278632 gene locus_tag LOCUS_02510 276803 278632 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029115.1 protein_id gnl|my_center|LOCUS_02510 279412 279002 gene locus_tag LOCUS_02520 279412 279002 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_02520 279626 280462 gene locus_tag LOCUS_02530 279626 280462 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226540.1 protein_id gnl|my_center|LOCUS_02530 280895 280404 gene locus_tag LOCUS_02540 gene soxR 280895 280404 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_02540 281474 282130 gene locus_tag LOCUS_02550 281474 282130 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908001.1 protein_id gnl|my_center|LOCUS_02550 282259 283896 gene locus_tag LOCUS_02560 282259 283896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 284185 283922 gene locus_tag LOCUS_02570 284185 283922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 284320 285387 gene locus_tag LOCUS_02580 284320 285387 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_02580 285520 285660 gene locus_tag LOCUS_02590 285520 285660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 285753 289097 gene locus_tag LOCUS_02600 285753 289097 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028423.1 protein_id gnl|my_center|LOCUS_02600 289094 289756 gene locus_tag LOCUS_02610 289094 289756 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067171.1 protein_id gnl|my_center|LOCUS_02610 290425 289766 gene locus_tag LOCUS_02620 290425 289766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 290651 292078 gene locus_tag LOCUS_02630 290651 292078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 292273 292752 gene locus_tag LOCUS_02640 292273 292752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02640 292749 293105 gene locus_tag LOCUS_02650 292749 293105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 293230 294513 gene locus_tag LOCUS_02660 293230 294513 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929999.1 protein_id gnl|my_center|LOCUS_02660 295837 294524 gene locus_tag LOCUS_02670 gene selA 295837 294524 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727953.1 protein_id gnl|my_center|LOCUS_02670 296026 296925 gene locus_tag LOCUS_02680 296026 296925 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223219.1 protein_id gnl|my_center|LOCUS_02680 298219 296954 gene locus_tag LOCUS_02690 298219 296954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229610.1 protein_id gnl|my_center|LOCUS_02690 299239 298355 gene locus_tag LOCUS_02700 299239 298355 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028377.1 protein_id gnl|my_center|LOCUS_02700 299337 299681 gene locus_tag LOCUS_02710 299337 299681 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028376.1 protein_id gnl|my_center|LOCUS_02710 300338 299871 gene locus_tag LOCUS_02720 300338 299871 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070936545.1 protein_id gnl|my_center|LOCUS_02720 301855 300338 gene locus_tag LOCUS_02730 301855 300338 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090806.1 protein_id gnl|my_center|LOCUS_02730 302154 302468 gene locus_tag LOCUS_02740 302154 302468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 302698 303045 gene locus_tag LOCUS_02750 302698 303045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 304326 303100 gene locus_tag LOCUS_02760 304326 303100 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 protein_id gnl|my_center|LOCUS_02760 304639 305883 gene locus_tag LOCUS_02770 304639 305883 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878598.1 protein_id gnl|my_center|LOCUS_02770 306078 307472 gene locus_tag LOCUS_02780 gene mnoS 306078 307472 CDS product two-component system sensor histidine kinase MnoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731147.1 protein_id gnl|my_center|LOCUS_02780 307459 308181 gene locus_tag LOCUS_02790 gene mnoR 307459 308181 CDS product two-component system response regulator MnoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897657.1 protein_id gnl|my_center|LOCUS_02790 309852 308338 gene locus_tag LOCUS_02800 309852 308338 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731149.1 protein_id gnl|my_center|LOCUS_02800 311110 309866 gene locus_tag LOCUS_02810 311110 309866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 312655 311363 gene locus_tag LOCUS_02820 gene mdo 312655 311363 CDS product NDMA-dependent methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731151.1 protein_id gnl|my_center|LOCUS_02820 312796 313557 gene locus_tag LOCUS_02830 312796 313557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 313744 315123 gene locus_tag LOCUS_02840 313744 315123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02840 315117 315794 gene locus_tag LOCUS_02850 315117 315794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 316867 315965 gene locus_tag LOCUS_02860 gene nrfD 316867 315965 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227549.1 protein_id gnl|my_center|LOCUS_02860 317745 316975 gene locus_tag LOCUS_02870 317745 316975 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727951.1 protein_id gnl|my_center|LOCUS_02870 320278 317738 gene locus_tag LOCUS_02880 gene fdh 320278 317738 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227547.1 protein_id gnl|my_center|LOCUS_02880 318422 318508 gene locus_tag LOCUS_t00020 318422 318508 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 320989 320387 gene locus_tag LOCUS_02890 320989 320387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 321105 321845 gene locus_tag LOCUS_02900 321105 321845 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_02900 323511 321856 gene locus_tag LOCUS_02910 gene menD 323511 321856 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466562.1 protein_id gnl|my_center|LOCUS_02910 323738 324958 gene locus_tag LOCUS_02920 gene menE 323738 324958 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216843435.1 protein_id gnl|my_center|LOCUS_02920 325156 325497 gene locus_tag LOCUS_02930 325156 325497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 325838 327394 gene locus_tag LOCUS_02940 325838 327394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 327867 327466 gene locus_tag LOCUS_02950 327867 327466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 328011 328628 gene locus_tag LOCUS_02960 328011 328628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 329035 329235 gene locus_tag LOCUS_02970 329035 329235 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_02970 329458 329282 gene locus_tag LOCUS_02980 329458 329282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 330111 329455 gene locus_tag LOCUS_02990 330111 329455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229714.1 protein_id gnl|my_center|LOCUS_02990 330170 330523 gene locus_tag LOCUS_03000 330170 330523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 331356 330553 gene locus_tag LOCUS_03010 331356 330553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 334354 331475 gene locus_tag LOCUS_03020 gene gcvP 334354 331475 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_03020 335324 334704 gene locus_tag LOCUS_03030 335324 334704 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805153.1 protein_id gnl|my_center|LOCUS_03030 336083 335649 gene locus_tag LOCUS_03040 336083 335649 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_03040 336974 336294 gene locus_tag LOCUS_03050 336974 336294 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027756.1 protein_id gnl|my_center|LOCUS_03050 337495 336980 gene locus_tag LOCUS_03060 337495 336980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 340493 337986 gene locus_tag LOCUS_03070 340493 337986 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_03070 341106 340498 gene locus_tag LOCUS_03080 341106 340498 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_03080 341373 341975 gene locus_tag LOCUS_03090 341373 341975 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229952.1 protein_id gnl|my_center|LOCUS_03090 342674 341991 gene locus_tag LOCUS_03100 342674 341991 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908409.1 protein_id gnl|my_center|LOCUS_03100 342909 342691 gene locus_tag LOCUS_03110 342909 342691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 343203 344312 gene locus_tag LOCUS_03120 343203 344312 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_03120 344434 345177 gene locus_tag LOCUS_03130 gene thyX 344434 345177 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_03130 346401 345241 gene locus_tag LOCUS_03140 346401 345241 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224176.1 protein_id gnl|my_center|LOCUS_03140 348788 346701 gene locus_tag LOCUS_03150 348788 346701 CDS product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_03150 349465 351060 gene locus_tag LOCUS_03160 349465 351060 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224032.1 protein_id gnl|my_center|LOCUS_03160 351230 353434 gene locus_tag LOCUS_03170 351230 353434 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_03170 353550 354014 gene locus_tag LOCUS_03180 353550 354014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 355218 354247 gene locus_tag LOCUS_03190 355218 354247 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_03190 355695 355276 gene locus_tag LOCUS_03200 355695 355276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 356933 355815 gene locus_tag LOCUS_03210 356933 355815 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_03210 357797 356997 gene locus_tag LOCUS_03220 357797 356997 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_03220 358340 357831 gene locus_tag LOCUS_03230 358340 357831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 358432 359031 gene locus_tag LOCUS_03240 358432 359031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 359083 359574 gene locus_tag LOCUS_03250 359083 359574 CDS product YfcE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228757.1 protein_id gnl|my_center|LOCUS_03250 359705 360304 gene locus_tag LOCUS_03260 359705 360304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 361047 360334 gene locus_tag LOCUS_03270 361047 360334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 363613 361109 gene locus_tag LOCUS_03280 363613 361109 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224843.1 protein_id gnl|my_center|LOCUS_03280 364921 363809 gene locus_tag LOCUS_03290 364921 363809 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 protein_id gnl|my_center|LOCUS_03290 366774 365140 gene locus_tag LOCUS_03300 gene pgm 366774 365140 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971701.1 protein_id gnl|my_center|LOCUS_03300 367419 368675 gene locus_tag LOCUS_03310 367419 368675 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310853.1 protein_id gnl|my_center|LOCUS_03310 368819 369727 gene locus_tag LOCUS_03320 368819 369727 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_03320 369724 370587 gene locus_tag LOCUS_03330 369724 370587 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226353.1 protein_id gnl|my_center|LOCUS_03330 370673 371425 gene locus_tag LOCUS_03340 370673 371425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 371488 372270 gene locus_tag LOCUS_03350 371488 372270 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_03350 372927 372706 gene locus_tag LOCUS_03360 372927 372706 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978728.1 protein_id gnl|my_center|LOCUS_03360 373446 372931 gene locus_tag LOCUS_03370 373446 372931 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026883.1 protein_id gnl|my_center|LOCUS_03370 373616 373975 gene locus_tag LOCUS_03380 373616 373975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 374114 374896 gene locus_tag LOCUS_03390 374114 374896 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_03390 375085 375939 gene locus_tag LOCUS_03400 375085 375939 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_03400 376783 375992 gene locus_tag LOCUS_03410 376783 375992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 377095 377607 gene locus_tag LOCUS_03420 377095 377607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 380568 377638 gene locus_tag LOCUS_03430 380568 377638 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138169592.1 protein_id gnl|my_center|LOCUS_03430 380890 381864 gene locus_tag LOCUS_03440 380890 381864 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225347.1 protein_id gnl|my_center|LOCUS_03440 382961 381930 gene locus_tag LOCUS_03450 382961 381930 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189282703.1 protein_id gnl|my_center|LOCUS_03450 383265 382927 gene locus_tag LOCUS_03460 383265 382927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 384272 383268 gene locus_tag LOCUS_03470 384272 383268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 384706 384269 gene locus_tag LOCUS_03480 384706 384269 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976908.1 protein_id gnl|my_center|LOCUS_03480 384937 385590 gene locus_tag LOCUS_03490 384937 385590 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_03490 385807 387120 gene locus_tag LOCUS_03500 gene egtA 385807 387120 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_03500 387117 388436 gene locus_tag LOCUS_03510 gene egtB 387117 388436 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_03510 388437 389147 gene locus_tag LOCUS_03520 gene egtC 388437 389147 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731157.1 protein_id gnl|my_center|LOCUS_03520 389179 390156 gene locus_tag LOCUS_03530 gene egtD 389179 390156 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 protein_id gnl|my_center|LOCUS_03530 390412 390131 gene locus_tag LOCUS_03540 390412 390131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 390771 390409 gene locus_tag LOCUS_03550 390771 390409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 391884 390898 gene locus_tag LOCUS_03560 391884 390898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 392479 391988 gene locus_tag LOCUS_03570 392479 391988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 393226 392561 gene locus_tag LOCUS_03580 393226 392561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 395424 393349 gene locus_tag LOCUS_03590 gene pta 395424 393349 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 protein_id gnl|my_center|LOCUS_03590 396394 395576 gene locus_tag LOCUS_03600 396394 395576 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_03600 396953 396489 gene locus_tag LOCUS_03610 396953 396489 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227068.1 protein_id gnl|my_center|LOCUS_03610 399229 396950 gene locus_tag LOCUS_03620 399229 396950 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227069.1 protein_id gnl|my_center|LOCUS_03620 400506 399631 gene locus_tag LOCUS_03630 400506 399631 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227678.1 protein_id gnl|my_center|LOCUS_03630 400667 401413 gene locus_tag LOCUS_03640 gene fabG 400667 401413 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_03640 402773 401625 gene locus_tag LOCUS_03650 402773 401625 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259168.1 protein_id gnl|my_center|LOCUS_03650 403285 403458 gene locus_tag LOCUS_03660 403285 403458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 403451 403843 gene locus_tag LOCUS_03670 403451 403843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 404069 404491 gene locus_tag LOCUS_03680 404069 404491 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886487.1 protein_id gnl|my_center|LOCUS_03680 405374 404631 gene locus_tag LOCUS_03690 405374 404631 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098829.1 protein_id gnl|my_center|LOCUS_03690 406347 405745 gene locus_tag LOCUS_03700 406347 405745 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487417.1 protein_id gnl|my_center|LOCUS_03700 406957 406373 gene locus_tag LOCUS_03710 406957 406373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 407100 408446 gene locus_tag LOCUS_03720 407100 408446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 409118 408783 gene locus_tag LOCUS_03730 409118 408783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 409743 411548 gene locus_tag LOCUS_03740 409743 411548 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_03740 412512 411730 gene locus_tag LOCUS_03750 412512 411730 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094416.1 protein_id gnl|my_center|LOCUS_03750 414649 412787 gene locus_tag LOCUS_03760 414649 412787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 415700 415152 gene locus_tag LOCUS_03770 415700 415152 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895362.1 protein_id gnl|my_center|LOCUS_03770 416950 416087 gene locus_tag LOCUS_03780 416950 416087 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_03780 418645 417269 gene locus_tag LOCUS_03790 418645 417269 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_03790 418899 418642 gene locus_tag LOCUS_03800 418899 418642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 421321 419024 gene locus_tag LOCUS_03810 421321 419024 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974723.1 protein_id gnl|my_center|LOCUS_03810 422304 421318 gene locus_tag LOCUS_03820 422304 421318 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975270.1 protein_id gnl|my_center|LOCUS_03820 422825 422301 gene locus_tag LOCUS_03830 422825 422301 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974721.1 protein_id gnl|my_center|LOCUS_03830 423011 423655 gene locus_tag LOCUS_03840 423011 423655 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_03840 424228 423701 gene locus_tag LOCUS_03850 424228 423701 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870383.1 protein_id gnl|my_center|LOCUS_03850 424938 424342 gene locus_tag LOCUS_03860 424938 424342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 425144 424899 gene locus_tag LOCUS_03870 425144 424899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 425491 425748 gene locus_tag LOCUS_03880 425491 425748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 426827 425952 gene locus_tag LOCUS_03890 426827 425952 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230072.1 protein_id gnl|my_center|LOCUS_03890 427486 426830 gene locus_tag LOCUS_03900 427486 426830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 427590 428369 gene locus_tag LOCUS_03910 427590 428369 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485703.1 protein_id gnl|my_center|LOCUS_03910 429359 428283 gene locus_tag LOCUS_03920 429359 428283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 430270 429356 gene locus_tag LOCUS_03930 430270 429356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 431340 430216 gene locus_tag LOCUS_03940 431340 430216 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230077.1 protein_id gnl|my_center|LOCUS_03940 431738 431340 gene locus_tag LOCUS_03950 431738 431340 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031076.1 protein_id gnl|my_center|LOCUS_03950 432701 431802 gene locus_tag LOCUS_03960 432701 431802 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485699.1 protein_id gnl|my_center|LOCUS_03960 432936 433661 gene locus_tag LOCUS_03970 432936 433661 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031073.1 protein_id gnl|my_center|LOCUS_03970 434139 433900 gene locus_tag LOCUS_03980 434139 433900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 434356 434054 gene locus_tag LOCUS_03990 434356 434054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 434495 434647 gene locus_tag LOCUS_04000 434495 434647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 435446 434703 gene locus_tag LOCUS_04010 435446 434703 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_04010 435579 437078 gene locus_tag LOCUS_04020 435579 437078 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064065404.1 protein_id gnl|my_center|LOCUS_04020 437860 437009 gene locus_tag LOCUS_04030 437860 437009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 438558 437857 gene locus_tag LOCUS_04040 438558 437857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228968.1 protein_id gnl|my_center|LOCUS_04040 439412 438555 gene locus_tag LOCUS_04050 gene folP 439412 438555 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_04050 439719 440945 gene locus_tag LOCUS_04060 439719 440945 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_04060 443848 440948 gene locus_tag LOCUS_04070 443848 440948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 444994 443885 gene locus_tag LOCUS_04080 444994 443885 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 protein_id gnl|my_center|LOCUS_04080 446366 445008 gene locus_tag LOCUS_04090 446366 445008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 447796 446375 gene locus_tag LOCUS_04100 447796 446375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 448323 447796 gene locus_tag LOCUS_04110 448323 447796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 449315 448440 gene locus_tag LOCUS_04120 gene menB 449315 448440 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639989.1 protein_id gnl|my_center|LOCUS_04120 450426 449374 gene locus_tag LOCUS_04130 450426 449374 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729987.1 protein_id gnl|my_center|LOCUS_04130 451823 450639 gene locus_tag LOCUS_04140 451823 450639 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_04140 452020 452727 gene locus_tag LOCUS_04150 452020 452727 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 protein_id gnl|my_center|LOCUS_04150 452746 453852 gene locus_tag LOCUS_04160 452746 453852 CDS product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_04160 454729 453926 gene locus_tag LOCUS_04170 454729 453926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 455081 457531 gene locus_tag LOCUS_04180 455081 457531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 457584 458228 gene locus_tag LOCUS_04190 457584 458228 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406104.1 protein_id gnl|my_center|LOCUS_04190 459679 458822 gene locus_tag LOCUS_04200 459679 458822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080524.1 protein_id gnl|my_center|LOCUS_04200 460311 460066 gene locus_tag LOCUS_04210 460311 460066 CDS product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 protein_id gnl|my_center|LOCUS_04210 461285 460677 gene locus_tag LOCUS_04220 461285 460677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 461328 461945 gene locus_tag LOCUS_04230 461328 461945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 462177 461926 gene locus_tag LOCUS_04240 462177 461926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 463154 462270 gene locus_tag LOCUS_04250 463154 462270 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027374.1 protein_id gnl|my_center|LOCUS_04250 464632 463571 gene locus_tag LOCUS_04260 464632 463571 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228376.1 protein_id gnl|my_center|LOCUS_04260 465489 464752 gene locus_tag LOCUS_04270 465489 464752 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228377.1 protein_id gnl|my_center|LOCUS_04270 466448 465486 gene locus_tag LOCUS_04280 466448 465486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878179.1 protein_id gnl|my_center|LOCUS_04280 467713 466643 gene locus_tag LOCUS_04290 467713 466643 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974547.1 protein_id gnl|my_center|LOCUS_04290 468994 467768 gene locus_tag LOCUS_04300 468994 467768 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 protein_id gnl|my_center|LOCUS_04300 470621 469152 gene locus_tag LOCUS_04310 470621 469152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 471022 472332 gene locus_tag LOCUS_04320 gene aceA 471022 472332 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223536.1 protein_id gnl|my_center|LOCUS_04320 474110 472500 gene locus_tag LOCUS_04330 474110 472500 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715246.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04330 474103 474282 gene locus_tag LOCUS_04340 474103 474282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 475025 474558 gene locus_tag LOCUS_04350 475025 474558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 476293 475472 gene locus_tag LOCUS_04360 476293 475472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 476758 476537 gene locus_tag LOCUS_04370 476758 476537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 476928 477989 gene locus_tag LOCUS_04380 476928 477989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 478295 479932 gene locus_tag LOCUS_04390 478295 479932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 480170 481522 gene locus_tag LOCUS_04400 480170 481522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 481573 481827 gene locus_tag LOCUS_04410 481573 481827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 481987 482880 gene locus_tag LOCUS_04420 481987 482880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 483531 482950 gene locus_tag LOCUS_04430 483531 482950 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_04430 483688 485244 gene locus_tag LOCUS_04440 483688 485244 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227193.1 protein_id gnl|my_center|LOCUS_04440 487933 485273 gene locus_tag LOCUS_04450 487933 485273 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035749.1 protein_id gnl|my_center|LOCUS_04450 488634 487933 gene locus_tag LOCUS_04460 488634 487933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086062.1 protein_id gnl|my_center|LOCUS_04460 489488 488631 gene locus_tag LOCUS_04470 489488 488631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086063.1 protein_id gnl|my_center|LOCUS_04470 490903 489485 gene locus_tag LOCUS_04480 490903 489485 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296526.1 protein_id gnl|my_center|LOCUS_04480 491142 490915 gene locus_tag LOCUS_04490 491142 490915 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058882.1 protein_id gnl|my_center|LOCUS_04490 491936 491184 gene locus_tag LOCUS_04500 491936 491184 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091866.1 protein_id gnl|my_center|LOCUS_04500 492497 492132 gene locus_tag LOCUS_04510 492497 492132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 492597 493487 gene locus_tag LOCUS_04520 492597 493487 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_04520 494169 493588 gene locus_tag LOCUS_04530 494169 493588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 495876 494203 gene locus_tag LOCUS_04540 gene ptsP 495876 494203 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_04540 495758 496252 gene locus_tag LOCUS_04550 495758 496252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 496469 497230 gene locus_tag LOCUS_04560 496469 497230 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_04560 497295 498245 gene locus_tag LOCUS_04570 gene pfkB 497295 498245 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_04570 498308 499480 gene locus_tag LOCUS_04580 498308 499480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04580 499498 499806 gene locus_tag LOCUS_04590 499498 499806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04590 499799 500257 gene locus_tag LOCUS_04600 499799 500257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 500254 501294 gene locus_tag LOCUS_04610 500254 501294 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_04610 501322 501603 gene locus_tag LOCUS_04620 501322 501603 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804003.1 protein_id gnl|my_center|LOCUS_04620 501703 503133 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcgcacgcggggatgatccc 503705 504883 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggaccatccccgcgtgcg 505336 508104 gene locus_tag LOCUS_04630 505336 508104 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_04630 508094 509734 gene locus_tag LOCUS_04640 gene casA 508094 509734 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227614.1 protein_id gnl|my_center|LOCUS_04640 509816 510406 gene locus_tag LOCUS_04650 509816 510406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 510403 511596 gene locus_tag LOCUS_04660 gene cas7e 510403 511596 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_04660 511695 512303 gene locus_tag LOCUS_04670 gene cas5e 511695 512303 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674073.1 protein_id gnl|my_center|LOCUS_04670 512303 512992 gene locus_tag LOCUS_04680 gene cas6e 512303 512992 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_04680 513046 513957 gene locus_tag LOCUS_04690 gene cas1e 513046 513957 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_04690 513951 514304 gene locus_tag LOCUS_04700 513951 514304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 514445 516060 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgctccccgcgcacgcggggatgatccc 516732 516124 gene locus_tag LOCUS_04710 516732 516124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 517473 520001 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggatcatccccgcgtgcgcggggagcac 520780 520217 gene locus_tag LOCUS_04720 520780 520217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 520895 522175 gene locus_tag LOCUS_04730 520895 522175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 523259 522366 gene locus_tag LOCUS_04740 523259 522366 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112815.1 protein_id gnl|my_center|LOCUS_04740 523352 524440 gene locus_tag LOCUS_04750 523352 524440 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968124.1 protein_id gnl|my_center|LOCUS_04750 524752 525111 gene locus_tag LOCUS_04760 524752 525111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 527074 526514 gene locus_tag LOCUS_04770 527074 526514 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029611.1 protein_id gnl|my_center|LOCUS_04770 527919 527167 gene locus_tag LOCUS_04780 527919 527167 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031436.1 protein_id gnl|my_center|LOCUS_04780 528903 528448 gene locus_tag LOCUS_04790 528903 528448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092142.1 protein_id gnl|my_center|LOCUS_04790 528988 529587 gene locus_tag LOCUS_04800 528988 529587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974075.1 protein_id gnl|my_center|LOCUS_04800 530052 529624 gene locus_tag LOCUS_04810 530052 529624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 530346 530573 gene locus_tag LOCUS_04820 530346 530573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 530914 530474 gene locus_tag LOCUS_04830 530914 530474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 531215 532699 gene locus_tag LOCUS_04840 531215 532699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 533456 532713 gene locus_tag LOCUS_04850 533456 532713 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850455.1 protein_id gnl|my_center|LOCUS_04850 534022 534366 gene locus_tag LOCUS_04860 534022 534366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 534363 534995 gene locus_tag LOCUS_04870 534363 534995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 535778 535062 gene locus_tag LOCUS_04880 535778 535062 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029673.1 protein_id gnl|my_center|LOCUS_04880 536495 535881 gene locus_tag LOCUS_04890 gene rpsD 536495 535881 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_04890 536578 537399 gene locus_tag LOCUS_04900 536578 537399 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897828.1 protein_id gnl|my_center|LOCUS_04900 538626 537427 gene locus_tag LOCUS_04910 538626 537427 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876734.1 protein_id gnl|my_center|LOCUS_04910 538765 540621 gene locus_tag LOCUS_04920 gene edd 538765 540621 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284323.1 protein_id gnl|my_center|LOCUS_04920 540618 541688 gene locus_tag LOCUS_04930 540618 541688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 541816 542427 gene locus_tag LOCUS_04940 gene eda 541816 542427 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_04940 542735 543655 gene locus_tag LOCUS_04950 542735 543655 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222871.1 protein_id gnl|my_center|LOCUS_04950 544676 543645 gene locus_tag LOCUS_04960 544676 543645 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_04960 546323 544698 gene locus_tag LOCUS_04970 546323 544698 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_04970 547398 546496 gene locus_tag LOCUS_04980 547398 546496 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_04980 548399 547398 gene locus_tag LOCUS_04990 548399 547398 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_04990 549698 548403 gene locus_tag LOCUS_05000 549698 548403 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_05000 550194 551471 gene locus_tag LOCUS_05010 550194 551471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977118.1 protein_id gnl|my_center|LOCUS_05010 552179 551547 gene locus_tag LOCUS_05020 552179 551547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 553683 552367 gene locus_tag LOCUS_05030 553683 552367 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227778.1 protein_id gnl|my_center|LOCUS_05030 553891 556797 gene locus_tag LOCUS_05040 553891 556797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 556903 558822 gene locus_tag LOCUS_05050 556903 558822 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_05050 558807 560879 gene locus_tag LOCUS_05060 558807 560879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 560876 561085 gene locus_tag LOCUS_05070 560876 561085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 561706 561242 gene locus_tag LOCUS_05080 561706 561242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 561606 563231 gene locus_tag LOCUS_05090 561606 563231 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222854.1 protein_id gnl|my_center|LOCUS_05090 564372 565955 gene locus_tag LOCUS_05100 564372 565955 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976914.1 protein_id gnl|my_center|LOCUS_05100 566056 566340 gene locus_tag LOCUS_05110 566056 566340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 566566 567372 gene locus_tag LOCUS_05120 566566 567372 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891739.1 protein_id gnl|my_center|LOCUS_05120 568690 567479 gene locus_tag LOCUS_05130 568690 567479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 protein_id gnl|my_center|LOCUS_05130 569742 568702 gene locus_tag LOCUS_05140 569742 568702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 570117 571454 gene locus_tag LOCUS_05150 570117 571454 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_05150 571551 572552 gene locus_tag LOCUS_05160 571551 572552 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_05160 572549 573448 gene locus_tag LOCUS_05170 572549 573448 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_05170 573445 574881 gene locus_tag LOCUS_05180 573445 574881 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896540.1 protein_id gnl|my_center|LOCUS_05180 574908 575933 gene locus_tag LOCUS_05190 574908 575933 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027638.1 protein_id gnl|my_center|LOCUS_05190 576087 577424 gene locus_tag LOCUS_05200 576087 577424 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_05200 577708 578604 gene locus_tag LOCUS_05210 577708 578604 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804906.1 protein_id gnl|my_center|LOCUS_05210 578770 580110 gene locus_tag LOCUS_05220 578770 580110 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_05220 580920 581744 gene locus_tag LOCUS_05230 580920 581744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 581798 582046 gene locus_tag LOCUS_05240 581798 582046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 583493 582138 gene locus_tag LOCUS_05250 583493 582138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 584495 584094 gene locus_tag LOCUS_05260 584495 584094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 584891 585694 gene locus_tag LOCUS_05270 584891 585694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 586754 585807 gene locus_tag LOCUS_05280 586754 585807 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030810.1 protein_id gnl|my_center|LOCUS_05280 587705 586770 gene locus_tag LOCUS_05290 587705 586770 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_05290 588715 587720 gene locus_tag LOCUS_05300 588715 587720 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_05300 589839 588712 gene locus_tag LOCUS_05310 589839 588712 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226918.1 protein_id gnl|my_center|LOCUS_05310 590806 589847 gene locus_tag LOCUS_05320 590806 589847 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030814.1 protein_id gnl|my_center|LOCUS_05320 591789 590803 gene locus_tag LOCUS_05330 591789 590803 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030815.1 protein_id gnl|my_center|LOCUS_05330 591912 592841 gene locus_tag LOCUS_05340 591912 592841 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030816.1 protein_id gnl|my_center|LOCUS_05340 592992 593312 gene locus_tag LOCUS_05350 gene mmr 592992 593312 CDS product multidrug efflux SMR transporter Mmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415995.1 protein_id gnl|my_center|LOCUS_05350 593309 593860 gene locus_tag LOCUS_05360 593309 593860 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416005.1 protein_id gnl|my_center|LOCUS_05360 594394 593936 gene locus_tag LOCUS_05370 gene trxA 594394 593936 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_05370 594805 595812 gene locus_tag LOCUS_05380 594805 595812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 595825 596658 gene locus_tag LOCUS_05390 595825 596658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 596701 596964 gene locus_tag LOCUS_05400 596701 596964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 596961 597380 gene locus_tag LOCUS_05410 596961 597380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 599254 597512 gene locus_tag LOCUS_05420 599254 597512 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929446.1 protein_id gnl|my_center|LOCUS_05420 599850 599437 gene locus_tag LOCUS_05430 599850 599437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 599951 601687 gene locus_tag LOCUS_05440 599951 601687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05440 601684 603441 gene locus_tag LOCUS_05450 601684 603441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05450 603865 605517 gene locus_tag LOCUS_05460 603865 605517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 605514 606410 gene locus_tag LOCUS_05470 605514 606410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 607821 606517 gene locus_tag LOCUS_05480 607821 606517 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618218.1 protein_id gnl|my_center|LOCUS_05480 609385 608141 gene locus_tag LOCUS_05490 609385 608141 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728434.1 protein_id gnl|my_center|LOCUS_05490 609573 611060 gene locus_tag LOCUS_05500 609573 611060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 612646 611078 gene locus_tag LOCUS_05510 gene phoD 612646 611078 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_05510 612867 613292 gene locus_tag LOCUS_05520 gene arfB 612867 613292 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230741.1 protein_id gnl|my_center|LOCUS_05520 613340 613792 gene locus_tag LOCUS_05530 613340 613792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 614062 613847 gene locus_tag LOCUS_05540 614062 613847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05540 614206 614087 gene locus_tag LOCUS_05550 614206 614087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05550 615179 614271 gene locus_tag LOCUS_05560 gene panE 615179 614271 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391265.1 protein_id gnl|my_center|LOCUS_05560 615304 616323 gene locus_tag LOCUS_05570 615304 616323 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165476103.1 protein_id gnl|my_center|LOCUS_05570 617244 616339 gene locus_tag LOCUS_05580 617244 616339 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222522.1 protein_id gnl|my_center|LOCUS_05580 617189 618229 gene locus_tag LOCUS_05590 617189 618229 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 protein_id gnl|my_center|LOCUS_05590 618269 618526 gene locus_tag LOCUS_05600 618269 618526 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 protein_id gnl|my_center|LOCUS_05600 619567 618596 gene locus_tag LOCUS_05610 619567 618596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 621430 619856 gene locus_tag LOCUS_05620 621430 619856 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_05620 623149 621797 gene locus_tag LOCUS_05630 623149 621797 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_05630 623912 623184 gene locus_tag LOCUS_05640 623912 623184 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891901.1 protein_id gnl|my_center|LOCUS_05640 624076 625404 gene locus_tag LOCUS_05650 624076 625404 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223243.1 protein_id gnl|my_center|LOCUS_05650 625600 625941 gene locus_tag LOCUS_05660 625600 625941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 626124 628145 gene locus_tag LOCUS_05670 626124 628145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 628649 628161 gene locus_tag LOCUS_05680 628649 628161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 629271 629858 gene locus_tag LOCUS_05690 629271 629858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 629996 630379 gene locus_tag LOCUS_05700 629996 630379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 631146 630481 gene locus_tag LOCUS_05710 631146 630481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 631260 632630 gene locus_tag LOCUS_05720 631260 632630 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005096459.1 protein_id gnl|my_center|LOCUS_05720 634635 632755 gene locus_tag LOCUS_05730 634635 632755 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229993.1 protein_id gnl|my_center|LOCUS_05730 635460 634906 gene locus_tag LOCUS_05740 635460 634906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 636236 635604 gene locus_tag LOCUS_05750 636236 635604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 636657 637217 gene locus_tag LOCUS_05760 636657 637217 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224412.1 protein_id gnl|my_center|LOCUS_05760 637219 637896 gene locus_tag LOCUS_05770 gene rsuA 637219 637896 CDS product anti-sigma U factor RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975858.1 protein_id gnl|my_center|LOCUS_05770 638776 638006 gene locus_tag LOCUS_05780 638776 638006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 641106 639130 gene locus_tag LOCUS_05790 641106 639130 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_05790 641330 643081 gene locus_tag LOCUS_05800 641330 643081 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229699.1 protein_id gnl|my_center|LOCUS_05800 644717 643548 gene locus_tag LOCUS_05810 644717 643548 CDS product TIGR03118 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928497.1 protein_id gnl|my_center|LOCUS_05810 645992 644904 gene locus_tag LOCUS_05820 645992 644904 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726798.1 protein_id gnl|my_center|LOCUS_05820 646145 646537 gene locus_tag LOCUS_05830 646145 646537 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255194.1 protein_id gnl|my_center|LOCUS_05830 646768 646574 gene locus_tag LOCUS_05840 646768 646574 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228904.1 protein_id gnl|my_center|LOCUS_05840 648006 646795 gene locus_tag LOCUS_05850 648006 646795 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221980.1 protein_id gnl|my_center|LOCUS_05850 648952 648119 gene locus_tag LOCUS_05860 gene phzF 648952 648119 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093628.1 protein_id gnl|my_center|LOCUS_05860 649971 648976 gene locus_tag LOCUS_05870 gene rbsK 649971 648976 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526901.1 protein_id gnl|my_center|LOCUS_05870 651221 650052 gene locus_tag LOCUS_05880 651221 650052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 652327 651395 gene locus_tag LOCUS_05890 652327 651395 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_05890 652754 653065 gene locus_tag LOCUS_05900 652754 653065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 654052 653207 gene locus_tag LOCUS_05910 654052 653207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 protein_id gnl|my_center|LOCUS_05910 654325 655899 gene locus_tag LOCUS_05920 654325 655899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 655984 656424 gene locus_tag LOCUS_05930 655984 656424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 656484 657062 gene locus_tag LOCUS_05940 656484 657062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_05940 657319 658698 gene locus_tag LOCUS_05950 657319 658698 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031698.1 protein_id gnl|my_center|LOCUS_05950 658695 659633 gene locus_tag LOCUS_05960 658695 659633 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_05960 659630 660565 gene locus_tag LOCUS_05970 659630 660565 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971654.1 protein_id gnl|my_center|LOCUS_05970 662882 660696 gene locus_tag LOCUS_05980 662882 660696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 665989 663047 gene locus_tag LOCUS_05990 665989 663047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 666235 666417 gene locus_tag LOCUS_06000 666235 666417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 666896 666471 gene locus_tag LOCUS_06010 666896 666471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 666777 667040 gene locus_tag LOCUS_06020 666777 667040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 667110 667940 gene locus_tag LOCUS_06030 667110 667940 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029566.1 protein_id gnl|my_center|LOCUS_06030 667925 668296 gene locus_tag LOCUS_06040 667925 668296 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030403591.1 protein_id gnl|my_center|LOCUS_06040 668600 669532 gene locus_tag LOCUS_06050 668600 669532 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_06050 669662 670555 gene locus_tag LOCUS_06060 669662 670555 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_06060 671479 671267 gene locus_tag LOCUS_06070 671479 671267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 671743 672057 gene locus_tag LOCUS_06080 671743 672057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 672306 673223 gene locus_tag LOCUS_06090 672306 673223 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_06090 673385 674305 gene locus_tag LOCUS_06100 673385 674305 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_06100 674472 675404 gene locus_tag LOCUS_06110 674472 675404 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_06110 675568 676491 gene locus_tag LOCUS_06120 675568 676491 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_06120 676662 677564 gene locus_tag LOCUS_06130 676662 677564 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_06130 678020 677616 gene locus_tag LOCUS_06140 678020 677616 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_06140 679297 678020 gene locus_tag LOCUS_06150 679297 678020 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931147.1 protein_id gnl|my_center|LOCUS_06150 680620 679310 gene locus_tag LOCUS_06160 680620 679310 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085419.1 protein_id gnl|my_center|LOCUS_06160 682414 680687 gene locus_tag LOCUS_06170 682414 680687 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 protein_id gnl|my_center|LOCUS_06170 683728 682649 gene locus_tag LOCUS_06180 683728 682649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 684036 684842 gene locus_tag LOCUS_06190 684036 684842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_06190 685253 684888 gene locus_tag LOCUS_06200 685253 684888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229623.1 protein_id gnl|my_center|LOCUS_06200 686450 685437 gene locus_tag LOCUS_06210 gene meaB 686450 685437 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_06210 688675 686447 gene locus_tag LOCUS_06220 gene scpA 688675 686447 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_06220 690501 688672 gene locus_tag LOCUS_06230 690501 688672 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_06230 691423 690656 gene locus_tag LOCUS_06240 691423 690656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 692491 691475 gene locus_tag LOCUS_06250 gene mtnA 692491 691475 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228779.1 protein_id gnl|my_center|LOCUS_06250 692729 693517 gene locus_tag LOCUS_06260 692729 693517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 693532 693759 gene locus_tag LOCUS_06270 693532 693759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 694583 693756 gene locus_tag LOCUS_06280 694583 693756 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730405.1 protein_id gnl|my_center|LOCUS_06280 695091 694870 gene locus_tag LOCUS_06290 695091 694870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 695153 696322 gene locus_tag LOCUS_06300 695153 696322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 696833 696402 gene locus_tag LOCUS_06310 696833 696402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978009.1 protein_id gnl|my_center|LOCUS_06310 696908 697267 gene locus_tag LOCUS_06320 696908 697267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 698035 697214 gene locus_tag LOCUS_06330 698035 697214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 698680 700101 gene locus_tag LOCUS_06340 698680 700101 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027415.1 protein_id gnl|my_center|LOCUS_06340 700497 701198 gene locus_tag LOCUS_06350 700497 701198 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040541.1 protein_id gnl|my_center|LOCUS_06350 701611 701534 gene locus_tag LOCUS_t00030 701611 701534 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 703264 701852 gene locus_tag LOCUS_06360 703264 701852 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222084.1 protein_id gnl|my_center|LOCUS_06360 703616 704464 gene locus_tag LOCUS_06370 703616 704464 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_06370 709041 704485 gene locus_tag LOCUS_06380 709041 704485 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886065.1 protein_id gnl|my_center|LOCUS_06380 709285 710862 gene locus_tag LOCUS_06390 709285 710862 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_06390 711326 710859 gene locus_tag LOCUS_06400 711326 710859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 711618 712412 gene locus_tag LOCUS_06410 711618 712412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 713843 712443 gene locus_tag LOCUS_06420 713843 712443 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_06420 714759 713956 gene locus_tag LOCUS_06430 714759 713956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 715271 716437 gene locus_tag LOCUS_06440 715271 716437 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_06440 717841 716447 gene locus_tag LOCUS_06450 gene sthA 717841 716447 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091308313.1 protein_id gnl|my_center|LOCUS_06450 718102 719808 gene locus_tag LOCUS_06460 718102 719808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 719823 720902 gene locus_tag LOCUS_06470 719823 720902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 720899 724075 gene locus_tag LOCUS_06480 720899 724075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 724062 726488 gene locus_tag LOCUS_06490 724062 726488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 727643 726507 gene locus_tag LOCUS_06500 727643 726507 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_06500 727679 728602 gene locus_tag LOCUS_06510 727679 728602 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_06510 728646 730271 gene locus_tag LOCUS_06520 gene pruA 728646 730271 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_06520 730752 730282 gene locus_tag LOCUS_06530 730752 730282 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 protein_id gnl|my_center|LOCUS_06530 732488 730836 gene locus_tag LOCUS_06540 732488 730836 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227653.1 protein_id gnl|my_center|LOCUS_06540 733246 732485 gene locus_tag LOCUS_06550 733246 732485 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227652.1 protein_id gnl|my_center|LOCUS_06550 733430 734422 gene locus_tag LOCUS_06560 gene dhaK 733430 734422 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_06560 734460 735113 gene locus_tag LOCUS_06570 gene dhaL 734460 735113 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031416.1 protein_id gnl|my_center|LOCUS_06570 735186 735566 gene locus_tag LOCUS_06580 735186 735566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 736060 735632 gene locus_tag LOCUS_06590 736060 735632 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729927.1 protein_id gnl|my_center|LOCUS_06590 736394 736179 gene locus_tag LOCUS_06600 736394 736179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 736284 736769 gene locus_tag LOCUS_06610 736284 736769 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_06610 738244 736808 gene locus_tag LOCUS_06620 gene der 738244 736808 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_06620 738915 738241 gene locus_tag LOCUS_06630 gene cmk 738915 738241 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_06630 740400 739006 gene locus_tag LOCUS_06640 740400 739006 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_06640 741083 740472 gene locus_tag LOCUS_06650 741083 740472 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_06650 742335 741199 gene locus_tag LOCUS_06660 742335 741199 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_06660 742737 742375 gene locus_tag LOCUS_06670 gene aroH 742737 742375 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_06670 744096 742801 gene locus_tag LOCUS_06680 744096 742801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 744764 744093 gene locus_tag LOCUS_06690 gene scpB 744764 744093 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_06690 745620 744757 gene locus_tag LOCUS_06700 745620 744757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 746602 745682 gene locus_tag LOCUS_06710 746602 745682 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_06710 747705 746755 gene locus_tag LOCUS_06720 gene xerD 747705 746755 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408401.1 protein_id gnl|my_center|LOCUS_06720 748449 747784 gene locus_tag LOCUS_06730 748449 747784 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_06730 750116 748446 gene locus_tag LOCUS_06740 750116 748446 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_06740 750396 751109 gene locus_tag LOCUS_06750 750396 751109 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_06750 751626 752246 gene locus_tag LOCUS_06760 751626 752246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 754402 752306 gene locus_tag LOCUS_06770 gene uvrB 754402 752306 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_06770 754774 754586 gene locus_tag LOCUS_06780 754774 754586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 754676 756226 gene locus_tag LOCUS_06790 754676 756226 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256570.1 protein_id gnl|my_center|LOCUS_06790 756223 757482 gene locus_tag LOCUS_06800 756223 757482 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256571.1 protein_id gnl|my_center|LOCUS_06800 758163 757555 gene locus_tag LOCUS_06810 gene coaE 758163 757555 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_06810 758735 758262 gene locus_tag LOCUS_06820 758735 758262 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230160.1 protein_id gnl|my_center|LOCUS_06820 760301 758859 gene locus_tag LOCUS_06830 gene rpsA 760301 758859 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_06830 761652 760525 gene locus_tag LOCUS_06840 761652 760525 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_06840 764477 761781 gene locus_tag LOCUS_06850 gene polA 764477 761781 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_06850 765304 766596 gene locus_tag LOCUS_06860 765304 766596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 766609 767595 gene locus_tag LOCUS_06870 766609 767595 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_06870 767585 768598 gene locus_tag LOCUS_06880 767585 768598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 768595 769431 gene locus_tag LOCUS_06890 768595 769431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_06890 771433 770132 gene locus_tag LOCUS_06900 771433 770132 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_06900 772221 771634 gene locus_tag LOCUS_06910 772221 771634 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_06910 772367 772441 gene locus_tag LOCUS_t00040 772367 772441 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 773843 772497 gene locus_tag LOCUS_06920 gene pyk 773843 772497 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_06920 774308 775288 gene locus_tag LOCUS_06930 774308 775288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 777130 775313 gene locus_tag LOCUS_06940 777130 775313 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_06940 778849 777362 gene locus_tag LOCUS_06950 778849 777362 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228800.1 protein_id gnl|my_center|LOCUS_06950 783433 778916 gene locus_tag LOCUS_06960 gene gltB 783433 778916 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742213.1 protein_id gnl|my_center|LOCUS_06960 784473 783808 gene locus_tag LOCUS_06970 784473 783808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 785773 784484 gene locus_tag LOCUS_06980 785773 784484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 786750 785770 gene locus_tag LOCUS_06990 gene lgt 786750 785770 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_06990 787587 786835 gene locus_tag LOCUS_07000 787587 786835 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_07000 788066 787587 gene locus_tag LOCUS_07010 788066 787587 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 protein_id gnl|my_center|LOCUS_07010 788032 788295 gene locus_tag LOCUS_07020 788032 788295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 789253 788459 gene locus_tag LOCUS_07030 gene trpA 789253 788459 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_07030 790547 789324 gene locus_tag LOCUS_07040 gene trpB 790547 789324 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_07040 791402 790578 gene locus_tag LOCUS_07050 gene trpC 791402 790578 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_07050 791994 791536 gene locus_tag LOCUS_07060 791994 791536 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_07060 792524 792051 gene locus_tag LOCUS_07070 792524 792051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 793289 792645 gene locus_tag LOCUS_07080 793289 792645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 793692 793315 gene locus_tag LOCUS_07090 gene hisI 793692 793315 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_07090 795544 793772 gene locus_tag LOCUS_07100 795544 793772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776699.1 protein_id gnl|my_center|LOCUS_07100 797456 795606 gene locus_tag LOCUS_07110 797456 795606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776700.1 protein_id gnl|my_center|LOCUS_07110 797569 798201 gene locus_tag LOCUS_07120 797569 798201 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_07120 798370 799350 gene locus_tag LOCUS_07130 798370 799350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 799347 799982 gene locus_tag LOCUS_07140 799347 799982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 800120 800284 gene locus_tag LOCUS_07150 800120 800284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 801277 800645 gene locus_tag LOCUS_07160 801277 800645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 802810 801476 gene locus_tag LOCUS_07170 802810 801476 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803753.1 protein_id gnl|my_center|LOCUS_07170 803630 802860 gene locus_tag LOCUS_07180 gene hisF 803630 802860 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466799.1 protein_id gnl|my_center|LOCUS_07180 804413 803688 gene locus_tag LOCUS_07190 gene priA 804413 803688 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776203.1 protein_id gnl|my_center|LOCUS_07190 805142 804507 gene locus_tag LOCUS_07200 gene hisH 805142 804507 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057924.1 protein_id gnl|my_center|LOCUS_07200 805288 805133 gene locus_tag LOCUS_07210 805288 805133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 805878 805285 gene locus_tag LOCUS_07220 gene hisB 805878 805285 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_07220 807032 805875 gene locus_tag LOCUS_07230 807032 805875 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224128.1 protein_id gnl|my_center|LOCUS_07230 808339 807029 gene locus_tag LOCUS_07240 gene hisD 808339 807029 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_07240 808481 808981 gene locus_tag LOCUS_07250 gene ybaK 808481 808981 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_07250 809171 810643 gene locus_tag LOCUS_07260 809171 810643 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256492.1 protein_id gnl|my_center|LOCUS_07260 811403 812734 gene locus_tag LOCUS_07270 gene murA 811403 812734 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775882.1 protein_id gnl|my_center|LOCUS_07270 816350 812829 gene locus_tag LOCUS_07280 gene dnaE 816350 812829 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_07280 817497 816478 gene locus_tag LOCUS_07290 817497 816478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 817962 821006 gene locus_tag LOCUS_07300 817962 821006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 821188 821853 gene locus_tag LOCUS_07310 821188 821853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07310 821850 822164 gene locus_tag LOCUS_07320 821850 822164 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_07320 823139 822210 gene locus_tag LOCUS_07330 823139 822210 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_07330 823832 823416 gene locus_tag LOCUS_07340 823832 823416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 824229 823960 gene locus_tag LOCUS_07350 824229 823960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 824627 827785 gene locus_tag LOCUS_07360 gene ileS 824627 827785 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_07360 829980 828238 gene locus_tag LOCUS_07370 829980 828238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 830928 830074 gene locus_tag LOCUS_07380 830928 830074 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080209.1 protein_id gnl|my_center|LOCUS_07380 831263 830976 gene locus_tag LOCUS_07390 831263 830976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 831892 831350 gene locus_tag LOCUS_07400 gene sepF 831892 831350 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_07400 832806 832039 gene locus_tag LOCUS_07410 832806 832039 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_07410 834445 832823 gene locus_tag LOCUS_07420 834445 832823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 835533 834769 gene locus_tag LOCUS_07430 835533 834769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 837057 835636 gene locus_tag LOCUS_07440 gene murC 837057 835636 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228036.1 protein_id gnl|my_center|LOCUS_07440 838139 837054 gene locus_tag LOCUS_07450 gene murG 838139 837054 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_07450 839512 838136 gene locus_tag LOCUS_07460 gene ftsW 839512 838136 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_07460 840975 839509 gene locus_tag LOCUS_07470 gene murD 840975 839509 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_07470 842220 841162 gene locus_tag LOCUS_07480 gene mraY 842220 841162 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_07480 843683 842217 gene locus_tag LOCUS_07490 843683 842217 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_07490 845323 843719 gene locus_tag LOCUS_07500 845323 843719 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_07500 847491 845320 gene locus_tag LOCUS_07510 gene ftsI 847491 845320 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_07510 848121 847504 gene locus_tag LOCUS_07520 848121 847504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 849137 848118 gene locus_tag LOCUS_07530 gene rsmH 849137 848118 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_07530 849844 849413 gene locus_tag LOCUS_07540 gene mraZ 849844 849413 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804693.1 protein_id gnl|my_center|LOCUS_07540 850352 849984 gene locus_tag LOCUS_07550 850352 849984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 850478 851464 gene locus_tag LOCUS_07560 850478 851464 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_07560 851461 852729 gene locus_tag LOCUS_07570 851461 852729 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_07570 852726 855242 gene locus_tag LOCUS_07580 852726 855242 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_07580 855980 855585 gene locus_tag LOCUS_07590 855980 855585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 857502 856231 gene locus_tag LOCUS_07600 gene dinB 857502 856231 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228056.1 protein_id gnl|my_center|LOCUS_07600 858323 857553 gene locus_tag LOCUS_07610 858323 857553 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_07610 858818 858408 gene locus_tag LOCUS_07620 gene nusB 858818 858408 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_07620 859381 858821 gene locus_tag LOCUS_07630 gene efp 859381 858821 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_07630 860582 859419 gene locus_tag LOCUS_07640 860582 859419 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224609.1 protein_id gnl|my_center|LOCUS_07640 863038 860807 gene locus_tag LOCUS_07650 gene katG 863038 860807 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027206.1 protein_id gnl|my_center|LOCUS_07650 863519 863070 gene locus_tag LOCUS_07660 863519 863070 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978301.1 protein_id gnl|my_center|LOCUS_07660 865148 863586 gene locus_tag LOCUS_07670 865148 863586 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978239.1 protein_id gnl|my_center|LOCUS_07670 865294 865881 gene locus_tag LOCUS_07680 865294 865881 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_07680 866962 865922 gene locus_tag LOCUS_07690 866962 865922 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731394.1 protein_id gnl|my_center|LOCUS_07690 867645 867061 gene locus_tag LOCUS_07700 867645 867061 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_07700 868795 867668 gene locus_tag LOCUS_07710 868795 867668 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223762.1 protein_id gnl|my_center|LOCUS_07710 870224 868941 gene locus_tag LOCUS_07720 870224 868941 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_07720 871050 870208 gene locus_tag LOCUS_07730 871050 870208 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_07730 871588 871124 gene locus_tag LOCUS_07740 871588 871124 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805205.1 protein_id gnl|my_center|LOCUS_07740 872055 871585 gene locus_tag LOCUS_07750 gene ribH 872055 871585 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224642.1 protein_id gnl|my_center|LOCUS_07750 873347 872052 gene locus_tag LOCUS_07760 873347 872052 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_07760 873964 873344 gene locus_tag LOCUS_07770 873964 873344 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_07770 874722 875753 gene locus_tag LOCUS_07780 874722 875753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 protein_id gnl|my_center|LOCUS_07780 875803 877593 gene locus_tag LOCUS_07790 875803 877593 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_07790 877672 878652 gene locus_tag LOCUS_07800 877672 878652 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_07800 878675 879745 gene locus_tag LOCUS_07810 878675 879745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_07810 879742 880794 gene locus_tag LOCUS_07820 879742 880794 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_07820 881489 880815 gene locus_tag LOCUS_07830 gene rpe 881489 880815 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_07830 882956 881556 gene locus_tag LOCUS_07840 882956 881556 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_07840 883902 882973 gene locus_tag LOCUS_07850 gene fmt 883902 882973 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_07850 884584 884036 gene locus_tag LOCUS_07860 gene def 884584 884036 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_07860 886044 884674 gene locus_tag LOCUS_07870 886044 884674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 protein_id gnl|my_center|LOCUS_07870 887169 886084 gene locus_tag LOCUS_07880 887169 886084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 889363 887252 gene locus_tag LOCUS_07890 889363 887252 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224627.1 protein_id gnl|my_center|LOCUS_07890 891198 889717 gene locus_tag LOCUS_07900 891198 889717 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 protein_id gnl|my_center|LOCUS_07900 893119 891632 gene locus_tag LOCUS_07910 893119 891632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 895679 893352 gene locus_tag LOCUS_07920 895679 893352 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225184.1 protein_id gnl|my_center|LOCUS_07920 896909 895716 gene locus_tag LOCUS_07930 gene metK 896909 895716 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_07930 898324 897074 gene locus_tag LOCUS_07940 gene coaBC 898324 897074 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_07940 898610 898332 gene locus_tag LOCUS_07950 gene rpoZ 898610 898332 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_07950 899500 898760 gene locus_tag LOCUS_07960 899500 898760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 899954 899631 gene locus_tag LOCUS_07970 899954 899631 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_07970 901294 900593 gene locus_tag LOCUS_07980 gene pyrF 901294 900593 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_07980 902265 901291 gene locus_tag LOCUS_07990 902265 901291 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_07990 903136 902255 gene locus_tag LOCUS_08000 903136 902255 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_08000 906789 903499 gene locus_tag LOCUS_08010 gene carB 906789 903499 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_08010 907912 906782 gene locus_tag LOCUS_08020 gene carA 907912 906782 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_08020 909243 907909 gene locus_tag LOCUS_08030 909243 907909 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_08030 910154 909240 gene locus_tag LOCUS_08040 910154 909240 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_08040 910678 910151 gene locus_tag LOCUS_08050 gene pyrR 910678 910151 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_08050 911125 912369 gene locus_tag LOCUS_08060 911125 912369 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_08060 912671 913165 gene locus_tag LOCUS_08070 gene bldD 912671 913165 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_08070 913869 913426 gene locus_tag LOCUS_08080 913869 913426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 914065 914161 gene locus_tag LOCUS_t00050 914065 914161 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 914404 914880 gene locus_tag LOCUS_08090 914404 914880 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104384.1 protein_id gnl|my_center|LOCUS_08090 914955 915518 gene locus_tag LOCUS_08100 914955 915518 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224203.1 protein_id gnl|my_center|LOCUS_08100 916478 915552 gene locus_tag LOCUS_08110 gene metF 916478 915552 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_08110 916628 917695 gene locus_tag LOCUS_08120 916628 917695 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_08120 918033 917776 gene locus_tag LOCUS_08130 918033 917776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 918945 918307 gene locus_tag LOCUS_08140 gene thiE 918945 918307 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_08140 919297 918923 gene locus_tag LOCUS_08150 919297 918923 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 protein_id gnl|my_center|LOCUS_08150 920848 919679 gene locus_tag LOCUS_08160 920848 919679 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_08160 921682 922875 gene locus_tag LOCUS_08170 gene thiO 921682 922875 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_08170 922893 923093 gene locus_tag LOCUS_08180 gene thiS 922893 923093 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_08180 923189 923944 gene locus_tag LOCUS_08190 923189 923944 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_08190 924347 926260 gene locus_tag LOCUS_08200 gene pknB 924347 926260 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224192.1 protein_id gnl|my_center|LOCUS_08200 927544 926381 gene locus_tag LOCUS_08210 927544 926381 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_08210 927699 927541 gene locus_tag LOCUS_08220 927699 927541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 927790 928635 gene locus_tag LOCUS_08230 927790 928635 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_08230 930552 929026 gene locus_tag LOCUS_08240 930552 929026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 930908 930549 gene locus_tag LOCUS_08250 930908 930549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 931675 930905 gene locus_tag LOCUS_08260 931675 930905 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_08260 933247 931742 gene locus_tag LOCUS_08270 933247 931742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 932862 932954 gene locus_tag LOCUS_t00060 932862 932954 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 934025 933405 gene locus_tag LOCUS_08280 934025 933405 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_08280 934266 935339 gene locus_tag LOCUS_08290 gene aroF 934266 935339 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_08290 935954 935448 gene locus_tag LOCUS_08300 935954 935448 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892388.1 protein_id gnl|my_center|LOCUS_08300 936038 936625 gene locus_tag LOCUS_08310 936038 936625 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029568.1 protein_id gnl|my_center|LOCUS_08310 937901 936690 gene locus_tag LOCUS_08320 gene thiI 937901 936690 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173822.1 protein_id gnl|my_center|LOCUS_08320 938790 938569 gene locus_tag LOCUS_08330 938790 938569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 938693 939526 gene locus_tag LOCUS_08340 938693 939526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 940664 939639 gene locus_tag LOCUS_08350 940664 939639 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_08350 940904 941812 gene locus_tag LOCUS_08360 940904 941812 CDS product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230946.1 protein_id gnl|my_center|LOCUS_08360 944075 941874 gene locus_tag LOCUS_08370 944075 941874 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_08370 944218 944838 gene locus_tag LOCUS_08380 944218 944838 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_08380 945961 944906 gene locus_tag LOCUS_08390 945961 944906 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_08390 946820 946353 gene locus_tag LOCUS_08400 946820 946353 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_08400 946974 947789 gene locus_tag LOCUS_08410 946974 947789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 947883 950243 gene locus_tag LOCUS_08420 947883 950243 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_08420 950586 951308 gene locus_tag LOCUS_08430 950586 951308 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532905.1 protein_id gnl|my_center|LOCUS_08430 951486 952808 gene locus_tag LOCUS_08440 951486 952808 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 protein_id gnl|my_center|LOCUS_08440 953655 952831 gene locus_tag LOCUS_08450 953655 952831 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_08450 955171 953702 gene locus_tag LOCUS_08460 955171 953702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031600.1 protein_id gnl|my_center|LOCUS_08460 955509 955231 gene locus_tag LOCUS_08470 955509 955231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 955650 956636 gene locus_tag LOCUS_08480 955650 956636 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_08480 957246 956692 gene locus_tag LOCUS_08490 957246 956692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 958040 957324 gene locus_tag LOCUS_08500 958040 957324 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_08500 958226 958987 gene locus_tag LOCUS_08510 958226 958987 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_08510 959011 959505 gene locus_tag LOCUS_08520 959011 959505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_08520 960674 959517 gene locus_tag LOCUS_08530 960674 959517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 961387 960671 gene locus_tag LOCUS_08540 961387 960671 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_08540 961644 961465 gene locus_tag LOCUS_08550 961644 961465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 963081 962134 gene locus_tag LOCUS_08560 963081 962134 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_08560 963730 963167 gene locus_tag LOCUS_08570 963730 963167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 964868 963711 gene locus_tag LOCUS_08580 964868 963711 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256376.1 protein_id gnl|my_center|LOCUS_08580 965386 964949 gene locus_tag LOCUS_08590 965386 964949 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_08590 966184 965408 gene locus_tag LOCUS_08600 966184 965408 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_08600 966333 968126 gene locus_tag LOCUS_08610 966333 968126 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_08610 969690 968542 gene locus_tag LOCUS_08620 969690 968542 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_08620 970620 969937 gene locus_tag LOCUS_08630 970620 969937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 972700 971717 gene locus_tag LOCUS_08640 972700 971717 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_08640 974192 972903 gene locus_tag LOCUS_08650 974192 972903 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_08650 974459 976207 gene locus_tag LOCUS_08660 974459 976207 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_08660 976484 976771 gene locus_tag LOCUS_08670 976484 976771 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_08670 977137 977349 gene locus_tag LOCUS_08680 977137 977349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 978314 977250 gene locus_tag LOCUS_08690 gene trpD 978314 977250 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_08690 978857 978456 gene locus_tag LOCUS_08700 978857 978456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_08700 979171 978902 gene locus_tag LOCUS_08710 979171 978902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 979134 979640 gene locus_tag LOCUS_08720 979134 979640 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_08720 979658 980476 gene locus_tag LOCUS_08730 979658 980476 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805020.1 protein_id gnl|my_center|LOCUS_08730 980473 981570 gene locus_tag LOCUS_08740 980473 981570 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_08740 981567 983243 gene locus_tag LOCUS_08750 981567 983243 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_08750 984671 983433 gene locus_tag LOCUS_08760 984671 983433 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727602.1 protein_id gnl|my_center|LOCUS_08760 985294 984899 gene locus_tag LOCUS_08770 985294 984899 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_08770 986964 985291 gene locus_tag LOCUS_08780 gene ctaD 986964 985291 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_08780 987662 986961 gene locus_tag LOCUS_08790 gene coxB 987662 986961 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 987997 989133 gene locus_tag LOCUS_08800 987997 989133 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08800 989133 989399 gene locus_tag LOCUS_08810 989133 989399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08810 989551 989994 gene locus_tag LOCUS_08820 gene hrp1 989551 989994 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_08820 991035 990049 gene locus_tag LOCUS_08830 991035 990049 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_08830 991494 991141 gene locus_tag LOCUS_08840 991494 991141 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_08840 991387 991725 gene locus_tag LOCUS_08850 991387 991725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 991765 992925 gene locus_tag LOCUS_08860 gene nadA 991765 992925 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_08860 993585 992998 gene locus_tag LOCUS_08870 993585 992998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_08870 994502 993591 gene locus_tag LOCUS_08880 gene htpX 994502 993591 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_08880 994917 994639 gene locus_tag LOCUS_08890 994917 994639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_08890 995759 994914 gene locus_tag LOCUS_08900 995759 994914 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_08900 995967 996614 gene locus_tag LOCUS_08910 995967 996614 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 protein_id gnl|my_center|LOCUS_08910 996738 997745 gene locus_tag LOCUS_08920 996738 997745 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_08920 998014 997808 gene locus_tag LOCUS_08930 998014 997808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_08930 998139 999239 gene locus_tag LOCUS_08940 998139 999239 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_08940 999236 1000033 gene locus_tag LOCUS_08950 999236 1000033 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_08950 1000230 1001753 gene locus_tag LOCUS_08960 1000230 1001753 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_08960 1001856 1003247 gene locus_tag LOCUS_08970 gene lpdA 1001856 1003247 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_08970 1003292 1004746 gene locus_tag LOCUS_08980 1003292 1004746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1004965 1005702 gene locus_tag LOCUS_08990 1004965 1005702 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031666.1 protein_id gnl|my_center|LOCUS_08990 1005769 1006458 gene locus_tag LOCUS_09000 gene lipB 1005769 1006458 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 protein_id gnl|my_center|LOCUS_09000 1006582 1007517 gene locus_tag LOCUS_09010 gene lipA 1006582 1007517 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223711.1 protein_id gnl|my_center|LOCUS_09010 1007764 1008465 gene locus_tag LOCUS_09020 1007764 1008465 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_09020 1008518 1009336 gene locus_tag LOCUS_09030 1008518 1009336 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227917.1 protein_id gnl|my_center|LOCUS_09030 1009847 1009380 gene locus_tag LOCUS_09040 1009847 1009380 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_09040 1010103 1011527 gene locus_tag LOCUS_09050 gene glnA 1010103 1011527 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_09050 1013005 1011905 gene locus_tag LOCUS_09060 1013005 1011905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1013323 1013012 gene locus_tag LOCUS_09070 1013323 1013012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1014424 1013501 gene locus_tag LOCUS_09080 1014424 1013501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1015708 1014566 gene locus_tag LOCUS_09090 1015708 1014566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1018807 1015817 gene locus_tag LOCUS_09100 1018807 1015817 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_09100 1019635 1018919 gene locus_tag LOCUS_09110 1019635 1018919 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978258.1 protein_id gnl|my_center|LOCUS_09110 1020800 1020078 gene locus_tag LOCUS_09120 1020800 1020078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228025.1 protein_id gnl|my_center|LOCUS_09120 1021156 1021572 gene locus_tag LOCUS_09130 1021156 1021572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039002.1 protein_id gnl|my_center|LOCUS_09130 1021599 1022420 gene locus_tag LOCUS_09140 1021599 1022420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1022497 1022985 gene locus_tag LOCUS_09150 1022497 1022985 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978180.1 protein_id gnl|my_center|LOCUS_09150 1024072 1023005 gene locus_tag LOCUS_09160 1024072 1023005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1024420 1024830 gene locus_tag LOCUS_09170 1024420 1024830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1026452 1025091 gene locus_tag LOCUS_09180 gene glnA 1026452 1025091 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_09180 1026673 1028463 gene locus_tag LOCUS_09190 1026673 1028463 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_09190 1028732 1029619 gene locus_tag LOCUS_09200 gene panB 1028732 1029619 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_09200 1030349 1029684 gene locus_tag LOCUS_09210 gene npdG 1030349 1029684 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_09210 1030450 1031025 gene locus_tag LOCUS_09220 1030450 1031025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_09220 1031276 1031043 gene locus_tag LOCUS_09230 1031276 1031043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1031350 1032198 gene locus_tag LOCUS_09240 gene map 1031350 1032198 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_09240 1032668 1032240 gene locus_tag LOCUS_09250 1032668 1032240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1035051 1033009 gene locus_tag LOCUS_09260 1035051 1033009 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_09260 1035808 1035101 gene locus_tag LOCUS_09270 1035808 1035101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1037263 1035965 gene locus_tag LOCUS_09280 1037263 1035965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1039022 1038105 gene locus_tag LOCUS_09290 1039022 1038105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1039232 1040347 gene locus_tag LOCUS_09300 gene ald 1039232 1040347 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_09300 1041088 1040360 gene locus_tag LOCUS_09310 1041088 1040360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1041250 1041930 gene locus_tag LOCUS_09320 1041250 1041930 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_09320 1042094 1043635 gene locus_tag LOCUS_09330 1042094 1043635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1043632 1045353 gene locus_tag LOCUS_09340 1043632 1045353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1046117 1045368 gene locus_tag LOCUS_09350 1046117 1045368 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031658.1 protein_id gnl|my_center|LOCUS_09350 1047038 1046154 gene locus_tag LOCUS_09360 1047038 1046154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856445.1 protein_id gnl|my_center|LOCUS_09360 1048087 1047035 gene locus_tag LOCUS_09370 1048087 1047035 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014890.1 protein_id gnl|my_center|LOCUS_09370 1049080 1048136 gene locus_tag LOCUS_09380 1049080 1048136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265874.1 protein_id gnl|my_center|LOCUS_09380 1049411 1050049 gene locus_tag LOCUS_09390 1049411 1050049 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_09390 1050576 1050274 gene locus_tag LOCUS_09400 1050576 1050274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1050940 1050704 gene locus_tag LOCUS_09410 1050940 1050704 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_09410 1051807 1050941 gene locus_tag LOCUS_09420 1051807 1050941 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_09420 1051974 1052516 gene locus_tag LOCUS_09430 1051974 1052516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1052966 1055353 gene locus_tag LOCUS_09440 1052966 1055353 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222121.1 protein_id gnl|my_center|LOCUS_09440 1056756 1055599 gene locus_tag LOCUS_09450 1056756 1055599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1057166 1057459 gene locus_tag LOCUS_09460 1057166 1057459 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230909.1 protein_id gnl|my_center|LOCUS_09460 1058048 1057608 gene locus_tag LOCUS_09470 1058048 1057608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1058197 1059054 gene locus_tag LOCUS_09480 1058197 1059054 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878082.1 protein_id gnl|my_center|LOCUS_09480 1059392 1060189 gene locus_tag LOCUS_09490 1059392 1060189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1061659 1060352 gene locus_tag LOCUS_09500 1061659 1060352 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_09500 1062031 1062105 gene locus_tag LOCUS_t00070 1062031 1062105 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1063295 1062420 gene locus_tag LOCUS_09510 1063295 1062420 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_09510 1063373 1063675 gene locus_tag LOCUS_09520 1063373 1063675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1063772 1064914 gene locus_tag LOCUS_09530 1063772 1064914 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_09530 1064995 1065444 gene locus_tag LOCUS_09540 1064995 1065444 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201788935.1 protein_id gnl|my_center|LOCUS_09540 1065802 1066590 gene locus_tag LOCUS_09550 1065802 1066590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1067180 1066719 gene locus_tag LOCUS_09560 1067180 1066719 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_09560 1067080 1067310 gene locus_tag LOCUS_09570 1067080 1067310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1067352 1067516 gene locus_tag LOCUS_09580 1067352 1067516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1068097 1067714 gene locus_tag LOCUS_09590 1068097 1067714 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888811.1 protein_id gnl|my_center|LOCUS_09590 1069068 1068172 gene locus_tag LOCUS_09600 1069068 1068172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1069250 1069585 gene locus_tag LOCUS_09610 1069250 1069585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284373.1 protein_id gnl|my_center|LOCUS_09610 1069833 1071164 gene locus_tag LOCUS_09620 1069833 1071164 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727632.1 protein_id gnl|my_center|LOCUS_09620 1071232 1072194 gene locus_tag LOCUS_09630 gene pfkB 1071232 1072194 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_09630 1073469 1072348 gene locus_tag LOCUS_09640 gene galK 1073469 1072348 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_09640 1074332 1073502 gene locus_tag LOCUS_09650 1074332 1073502 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224066.1 protein_id gnl|my_center|LOCUS_09650 1074334 1074519 gene locus_tag LOCUS_09660 1074334 1074519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1074580 1074505 gene locus_tag LOCUS_t00080 1074580 1074505 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1074743 1075270 gene locus_tag LOCUS_09670 1074743 1075270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1075773 1075282 gene locus_tag LOCUS_09680 1075773 1075282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1077059 1075791 gene locus_tag LOCUS_09690 1077059 1075791 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_09690 1078242 1077148 gene locus_tag LOCUS_09700 gene rpoD 1078242 1077148 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_09700 1080315 1078423 gene locus_tag LOCUS_09710 gene dnaG 1080315 1078423 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228362.1 protein_id gnl|my_center|LOCUS_09710 1080430 1081428 gene locus_tag LOCUS_09720 1080430 1081428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1082697 1081438 gene locus_tag LOCUS_09730 1082697 1081438 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_09730 1083915 1082707 gene locus_tag LOCUS_09740 1083915 1082707 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_09740 1086732 1084072 gene locus_tag LOCUS_09750 gene ppdK 1086732 1084072 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_09750 1087132 1087350 gene locus_tag LOCUS_09760 1087132 1087350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1088582 1087650 gene locus_tag LOCUS_09770 1088582 1087650 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222394.1 protein_id gnl|my_center|LOCUS_09770 1088679 1089365 gene locus_tag LOCUS_09780 1088679 1089365 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222393.1 protein_id gnl|my_center|LOCUS_09780 1090886 1089501 gene locus_tag LOCUS_09790 1090886 1089501 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_09790 1091342 1091064 gene locus_tag LOCUS_09800 1091342 1091064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1091555 1091977 gene locus_tag LOCUS_09810 1091555 1091977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1092165 1092013 gene locus_tag LOCUS_09820 1092165 1092013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1092310 1092522 gene locus_tag LOCUS_09830 1092310 1092522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1092962 1092654 gene locus_tag LOCUS_09840 1092962 1092654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1093439 1093807 gene locus_tag LOCUS_09850 1093439 1093807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1093804 1095255 gene locus_tag LOCUS_09860 1093804 1095255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1095170 1097047 gene locus_tag LOCUS_09870 1095170 1097047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1098024 1097233 gene locus_tag LOCUS_09880 1098024 1097233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1098677 1098021 gene locus_tag LOCUS_09890 1098677 1098021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026862.1 protein_id gnl|my_center|LOCUS_09890 1098951 1099934 gene locus_tag LOCUS_09900 1098951 1099934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1100766 1099963 gene locus_tag LOCUS_09910 1100766 1099963 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_09910 1101173 1103104 gene locus_tag LOCUS_09920 1101173 1103104 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226416.1 protein_id gnl|my_center|LOCUS_09920 1103108 1104955 gene locus_tag LOCUS_09930 1103108 1104955 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_09930 1104970 1105833 gene locus_tag LOCUS_09940 1104970 1105833 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972421.1 protein_id gnl|my_center|LOCUS_09940 1105838 1106662 gene locus_tag LOCUS_09950 gene fdhD 1105838 1106662 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_09950 1106930 1107940 gene locus_tag LOCUS_09960 1106930 1107940 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_09960 1108006 1108752 gene locus_tag LOCUS_09970 1108006 1108752 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_09970 1108752 1109582 gene locus_tag LOCUS_09980 1108752 1109582 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_09980 1109579 1109971 gene locus_tag LOCUS_09990 1109579 1109971 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_09990 1110768 1109911 gene locus_tag LOCUS_10000 1110768 1109911 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227664.1 protein_id gnl|my_center|LOCUS_10000 1110894 1111442 gene locus_tag LOCUS_10010 1110894 1111442 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_10010 1112294 1111527 gene locus_tag LOCUS_10020 1112294 1111527 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228389.1 protein_id gnl|my_center|LOCUS_10020 1113005 1112304 gene locus_tag LOCUS_10030 gene recO 1113005 1112304 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_10030 1113427 1113176 gene locus_tag LOCUS_10040 1113427 1113176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1113312 1114871 gene locus_tag LOCUS_10050 1113312 1114871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1114868 1115596 gene locus_tag LOCUS_10060 1114868 1115596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1116430 1115705 gene locus_tag LOCUS_10070 1116430 1115705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_10070 1117224 1116466 gene locus_tag LOCUS_10080 1117224 1116466 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973614.1 protein_id gnl|my_center|LOCUS_10080 1117290 1117934 gene locus_tag LOCUS_10090 1117290 1117934 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029663.1 protein_id gnl|my_center|LOCUS_10090 1118382 1118573 gene locus_tag LOCUS_10100 1118382 1118573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1118759 1118950 gene locus_tag LOCUS_10110 1118759 1118950 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978159.1 protein_id gnl|my_center|LOCUS_10110 1120085 1119156 gene locus_tag LOCUS_10120 1120085 1119156 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116024687.1 protein_id gnl|my_center|LOCUS_10120 1120188 1120919 gene locus_tag LOCUS_10130 1120188 1120919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123667195.1 protein_id gnl|my_center|LOCUS_10130 1120923 1121438 gene locus_tag LOCUS_10140 1120923 1121438 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_10140 1121705 1122433 gene locus_tag LOCUS_10150 1121705 1122433 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_10150 1122430 1123632 gene locus_tag LOCUS_10160 gene rocD 1122430 1123632 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 protein_id gnl|my_center|LOCUS_10160 1125273 1123639 gene locus_tag LOCUS_10170 1125273 1123639 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_10170 1125870 1125376 gene locus_tag LOCUS_10180 1125870 1125376 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224396.1 protein_id gnl|my_center|LOCUS_10180 1126628 1125867 gene locus_tag LOCUS_10190 1126628 1125867 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_10190 1127437 1126625 gene locus_tag LOCUS_10200 1127437 1126625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172561.1 protein_id gnl|my_center|LOCUS_10200 1128294 1127452 gene locus_tag LOCUS_10210 1128294 1127452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626598.1 protein_id gnl|my_center|LOCUS_10210 1129303 1128287 gene locus_tag LOCUS_10220 1129303 1128287 CDS product putative FMN-dependent luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965649.1 protein_id gnl|my_center|LOCUS_10220 1130377 1129337 gene locus_tag LOCUS_10230 1130377 1129337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1131596 1130388 gene locus_tag LOCUS_10240 1131596 1130388 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207962.1 protein_id gnl|my_center|LOCUS_10240 1133836 1131764 gene locus_tag LOCUS_10250 1133836 1131764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1134228 1133983 gene locus_tag LOCUS_10260 1134228 1133983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1134324 1135061 gene locus_tag LOCUS_10270 1134324 1135061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1136694 1135123 gene locus_tag LOCUS_10280 1136694 1135123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1136802 1137320 gene locus_tag LOCUS_10290 1136802 1137320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1138058 1137417 gene locus_tag LOCUS_10300 1138058 1137417 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_10300 1139034 1138060 gene locus_tag LOCUS_10310 1139034 1138060 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_10310 1140063 1139116 gene locus_tag LOCUS_10320 1140063 1139116 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225136.1 protein_id gnl|my_center|LOCUS_10320 1140342 1141070 gene locus_tag LOCUS_10330 1140342 1141070 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230648.1 protein_id gnl|my_center|LOCUS_10330 1141305 1141592 gene locus_tag LOCUS_10340 1141305 1141592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1143190 1141478 gene locus_tag LOCUS_10350 gene leuA 1143190 1141478 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930223.1 protein_id gnl|my_center|LOCUS_10350 1143786 1145894 gene locus_tag LOCUS_10360 1143786 1145894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1149449 1145934 gene locus_tag LOCUS_10370 1149449 1145934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10370 1149688 1149446 gene locus_tag LOCUS_10380 1149688 1149446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1150987 1150295 gene locus_tag LOCUS_10390 gene urtE 1150987 1150295 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112317.1 protein_id gnl|my_center|LOCUS_10390 1151773 1150988 gene locus_tag LOCUS_10400 gene urtD 1151773 1150988 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 protein_id gnl|my_center|LOCUS_10400 1152921 1151770 gene locus_tag LOCUS_10410 gene urtC 1152921 1151770 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 protein_id gnl|my_center|LOCUS_10410 1153796 1152918 gene locus_tag LOCUS_10420 gene urtB 1153796 1152918 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_10420 1155182 1153935 gene locus_tag LOCUS_10430 gene urtA 1155182 1153935 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 protein_id gnl|my_center|LOCUS_10430 1155360 1155692 gene locus_tag LOCUS_10440 1155360 1155692 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409305.1 protein_id gnl|my_center|LOCUS_10440 1155689 1156033 gene locus_tag LOCUS_10450 1155689 1156033 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230176.1 protein_id gnl|my_center|LOCUS_10450 1156026 1157768 gene locus_tag LOCUS_10460 1156026 1157768 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 protein_id gnl|my_center|LOCUS_10460 1157778 1158761 gene locus_tag LOCUS_10470 1157778 1158761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1158839 1159576 gene locus_tag LOCUS_10480 gene ureG 1158839 1159576 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230173.1 protein_id gnl|my_center|LOCUS_10480 1159743 1159573 gene locus_tag LOCUS_10490 1159743 1159573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1159682 1160443 gene locus_tag LOCUS_10500 1159682 1160443 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803980.1 protein_id gnl|my_center|LOCUS_10500 1160571 1160969 gene locus_tag LOCUS_10510 1160571 1160969 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171561.1 protein_id gnl|my_center|LOCUS_10510 1162095 1161076 gene locus_tag LOCUS_10520 gene era 1162095 1161076 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228396.1 protein_id gnl|my_center|LOCUS_10520 1162430 1162092 gene locus_tag LOCUS_10530 1162430 1162092 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_10530 1164075 1162759 gene locus_tag LOCUS_10540 1164075 1162759 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228398.1 protein_id gnl|my_center|LOCUS_10540 1164554 1164072 gene locus_tag LOCUS_10550 gene ybeY 1164554 1164072 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 protein_id gnl|my_center|LOCUS_10550 1165629 1164562 gene locus_tag LOCUS_10560 1165629 1164562 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228400.1 protein_id gnl|my_center|LOCUS_10560 1166131 1165778 gene locus_tag LOCUS_10570 1166131 1165778 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_10570 1166393 1166872 gene locus_tag LOCUS_10580 1166393 1166872 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_10580 1166869 1167567 gene locus_tag LOCUS_10590 1166869 1167567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1168686 1167946 gene locus_tag LOCUS_10600 1168686 1167946 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_10600 1169086 1171752 gene locus_tag LOCUS_10610 1169086 1171752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1172093 1173280 gene locus_tag LOCUS_10620 1172093 1173280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1174623 1173484 gene locus_tag LOCUS_10630 gene dnaJ 1174623 1173484 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_10630 1175640 1174624 gene locus_tag LOCUS_10640 gene hrcA 1175640 1174624 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_10640 1175907 1176809 gene locus_tag LOCUS_10650 1175907 1176809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1176863 1177684 gene locus_tag LOCUS_10660 1176863 1177684 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_10660 1178907 1177690 gene locus_tag LOCUS_10670 gene hemW 1178907 1177690 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_10670 1180762 1178924 gene locus_tag LOCUS_10680 gene lepA 1180762 1178924 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083190386.1 protein_id gnl|my_center|LOCUS_10680 1181392 1181670 gene locus_tag LOCUS_10690 gene rpsT 1181392 1181670 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_10690 1181923 1182420 gene locus_tag LOCUS_10700 1181923 1182420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1182417 1185209 gene locus_tag LOCUS_10710 1182417 1185209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1185832 1186545 gene locus_tag LOCUS_10720 1185832 1186545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_10720 1187231 1186569 gene locus_tag LOCUS_10730 gene modA 1187231 1186569 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_10730 1189038 1188052 gene locus_tag LOCUS_10740 gene holA 1189038 1188052 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_10740 1191557 1189065 gene locus_tag LOCUS_10750 1191557 1189065 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228464.1 protein_id gnl|my_center|LOCUS_10750 1192129 1191554 gene locus_tag LOCUS_10760 1192129 1191554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 1193635 1193474 gene locus_tag LOCUS_10770 1193635 1193474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1194521 1193679 gene locus_tag LOCUS_10780 1194521 1193679 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_10780 1195831 1194623 gene locus_tag LOCUS_10790 gene hutI 1195831 1194623 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068174090.1 protein_id gnl|my_center|LOCUS_10790 1197649 1196369 gene locus_tag LOCUS_10800 gene hflX 1197649 1196369 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_10800 1198825 1198142 gene locus_tag LOCUS_10810 1198825 1198142 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_10810 1199239 1200828 gene locus_tag LOCUS_10820 gene aceB 1199239 1200828 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_10820 1200887 1202383 gene locus_tag LOCUS_10830 1200887 1202383 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_10830 1202383 1203672 gene locus_tag LOCUS_10840 1202383 1203672 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257999.1 protein_id gnl|my_center|LOCUS_10840 1203672 1204967 gene locus_tag LOCUS_10850 1203672 1204967 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_10850 1204964 1205716 gene locus_tag LOCUS_10860 gene allR 1204964 1205716 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_10860 1205713 1205937 gene locus_tag LOCUS_10870 1205713 1205937 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_10870 1206810 1206001 gene locus_tag LOCUS_10880 1206810 1206001 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229983.1 protein_id gnl|my_center|LOCUS_10880 1207841 1206813 gene locus_tag LOCUS_10890 1207841 1206813 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229982.1 protein_id gnl|my_center|LOCUS_10890 1208912 1209382 gene locus_tag LOCUS_10900 1208912 1209382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1209482 1210045 gene locus_tag LOCUS_10910 1209482 1210045 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224335.1 protein_id gnl|my_center|LOCUS_10910 1210045 1210971 gene locus_tag LOCUS_10920 1210045 1210971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1213274 1211643 gene locus_tag LOCUS_10930 1213274 1211643 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029665.1 protein_id gnl|my_center|LOCUS_10930 1216729 1213271 gene locus_tag LOCUS_10940 1216729 1213271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1217981 1217061 gene locus_tag LOCUS_10950 1217981 1217061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1219656 1218217 gene locus_tag LOCUS_10960 1219656 1218217 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974636.1 protein_id gnl|my_center|LOCUS_10960 1219703 1220566 gene locus_tag LOCUS_10970 1219703 1220566 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775990.1 protein_id gnl|my_center|LOCUS_10970 1220563 1221225 gene locus_tag LOCUS_10980 1220563 1221225 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_10980 1221241 1222095 gene locus_tag LOCUS_10990 1221241 1222095 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_10990 1222092 1223978 gene locus_tag LOCUS_11000 1222092 1223978 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460092.1 protein_id gnl|my_center|LOCUS_11000 1224004 1224576 gene locus_tag LOCUS_11010 1224004 1224576 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530684.1 protein_id gnl|my_center|LOCUS_11010 1224945 1225787 gene locus_tag LOCUS_11020 1224945 1225787 CDS product bromoperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_11020 1225870 1226286 gene locus_tag LOCUS_11030 1225870 1226286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1227056 1226520 gene locus_tag LOCUS_11040 1227056 1226520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1227190 1227870 gene locus_tag LOCUS_11050 1227190 1227870 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_11050 1227944 1229230 gene locus_tag LOCUS_11060 1227944 1229230 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027197.1 protein_id gnl|my_center|LOCUS_11060 1229421 1230488 gene locus_tag LOCUS_11070 1229421 1230488 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_11070 1231499 1230747 gene locus_tag LOCUS_11080 1231499 1230747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1231879 1231496 gene locus_tag LOCUS_11090 1231879 1231496 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227432.1 protein_id gnl|my_center|LOCUS_11090 1233279 1232548 gene locus_tag LOCUS_11100 1233279 1232548 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028771.1 protein_id gnl|my_center|LOCUS_11100 1234335 1233439 gene locus_tag LOCUS_11110 1234335 1233439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1234797 1235411 gene locus_tag LOCUS_11120 1234797 1235411 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 protein_id gnl|my_center|LOCUS_11120 1235753 1237651 gene locus_tag LOCUS_11130 1235753 1237651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1238119 1237664 gene locus_tag LOCUS_11140 1238119 1237664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1238574 1238855 gene locus_tag LOCUS_11150 1238574 1238855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1241770 1239161 gene locus_tag LOCUS_11160 1241770 1239161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1242411 1241893 gene locus_tag LOCUS_11170 1242411 1241893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1242561 1244591 gene locus_tag LOCUS_11180 1242561 1244591 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_11180 1246685 1245045 gene locus_tag LOCUS_11190 1246685 1245045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1246936 1246676 gene locus_tag LOCUS_11200 1246936 1246676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1246827 1247399 gene locus_tag LOCUS_11210 1246827 1247399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1250761 1247426 gene locus_tag LOCUS_11220 1250761 1247426 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202495.1 protein_id gnl|my_center|LOCUS_11220 1251140 1250811 gene locus_tag LOCUS_11230 1251140 1250811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1252351 1251140 gene locus_tag LOCUS_11240 1252351 1251140 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229309.1 protein_id gnl|my_center|LOCUS_11240 1254869 1252362 gene locus_tag LOCUS_11250 1254869 1252362 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_11250 1255366 1256007 gene locus_tag LOCUS_11260 1255366 1256007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1256244 1258292 gene locus_tag LOCUS_11270 1256244 1258292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1258289 1259695 gene locus_tag LOCUS_11280 1258289 1259695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1259894 1260202 gene locus_tag LOCUS_11290 1259894 1260202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1260281 1262245 gene locus_tag LOCUS_11300 1260281 1262245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1262729 1262253 gene locus_tag LOCUS_11310 1262729 1262253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1263187 1263459 gene locus_tag LOCUS_11320 1263187 1263459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1264326 1263673 gene locus_tag LOCUS_11330 1264326 1263673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229430.1 protein_id gnl|my_center|LOCUS_11330 1264574 1265344 gene locus_tag LOCUS_11340 1264574 1265344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1265906 1265391 gene locus_tag LOCUS_11350 1265906 1265391 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223801.1 protein_id gnl|my_center|LOCUS_11350 1267649 1265994 gene locus_tag LOCUS_11360 gene betA 1267649 1265994 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229316.1 protein_id gnl|my_center|LOCUS_11360 1269792 1267813 gene locus_tag LOCUS_11370 1269792 1267813 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_11370 1270868 1269789 gene locus_tag LOCUS_11380 1270868 1269789 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_11380 1271499 1271134 gene locus_tag LOCUS_11390 1271499 1271134 CDS product phosphomannose isomerase type II C-terminal cupin domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017550.1 protein_id gnl|my_center|LOCUS_11390 1274002 1271720 gene locus_tag LOCUS_11400 1274002 1271720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112509.1 protein_id gnl|my_center|LOCUS_11400 1275058 1274219 gene locus_tag LOCUS_11410 gene dapF 1275058 1274219 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_11410 1276096 1275158 gene locus_tag LOCUS_11420 gene miaA 1276096 1275158 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_11420 1277103 1276300 gene locus_tag LOCUS_11430 1277103 1276300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1278730 1277246 gene locus_tag LOCUS_11440 gene miaB 1278730 1277246 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_11440 1279109 1279747 gene locus_tag LOCUS_11450 1279109 1279747 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466810.1 protein_id gnl|my_center|LOCUS_11450 1279813 1280682 gene locus_tag LOCUS_11460 1279813 1280682 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 protein_id gnl|my_center|LOCUS_11460 1280766 1281434 gene locus_tag LOCUS_11470 1280766 1281434 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 protein_id gnl|my_center|LOCUS_11470 1281431 1282336 gene locus_tag LOCUS_11480 1281431 1282336 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030446.1 protein_id gnl|my_center|LOCUS_11480 1284317 1282695 gene locus_tag LOCUS_11490 gene rny 1284317 1282695 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965122.1 protein_id gnl|my_center|LOCUS_11490 1285586 1284936 gene locus_tag LOCUS_11500 1285586 1284936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11500 1286029 1285598 gene locus_tag LOCUS_11510 1286029 1285598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1286010 1286696 gene locus_tag LOCUS_11520 1286010 1286696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1287240 1287046 gene locus_tag LOCUS_11530 1287240 1287046 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_11530 1287488 1292125 gene locus_tag LOCUS_11540 1287488 1292125 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109508967.1 protein_id gnl|my_center|LOCUS_11540 1292105 1292026 gene locus_tag LOCUS_t00090 1292105 1292026 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1293018 1292602 gene locus_tag LOCUS_11550 1293018 1292602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1293182 1295338 gene locus_tag LOCUS_11560 1293182 1295338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1296105 1295461 gene locus_tag LOCUS_11570 1296105 1295461 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_11570 1297395 1296211 gene locus_tag LOCUS_11580 1297395 1296211 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_11580 1298719 1297505 gene locus_tag LOCUS_11590 1298719 1297505 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_11590 1298827 1299279 gene locus_tag LOCUS_11600 1298827 1299279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1299283 1300065 gene locus_tag LOCUS_11610 1299283 1300065 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_11610 1300577 1300224 gene locus_tag LOCUS_11620 1300577 1300224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1301341 1300835 gene locus_tag LOCUS_11630 1301341 1300835 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_11630 1302038 1301334 gene locus_tag LOCUS_11640 1302038 1301334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1303480 1302035 gene locus_tag LOCUS_11650 gene rimO 1303480 1302035 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_11650 1304635 1303577 gene locus_tag LOCUS_11660 1304635 1303577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1307389 1304813 gene locus_tag LOCUS_11670 1307389 1304813 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113701643.1 protein_id gnl|my_center|LOCUS_11670 1307597 1308568 gene locus_tag LOCUS_11680 1307597 1308568 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728676.1 protein_id gnl|my_center|LOCUS_11680 1308894 1308649 gene locus_tag LOCUS_11690 1308894 1308649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1309745 1308891 gene locus_tag LOCUS_11700 1309745 1308891 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_11700 1309998 1310342 gene locus_tag LOCUS_11710 1309998 1310342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1310937 1310485 gene locus_tag LOCUS_11720 1310937 1310485 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191904.1 protein_id gnl|my_center|LOCUS_11720 1311021 1311884 gene locus_tag LOCUS_11730 1311021 1311884 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224928.1 protein_id gnl|my_center|LOCUS_11730 1311881 1313095 gene locus_tag LOCUS_11740 1311881 1313095 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_11740 1313990 1313229 gene locus_tag LOCUS_11750 1313990 1313229 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031747.1 protein_id gnl|my_center|LOCUS_11750 1314160 1315758 gene locus_tag LOCUS_11760 1314160 1315758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1317516 1315831 gene locus_tag LOCUS_11770 1317516 1315831 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_11770 1318404 1317526 gene locus_tag LOCUS_11780 gene dapA 1318404 1317526 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_11780 1318986 1319741 gene locus_tag LOCUS_11790 1318986 1319741 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_11790 1320892 1319840 gene locus_tag LOCUS_11800 1320892 1319840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980499.1 protein_id gnl|my_center|LOCUS_11800 1321883 1320960 gene locus_tag LOCUS_11810 1321883 1320960 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027867.1 protein_id gnl|my_center|LOCUS_11810 1321882 1323330 gene locus_tag LOCUS_11820 1321882 1323330 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038535091.1 protein_id gnl|my_center|LOCUS_11820 1323354 1324079 gene locus_tag LOCUS_11830 1323354 1324079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1324123 1324713 gene locus_tag LOCUS_11840 1324123 1324713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1324803 1325756 gene locus_tag LOCUS_11850 1324803 1325756 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776415.1 protein_id gnl|my_center|LOCUS_11850 1326481 1325822 gene locus_tag LOCUS_11860 gene dapB 1326481 1325822 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081787.1 protein_id gnl|my_center|LOCUS_11860 1327908 1326640 gene locus_tag LOCUS_11870 1327908 1326640 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_11870 1330298 1327980 gene locus_tag LOCUS_11880 1330298 1327980 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_11880 1330900 1330631 gene locus_tag LOCUS_11890 gene rpsO 1330900 1330631 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_11890 1332149 1331139 gene locus_tag LOCUS_11900 1332149 1331139 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_11900 1333273 1332371 gene locus_tag LOCUS_11910 gene truB 1333273 1332371 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_11910 1334502 1333345 gene locus_tag LOCUS_11920 gene nrnA 1334502 1333345 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414507.1 protein_id gnl|my_center|LOCUS_11920 1335020 1334499 gene locus_tag LOCUS_11930 gene rbfA 1335020 1334499 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804655.1 protein_id gnl|my_center|LOCUS_11930 1335371 1335036 gene locus_tag LOCUS_11940 1335371 1335036 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228120.1 protein_id gnl|my_center|LOCUS_11940 1338471 1335523 gene locus_tag LOCUS_11950 1338471 1335523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1338864 1338628 gene locus_tag LOCUS_11960 1338864 1338628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1339930 1338905 gene locus_tag LOCUS_11970 gene nusA 1339930 1338905 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_11970 1340451 1339942 gene locus_tag LOCUS_11980 gene rimP 1340451 1339942 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285696.1 protein_id gnl|my_center|LOCUS_11980 1340699 1341298 gene locus_tag LOCUS_11990 1340699 1341298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1341327 1341734 gene locus_tag LOCUS_12000 1341327 1341734 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_12000 1343618 1341876 gene locus_tag LOCUS_12010 1343618 1341876 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223963.1 protein_id gnl|my_center|LOCUS_12010 1344489 1343836 gene locus_tag LOCUS_12020 1344489 1343836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1345104 1344616 gene locus_tag LOCUS_12030 1345104 1344616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1345955 1347316 gene locus_tag LOCUS_12040 1345955 1347316 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_12040 1348061 1347375 gene locus_tag LOCUS_12050 1348061 1347375 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_12050 1348876 1348157 gene locus_tag LOCUS_12060 1348876 1348157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1350045 1349263 gene locus_tag LOCUS_12070 1350045 1349263 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097911.1 protein_id gnl|my_center|LOCUS_12070 1350521 1351294 gene locus_tag LOCUS_12080 1350521 1351294 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726679.1 protein_id gnl|my_center|LOCUS_12080 1352902 1351364 gene locus_tag LOCUS_12090 1352902 1351364 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030606.1 protein_id gnl|my_center|LOCUS_12090 1354355 1352949 gene locus_tag LOCUS_12100 gene phoD 1354355 1352949 CDS product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 protein_id gnl|my_center|LOCUS_12100 1354495 1355265 gene locus_tag LOCUS_12110 gene kstR2 1354495 1355265 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897410.1 protein_id gnl|my_center|LOCUS_12110 1355262 1355945 gene locus_tag LOCUS_12120 1355262 1355945 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227842.1 protein_id gnl|my_center|LOCUS_12120 1356960 1356046 gene locus_tag LOCUS_12130 1356960 1356046 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_12130 1357878 1356973 gene locus_tag LOCUS_12140 1357878 1356973 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_12140 1359352 1357898 gene locus_tag LOCUS_12150 gene ngcE 1359352 1357898 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_12150 1360149 1359400 gene locus_tag LOCUS_12160 1360149 1359400 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732177.1 protein_id gnl|my_center|LOCUS_12160 1361029 1360157 gene locus_tag LOCUS_12170 1361029 1360157 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946417.1 protein_id gnl|my_center|LOCUS_12170 1361699 1363687 gene locus_tag LOCUS_12180 1361699 1363687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1363894 1364835 gene locus_tag LOCUS_12190 1363894 1364835 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_12190 1364838 1365107 gene locus_tag LOCUS_12200 1364838 1365107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1365325 1365888 gene locus_tag LOCUS_12210 1365325 1365888 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228131.1 protein_id gnl|my_center|LOCUS_12210 1366811 1366158 gene locus_tag LOCUS_12220 1366811 1366158 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229221.1 protein_id gnl|my_center|LOCUS_12220 1369268 1366935 gene locus_tag LOCUS_12230 1369268 1366935 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031731.1 protein_id gnl|my_center|LOCUS_12230 1369434 1369979 gene locus_tag LOCUS_12240 1369434 1369979 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412790.1 protein_id gnl|my_center|LOCUS_12240 1370335 1372965 gene locus_tag LOCUS_12250 1370335 1372965 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229233.1 protein_id gnl|my_center|LOCUS_12250 1374269 1373451 gene locus_tag LOCUS_12260 1374269 1373451 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_12260 1375943 1374342 gene locus_tag LOCUS_12270 1375943 1374342 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030952.1 protein_id gnl|my_center|LOCUS_12270 1377260 1376091 gene locus_tag LOCUS_12280 gene ispG 1377260 1376091 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_12280 1378651 1377419 gene locus_tag LOCUS_12290 gene dxr 1378651 1377419 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_12290 1378857 1380074 gene locus_tag LOCUS_12300 1378857 1380074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1380189 1381352 gene locus_tag LOCUS_12310 1380189 1381352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1382813 1381386 gene locus_tag LOCUS_12320 1382813 1381386 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_12320 1382999 1383685 gene locus_tag LOCUS_12330 1382999 1383685 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_12330 1385116 1383698 gene locus_tag LOCUS_12340 1385116 1383698 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_12340 1385615 1385878 gene locus_tag LOCUS_12350 1385615 1385878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1387132 1385888 gene locus_tag LOCUS_12360 1387132 1385888 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223107.1 protein_id gnl|my_center|LOCUS_12360 1388713 1387196 gene locus_tag LOCUS_12370 1388713 1387196 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_12370 1390005 1388710 gene locus_tag LOCUS_12380 1390005 1388710 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_12380 1391626 1390109 gene locus_tag LOCUS_12390 1391626 1390109 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_12390 1391748 1392491 gene locus_tag LOCUS_12400 1391748 1392491 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223221.1 protein_id gnl|my_center|LOCUS_12400 1392606 1394297 gene locus_tag LOCUS_12410 1392606 1394297 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226824.1 protein_id gnl|my_center|LOCUS_12410 1394456 1396072 gene locus_tag LOCUS_12420 1394456 1396072 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228411.1 protein_id gnl|my_center|LOCUS_12420 1396486 1397829 gene locus_tag LOCUS_12430 1396486 1397829 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_12430 1398147 1398037 gene locus_tag LOCUS_r00010 1398147 1398037 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence002 1602 379 gene locus_tag LOCUS_12440 1602 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3023 1833 gene locus_tag LOCUS_12450 3023 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4244 3831 gene locus_tag LOCUS_12460 4244 3831 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230403.1 protein_id gnl|my_center|LOCUS_12460 5194 4340 gene locus_tag LOCUS_12470 5194 4340 CDS product CmcJ/NvfI family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 protein_id gnl|my_center|LOCUS_12470 5453 6277 gene locus_tag LOCUS_12480 5453 6277 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144187.1 protein_id gnl|my_center|LOCUS_12480 6604 6284 gene locus_tag LOCUS_12490 6604 6284 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_12490 6723 7484 gene locus_tag LOCUS_12500 6723 7484 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803977.1 protein_id gnl|my_center|LOCUS_12500 7652 7972 gene locus_tag LOCUS_12510 7652 7972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 7969 9273 gene locus_tag LOCUS_12520 7969 9273 CDS product MSMEG_0569 family flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_12520 9287 10102 gene locus_tag LOCUS_12530 9287 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 10189 10716 gene locus_tag LOCUS_12540 10189 10716 CDS product MSMEG_0572 family nitrogen starvation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_12540 10730 11833 gene locus_tag LOCUS_12550 10730 11833 CDS product MSMEG_0568 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876804.1 protein_id gnl|my_center|LOCUS_12550 11839 13521 gene locus_tag LOCUS_12560 11839 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 13533 14369 gene locus_tag LOCUS_12570 13533 14369 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104253.1 protein_id gnl|my_center|LOCUS_12570 14704 15582 gene locus_tag LOCUS_12580 14704 15582 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727037.1 protein_id gnl|my_center|LOCUS_12580 15589 15909 gene locus_tag LOCUS_12590 15589 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 15906 16979 gene locus_tag LOCUS_12600 15906 16979 CDS product MSMEG_0565 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876802.1 protein_id gnl|my_center|LOCUS_12600 18016 17021 gene locus_tag LOCUS_12610 18016 17021 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_12610 20439 18064 gene locus_tag LOCUS_12620 20439 18064 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_12620 22614 20872 gene locus_tag LOCUS_12630 22614 20872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141301.1 protein_id gnl|my_center|LOCUS_12630 24317 22614 gene locus_tag LOCUS_12640 24317 22614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_12640 25066 24314 gene locus_tag LOCUS_12650 25066 24314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_12650 26121 25063 gene locus_tag LOCUS_12660 26121 25063 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209211630.1 protein_id gnl|my_center|LOCUS_12660 27125 26121 gene locus_tag LOCUS_12670 27125 26121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_12670 27281 27883 gene locus_tag LOCUS_12680 27281 27883 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_12680 27888 28451 gene locus_tag LOCUS_12690 27888 28451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 28867 28793 gene locus_tag LOCUS_t00100 28867 28793 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29281 30396 gene locus_tag LOCUS_12700 29281 30396 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403008.1 protein_id gnl|my_center|LOCUS_12700 30404 31042 gene locus_tag LOCUS_12710 30404 31042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 31133 34384 gene locus_tag LOCUS_12720 31133 34384 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_12720 34423 34878 gene locus_tag LOCUS_12730 34423 34878 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222966.1 protein_id gnl|my_center|LOCUS_12730 37196 34959 gene locus_tag LOCUS_12740 37196 34959 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_12740 40766 37665 gene locus_tag LOCUS_12750 40766 37665 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225870.1 protein_id gnl|my_center|LOCUS_12750 41330 42568 gene locus_tag LOCUS_12760 41330 42568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228145.1 protein_id gnl|my_center|LOCUS_12760 42565 43017 gene locus_tag LOCUS_12770 42565 43017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 45082 42926 gene locus_tag LOCUS_12780 45082 42926 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831565.1 protein_id gnl|my_center|LOCUS_12780 46988 45768 gene locus_tag LOCUS_12790 gene fdhA 46988 45768 CDS product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118811.1 protein_id gnl|my_center|LOCUS_12790 47647 47282 gene locus_tag LOCUS_12800 47647 47282 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977426.1 protein_id gnl|my_center|LOCUS_12800 49623 47644 gene locus_tag LOCUS_12810 49623 47644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 49776 51368 gene locus_tag LOCUS_12820 49776 51368 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 protein_id gnl|my_center|LOCUS_12820 52331 51372 gene locus_tag LOCUS_12830 52331 51372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 52212 52790 gene locus_tag LOCUS_12840 52212 52790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 52833 53180 gene locus_tag LOCUS_12850 52833 53180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 53418 53804 gene locus_tag LOCUS_12860 53418 53804 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776558.1 protein_id gnl|my_center|LOCUS_12860 54036 54410 gene locus_tag LOCUS_12870 54036 54410 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776558.1 protein_id gnl|my_center|LOCUS_12870 54999 54436 gene locus_tag LOCUS_12880 54999 54436 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079730.1 protein_id gnl|my_center|LOCUS_12880 55063 55452 gene locus_tag LOCUS_12890 55063 55452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 55536 58721 gene locus_tag LOCUS_12900 55536 58721 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_12900 59357 58788 gene locus_tag LOCUS_12910 59357 58788 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529753.1 protein_id gnl|my_center|LOCUS_12910 59580 59990 gene locus_tag LOCUS_12920 59580 59990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 60369 60668 gene locus_tag LOCUS_12930 60369 60668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 61519 60554 gene locus_tag LOCUS_12940 61519 60554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 62826 61516 gene locus_tag LOCUS_12950 62826 61516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 63339 63557 gene locus_tag LOCUS_12960 63339 63557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 64652 63636 gene locus_tag LOCUS_12970 64652 63636 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 protein_id gnl|my_center|LOCUS_12970 64706 65296 gene locus_tag LOCUS_12980 64706 65296 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727620.1 protein_id gnl|my_center|LOCUS_12980 65293 65754 gene locus_tag LOCUS_12990 65293 65754 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_12990 65830 66321 gene locus_tag LOCUS_13000 65830 66321 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897995.1 protein_id gnl|my_center|LOCUS_13000 66547 66819 gene locus_tag LOCUS_13010 66547 66819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 67454 66879 gene locus_tag LOCUS_13020 67454 66879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 67960 67451 gene locus_tag LOCUS_13030 67960 67451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 68197 69114 gene locus_tag LOCUS_13040 68197 69114 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_13040 69047 69274 gene locus_tag LOCUS_13050 69047 69274 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_13050 70467 69721 gene locus_tag LOCUS_13060 70467 69721 CDS product NgoMIV family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951140.1 protein_id gnl|my_center|LOCUS_13060 71980 70535 gene locus_tag LOCUS_13070 gene dcm 71980 70535 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230932.1 protein_id gnl|my_center|LOCUS_13070 72058 72573 gene locus_tag LOCUS_13080 72058 72573 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_13080 73689 72988 gene locus_tag LOCUS_13090 73689 72988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230935.1 protein_id gnl|my_center|LOCUS_13090 73939 73721 gene locus_tag LOCUS_13100 73939 73721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 73859 75217 gene locus_tag LOCUS_13110 73859 75217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109210242.1 protein_id gnl|my_center|LOCUS_13110 75187 77040 gene locus_tag LOCUS_13120 75187 77040 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_13120 77502 77215 gene locus_tag LOCUS_13130 77502 77215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 77923 77471 gene locus_tag LOCUS_13140 77923 77471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 78286 79110 gene locus_tag LOCUS_13150 78286 79110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 79309 79527 gene locus_tag LOCUS_13160 79309 79527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 81117 79714 gene locus_tag LOCUS_13170 81117 79714 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_13170 81302 81114 gene locus_tag LOCUS_13180 81302 81114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 81762 82049 gene locus_tag LOCUS_13190 81762 82049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 83296 82316 gene locus_tag LOCUS_13200 gene trpS 83296 82316 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_13200 84530 83505 gene locus_tag LOCUS_13210 84530 83505 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_13210 85447 84827 gene locus_tag LOCUS_13220 85447 84827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 protein_id gnl|my_center|LOCUS_13220 85566 86609 gene locus_tag LOCUS_13230 85566 86609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225204.1 protein_id gnl|my_center|LOCUS_13230 87102 86650 gene locus_tag LOCUS_13240 87102 86650 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031198.1 protein_id gnl|my_center|LOCUS_13240 88397 87411 gene locus_tag LOCUS_13250 88397 87411 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079794.1 protein_id gnl|my_center|LOCUS_13250 89181 88639 gene locus_tag LOCUS_13260 89181 88639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 89840 89205 gene locus_tag LOCUS_13270 89840 89205 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 protein_id gnl|my_center|LOCUS_13270 91081 89840 gene locus_tag LOCUS_13280 91081 89840 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_13280 92144 91152 gene locus_tag LOCUS_13290 92144 91152 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973944.1 protein_id gnl|my_center|LOCUS_13290 92336 92890 gene locus_tag LOCUS_13300 92336 92890 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 protein_id gnl|my_center|LOCUS_13300 92892 93428 gene locus_tag LOCUS_13310 92892 93428 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_13310 94625 93909 gene locus_tag LOCUS_13320 94625 93909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 95497 94622 gene locus_tag LOCUS_13330 95497 94622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462188.1 protein_id gnl|my_center|LOCUS_13330 95853 95494 gene locus_tag LOCUS_13340 95853 95494 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_13340 96143 96511 gene locus_tag LOCUS_13350 96143 96511 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082630.1 protein_id gnl|my_center|LOCUS_13350 98456 96573 gene locus_tag LOCUS_13360 98456 96573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_13360 98362 98691 gene locus_tag LOCUS_13370 98362 98691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 98802 100301 gene locus_tag LOCUS_13380 98802 100301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027315.1 protein_id gnl|my_center|LOCUS_13380 100417 101070 gene locus_tag LOCUS_13390 100417 101070 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227434.1 protein_id gnl|my_center|LOCUS_13390 101205 101777 gene locus_tag LOCUS_13400 101205 101777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 101771 101871 gene locus_tag LOCUS_t00110 101771 101871 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 102800 101808 gene locus_tag LOCUS_13410 102800 101808 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027358.1 protein_id gnl|my_center|LOCUS_13410 103429 102887 gene locus_tag LOCUS_13420 103429 102887 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_13420 103713 105971 gene locus_tag LOCUS_13430 103713 105971 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030648.1 protein_id gnl|my_center|LOCUS_13430 106075 106926 gene locus_tag LOCUS_13440 106075 106926 CDS product rRNA (guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223831.1 protein_id gnl|my_center|LOCUS_13440 107082 108851 gene locus_tag LOCUS_13450 107082 108851 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142567766.1 protein_id gnl|my_center|LOCUS_13450 110434 108872 gene locus_tag LOCUS_13460 110434 108872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 110570 114778 gene locus_tag LOCUS_13470 110570 114778 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 protein_id gnl|my_center|LOCUS_13470 114782 115408 gene locus_tag LOCUS_13480 114782 115408 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_13480 117653 115536 gene locus_tag LOCUS_13490 117653 115536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 118111 118647 gene locus_tag LOCUS_13500 gene pyrE 118111 118647 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_13500 119139 118696 gene locus_tag LOCUS_13510 119139 118696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 120864 119566 gene locus_tag LOCUS_13520 120864 119566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 120973 121995 gene locus_tag LOCUS_13530 gene fbaA 120973 121995 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_13530 122072 122494 gene locus_tag LOCUS_13540 122072 122494 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_13540 123004 123636 gene locus_tag LOCUS_13550 123004 123636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 123836 125119 gene locus_tag LOCUS_13560 123836 125119 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_13560 125515 126531 gene locus_tag LOCUS_13570 125515 126531 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_13570 127781 126636 gene locus_tag LOCUS_13580 gene corA 127781 126636 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223003.1 protein_id gnl|my_center|LOCUS_13580 128297 129517 gene locus_tag LOCUS_13590 gene purD 128297 129517 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_13590 130440 130219 gene locus_tag LOCUS_13600 130440 130219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 130330 131514 gene locus_tag LOCUS_13610 gene murA 130330 131514 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_13610 131906 133237 gene locus_tag LOCUS_13620 131906 133237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 133484 134863 gene locus_tag LOCUS_13630 133484 134863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 136048 134993 gene locus_tag LOCUS_13640 gene hisC 136048 134993 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_13640 137017 136292 gene locus_tag LOCUS_13650 137017 136292 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_13650 138851 137076 gene locus_tag LOCUS_13660 138851 137076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 140132 138951 gene locus_tag LOCUS_13670 140132 138951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 141435 140146 gene locus_tag LOCUS_13680 141435 140146 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_13680 143169 141535 gene locus_tag LOCUS_13690 143169 141535 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776768.1 protein_id gnl|my_center|LOCUS_13690 143257 144423 gene locus_tag LOCUS_13700 143257 144423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 144454 146526 gene locus_tag LOCUS_13710 144454 146526 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776746.1 protein_id gnl|my_center|LOCUS_13710 147628 146702 gene locus_tag LOCUS_13720 147628 146702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_13720 147999 150311 gene locus_tag LOCUS_13730 gene hypF 147999 150311 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225635.1 protein_id gnl|my_center|LOCUS_13730 152178 150496 gene locus_tag LOCUS_13740 152178 150496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 153413 152550 gene locus_tag LOCUS_13750 153413 152550 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223525.1 protein_id gnl|my_center|LOCUS_13750 153576 154109 gene locus_tag LOCUS_13760 153576 154109 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978174.1 protein_id gnl|my_center|LOCUS_13760 154156 155142 gene locus_tag LOCUS_13770 154156 155142 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027599.1 protein_id gnl|my_center|LOCUS_13770 155142 157409 gene locus_tag LOCUS_13780 155142 157409 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727118.1 protein_id gnl|my_center|LOCUS_13780 157660 159087 gene locus_tag LOCUS_13790 gene gndA 157660 159087 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222331.1 protein_id gnl|my_center|LOCUS_13790 159277 160656 gene locus_tag LOCUS_13800 159277 160656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 160750 162312 gene locus_tag LOCUS_13810 160750 162312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 162816 163769 gene locus_tag LOCUS_13820 162816 163769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_13820 163984 164370 gene locus_tag LOCUS_13830 163984 164370 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221993.1 protein_id gnl|my_center|LOCUS_13830 165217 164444 gene locus_tag LOCUS_13840 gene fabG 165217 164444 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_13840 166227 165268 gene locus_tag LOCUS_13850 166227 165268 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_13850 166382 167599 gene locus_tag LOCUS_13860 166382 167599 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_13860 168326 167817 gene locus_tag LOCUS_13870 168326 167817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 169201 172311 gene locus_tag LOCUS_13880 gene afsR 169201 172311 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_13880 172569 172399 gene locus_tag LOCUS_13890 172569 172399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 174231 172768 gene locus_tag LOCUS_13900 174231 172768 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_13900 174399 174713 gene locus_tag LOCUS_13910 174399 174713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 175275 174721 gene locus_tag LOCUS_13920 175275 174721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 175954 175355 gene locus_tag LOCUS_13930 175954 175355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 176043 176618 gene locus_tag LOCUS_13940 176043 176618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 176699 177505 gene locus_tag LOCUS_13950 176699 177505 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_13950 177638 178783 gene locus_tag LOCUS_13960 177638 178783 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_13960 179568 179158 gene locus_tag LOCUS_13970 179568 179158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 179926 180771 gene locus_tag LOCUS_13980 179926 180771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 182107 181043 gene locus_tag LOCUS_13990 182107 181043 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_13990 183378 182104 gene locus_tag LOCUS_14000 183378 182104 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_14000 184228 183698 gene locus_tag LOCUS_14010 184228 183698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 184820 184221 gene locus_tag LOCUS_14020 gene recR 184820 184221 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_14020 185186 184836 gene locus_tag LOCUS_14030 185186 184836 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975320.1 protein_id gnl|my_center|LOCUS_14030 187885 185591 gene locus_tag LOCUS_14040 187885 185591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 187986 188315 gene locus_tag LOCUS_14050 187986 188315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 188375 188461 gene locus_tag LOCUS_t00120 188375 188461 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 188740 189066 gene locus_tag LOCUS_14060 188740 189066 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895874.1 protein_id gnl|my_center|LOCUS_14060 189144 189233 gene locus_tag LOCUS_t00130 189144 189233 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 189688 189299 gene locus_tag LOCUS_14070 189688 189299 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973901.1 protein_id gnl|my_center|LOCUS_14070 190280 189753 gene locus_tag LOCUS_14080 190280 189753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 190770 190288 gene locus_tag LOCUS_14090 190770 190288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 191374 190787 gene locus_tag LOCUS_14100 191374 190787 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112944.1 protein_id gnl|my_center|LOCUS_14100 191544 192152 gene locus_tag LOCUS_14110 gene upp 191544 192152 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_14110 192476 192694 gene locus_tag LOCUS_14120 192476 192694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 192911 193069 gene locus_tag LOCUS_14130 192911 193069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 193066 193593 gene locus_tag LOCUS_14140 193066 193593 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095467.1 protein_id gnl|my_center|LOCUS_14140 193783 195069 gene locus_tag LOCUS_14150 193783 195069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 195636 196322 gene locus_tag LOCUS_14160 195636 196322 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728586.1 protein_id gnl|my_center|LOCUS_14160 197661 196564 gene locus_tag LOCUS_14170 gene dnaN 197661 196564 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_14170 198434 197781 gene locus_tag LOCUS_14180 198434 197781 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221997.1 protein_id gnl|my_center|LOCUS_14180 199962 198445 gene locus_tag LOCUS_14190 199962 198445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 200106 201065 gene locus_tag LOCUS_14200 200106 201065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_14200 201420 201172 gene locus_tag LOCUS_14210 201420 201172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 201419 202213 gene locus_tag LOCUS_14220 201419 202213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_14220 202304 202885 gene locus_tag LOCUS_14230 202304 202885 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_14230 202943 204388 gene locus_tag LOCUS_14240 202943 204388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229299.1 protein_id gnl|my_center|LOCUS_14240 204385 205140 gene locus_tag LOCUS_14250 204385 205140 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141309845.1 protein_id gnl|my_center|LOCUS_14250 206574 205222 gene locus_tag LOCUS_14260 gene dnaB 206574 205222 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_14260 206947 208272 gene locus_tag LOCUS_14270 206947 208272 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_14270 208381 210126 gene locus_tag LOCUS_14280 208381 210126 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_14280 210690 210244 gene locus_tag LOCUS_14290 gene rplI 210690 210244 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_14290 210947 210708 gene locus_tag LOCUS_14300 gene rpsR 210947 210708 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_14300 211556 211056 gene locus_tag LOCUS_14310 211556 211056 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_14310 212090 211800 gene locus_tag LOCUS_14320 gene rpsF 212090 211800 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 protein_id gnl|my_center|LOCUS_14320 212349 212666 gene locus_tag LOCUS_14330 212349 212666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_14330 212795 213553 gene locus_tag LOCUS_14340 212795 213553 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467888.1 protein_id gnl|my_center|LOCUS_14340 214931 213687 gene locus_tag LOCUS_14350 214931 213687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 216401 215016 gene locus_tag LOCUS_14360 216401 215016 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_14360 219363 216466 gene locus_tag LOCUS_14370 219363 216466 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 protein_id gnl|my_center|LOCUS_14370 220053 220745 gene locus_tag LOCUS_14380 220053 220745 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_14380 220773 221852 gene locus_tag LOCUS_14390 220773 221852 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_14390 222616 221984 gene locus_tag LOCUS_14400 gene idi 222616 221984 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898999.1 protein_id gnl|my_center|LOCUS_14400 222693 224024 gene locus_tag LOCUS_14410 222693 224024 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_14410 225557 224034 gene locus_tag LOCUS_14420 225557 224034 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_14420 225810 226205 gene locus_tag LOCUS_14430 225810 226205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 226463 228544 gene locus_tag LOCUS_14440 226463 228544 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930082.1 protein_id gnl|my_center|LOCUS_14440 228541 230160 gene locus_tag LOCUS_14450 228541 230160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 230384 231913 gene locus_tag LOCUS_14460 230384 231913 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 protein_id gnl|my_center|LOCUS_14460 231969 232574 gene locus_tag LOCUS_14470 gene sigM 231969 232574 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_14470 232564 233793 gene locus_tag LOCUS_14480 232564 233793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 234018 234950 gene locus_tag LOCUS_14490 gene trxB 234018 234950 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_14490 235144 235467 gene locus_tag LOCUS_14500 gene trxA 235144 235467 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_14500 236222 235674 gene locus_tag LOCUS_14510 236222 235674 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_14510 236790 237971 gene locus_tag LOCUS_14520 236790 237971 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_14520 238046 238996 gene locus_tag LOCUS_14530 238046 238996 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_14530 240052 241122 gene locus_tag LOCUS_14540 240052 241122 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_14540 241250 241498 gene locus_tag LOCUS_14550 241250 241498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 242360 242512 gene locus_tag LOCUS_14560 242360 242512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14560 245518 244547 gene locus_tag LOCUS_14570 245518 244547 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231063.1 protein_id gnl|my_center|LOCUS_14570 246371 245598 gene locus_tag LOCUS_14580 246371 245598 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_14580 247381 246659 gene locus_tag LOCUS_14590 gene rsmG 247381 246659 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_14590 248511 247963 gene locus_tag LOCUS_14600 248511 247963 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_14600 249458 248508 gene locus_tag LOCUS_14610 249458 248508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 249744 249463 gene locus_tag LOCUS_14620 gene yidD 249744 249463 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037400.1 protein_id gnl|my_center|LOCUS_14620 250127 249741 gene locus_tag LOCUS_14630 gene rnpA 250127 249741 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029288.1 protein_id gnl|my_center|LOCUS_14630 250434 250297 gene locus_tag LOCUS_14640 250434 250297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 251040 252929 gene locus_tag LOCUS_14650 251040 252929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 253632 254765 gene locus_tag LOCUS_14660 gene dnaN 253632 254765 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_14660 254829 255773 gene locus_tag LOCUS_14670 gene gnd 254829 255773 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_14670 256035 257261 gene locus_tag LOCUS_14680 gene recF 256035 257261 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726603.1 protein_id gnl|my_center|LOCUS_14680 257251 257778 gene locus_tag LOCUS_14690 257251 257778 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_14690 258115 260055 gene locus_tag LOCUS_14700 gene gyrB 258115 260055 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116174448.1 protein_id gnl|my_center|LOCUS_14700 260098 262626 gene locus_tag LOCUS_14710 gene gyrA 260098 262626 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_14710 262626 263444 gene locus_tag LOCUS_14720 262626 263444 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221962.1 protein_id gnl|my_center|LOCUS_14720 263620 263696 gene locus_tag LOCUS_t00140 263620 263696 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 264547 264948 gene locus_tag LOCUS_14730 264547 264948 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226135.1 protein_id gnl|my_center|LOCUS_14730 265904 265011 gene locus_tag LOCUS_14740 265904 265011 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030936.1 protein_id gnl|my_center|LOCUS_14740 266535 265918 gene locus_tag LOCUS_14750 266535 265918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 266840 266565 gene locus_tag LOCUS_14760 266840 266565 CDS product DUF6295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226838.1 protein_id gnl|my_center|LOCUS_14760 267608 266865 gene locus_tag LOCUS_14770 267608 266865 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226837.1 protein_id gnl|my_center|LOCUS_14770 267583 267948 gene locus_tag LOCUS_14780 267583 267948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 267951 268697 gene locus_tag LOCUS_14790 267951 268697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 268712 269824 gene locus_tag LOCUS_14800 268712 269824 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027275.1 protein_id gnl|my_center|LOCUS_14800 269839 271140 gene locus_tag LOCUS_14810 269839 271140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 271159 271491 gene locus_tag LOCUS_14820 271159 271491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 272992 271892 gene locus_tag LOCUS_14830 272992 271892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 protein_id gnl|my_center|LOCUS_14830 274518 272977 gene locus_tag LOCUS_14840 274518 272977 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258152.1 protein_id gnl|my_center|LOCUS_14840 275754 274579 gene locus_tag LOCUS_14850 275754 274579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 276070 276483 gene locus_tag LOCUS_14860 276070 276483 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097137372.1 protein_id gnl|my_center|LOCUS_14860 277033 277233 gene locus_tag LOCUS_14870 277033 277233 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085690.1 protein_id gnl|my_center|LOCUS_14870 277236 278501 gene locus_tag LOCUS_14880 277236 278501 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_14880 278846 279811 gene locus_tag LOCUS_14890 278846 279811 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_14890 279967 280941 gene locus_tag LOCUS_14900 279967 280941 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484222.1 protein_id gnl|my_center|LOCUS_14900 281430 281158 gene locus_tag LOCUS_14910 281430 281158 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 protein_id gnl|my_center|LOCUS_14910 281411 281740 gene locus_tag LOCUS_14920 281411 281740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 281870 283513 gene locus_tag LOCUS_14930 281870 283513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 283854 285194 gene locus_tag LOCUS_14940 gene gdhA 283854 285194 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896839.1 protein_id gnl|my_center|LOCUS_14940 286636 286295 gene locus_tag LOCUS_14950 286636 286295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 286943 287938 gene locus_tag LOCUS_14960 286943 287938 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666121.1 protein_id gnl|my_center|LOCUS_14960 287941 288600 gene locus_tag LOCUS_14970 287941 288600 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030451.1 protein_id gnl|my_center|LOCUS_14970 289917 289096 gene locus_tag LOCUS_14980 289917 289096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 290355 291668 gene locus_tag LOCUS_14990 290355 291668 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893543.1 protein_id gnl|my_center|LOCUS_14990 291703 292686 gene locus_tag LOCUS_15000 291703 292686 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529314.1 protein_id gnl|my_center|LOCUS_15000 292674 293666 gene locus_tag LOCUS_15010 292674 293666 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259507.1 protein_id gnl|my_center|LOCUS_15010 293832 295181 gene locus_tag LOCUS_15020 293832 295181 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227115.1 protein_id gnl|my_center|LOCUS_15020 295178 296071 gene locus_tag LOCUS_15030 295178 296071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 296074 296766 gene locus_tag LOCUS_15040 296074 296766 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225814.1 protein_id gnl|my_center|LOCUS_15040 297321 296893 gene locus_tag LOCUS_15050 297321 296893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 297855 298616 gene locus_tag LOCUS_15060 297855 298616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 298685 300082 gene locus_tag LOCUS_15070 gene rtcB 298685 300082 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413616.1 protein_id gnl|my_center|LOCUS_15070 300082 300507 gene locus_tag LOCUS_15080 300082 300507 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413614.1 protein_id gnl|my_center|LOCUS_15080 300744 301529 gene locus_tag LOCUS_15090 300744 301529 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_15090 301704 302141 gene locus_tag LOCUS_15100 301704 302141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 302258 303472 gene locus_tag LOCUS_15110 302258 303472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 303988 303596 gene locus_tag LOCUS_15120 303988 303596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 304614 304090 gene locus_tag LOCUS_15130 304614 304090 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226958.1 protein_id gnl|my_center|LOCUS_15130 305670 304693 gene locus_tag LOCUS_15140 305670 304693 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029931.1 protein_id gnl|my_center|LOCUS_15140 305948 306769 gene locus_tag LOCUS_15150 305948 306769 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_15150 307704 306814 gene locus_tag LOCUS_15160 307704 306814 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230679.1 protein_id gnl|my_center|LOCUS_15160 308666 307701 gene locus_tag LOCUS_15170 308666 307701 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230680.1 protein_id gnl|my_center|LOCUS_15170 309511 308666 gene locus_tag LOCUS_15180 309511 308666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230681.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 310999 309785 gene locus_tag LOCUS_15190 310999 309785 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876235.1 protein_id gnl|my_center|LOCUS_15190 312024 310996 gene locus_tag LOCUS_15200 312024 310996 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 protein_id gnl|my_center|LOCUS_15200 312993 312328 gene locus_tag LOCUS_15210 312993 312328 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029778.1 protein_id gnl|my_center|LOCUS_15210 313452 313075 gene locus_tag LOCUS_15220 313452 313075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 314713 313490 gene locus_tag LOCUS_15230 gene glcF 314713 313490 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_15230 316086 314710 gene locus_tag LOCUS_15240 gene glcD 316086 314710 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_15240 317750 316092 gene locus_tag LOCUS_15250 317750 316092 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 protein_id gnl|my_center|LOCUS_15250 317888 318550 gene locus_tag LOCUS_15260 317888 318550 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229023.1 protein_id gnl|my_center|LOCUS_15260 318578 319132 gene locus_tag LOCUS_15270 318578 319132 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_15270 319129 319815 gene locus_tag LOCUS_15280 319129 319815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 319922 320245 gene locus_tag LOCUS_15290 319922 320245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 320533 320994 gene locus_tag LOCUS_15300 320533 320994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 320991 322553 gene locus_tag LOCUS_15310 320991 322553 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_15310 322854 323519 gene locus_tag LOCUS_15320 322854 323519 CDS product YwiC-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779966.1 protein_id gnl|my_center|LOCUS_15320 323667 324248 gene locus_tag LOCUS_15330 323667 324248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 325292 324270 gene locus_tag LOCUS_15340 325292 324270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 326669 325842 gene locus_tag LOCUS_15350 326669 325842 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 protein_id gnl|my_center|LOCUS_15350 326773 328293 gene locus_tag LOCUS_15360 326773 328293 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845095.1 protein_id gnl|my_center|LOCUS_15360 329165 328548 gene locus_tag LOCUS_15370 329165 328548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15370 329577 330470 gene locus_tag LOCUS_15380 329577 330470 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026999.1 protein_id gnl|my_center|LOCUS_15380 331470 332549 gene locus_tag LOCUS_15390 331470 332549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 332824 333063 gene locus_tag LOCUS_15400 332824 333063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 333885 334382 gene locus_tag LOCUS_15410 333885 334382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 334346 335266 gene locus_tag LOCUS_15420 334346 335266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 335618 335310 gene locus_tag LOCUS_15430 335618 335310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 336791 337282 gene locus_tag LOCUS_15440 336791 337282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 337869 338429 gene locus_tag LOCUS_15450 337869 338429 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_15450 338518 338850 gene locus_tag LOCUS_15460 338518 338850 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_15460 340303 338816 gene locus_tag LOCUS_15470 340303 338816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 340609 340950 gene locus_tag LOCUS_15480 340609 340950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 341109 341840 gene locus_tag LOCUS_15490 341109 341840 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_15490 341959 342372 gene locus_tag LOCUS_15500 341959 342372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 342369 342671 gene locus_tag LOCUS_15510 342369 342671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 342755 344179 gene locus_tag LOCUS_15520 342755 344179 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110627.1 protein_id gnl|my_center|LOCUS_15520 344176 345804 gene locus_tag LOCUS_15530 344176 345804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227708.1 protein_id gnl|my_center|LOCUS_15530 345801 346007 gene locus_tag LOCUS_15540 345801 346007 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043441830.1 protein_id gnl|my_center|LOCUS_15540 346007 347176 gene locus_tag LOCUS_15550 346007 347176 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_15550 347308 347233 gene locus_tag LOCUS_t00150 347308 347233 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 348152 347400 gene locus_tag LOCUS_15560 348152 347400 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_15560 348300 348181 gene locus_tag LOCUS_15570 348300 348181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 348707 350239 gene locus_tag LOCUS_15580 348707 350239 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230428.1 protein_id gnl|my_center|LOCUS_15580 350926 350501 gene locus_tag LOCUS_15590 350926 350501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 351267 350980 gene locus_tag LOCUS_15600 351267 350980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 351836 351294 gene locus_tag LOCUS_15610 351836 351294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 351823 352029 gene locus_tag LOCUS_15620 351823 352029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 352022 352558 gene locus_tag LOCUS_15630 352022 352558 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929825.1 protein_id gnl|my_center|LOCUS_15630 352713 353573 gene locus_tag LOCUS_15640 352713 353573 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 protein_id gnl|my_center|LOCUS_15640 353882 353637 gene locus_tag LOCUS_15650 gene crgA 353882 353637 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_15650 356116 354131 gene locus_tag LOCUS_15660 gene pknB 356116 354131 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_15660 357671 356190 gene locus_tag LOCUS_15670 357671 356190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 359119 357668 gene locus_tag LOCUS_15680 gene pbpA 359119 357668 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 protein_id gnl|my_center|LOCUS_15680 360495 359116 gene locus_tag LOCUS_15690 360495 359116 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_15690 361922 360492 gene locus_tag LOCUS_15700 361922 360492 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776670.1 protein_id gnl|my_center|LOCUS_15700 362380 361919 gene locus_tag LOCUS_15710 gene fhaB 362380 361919 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_15710 363135 362398 gene locus_tag LOCUS_15720 363135 362398 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_15720 363365 363448 gene locus_tag LOCUS_t00160 363365 363448 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 363494 363673 gene locus_tag LOCUS_15730 363494 363673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 364886 363873 gene locus_tag LOCUS_15740 364886 363873 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026954.1 protein_id gnl|my_center|LOCUS_15740 366365 365022 gene locus_tag LOCUS_15750 366365 365022 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026955.1 protein_id gnl|my_center|LOCUS_15750 366822 368069 gene locus_tag LOCUS_15760 366822 368069 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624060.1 protein_id gnl|my_center|LOCUS_15760 368283 369167 gene locus_tag LOCUS_15770 368283 369167 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_15770 369235 369558 gene locus_tag LOCUS_15780 369235 369558 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_15780 369646 369852 gene locus_tag LOCUS_15790 369646 369852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 369977 371344 gene locus_tag LOCUS_15800 gene cytX 369977 371344 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256688.1 protein_id gnl|my_center|LOCUS_15800 371959 371426 gene locus_tag LOCUS_15810 371959 371426 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 protein_id gnl|my_center|LOCUS_15810 372116 374044 gene locus_tag LOCUS_15820 372116 374044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 374179 374676 gene locus_tag LOCUS_15830 374179 374676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 374811 374659 gene locus_tag LOCUS_15840 374811 374659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 374987 374817 gene locus_tag LOCUS_15850 374987 374817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 376235 375273 gene locus_tag LOCUS_15860 376235 375273 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228718.1 protein_id gnl|my_center|LOCUS_15860 378070 376379 gene locus_tag LOCUS_15870 378070 376379 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 protein_id gnl|my_center|LOCUS_15870 379185 378205 gene locus_tag LOCUS_15880 379185 378205 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897017.1 protein_id gnl|my_center|LOCUS_15880 380709 379201 gene locus_tag LOCUS_15890 380709 379201 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 protein_id gnl|my_center|LOCUS_15890 381941 380724 gene locus_tag LOCUS_15900 381941 380724 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404744.1 protein_id gnl|my_center|LOCUS_15900 382133 383341 gene locus_tag LOCUS_15910 382133 383341 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_15910 383338 384255 gene locus_tag LOCUS_15920 383338 384255 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206875.1 protein_id gnl|my_center|LOCUS_15920 384252 385061 gene locus_tag LOCUS_15930 384252 385061 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742172.1 protein_id gnl|my_center|LOCUS_15930 385316 386029 gene locus_tag LOCUS_15940 385316 386029 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_15940 386773 386078 gene locus_tag LOCUS_15950 386773 386078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 386901 387284 gene locus_tag LOCUS_15960 gene bldG 386901 387284 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_15960 388010 388735 gene locus_tag LOCUS_15970 388010 388735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 388741 390396 gene locus_tag LOCUS_15980 388741 390396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 392350 390296 gene locus_tag LOCUS_15990 392350 390296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 392763 394025 gene locus_tag LOCUS_16000 392763 394025 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877982.1 protein_id gnl|my_center|LOCUS_16000 394049 395071 gene locus_tag LOCUS_16010 394049 395071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 395116 396120 gene locus_tag LOCUS_16020 gene pheA 395116 396120 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_16020 396229 397506 gene locus_tag LOCUS_16030 gene serS 396229 397506 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 protein_id gnl|my_center|LOCUS_16030 397927 397724 gene locus_tag LOCUS_16040 397927 397724 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 protein_id gnl|my_center|LOCUS_16040 398726 399562 gene locus_tag LOCUS_16050 398726 399562 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_16050 400811 400284 gene locus_tag LOCUS_16060 400811 400284 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_16060 401783 400827 gene locus_tag LOCUS_16070 401783 400827 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_16070 401898 404393 gene locus_tag LOCUS_16080 401898 404393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 404468 404557 gene locus_tag LOCUS_t00170 404468 404557 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 406889 404802 gene locus_tag LOCUS_16090 406889 404802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 408524 407055 gene locus_tag LOCUS_16100 408524 407055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 409022 410632 gene locus_tag LOCUS_16110 409022 410632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 411124 411777 gene locus_tag LOCUS_16120 411124 411777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 412191 411796 gene locus_tag LOCUS_16130 412191 411796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 413447 412284 gene locus_tag LOCUS_16140 413447 412284 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_16140 414265 415011 gene locus_tag LOCUS_16150 414265 415011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 415999 415172 gene locus_tag LOCUS_16160 415999 415172 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228386.1 protein_id gnl|my_center|LOCUS_16160 417015 415996 gene locus_tag LOCUS_16170 417015 415996 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225345.1 protein_id gnl|my_center|LOCUS_16170 417951 417091 gene locus_tag LOCUS_16180 417951 417091 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224326.1 protein_id gnl|my_center|LOCUS_16180 418512 419705 gene locus_tag LOCUS_16190 418512 419705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 419863 420159 gene locus_tag LOCUS_16200 419863 420159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 420169 420564 gene locus_tag LOCUS_16210 420169 420564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 421328 420801 gene locus_tag LOCUS_16220 421328 420801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 421327 421554 gene locus_tag LOCUS_16230 421327 421554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 421637 421903 gene locus_tag LOCUS_16240 421637 421903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 421987 423519 gene locus_tag LOCUS_16250 421987 423519 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730516.1 protein_id gnl|my_center|LOCUS_16250 423967 425160 gene locus_tag LOCUS_16260 423967 425160 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_16260 426112 425279 gene locus_tag LOCUS_16270 426112 425279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 427058 426120 gene locus_tag LOCUS_16280 427058 426120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 427441 427983 gene locus_tag LOCUS_16290 427441 427983 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495205.1 protein_id gnl|my_center|LOCUS_16290 428638 428111 gene locus_tag LOCUS_16300 428638 428111 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_16300 428722 429285 gene locus_tag LOCUS_16310 428722 429285 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226185.1 protein_id gnl|my_center|LOCUS_16310 429469 429559 gene locus_tag LOCUS_t00180 429469 429559 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 429813 430010 gene locus_tag LOCUS_16320 429813 430010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 430392 430652 gene locus_tag LOCUS_16330 430392 430652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 430698 431201 gene locus_tag LOCUS_16340 430698 431201 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_16340 431201 432541 gene locus_tag LOCUS_16350 431201 432541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 433096 432569 gene locus_tag LOCUS_16360 433096 432569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 433849 433241 gene locus_tag LOCUS_16370 433849 433241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 435367 433985 gene locus_tag LOCUS_16380 gene xylB 435367 433985 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 protein_id gnl|my_center|LOCUS_16380 436512 435364 gene locus_tag LOCUS_16390 gene xylA 436512 435364 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228546.1 protein_id gnl|my_center|LOCUS_16390 436587 437768 gene locus_tag LOCUS_16400 436587 437768 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228545.1 protein_id gnl|my_center|LOCUS_16400 437813 438277 gene locus_tag LOCUS_16410 437813 438277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 438670 438434 gene locus_tag LOCUS_16420 438670 438434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 439665 438787 gene locus_tag LOCUS_16430 439665 438787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 439787 440314 gene locus_tag LOCUS_16440 439787 440314 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223520.1 protein_id gnl|my_center|LOCUS_16440 441562 440372 gene locus_tag LOCUS_16450 441562 440372 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_16450 441767 442981 gene locus_tag LOCUS_16460 441767 442981 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_16460 442969 443619 gene locus_tag LOCUS_16470 442969 443619 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_16470 443943 443870 gene locus_tag LOCUS_t00190 443943 443870 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 444173 444757 gene locus_tag LOCUS_16480 444173 444757 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230366.1 protein_id gnl|my_center|LOCUS_16480 445876 445301 gene locus_tag LOCUS_16490 445876 445301 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027617.1 protein_id gnl|my_center|LOCUS_16490 446225 445857 gene locus_tag LOCUS_16500 446225 445857 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_16500 446629 446222 gene locus_tag LOCUS_16510 446629 446222 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_16510 449223 446626 gene locus_tag LOCUS_16520 449223 446626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 449335 450147 gene locus_tag LOCUS_16530 449335 450147 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_16530 452082 450217 gene locus_tag LOCUS_16540 452082 450217 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113842.1 protein_id gnl|my_center|LOCUS_16540 452392 452781 gene locus_tag LOCUS_16550 452392 452781 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222675.1 protein_id gnl|my_center|LOCUS_16550 453612 452794 gene locus_tag LOCUS_16560 453612 452794 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 protein_id gnl|my_center|LOCUS_16560 453752 454567 gene locus_tag LOCUS_16570 453752 454567 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_16570 454564 455469 gene locus_tag LOCUS_16580 454564 455469 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226066.1 protein_id gnl|my_center|LOCUS_16580 455466 456509 gene locus_tag LOCUS_16590 gene dmpG 455466 456509 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226067.1 protein_id gnl|my_center|LOCUS_16590 456829 456662 gene locus_tag LOCUS_16600 456829 456662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 457446 458765 gene locus_tag LOCUS_16610 457446 458765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 458841 459881 gene locus_tag LOCUS_16620 458841 459881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 460135 461289 gene locus_tag LOCUS_16630 460135 461289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 462000 461590 gene locus_tag LOCUS_16640 462000 461590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 462334 463206 gene locus_tag LOCUS_16650 462334 463206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 463545 463892 gene locus_tag LOCUS_16660 463545 463892 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 protein_id gnl|my_center|LOCUS_16660 464400 464750 gene locus_tag LOCUS_16670 464400 464750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 466187 464943 gene locus_tag LOCUS_16680 466187 464943 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_16680 466540 467670 gene locus_tag LOCUS_16690 466540 467670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 467729 469045 gene locus_tag LOCUS_16700 467729 469045 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211158.1 protein_id gnl|my_center|LOCUS_16700 469076 469624 gene locus_tag LOCUS_16710 469076 469624 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276076.1 protein_id gnl|my_center|LOCUS_16710 469662 470387 gene locus_tag LOCUS_16720 469662 470387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 470519 471745 gene locus_tag LOCUS_16730 470519 471745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_16730 471810 472685 gene locus_tag LOCUS_16740 471810 472685 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040053.1 protein_id gnl|my_center|LOCUS_16740 472672 473739 gene locus_tag LOCUS_16750 472672 473739 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253118.1 protein_id gnl|my_center|LOCUS_16750 473732 474478 gene locus_tag LOCUS_16760 473732 474478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 protein_id gnl|my_center|LOCUS_16760 474481 475206 gene locus_tag LOCUS_16770 474481 475206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391472.1 protein_id gnl|my_center|LOCUS_16770 476890 475496 gene locus_tag LOCUS_16780 476890 475496 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 protein_id gnl|my_center|LOCUS_16780 478295 476910 gene locus_tag LOCUS_16790 478295 476910 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927872.1 protein_id gnl|my_center|LOCUS_16790 479089 478292 gene locus_tag LOCUS_16800 479089 478292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 480650 479217 gene locus_tag LOCUS_16810 gene tcuA 480650 479217 CDS product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 protein_id gnl|my_center|LOCUS_16810 481261 480659 gene locus_tag LOCUS_16820 481261 480659 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194414.1 protein_id gnl|my_center|LOCUS_16820 482067 481285 gene locus_tag LOCUS_16830 482067 481285 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_16830 483437 482064 gene locus_tag LOCUS_16840 483437 482064 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810930.1 protein_id gnl|my_center|LOCUS_16840 484332 483430 gene locus_tag LOCUS_16850 484332 483430 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_16850 484993 484457 gene locus_tag LOCUS_16860 484993 484457 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_16860 484923 485162 gene locus_tag LOCUS_16870 484923 485162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 486011 485454 gene locus_tag LOCUS_16880 486011 485454 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_16880 486469 486014 gene locus_tag LOCUS_16890 486469 486014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 486811 487566 gene locus_tag LOCUS_16900 486811 487566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 488203 487574 gene locus_tag LOCUS_16910 488203 487574 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_16910 488934 488200 gene locus_tag LOCUS_16920 488934 488200 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226657.1 protein_id gnl|my_center|LOCUS_16920 489647 488823 gene locus_tag LOCUS_16930 489647 488823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 491062 490112 gene locus_tag LOCUS_16940 491062 490112 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_16940 492047 491046 gene locus_tag LOCUS_16950 492047 491046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_16950 493209 492064 gene locus_tag LOCUS_16960 493209 492064 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173509.1 protein_id gnl|my_center|LOCUS_16960 493382 493696 gene locus_tag LOCUS_16970 493382 493696 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229578.1 protein_id gnl|my_center|LOCUS_16970 493960 494748 gene locus_tag LOCUS_16980 493960 494748 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_16980 497299 494735 gene locus_tag LOCUS_16990 497299 494735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 498567 497296 gene locus_tag LOCUS_17000 498567 497296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_17000 499262 498564 gene locus_tag LOCUS_17010 499262 498564 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727432.1 protein_id gnl|my_center|LOCUS_17010 499402 500277 gene locus_tag LOCUS_17020 499402 500277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 500841 502415 gene locus_tag LOCUS_17030 500841 502415 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258343.1 protein_id gnl|my_center|LOCUS_17030 502520 503011 gene locus_tag LOCUS_17040 502520 503011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 503363 504139 gene locus_tag LOCUS_17050 503363 504139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17050 504301 504591 gene locus_tag LOCUS_17060 504301 504591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 504805 506718 gene locus_tag LOCUS_17070 504805 506718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_17070 506738 507364 gene locus_tag LOCUS_17080 506738 507364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 507368 508357 gene locus_tag LOCUS_17090 gene tgmB 507368 508357 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228560.1 protein_id gnl|my_center|LOCUS_17090 508354 508905 gene locus_tag LOCUS_17100 508354 508905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 510279 508948 gene locus_tag LOCUS_17110 510279 508948 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258295.1 protein_id gnl|my_center|LOCUS_17110 510980 510276 gene locus_tag LOCUS_17120 510980 510276 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_17120 512190 510952 gene locus_tag LOCUS_17130 512190 510952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17130 513044 512172 gene locus_tag LOCUS_17140 513044 512172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 513748 513041 gene locus_tag LOCUS_17150 513748 513041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 515267 513777 gene locus_tag LOCUS_17160 515267 513777 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 protein_id gnl|my_center|LOCUS_17160 515534 516163 gene locus_tag LOCUS_17170 515534 516163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 516231 516407 gene locus_tag LOCUS_17180 516231 516407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 517028 516792 gene locus_tag LOCUS_17190 517028 516792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 517308 517087 gene locus_tag LOCUS_17200 517308 517087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 518178 517330 gene locus_tag LOCUS_17210 518178 517330 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_17210 518728 519258 gene locus_tag LOCUS_17220 518728 519258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 520648 519596 gene locus_tag LOCUS_17230 520648 519596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223209.1 protein_id gnl|my_center|LOCUS_17230 521607 520645 gene locus_tag LOCUS_17240 521607 520645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223210.1 protein_id gnl|my_center|LOCUS_17240 523368 521710 gene locus_tag LOCUS_17250 523368 521710 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803761.1 protein_id gnl|my_center|LOCUS_17250 524587 523487 gene locus_tag LOCUS_17260 524587 523487 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223212.1 protein_id gnl|my_center|LOCUS_17260 527208 524608 gene locus_tag LOCUS_17270 527208 524608 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027471.1 protein_id gnl|my_center|LOCUS_17270 527453 528262 gene locus_tag LOCUS_17280 527453 528262 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 protein_id gnl|my_center|LOCUS_17280 528374 529972 gene locus_tag LOCUS_17290 528374 529972 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223211.1 protein_id gnl|my_center|LOCUS_17290 532861 530108 gene locus_tag LOCUS_17300 532861 530108 CDS product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229330.1 protein_id gnl|my_center|LOCUS_17300 533640 533143 gene locus_tag LOCUS_17310 533640 533143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 535049 533637 gene locus_tag LOCUS_17320 535049 533637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 536340 535051 gene locus_tag LOCUS_17330 536340 535051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 537212 536337 gene locus_tag LOCUS_17340 537212 536337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 539440 537212 gene locus_tag LOCUS_17350 539440 537212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 540267 539437 gene locus_tag LOCUS_17360 540267 539437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 541097 540384 gene locus_tag LOCUS_17370 541097 540384 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781894.1 protein_id gnl|my_center|LOCUS_17370 542536 541367 gene locus_tag LOCUS_17380 542536 541367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 543655 542687 gene locus_tag LOCUS_17390 543655 542687 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973040.1 protein_id gnl|my_center|LOCUS_17390 543926 544489 gene locus_tag LOCUS_17400 543926 544489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027495.1 protein_id gnl|my_center|LOCUS_17400 544517 544726 gene locus_tag LOCUS_17410 544517 544726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 544945 545577 gene locus_tag LOCUS_17420 544945 545577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 545585 546814 gene locus_tag LOCUS_17430 545585 546814 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777064.1 protein_id gnl|my_center|LOCUS_17430 546927 547625 gene locus_tag LOCUS_17440 546927 547625 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_17440 548260 547835 gene locus_tag LOCUS_17450 548260 547835 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726613.1 protein_id gnl|my_center|LOCUS_17450 549211 548906 gene locus_tag LOCUS_17460 549211 548906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 551322 549490 gene locus_tag LOCUS_17470 551322 549490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726610.1 protein_id gnl|my_center|LOCUS_17470 553133 551319 gene locus_tag LOCUS_17480 553133 551319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891342.1 protein_id gnl|my_center|LOCUS_17480 553372 553139 gene locus_tag LOCUS_17490 553372 553139 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726914.1 protein_id gnl|my_center|LOCUS_17490 555568 553496 gene locus_tag LOCUS_17500 555568 553496 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 protein_id gnl|my_center|LOCUS_17500 555777 556646 gene locus_tag LOCUS_17510 555777 556646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 556871 557167 gene locus_tag LOCUS_17520 556871 557167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 557594 558178 gene locus_tag LOCUS_17530 557594 558178 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226035.1 protein_id gnl|my_center|LOCUS_17530 558414 558818 gene locus_tag LOCUS_17540 558414 558818 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_17540 558969 559160 gene locus_tag LOCUS_17550 558969 559160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 562980 559294 gene locus_tag LOCUS_17560 562980 559294 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007510795.1 protein_id gnl|my_center|LOCUS_17560 563146 563613 gene locus_tag LOCUS_17570 563146 563613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 563623 565335 gene locus_tag LOCUS_17580 563623 565335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 566683 565688 gene locus_tag LOCUS_17590 566683 565688 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_17590 567926 566724 gene locus_tag LOCUS_17600 567926 566724 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_17600 568035 568700 gene locus_tag LOCUS_17610 568035 568700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 568986 570002 gene locus_tag LOCUS_17620 568986 570002 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_17620 570005 570895 gene locus_tag LOCUS_17630 570005 570895 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_17630 570896 571285 gene locus_tag LOCUS_17640 570896 571285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 571289 572131 gene locus_tag LOCUS_17650 571289 572131 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_17650 572289 573239 gene locus_tag LOCUS_17660 572289 573239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 573369 574205 gene locus_tag LOCUS_17670 573369 574205 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728963.1 protein_id gnl|my_center|LOCUS_17670 575511 574696 gene locus_tag LOCUS_17680 575511 574696 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031850.1 protein_id gnl|my_center|LOCUS_17680 577848 575656 gene locus_tag LOCUS_17690 577848 575656 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_17690 579337 578096 gene locus_tag LOCUS_17700 579337 578096 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_17700 579841 579395 gene locus_tag LOCUS_17710 579841 579395 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317797.1 protein_id gnl|my_center|LOCUS_17710 580353 579850 gene locus_tag LOCUS_17720 580353 579850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 581214 580480 gene locus_tag LOCUS_17730 gene cobF 581214 580480 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031346.1 protein_id gnl|my_center|LOCUS_17730 581318 581704 gene locus_tag LOCUS_17740 581318 581704 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_17740 581715 582941 gene locus_tag LOCUS_17750 gene cbiE 581715 582941 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114023.1 protein_id gnl|my_center|LOCUS_17750 583249 584004 gene locus_tag LOCUS_17760 gene cobM 583249 584004 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410682.1 protein_id gnl|my_center|LOCUS_17760 583989 584723 gene locus_tag LOCUS_17770 583989 584723 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_17770 585680 585330 gene locus_tag LOCUS_17780 585680 585330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 586137 585748 gene locus_tag LOCUS_17790 586137 585748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 586740 586144 gene locus_tag LOCUS_17800 586740 586144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 586919 588346 gene locus_tag LOCUS_17810 586919 588346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_17810 588327 588884 gene locus_tag LOCUS_17820 588327 588884 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226214.1 protein_id gnl|my_center|LOCUS_17820 589256 590098 gene locus_tag LOCUS_17830 589256 590098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_17830 590168 590308 gene locus_tag LOCUS_17840 590168 590308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 590793 590945 gene locus_tag LOCUS_17850 590793 590945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 592417 590936 gene locus_tag LOCUS_17860 592417 590936 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228824.1 protein_id gnl|my_center|LOCUS_17860 596066 592473 gene locus_tag LOCUS_17870 gene cobN 596066 592473 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228832.1 protein_id gnl|my_center|LOCUS_17870 596205 597413 gene locus_tag LOCUS_17880 gene cobG 596205 597413 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 protein_id gnl|my_center|LOCUS_17880 597410 598051 gene locus_tag LOCUS_17890 597410 598051 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_17890 598487 598224 gene locus_tag LOCUS_17900 598487 598224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 600332 598908 gene locus_tag LOCUS_17910 600332 598908 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 protein_id gnl|my_center|LOCUS_17910 600907 600326 gene locus_tag LOCUS_17920 gene cobO 600907 600326 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_17920 603002 600930 gene locus_tag LOCUS_17930 603002 600930 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_17930 603954 603175 gene locus_tag LOCUS_17940 603954 603175 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_17940 604206 603964 gene locus_tag LOCUS_17950 604206 603964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 604508 604711 gene locus_tag LOCUS_17960 604508 604711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 604919 606121 gene locus_tag LOCUS_17970 604919 606121 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467629.1 protein_id gnl|my_center|LOCUS_17970 606541 606122 gene locus_tag LOCUS_17980 606541 606122 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059289.1 protein_id gnl|my_center|LOCUS_17980 606990 606538 gene locus_tag LOCUS_17990 606990 606538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 607926 607261 gene locus_tag LOCUS_18000 607926 607261 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191312123.1 protein_id gnl|my_center|LOCUS_18000 608010 609044 gene locus_tag LOCUS_18010 608010 609044 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_18010 609166 611361 gene locus_tag LOCUS_18020 609166 611361 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_18020 611674 612693 gene locus_tag LOCUS_18030 611674 612693 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284494.1 protein_id gnl|my_center|LOCUS_18030 613362 612754 gene locus_tag LOCUS_18040 613362 612754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 614149 613529 gene locus_tag LOCUS_18050 614149 613529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 614709 614341 gene locus_tag LOCUS_18060 614709 614341 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_18060 615341 614832 gene locus_tag LOCUS_18070 615341 614832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 616571 615516 gene locus_tag LOCUS_18080 616571 615516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 617754 616735 gene locus_tag LOCUS_18090 617754 616735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 619049 617862 gene locus_tag LOCUS_18100 619049 617862 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 protein_id gnl|my_center|LOCUS_18100 620222 619260 gene locus_tag LOCUS_18110 620222 619260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 622000 620789 gene locus_tag LOCUS_18120 622000 620789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 623079 622816 gene locus_tag LOCUS_18130 623079 622816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 623239 625092 gene locus_tag LOCUS_18140 623239 625092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 626078 625197 gene locus_tag LOCUS_18150 626078 625197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 626489 626172 gene locus_tag LOCUS_18160 626489 626172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 627016 626744 gene locus_tag LOCUS_18170 627016 626744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 627085 628785 gene locus_tag LOCUS_18180 627085 628785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 629497 628904 gene locus_tag LOCUS_18190 629497 628904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 630277 629768 gene locus_tag LOCUS_18200 630277 629768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_18200 630911 630480 gene locus_tag LOCUS_18210 630911 630480 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_18210 631268 631711 gene locus_tag LOCUS_18220 631268 631711 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899429.1 protein_id gnl|my_center|LOCUS_18220 631708 633003 gene locus_tag LOCUS_18230 631708 633003 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_18230 633549 634319 gene locus_tag LOCUS_18240 633549 634319 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_18240 635451 634300 gene locus_tag LOCUS_18250 635451 634300 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113887.1 protein_id gnl|my_center|LOCUS_18250 635983 638064 gene locus_tag LOCUS_18260 635983 638064 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204072091.1 protein_id gnl|my_center|LOCUS_18260 638402 639211 gene locus_tag LOCUS_18270 638402 639211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 639293 639682 gene locus_tag LOCUS_18280 639293 639682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 640197 642266 gene locus_tag LOCUS_18290 640197 642266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 642259 644229 gene locus_tag LOCUS_18300 642259 644229 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192966.1 protein_id gnl|my_center|LOCUS_18300 644258 645853 gene locus_tag LOCUS_18310 644258 645853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 645910 646083 gene locus_tag LOCUS_18320 645910 646083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 646163 648769 gene locus_tag LOCUS_18330 646163 648769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 648766 649746 gene locus_tag LOCUS_18340 648766 649746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 649743 650873 gene locus_tag LOCUS_18350 649743 650873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 651280 651993 gene locus_tag LOCUS_18360 651280 651993 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_18360 652098 652679 gene locus_tag LOCUS_18370 652098 652679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 652958 654328 gene locus_tag LOCUS_18380 652958 654328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 654325 655446 gene locus_tag LOCUS_18390 654325 655446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 655770 655682 gene locus_tag LOCUS_t00200 655770 655682 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 655996 657297 gene locus_tag LOCUS_18400 655996 657297 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_18400 657442 658029 gene locus_tag LOCUS_18410 657442 658029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 658252 660141 gene locus_tag LOCUS_18420 658252 660141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 660632 660447 gene locus_tag LOCUS_18430 660632 660447 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977152.1 protein_id gnl|my_center|LOCUS_18430 660847 663498 gene locus_tag LOCUS_18440 gene topA 660847 663498 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_18440 663599 665617 gene locus_tag LOCUS_18450 663599 665617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 665625 666764 gene locus_tag LOCUS_18460 665625 666764 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230507.1 protein_id gnl|my_center|LOCUS_18460 666815 667378 gene locus_tag LOCUS_18470 666815 667378 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284396.1 protein_id gnl|my_center|LOCUS_18470 667375 668886 gene locus_tag LOCUS_18480 667375 668886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 669082 669921 gene locus_tag LOCUS_18490 669082 669921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 669918 671456 gene locus_tag LOCUS_18500 669918 671456 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_18500 671535 671609 gene locus_tag LOCUS_t00210 671535 671609 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 672316 671738 gene locus_tag LOCUS_18510 672316 671738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 672898 672473 gene locus_tag LOCUS_18520 672898 672473 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143490.1 protein_id gnl|my_center|LOCUS_18520 673499 673239 gene locus_tag LOCUS_18530 673499 673239 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055540536.1 protein_id gnl|my_center|LOCUS_18530 673769 674014 gene locus_tag LOCUS_18540 673769 674014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 675294 674314 gene locus_tag LOCUS_18550 675294 674314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 676230 675463 gene locus_tag LOCUS_18560 676230 675463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 676623 676874 gene locus_tag LOCUS_18570 676623 676874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 677181 678185 gene locus_tag LOCUS_18580 677181 678185 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728687.1 protein_id gnl|my_center|LOCUS_18580 678707 678330 gene locus_tag LOCUS_18590 678707 678330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18590 678979 678626 gene locus_tag LOCUS_18600 678979 678626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 679479 680576 gene locus_tag LOCUS_18610 679479 680576 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 protein_id gnl|my_center|LOCUS_18610 680786 682399 gene locus_tag LOCUS_18620 680786 682399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 682485 682820 gene locus_tag LOCUS_18630 682485 682820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 682921 683163 gene locus_tag LOCUS_18640 682921 683163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 683374 684711 gene locus_tag LOCUS_18650 683374 684711 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484443.1 protein_id gnl|my_center|LOCUS_18650 683637 683730 gene locus_tag LOCUS_t00220 683637 683730 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 684742 686304 gene locus_tag LOCUS_18660 684742 686304 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 protein_id gnl|my_center|LOCUS_18660 686297 687385 gene locus_tag LOCUS_18670 686297 687385 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_18670 687382 688485 gene locus_tag LOCUS_18680 687382 688485 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537508.1 protein_id gnl|my_center|LOCUS_18680 688572 689720 gene locus_tag LOCUS_18690 688572 689720 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385593.1 protein_id gnl|my_center|LOCUS_18690 689717 691273 gene locus_tag LOCUS_18700 689717 691273 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211366446.1 protein_id gnl|my_center|LOCUS_18700 691604 692842 gene locus_tag LOCUS_18710 gene metK 691604 692842 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284357.1 protein_id gnl|my_center|LOCUS_18710 693374 693970 gene locus_tag LOCUS_18720 693374 693970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 695488 695772 gene locus_tag LOCUS_18730 695488 695772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 695800 697056 gene locus_tag LOCUS_18740 695800 697056 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729771.1 protein_id gnl|my_center|LOCUS_18740 698112 697708 gene locus_tag LOCUS_18750 698112 697708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 699682 698465 gene locus_tag LOCUS_18760 699682 698465 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221972.1 protein_id gnl|my_center|LOCUS_18760 699959 701200 gene locus_tag LOCUS_18770 699959 701200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 700697 700777 gene locus_tag LOCUS_t00230 700697 700777 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 701206 702522 gene locus_tag LOCUS_18780 701206 702522 CDS product HEXXH motif domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229895.1 protein_id gnl|my_center|LOCUS_18780 705397 703004 gene locus_tag LOCUS_18790 705397 703004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 705883 706098 gene locus_tag LOCUS_18800 705883 706098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 706205 708145 gene locus_tag LOCUS_18810 706205 708145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 709002 709328 gene locus_tag LOCUS_18820 709002 709328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 709333 711495 gene locus_tag LOCUS_18830 gene cstA 709333 711495 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259563.1 protein_id gnl|my_center|LOCUS_18830 711927 711748 gene locus_tag LOCUS_18840 711927 711748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 712225 713364 gene locus_tag LOCUS_18850 712225 713364 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226129.1 protein_id gnl|my_center|LOCUS_18850 713366 713758 gene locus_tag LOCUS_18860 713366 713758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 713767 714273 gene locus_tag LOCUS_18870 713767 714273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 714344 715033 gene locus_tag LOCUS_18880 714344 715033 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224231.1 protein_id gnl|my_center|LOCUS_18880 715164 716816 gene locus_tag LOCUS_18890 715164 716816 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_18890 716930 717730 gene locus_tag LOCUS_18900 716930 717730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 717854 719497 gene locus_tag LOCUS_18910 717854 719497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 719652 720884 gene locus_tag LOCUS_18920 719652 720884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 721587 721087 gene locus_tag LOCUS_18930 721587 721087 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_18930 721728 723101 gene locus_tag LOCUS_18940 gene dacB 721728 723101 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_18940 723179 724255 gene locus_tag LOCUS_18950 723179 724255 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_18950 724304 725350 gene locus_tag LOCUS_18960 gene tilS 724304 725350 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_18960 725364 725927 gene locus_tag LOCUS_18970 gene hpt 725364 725927 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_18970 726342 728351 gene locus_tag LOCUS_18980 gene ftsH 726342 728351 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_18980 728509 729120 gene locus_tag LOCUS_18990 gene folE 728509 729120 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_18990 729180 730034 gene locus_tag LOCUS_19000 gene folP 729180 730034 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_19000 730031 730471 gene locus_tag LOCUS_19010 730031 730471 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_19010 730468 730845 gene locus_tag LOCUS_19020 gene folB 730468 730845 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_19020 730833 731333 gene locus_tag LOCUS_19030 gene folK 730833 731333 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_19030 731342 731812 gene locus_tag LOCUS_19040 731342 731812 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230462.1 protein_id gnl|my_center|LOCUS_19040 732967 731825 gene locus_tag LOCUS_19050 732967 731825 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_19050 733103 734320 gene locus_tag LOCUS_19060 733103 734320 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_19060 734802 735335 gene locus_tag LOCUS_19070 734802 735335 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_19070 735332 736081 gene locus_tag LOCUS_19080 735332 736081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19080 736086 737885 gene locus_tag LOCUS_19090 736086 737885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 738862 737891 gene locus_tag LOCUS_19100 738862 737891 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_19100 739159 740052 gene locus_tag LOCUS_19110 739159 740052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19110 740043 740906 gene locus_tag LOCUS_19120 gene panC 740043 740906 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 protein_id gnl|my_center|LOCUS_19120 740993 743512 gene locus_tag LOCUS_19130 740993 743512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 743512 744297 gene locus_tag LOCUS_19140 743512 744297 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_19140 744469 745953 gene locus_tag LOCUS_19150 gene lysS 744469 745953 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230454.1 protein_id gnl|my_center|LOCUS_19150 746174 746422 gene locus_tag LOCUS_19160 746174 746422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 747600 746629 gene locus_tag LOCUS_19170 747600 746629 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_19170 748078 748773 gene locus_tag LOCUS_19180 748078 748773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 748854 750251 gene locus_tag LOCUS_19190 748854 750251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 750593 750742 gene locus_tag LOCUS_19200 750593 750742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 750847 751173 gene locus_tag LOCUS_19210 750847 751173 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_19210 751445 753949 gene locus_tag LOCUS_19220 751445 753949 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_19220 754289 755245 gene locus_tag LOCUS_19230 gene eboE 754289 755245 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028848.1 protein_id gnl|my_center|LOCUS_19230 756135 755269 gene locus_tag LOCUS_19240 756135 755269 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_19240 756203 756862 gene locus_tag LOCUS_19250 756203 756862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 757955 756876 gene locus_tag LOCUS_19260 gene disA 757955 756876 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_19260 759622 758192 gene locus_tag LOCUS_19270 gene radA 759622 758192 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_19270 760424 759723 gene locus_tag LOCUS_19280 760424 759723 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_19280 760484 761302 gene locus_tag LOCUS_19290 760484 761302 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_19290 761809 763968 gene locus_tag LOCUS_19300 761809 763968 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226200.1 protein_id gnl|my_center|LOCUS_19300 764306 765103 gene locus_tag LOCUS_19310 764306 765103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 765100 766170 gene locus_tag LOCUS_19320 765100 766170 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892787.1 protein_id gnl|my_center|LOCUS_19320 766184 766465 gene locus_tag LOCUS_19330 766184 766465 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 protein_id gnl|my_center|LOCUS_19330 766836 766648 gene locus_tag LOCUS_19340 766836 766648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 768390 767050 gene locus_tag LOCUS_19350 768390 767050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 769072 768521 gene locus_tag LOCUS_19360 769072 768521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 769246 770523 gene locus_tag LOCUS_19370 769246 770523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 770874 770653 gene locus_tag LOCUS_19380 770874 770653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 771809 771057 gene locus_tag LOCUS_19390 771809 771057 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_19390 772650 773765 gene locus_tag LOCUS_19400 772650 773765 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229571.1 protein_id gnl|my_center|LOCUS_19400 774118 774972 gene locus_tag LOCUS_19410 774118 774972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 775569 775084 gene locus_tag LOCUS_19420 775569 775084 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062926.1 protein_id gnl|my_center|LOCUS_19420 775812 776255 gene locus_tag LOCUS_19430 775812 776255 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226497.1 protein_id gnl|my_center|LOCUS_19430 776399 777220 gene locus_tag LOCUS_19440 776399 777220 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 protein_id gnl|my_center|LOCUS_19440 777261 778751 gene locus_tag LOCUS_19450 777261 778751 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013532.1 protein_id gnl|my_center|LOCUS_19450 778964 779224 gene locus_tag LOCUS_19460 778964 779224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 779631 779903 gene locus_tag LOCUS_19470 779631 779903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 781625 779928 gene locus_tag LOCUS_19480 781625 779928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 783489 781678 gene locus_tag LOCUS_19490 783489 781678 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073255020.1 protein_id gnl|my_center|LOCUS_19490 783740 784774 gene locus_tag LOCUS_19500 783740 784774 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_19500 786163 784802 gene locus_tag LOCUS_19510 786163 784802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 787276 786284 gene locus_tag LOCUS_19520 gene rihA 787276 786284 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 protein_id gnl|my_center|LOCUS_19520 787386 787772 gene locus_tag LOCUS_19530 787386 787772 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_19530 789276 787927 gene locus_tag LOCUS_19540 789276 787927 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087547.1 protein_id gnl|my_center|LOCUS_19540 790307 789294 gene locus_tag LOCUS_19550 790307 789294 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_19550 791432 790311 gene locus_tag LOCUS_19560 gene pdhA 791432 790311 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257841.1 protein_id gnl|my_center|LOCUS_19560 791940 791473 gene locus_tag LOCUS_19570 791940 791473 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257840.1 protein_id gnl|my_center|LOCUS_19570 793893 792160 gene locus_tag LOCUS_19580 793893 792160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 794407 795120 gene locus_tag LOCUS_19590 794407 795120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 795856 795383 gene locus_tag LOCUS_19600 795856 795383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 796393 796992 gene locus_tag LOCUS_19610 796393 796992 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028021.1 protein_id gnl|my_center|LOCUS_19610 797201 802303 gene locus_tag LOCUS_19620 797201 802303 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_19620 802307 805141 gene locus_tag LOCUS_19630 802307 805141 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_19630 805141 809379 gene locus_tag LOCUS_19640 805141 809379 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_19640 809389 811500 gene locus_tag LOCUS_19650 809389 811500 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804186.1 protein_id gnl|my_center|LOCUS_19650 811527 812720 gene locus_tag LOCUS_19660 811527 812720 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_19660 813651 813265 gene locus_tag LOCUS_19670 813651 813265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 815950 815615 gene locus_tag LOCUS_19680 815950 815615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 816584 816276 gene locus_tag LOCUS_19690 816584 816276 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087723.1 protein_id gnl|my_center|LOCUS_19690 816577 816930 gene locus_tag LOCUS_19700 816577 816930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 817552 816989 gene locus_tag LOCUS_19710 817552 816989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 817899 818621 gene locus_tag LOCUS_19720 817899 818621 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_19720 820088 818916 gene locus_tag LOCUS_19730 820088 818916 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028682.1 protein_id gnl|my_center|LOCUS_19730 820335 820259 gene locus_tag LOCUS_t00240 820335 820259 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 821266 820361 gene locus_tag LOCUS_19740 821266 820361 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 protein_id gnl|my_center|LOCUS_19740 821307 821786 gene locus_tag LOCUS_19750 821307 821786 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_19750 824106 821881 gene locus_tag LOCUS_19760 824106 821881 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811993.1 protein_id gnl|my_center|LOCUS_19760 824404 824700 gene locus_tag LOCUS_19770 gene wblA 824404 824700 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_19770 825955 824804 gene locus_tag LOCUS_19780 825955 824804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 827304 826300 gene locus_tag LOCUS_19790 827304 826300 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_19790 827453 827608 gene locus_tag LOCUS_19800 827453 827608 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975360.1 protein_id gnl|my_center|LOCUS_19800 827605 828084 gene locus_tag LOCUS_19810 827605 828084 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_19810 828125 828988 gene locus_tag LOCUS_19820 828125 828988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_19820 828985 829785 gene locus_tag LOCUS_19830 828985 829785 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_19830 830552 829875 gene locus_tag LOCUS_19840 830552 829875 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_19840 830852 831388 gene locus_tag LOCUS_19850 gene nth 830852 831388 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_19850 831385 832200 gene locus_tag LOCUS_19860 831385 832200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 832507 833697 gene locus_tag LOCUS_19870 832507 833697 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_19870 833974 833834 gene locus_tag LOCUS_19880 833974 833834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 834769 834035 gene locus_tag LOCUS_19890 834769 834035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 836104 835178 gene locus_tag LOCUS_19900 836104 835178 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_19900 836529 836101 gene locus_tag LOCUS_19910 836529 836101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 838740 836764 gene locus_tag LOCUS_19920 gene acs 838740 836764 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_19920 838987 839823 gene locus_tag LOCUS_19930 838987 839823 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_19930 841077 842129 gene locus_tag LOCUS_19940 841077 842129 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_19940 842126 843373 gene locus_tag LOCUS_19950 842126 843373 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897599.1 protein_id gnl|my_center|LOCUS_19950 843576 844313 gene locus_tag LOCUS_19960 843576 844313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 844359 845297 gene locus_tag LOCUS_19970 844359 845297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 845412 845624 gene locus_tag LOCUS_19980 845412 845624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 845621 846115 gene locus_tag LOCUS_19990 845621 846115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 846826 847134 gene locus_tag LOCUS_20000 846826 847134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 850202 848178 gene locus_tag LOCUS_20010 850202 848178 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_20010 850651 851001 gene locus_tag LOCUS_20020 gene bldG 850651 851001 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_20020 851004 851465 gene locus_tag LOCUS_20030 851004 851465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_20030 852148 854460 gene locus_tag LOCUS_20040 852148 854460 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_20040 854685 854461 gene locus_tag LOCUS_20050 854685 854461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 854669 855178 gene locus_tag LOCUS_20060 854669 855178 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_20060 856418 855198 gene locus_tag LOCUS_20070 gene serB 856418 855198 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_20070 857523 856753 gene locus_tag LOCUS_20080 857523 856753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_20080 857636 858424 gene locus_tag LOCUS_20090 857636 858424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284427.1 protein_id gnl|my_center|LOCUS_20090 858767 859522 gene locus_tag LOCUS_20100 858767 859522 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222221.1 protein_id gnl|my_center|LOCUS_20100 859554 859796 gene locus_tag LOCUS_20110 859554 859796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 860765 859842 gene locus_tag LOCUS_20120 860765 859842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 861541 860909 gene locus_tag LOCUS_20130 861541 860909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 861764 861528 gene locus_tag LOCUS_20140 861764 861528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 863232 863005 gene locus_tag LOCUS_20150 863232 863005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 863735 864592 gene locus_tag LOCUS_20160 863735 864592 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_20160 864641 864835 gene locus_tag LOCUS_20170 864641 864835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 864926 865129 gene locus_tag LOCUS_20180 864926 865129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 865330 865983 gene locus_tag LOCUS_20190 865330 865983 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_20190 866230 866703 gene locus_tag LOCUS_20200 866230 866703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 867523 866888 gene locus_tag LOCUS_20210 867523 866888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 870234 867637 gene locus_tag LOCUS_20220 gene clpB 870234 867637 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_20220 870601 870251 gene locus_tag LOCUS_20230 870601 870251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 871785 870625 gene locus_tag LOCUS_20240 gene dnaJ 871785 870625 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_20240 872644 871835 gene locus_tag LOCUS_20250 gene grpE 872644 871835 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_20250 874509 872641 gene locus_tag LOCUS_20260 gene dnaK 874509 872641 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_20260 875203 874718 gene locus_tag LOCUS_20270 875203 874718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 875383 876312 gene locus_tag LOCUS_20280 875383 876312 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_20280 876352 877119 gene locus_tag LOCUS_20290 gene proC 876352 877119 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_20290 877211 878374 gene locus_tag LOCUS_20300 877211 878374 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_20300 878435 879274 gene locus_tag LOCUS_20310 878435 879274 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_20310 879547 879798 gene locus_tag LOCUS_20320 879547 879798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 880261 880458 gene locus_tag LOCUS_20330 880261 880458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 880482 881507 gene locus_tag LOCUS_20340 880482 881507 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_20340 881504 882349 gene locus_tag LOCUS_20350 881504 882349 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_20350 882411 883577 gene locus_tag LOCUS_20360 882411 883577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 884520 883654 gene locus_tag LOCUS_20370 884520 883654 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878084.1 protein_id gnl|my_center|LOCUS_20370 885502 884609 gene locus_tag LOCUS_20380 885502 884609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 886212 885595 gene locus_tag LOCUS_20390 886212 885595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 886509 888107 gene locus_tag LOCUS_20400 886509 888107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 888401 888153 gene locus_tag LOCUS_20410 888401 888153 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_20410 888664 889638 gene locus_tag LOCUS_20420 888664 889638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 889827 891197 gene locus_tag LOCUS_20430 889827 891197 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061882.1 protein_id gnl|my_center|LOCUS_20430 891445 892368 gene locus_tag LOCUS_20440 gene hemC 891445 892368 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_20440 892383 893933 gene locus_tag LOCUS_20450 892383 893933 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_20450 894006 895028 gene locus_tag LOCUS_20460 gene hemB 894006 895028 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_20460 895079 895723 gene locus_tag LOCUS_20470 895079 895723 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_20470 895797 897098 gene locus_tag LOCUS_20480 gene hemL 895797 897098 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_20480 897421 897218 gene locus_tag LOCUS_20490 897421 897218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 897494 898462 gene locus_tag LOCUS_20500 897494 898462 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_20500 898537 899178 gene locus_tag LOCUS_20510 898537 899178 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_20510 899269 899856 gene locus_tag LOCUS_20520 899269 899856 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_20520 899843 900583 gene locus_tag LOCUS_20530 899843 900583 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_20530 900584 902320 gene locus_tag LOCUS_20540 900584 902320 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_20540 902325 903296 gene locus_tag LOCUS_20550 gene ccsB 902325 903296 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_20550 903770 903447 gene locus_tag LOCUS_20560 903770 903447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 904132 905124 gene locus_tag LOCUS_20570 904132 905124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 905135 905374 gene locus_tag LOCUS_20580 905135 905374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 906481 906242 gene locus_tag LOCUS_20590 906481 906242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 906723 906935 gene locus_tag LOCUS_20600 906723 906935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 908292 906943 gene locus_tag LOCUS_20610 908292 906943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 908416 909099 gene locus_tag LOCUS_20620 908416 909099 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402936.1 protein_id gnl|my_center|LOCUS_20620 909825 911072 gene locus_tag LOCUS_20630 909825 911072 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_20630 911128 911493 gene locus_tag LOCUS_20640 911128 911493 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_20640 911504 912058 gene locus_tag LOCUS_20650 911504 912058 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_20650 912055 912780 gene locus_tag LOCUS_20660 912055 912780 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 protein_id gnl|my_center|LOCUS_20660 912857 914185 gene locus_tag LOCUS_20670 912857 914185 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_20670 914182 914862 gene locus_tag LOCUS_20680 914182 914862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 914859 916154 gene locus_tag LOCUS_20690 gene nuoF 914859 916154 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080146.1 protein_id gnl|my_center|LOCUS_20690 916207 918618 gene locus_tag LOCUS_20700 916207 918618 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 protein_id gnl|my_center|LOCUS_20700 918615 919973 gene locus_tag LOCUS_20710 gene nuoH 918615 919973 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 protein_id gnl|my_center|LOCUS_20710 919960 920475 gene locus_tag LOCUS_20720 gene nuoI 919960 920475 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222460.1 protein_id gnl|my_center|LOCUS_20720 920468 921232 gene locus_tag LOCUS_20730 920468 921232 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 protein_id gnl|my_center|LOCUS_20730 921229 921525 gene locus_tag LOCUS_20740 gene nuoK 921229 921525 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_20740 921536 923443 gene locus_tag LOCUS_20750 gene nuoL 921536 923443 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_20750 923443 924987 gene locus_tag LOCUS_20760 923443 924987 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 protein_id gnl|my_center|LOCUS_20760 924984 926528 gene locus_tag LOCUS_20770 gene nuoN 924984 926528 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_20770 926547 927542 gene locus_tag LOCUS_20780 926547 927542 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_20780 928551 927625 gene locus_tag LOCUS_20790 gene rarD 928551 927625 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20790 928698 929360 gene locus_tag LOCUS_20800 gene msrA 928698 929360 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_20800 929814 929392 gene locus_tag LOCUS_20810 929814 929392 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 protein_id gnl|my_center|LOCUS_20810 929927 930862 gene locus_tag LOCUS_20820 929927 930862 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226717.1 protein_id gnl|my_center|LOCUS_20820 931336 930872 gene locus_tag LOCUS_20830 931336 930872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 931837 932697 gene locus_tag LOCUS_20840 931837 932697 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976427.1 protein_id gnl|my_center|LOCUS_20840 933234 934595 gene locus_tag LOCUS_20850 933234 934595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 935261 934638 gene locus_tag LOCUS_20860 935261 934638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 935517 935371 gene locus_tag LOCUS_20870 935517 935371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 935708 935514 gene locus_tag LOCUS_20880 935708 935514 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_20880 936428 936069 gene locus_tag LOCUS_20890 936428 936069 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_20890 938806 936425 gene locus_tag LOCUS_20900 938806 936425 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027618.1 protein_id gnl|my_center|LOCUS_20900 939160 940143 gene locus_tag LOCUS_20910 939160 940143 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_20910 942277 940688 gene locus_tag LOCUS_20920 942277 940688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 942479 942826 gene locus_tag LOCUS_20930 942479 942826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 943441 944895 gene locus_tag LOCUS_20940 943441 944895 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978484.1 protein_id gnl|my_center|LOCUS_20940 944897 945964 gene locus_tag LOCUS_20950 944897 945964 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_20950 946067 947053 gene locus_tag LOCUS_20960 gene rfbB 946067 947053 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_20960 947050 947928 gene locus_tag LOCUS_20970 gene rfbD 947050 947928 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_20970 948530 947931 gene locus_tag LOCUS_20980 948530 947931 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727714.1 protein_id gnl|my_center|LOCUS_20980 948414 948728 gene locus_tag LOCUS_20990 948414 948728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 948725 949966 gene locus_tag LOCUS_21000 948725 949966 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027081.1 protein_id gnl|my_center|LOCUS_21000 949963 950757 gene locus_tag LOCUS_21010 949963 950757 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978472.1 protein_id gnl|my_center|LOCUS_21010 950754 951449 gene locus_tag LOCUS_21020 950754 951449 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978471.1 protein_id gnl|my_center|LOCUS_21020 951453 952484 gene locus_tag LOCUS_21030 951453 952484 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978470.1 protein_id gnl|my_center|LOCUS_21030 952481 953800 gene locus_tag LOCUS_21040 952481 953800 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187744700.1 protein_id gnl|my_center|LOCUS_21040 953794 955017 gene locus_tag LOCUS_21050 953794 955017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 955010 956572 gene locus_tag LOCUS_21060 955010 956572 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845897.1 protein_id gnl|my_center|LOCUS_21060 956582 957472 gene locus_tag LOCUS_21070 956582 957472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 958680 957484 gene locus_tag LOCUS_21080 958680 957484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 958974 960056 gene locus_tag LOCUS_21090 958974 960056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 961056 960175 gene locus_tag LOCUS_21100 961056 960175 CDS product DUF6492 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061722.1 protein_id gnl|my_center|LOCUS_21100 961394 962173 gene locus_tag LOCUS_21110 961394 962173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 962170 963534 gene locus_tag LOCUS_21120 962170 963534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 963676 964338 gene locus_tag LOCUS_21130 963676 964338 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230956.1 protein_id gnl|my_center|LOCUS_21130 964335 965747 gene locus_tag LOCUS_21140 964335 965747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 967215 965755 gene locus_tag LOCUS_21150 967215 965755 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803913.1 protein_id gnl|my_center|LOCUS_21150 968528 967494 gene locus_tag LOCUS_21160 968528 967494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 969740 968829 gene locus_tag LOCUS_21170 969740 968829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 970310 969750 gene locus_tag LOCUS_21180 gene rfbC 970310 969750 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730941.1 protein_id gnl|my_center|LOCUS_21180 970569 971528 gene locus_tag LOCUS_21190 970569 971528 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 protein_id gnl|my_center|LOCUS_21190 972720 971455 gene locus_tag LOCUS_21200 972720 971455 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484336.1 protein_id gnl|my_center|LOCUS_21200 974050 972710 gene locus_tag LOCUS_21210 974050 972710 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027071.1 protein_id gnl|my_center|LOCUS_21210 975287 974073 gene locus_tag LOCUS_21220 975287 974073 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_21220 976245 975313 gene locus_tag LOCUS_21230 976245 975313 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730926.1 protein_id gnl|my_center|LOCUS_21230 977047 976382 gene locus_tag LOCUS_21240 977047 976382 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199864955.1 protein_id gnl|my_center|LOCUS_21240 978318 977380 gene locus_tag LOCUS_21250 978318 977380 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_21250 979619 978573 gene locus_tag LOCUS_21260 979619 978573 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_21260 981456 979612 gene locus_tag LOCUS_21270 981456 979612 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_21270 983476 982082 gene locus_tag LOCUS_21280 983476 982082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 983629 984159 gene locus_tag LOCUS_21290 983629 984159 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_21290 984149 984718 gene locus_tag LOCUS_21300 984149 984718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21300 985616 985005 gene locus_tag LOCUS_21310 985616 985005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 986344 987396 gene locus_tag LOCUS_21320 986344 987396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 987737 988591 gene locus_tag LOCUS_21330 gene htpX 987737 988591 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_21330 989188 988613 gene locus_tag LOCUS_21340 989188 988613 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977253.1 protein_id gnl|my_center|LOCUS_21340 990434 989946 gene locus_tag LOCUS_21350 990434 989946 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_21350 990581 990665 gene locus_tag LOCUS_t00250 990581 990665 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 992305 991058 gene locus_tag LOCUS_21360 992305 991058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 992886 993470 gene locus_tag LOCUS_21370 992886 993470 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989391.1 protein_id gnl|my_center|LOCUS_21370 993704 995590 gene locus_tag LOCUS_21380 993704 995590 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 protein_id gnl|my_center|LOCUS_21380 995727 996152 gene locus_tag LOCUS_21390 995727 996152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101257084.1 protein_id gnl|my_center|LOCUS_21390 997010 996198 gene locus_tag LOCUS_21400 997010 996198 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466552.1 protein_id gnl|my_center|LOCUS_21400 997276 997530 gene locus_tag LOCUS_21410 997276 997530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 997597 997672 gene locus_tag LOCUS_t00260 997597 997672 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 997843 997917 gene locus_tag LOCUS_t00270 997843 997917 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 998000 998164 gene locus_tag LOCUS_21420 gene rpmG 998000 998164 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005152047.1 protein_id gnl|my_center|LOCUS_21420 998383 998832 gene locus_tag LOCUS_21430 998383 998832 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_21430 998834 999262 gene locus_tag LOCUS_21440 998834 999262 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_21440 999353 1000411 gene locus_tag LOCUS_21450 999353 1000411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 1000431 1001498 gene locus_tag LOCUS_21460 1000431 1001498 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_21460 1001792 1002361 gene locus_tag LOCUS_21470 1001792 1002361 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896727.1 protein_id gnl|my_center|LOCUS_21470 1003143 1002472 gene locus_tag LOCUS_21480 1003143 1002472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21480 1003346 1005676 gene locus_tag LOCUS_21490 1003346 1005676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1006047 1006985 gene locus_tag LOCUS_21500 gene deoC 1006047 1006985 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_21500 1006996 1008429 gene locus_tag LOCUS_21510 1006996 1008429 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222793.1 protein_id gnl|my_center|LOCUS_21510 1008416 1008634 gene locus_tag LOCUS_21520 1008416 1008634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1008739 1009605 gene locus_tag LOCUS_21530 1008739 1009605 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_21530 1009921 1009703 gene locus_tag LOCUS_21540 1009921 1009703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1012633 1010360 gene locus_tag LOCUS_21550 1012633 1010360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1013881 1013171 gene locus_tag LOCUS_21560 1013881 1013171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963611.1 protein_id gnl|my_center|LOCUS_21560 1014724 1013882 gene locus_tag LOCUS_21570 1014724 1013882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1015676 1016221 gene locus_tag LOCUS_21580 1015676 1016221 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029464.1 protein_id gnl|my_center|LOCUS_21580 1016208 1016438 gene locus_tag LOCUS_21590 1016208 1016438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1016393 1017139 gene locus_tag LOCUS_21600 1016393 1017139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 1018022 1017507 gene locus_tag LOCUS_21610 1018022 1017507 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535734.1 protein_id gnl|my_center|LOCUS_21610 1018440 1020608 gene locus_tag LOCUS_21620 1018440 1020608 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_21620 1021365 1020928 gene locus_tag LOCUS_21630 1021365 1020928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1022090 1021683 gene locus_tag LOCUS_21640 1022090 1021683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1023914 1022286 gene locus_tag LOCUS_21650 1023914 1022286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1025393 1024272 gene locus_tag LOCUS_21660 1025393 1024272 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191120.1 protein_id gnl|my_center|LOCUS_21660 1026623 1025565 gene locus_tag LOCUS_21670 1026623 1025565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838152.1 protein_id gnl|my_center|LOCUS_21670 1026845 1027762 gene locus_tag LOCUS_21680 1026845 1027762 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227980.1 protein_id gnl|my_center|LOCUS_21680 1030388 1027770 gene locus_tag LOCUS_21690 gene clpB 1030388 1027770 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_21690 1030771 1030391 gene locus_tag LOCUS_21700 1030771 1030391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1031709 1030768 gene locus_tag LOCUS_21710 1031709 1030768 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_21710 1032453 1031725 gene locus_tag LOCUS_21720 1032453 1031725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1034404 1032506 gene locus_tag LOCUS_21730 gene dnaK 1034404 1032506 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_21730 1035045 1034569 gene locus_tag LOCUS_21740 1035045 1034569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286307.1 protein_id gnl|my_center|LOCUS_21740 1035585 1035127 gene locus_tag LOCUS_21750 1035585 1035127 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_21750 1035930 1038899 gene locus_tag LOCUS_21760 1035930 1038899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1039016 1038810 gene locus_tag LOCUS_21770 1039016 1038810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1039245 1039536 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcctcatcgcccctgagagggg 1040996 1039686 gene locus_tag LOCUS_21780 1040996 1039686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1040907 1041104 gene locus_tag LOCUS_21790 1040907 1041104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1042570 1041278 gene locus_tag LOCUS_21800 1042570 1041278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1043659 1042814 gene locus_tag LOCUS_21810 1043659 1042814 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776276.1 protein_id gnl|my_center|LOCUS_21810 1045169 1043679 gene locus_tag LOCUS_21820 1045169 1043679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1046237 1045200 gene locus_tag LOCUS_21830 1046237 1045200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1047543 1046251 gene locus_tag LOCUS_21840 1047543 1046251 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_21840 1048641 1047634 gene locus_tag LOCUS_21850 1048641 1047634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21850 1050683 1048641 gene locus_tag LOCUS_21860 1050683 1048641 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014868643.1 protein_id gnl|my_center|LOCUS_21860 1050580 1050918 gene locus_tag LOCUS_21870 1050580 1050918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1052314 1051088 gene locus_tag LOCUS_21880 1052314 1051088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_21880 1052944 1053492 gene locus_tag LOCUS_21890 1052944 1053492 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_21890 1053703 1054596 gene locus_tag LOCUS_21900 1053703 1054596 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029030.1 protein_id gnl|my_center|LOCUS_21900 1054745 1055278 gene locus_tag LOCUS_21910 1054745 1055278 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224353.1 protein_id gnl|my_center|LOCUS_21910 1056063 1055419 gene locus_tag LOCUS_21920 gene lipB 1056063 1055419 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618236.1 protein_id gnl|my_center|LOCUS_21920 1056486 1056265 gene locus_tag LOCUS_21930 1056486 1056265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1057068 1056541 gene locus_tag LOCUS_21940 1057068 1056541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484326.1 protein_id gnl|my_center|LOCUS_21940 1057389 1057958 gene locus_tag LOCUS_21950 1057389 1057958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 1058482 1059309 gene locus_tag LOCUS_21960 1058482 1059309 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977503.1 protein_id gnl|my_center|LOCUS_21960 1059480 1060394 gene locus_tag LOCUS_21970 1059480 1060394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1060610 1061764 gene locus_tag LOCUS_21980 1060610 1061764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 1062072 1062512 gene locus_tag LOCUS_21990 1062072 1062512 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227629.1 protein_id gnl|my_center|LOCUS_21990 1062739 1063080 gene locus_tag LOCUS_22000 1062739 1063080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 1063243 1063554 gene locus_tag LOCUS_22010 1063243 1063554 CDS product EthD family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083228.1 protein_id gnl|my_center|LOCUS_22010 1063730 1064797 gene locus_tag LOCUS_22020 1063730 1064797 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_22020 1064857 1065720 gene locus_tag LOCUS_22030 1064857 1065720 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223929.1 protein_id gnl|my_center|LOCUS_22030 1065760 1066245 gene locus_tag LOCUS_22040 1065760 1066245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1067292 1066249 gene locus_tag LOCUS_22050 gene desE 1067292 1066249 CDS product siderophore-binding protein DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976020.1 protein_id gnl|my_center|LOCUS_22050 1067420 1068472 gene locus_tag LOCUS_22060 1067420 1068472 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_22060 1068525 1069550 gene locus_tag LOCUS_22070 1068525 1069550 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_22070 1069636 1069968 gene locus_tag LOCUS_22080 1069636 1069968 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327415.1 protein_id gnl|my_center|LOCUS_22080 1069982 1070464 gene locus_tag LOCUS_22090 1069982 1070464 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973265.1 protein_id gnl|my_center|LOCUS_22090 1070875 1070552 gene locus_tag LOCUS_22100 1070875 1070552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1071558 1070911 gene locus_tag LOCUS_22110 1071558 1070911 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448628.1 protein_id gnl|my_center|LOCUS_22110 1071749 1071564 gene locus_tag LOCUS_22120 1071749 1071564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1072142 1071942 gene locus_tag LOCUS_22130 1072142 1071942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1072736 1072428 gene locus_tag LOCUS_22140 1072736 1072428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1073095 1072691 gene locus_tag LOCUS_22150 1073095 1072691 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864910.1 protein_id gnl|my_center|LOCUS_22150 1073376 1074344 gene locus_tag LOCUS_22160 1073376 1074344 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029602.1 protein_id gnl|my_center|LOCUS_22160 1074344 1075189 gene locus_tag LOCUS_22170 1074344 1075189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_22170 1078314 1075171 gene locus_tag LOCUS_22180 1078314 1075171 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485318.1 protein_id gnl|my_center|LOCUS_22180 1078515 1078898 gene locus_tag LOCUS_22190 1078515 1078898 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 protein_id gnl|my_center|LOCUS_22190 1079012 1079626 gene locus_tag LOCUS_22200 1079012 1079626 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 protein_id gnl|my_center|LOCUS_22200 1079827 1079754 gene locus_tag LOCUS_t00280 1079827 1079754 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1080128 1080703 gene locus_tag LOCUS_22210 gene dcd 1080128 1080703 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_22210 1080909 1081526 gene locus_tag LOCUS_22220 1080909 1081526 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_22220 1081527 1082525 gene locus_tag LOCUS_22230 gene pitH 1081527 1082525 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_22230 1083444 1082554 gene locus_tag LOCUS_22240 gene mshD 1083444 1082554 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_22240 1084331 1083609 gene locus_tag LOCUS_22250 gene glnR 1084331 1083609 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_22250 1084606 1084854 gene locus_tag LOCUS_22260 1084606 1084854 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_22260 1085063 1085740 gene locus_tag LOCUS_22270 1085063 1085740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 1086008 1085730 gene locus_tag LOCUS_22280 1086008 1085730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 1085901 1086293 gene locus_tag LOCUS_22290 1085901 1086293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1086290 1087048 gene locus_tag LOCUS_22300 gene rsuA 1086290 1087048 CDS product anti-sigma U factor RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975858.1 protein_id gnl|my_center|LOCUS_22300 1087501 1087866 gene locus_tag LOCUS_22310 1087501 1087866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1087878 1088717 gene locus_tag LOCUS_22320 1087878 1088717 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_22320 1088714 1089016 gene locus_tag LOCUS_22330 1088714 1089016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1089243 1090685 gene locus_tag LOCUS_22340 1089243 1090685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1091235 1090840 gene locus_tag LOCUS_22350 1091235 1090840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 1091356 1092759 gene locus_tag LOCUS_22360 1091356 1092759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110852.1 protein_id gnl|my_center|LOCUS_22360 1093752 1092796 gene locus_tag LOCUS_22370 1093752 1092796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1094822 1093749 gene locus_tag LOCUS_22380 1094822 1093749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1095427 1094819 gene locus_tag LOCUS_22390 1095427 1094819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 1095662 1097026 gene locus_tag LOCUS_22400 1095662 1097026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110852.1 protein_id gnl|my_center|LOCUS_22400 1097823 1096981 gene locus_tag LOCUS_22410 1097823 1096981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1100512 1099562 gene locus_tag LOCUS_22420 1100512 1099562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1101174 1100509 gene locus_tag LOCUS_22430 1101174 1100509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1101411 1103402 gene locus_tag LOCUS_22440 1101411 1103402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1103494 1106595 gene locus_tag LOCUS_22450 1103494 1106595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1106653 1107882 gene locus_tag LOCUS_22460 1106653 1107882 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_22460 1107872 1108582 gene locus_tag LOCUS_22470 1107872 1108582 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_22470 1109109 1108885 gene locus_tag LOCUS_22480 1109109 1108885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1109997 1109140 gene locus_tag LOCUS_22490 1109997 1109140 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_22490 1110290 1111009 gene locus_tag LOCUS_22500 1110290 1111009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 1111394 1111032 gene locus_tag LOCUS_22510 1111394 1111032 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_22510 1112153 1111404 gene locus_tag LOCUS_22520 1112153 1111404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 1112319 1112825 gene locus_tag LOCUS_22530 1112319 1112825 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_22530 1113279 1113728 gene locus_tag LOCUS_22540 1113279 1113728 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_22540 1113821 1114813 gene locus_tag LOCUS_22550 1113821 1114813 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_22550 1115306 1114872 gene locus_tag LOCUS_22560 gene dtd 1115306 1114872 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_22560 1115449 1116396 gene locus_tag LOCUS_22570 1115449 1116396 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_22570 1118106 1116409 gene locus_tag LOCUS_22580 1118106 1116409 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223053.1 protein_id gnl|my_center|LOCUS_22580 1119000 1118284 gene locus_tag LOCUS_22590 gene alaXM 1119000 1118284 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846184.1 protein_id gnl|my_center|LOCUS_22590 1119393 1119070 gene locus_tag LOCUS_22600 1119393 1119070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1119376 1119567 gene locus_tag LOCUS_22610 1119376 1119567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1120115 1119654 gene locus_tag LOCUS_22620 1120115 1119654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1120673 1120119 gene locus_tag LOCUS_22630 1120673 1120119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 1121654 1120737 gene locus_tag LOCUS_22640 1121654 1120737 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 protein_id gnl|my_center|LOCUS_22640 1122007 1121651 gene locus_tag LOCUS_22650 1122007 1121651 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895085.1 protein_id gnl|my_center|LOCUS_22650 1122568 1122158 gene locus_tag LOCUS_22660 1122568 1122158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1122928 1123440 gene locus_tag LOCUS_22670 1122928 1123440 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_22670 1124310 1123450 gene locus_tag LOCUS_22680 1124310 1123450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_22680 1125128 1124361 gene locus_tag LOCUS_22690 1125128 1124361 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031214.1 protein_id gnl|my_center|LOCUS_22690 1125388 1126680 gene locus_tag LOCUS_22700 gene mshA 1125388 1126680 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_22700 1126677 1127312 gene locus_tag LOCUS_22710 1126677 1127312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 1127378 1128121 gene locus_tag LOCUS_22720 1127378 1128121 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_22720 1128890 1128231 gene locus_tag LOCUS_22730 gene phoU 1128890 1128231 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_22730 1129182 1130354 gene locus_tag LOCUS_22740 1129182 1130354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_22740 1130504 1131196 gene locus_tag LOCUS_22750 1130504 1131196 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_22750 1132424 1131792 gene locus_tag LOCUS_22760 1132424 1131792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 1132687 1133175 gene locus_tag LOCUS_22770 1132687 1133175 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559016.1 protein_id gnl|my_center|LOCUS_22770 1133169 1133699 gene locus_tag LOCUS_22780 gene ispF 1133169 1133699 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_22780 1134423 1134701 gene locus_tag LOCUS_22790 1134423 1134701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1136476 1134803 gene locus_tag LOCUS_22800 1136476 1134803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1136799 1138034 gene locus_tag LOCUS_22810 gene cysS 1136799 1138034 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_22810 1138589 1138182 gene locus_tag LOCUS_22820 1138589 1138182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1139488 1138589 gene locus_tag LOCUS_22830 1139488 1138589 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_22830 1140089 1140961 gene locus_tag LOCUS_22840 1140089 1140961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1140975 1141451 gene locus_tag LOCUS_22850 1140975 1141451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_22850 1142000 1141848 gene locus_tag LOCUS_22860 1142000 1141848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1142431 1143180 gene locus_tag LOCUS_22870 1142431 1143180 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 protein_id gnl|my_center|LOCUS_22870 1143211 1143387 gene locus_tag LOCUS_22880 1143211 1143387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1143535 1144479 gene locus_tag LOCUS_22890 gene rlmB 1143535 1144479 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_22890 1144538 1144611 gene locus_tag LOCUS_t00290 1144538 1144611 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1145248 1144823 gene locus_tag LOCUS_22900 1145248 1144823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1145762 1147090 gene locus_tag LOCUS_22910 1145762 1147090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1147642 1147394 gene locus_tag LOCUS_22920 1147642 1147394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1148310 1147819 gene locus_tag LOCUS_22930 1148310 1147819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1148644 1149195 gene locus_tag LOCUS_22940 1148644 1149195 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973087.1 protein_id gnl|my_center|LOCUS_22940 1149224 1150465 gene locus_tag LOCUS_22950 1149224 1150465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 1151289 1150624 gene locus_tag LOCUS_22960 1151289 1150624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 1151837 1151382 gene locus_tag LOCUS_22970 1151837 1151382 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326890.1 protein_id gnl|my_center|LOCUS_22970 1154521 1152518 gene locus_tag LOCUS_22980 1154521 1152518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 1155300 1154857 gene locus_tag LOCUS_22990 1155300 1154857 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222796.1 protein_id gnl|my_center|LOCUS_22990 1156263 1155886 gene locus_tag LOCUS_23000 1156263 1155886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1159864 1156817 gene locus_tag LOCUS_23010 1159864 1156817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 1160148 1161119 gene locus_tag LOCUS_23020 1160148 1161119 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_23020 1161370 1162428 gene locus_tag LOCUS_23030 1161370 1162428 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_23030 1162428 1163192 gene locus_tag LOCUS_23040 gene cbiQ 1162428 1163192 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_23040 1163240 1164040 gene locus_tag LOCUS_23050 1163240 1164040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_23050 1164078 1164416 gene locus_tag LOCUS_23060 1164078 1164416 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_23060 1164623 1165396 gene locus_tag LOCUS_23070 1164623 1165396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063198.1 protein_id gnl|my_center|LOCUS_23070 1165514 1166278 gene locus_tag LOCUS_23080 1165514 1166278 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808209.1 protein_id gnl|my_center|LOCUS_23080 1166441 1167106 gene locus_tag LOCUS_23090 1166441 1167106 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_23090 1168335 1167220 gene locus_tag LOCUS_23100 gene serC 1168335 1167220 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_23100 1169797 1168694 gene locus_tag LOCUS_23110 1169797 1168694 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_23110 1170081 1170728 gene locus_tag LOCUS_23120 gene pdxH 1170081 1170728 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_23120 1170838 1172130 gene locus_tag LOCUS_23130 1170838 1172130 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742199.1 protein_id gnl|my_center|LOCUS_23130 1172463 1173179 gene locus_tag LOCUS_23140 1172463 1173179 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081890.1 protein_id gnl|my_center|LOCUS_23140 1173309 1175543 gene locus_tag LOCUS_23150 1173309 1175543 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161102907.1 protein_id gnl|my_center|LOCUS_23150 1175756 1175589 gene locus_tag LOCUS_23160 1175756 1175589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1177120 1175975 gene locus_tag LOCUS_23170 1177120 1175975 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_23170 1177305 1178798 gene locus_tag LOCUS_23180 1177305 1178798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1178814 1179632 gene locus_tag LOCUS_23190 1178814 1179632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1179865 1180818 gene locus_tag LOCUS_23200 1179865 1180818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 1180837 1181724 gene locus_tag LOCUS_23210 1180837 1181724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1181954 1183087 gene locus_tag LOCUS_23220 1181954 1183087 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897409.1 protein_id gnl|my_center|LOCUS_23220 1183415 1184275 gene locus_tag LOCUS_23230 1183415 1184275 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_23230 1186233 1184368 gene locus_tag LOCUS_23240 1186233 1184368 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_23240 1187133 1186399 gene locus_tag LOCUS_23250 1187133 1186399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1187286 1188302 gene locus_tag LOCUS_23260 1187286 1188302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 1188451 1190487 gene locus_tag LOCUS_23270 1188451 1190487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_23270 1191559 1190507 gene locus_tag LOCUS_23280 1191559 1190507 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_23280 1192969 1191764 gene locus_tag LOCUS_23290 1192969 1191764 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_23290 1193201 1193274 gene locus_tag LOCUS_t00300 1193201 1193274 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1193353 1193601 gene locus_tag LOCUS_23300 gene secE 1193353 1193601 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_23300 1193664 1194446 gene locus_tag LOCUS_23310 gene nusG 1193664 1194446 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 protein_id gnl|my_center|LOCUS_23310 1194835 1195266 gene locus_tag LOCUS_23320 gene rplK 1194835 1195266 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_23320 1195426 1196145 gene locus_tag LOCUS_23330 gene rplA 1195426 1196145 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_23330 1196596 1197120 gene locus_tag LOCUS_23340 gene rplJ 1196596 1197120 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_23340 1197232 1197624 gene locus_tag LOCUS_23350 gene rplL 1197232 1197624 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_23350 1197940 1198440 gene locus_tag LOCUS_23360 1197940 1198440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 1198437 1199339 gene locus_tag LOCUS_23370 1198437 1199339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence003 306 1583 gene locus_tag LOCUS_23380 306 1583 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_23380 1701 2063 gene locus_tag LOCUS_23390 1701 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2075 3775 gene locus_tag LOCUS_23400 2075 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 3951 4361 gene locus_tag LOCUS_23410 gene ndk 3951 4361 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060204.1 protein_id gnl|my_center|LOCUS_23410 4617 5648 gene locus_tag LOCUS_23420 4617 5648 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_23420 5648 6661 gene locus_tag LOCUS_23430 gene mreC 5648 6661 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_23430 6654 7178 gene locus_tag LOCUS_23440 6654 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 7175 9226 gene locus_tag LOCUS_23450 gene mrdA 7175 9226 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_23450 9223 10389 gene locus_tag LOCUS_23460 gene rodA 9223 10389 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_23460 10548 10805 gene locus_tag LOCUS_23470 10548 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 11130 12578 gene locus_tag LOCUS_23480 11130 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 12575 13474 gene locus_tag LOCUS_23490 12575 13474 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222042.1 protein_id gnl|my_center|LOCUS_23490 13560 13739 gene locus_tag LOCUS_23500 13560 13739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 13841 15763 gene locus_tag LOCUS_23510 13841 15763 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_23510 15940 16713 gene locus_tag LOCUS_23520 15940 16713 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_23520 16818 19709 gene locus_tag LOCUS_23530 16818 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23530 19979 20293 gene locus_tag LOCUS_23540 gene rplU 19979 20293 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412578.1 protein_id gnl|my_center|LOCUS_23540 20471 20734 gene locus_tag LOCUS_23550 gene rpmA 20471 20734 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_23550 20870 22225 gene locus_tag LOCUS_23560 gene obgE 20870 22225 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_23560 22389 23513 gene locus_tag LOCUS_23570 gene proB 22389 23513 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_23570 23524 24849 gene locus_tag LOCUS_23580 23524 24849 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_23580 24948 26600 gene locus_tag LOCUS_23590 24948 26600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 27596 26676 gene locus_tag LOCUS_23600 27596 26676 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23600 27919 28530 gene locus_tag LOCUS_23610 gene nadD 27919 28530 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_23610 28648 29055 gene locus_tag LOCUS_23620 gene rsfS 28648 29055 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_23620 29052 29687 gene locus_tag LOCUS_23630 29052 29687 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_23630 30284 31387 gene locus_tag LOCUS_23640 30284 31387 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894734.1 protein_id gnl|my_center|LOCUS_23640 31430 32431 gene locus_tag LOCUS_23650 gene selD 31430 32431 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727954.1 protein_id gnl|my_center|LOCUS_23650 34734 32602 gene locus_tag LOCUS_23660 gene recQ 34734 32602 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224869.1 protein_id gnl|my_center|LOCUS_23660 34931 36190 gene locus_tag LOCUS_23670 34931 36190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 36220 36969 gene locus_tag LOCUS_23680 36220 36969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 37047 37409 gene locus_tag LOCUS_23690 37047 37409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222284.1 protein_id gnl|my_center|LOCUS_23690 37412 37867 gene locus_tag LOCUS_23700 37412 37867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 38010 38918 gene locus_tag LOCUS_23710 38010 38918 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_23710 38908 39684 gene locus_tag LOCUS_23720 38908 39684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 40670 40131 gene locus_tag LOCUS_23730 40670 40131 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_23730 41679 40684 gene locus_tag LOCUS_23740 41679 40684 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976404.1 protein_id gnl|my_center|LOCUS_23740 42401 41829 gene locus_tag LOCUS_23750 42401 41829 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229034.1 protein_id gnl|my_center|LOCUS_23750 43371 42511 gene locus_tag LOCUS_23760 43371 42511 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028354.1 protein_id gnl|my_center|LOCUS_23760 43274 43522 gene locus_tag LOCUS_23770 43274 43522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 43647 45128 gene locus_tag LOCUS_23780 43647 45128 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976375.1 protein_id gnl|my_center|LOCUS_23780 46313 45138 gene locus_tag LOCUS_23790 46313 45138 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974708.1 protein_id gnl|my_center|LOCUS_23790 47254 46310 gene locus_tag LOCUS_23800 47254 46310 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_23800 47359 47432 gene locus_tag LOCUS_t00310 47359 47432 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 47457 47657 gene locus_tag LOCUS_23810 47457 47657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 47952 48395 gene locus_tag LOCUS_23820 47952 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 49859 48561 gene locus_tag LOCUS_23830 49859 48561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 50804 50166 gene locus_tag LOCUS_23840 50804 50166 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485986.1 protein_id gnl|my_center|LOCUS_23840 51981 50809 gene locus_tag LOCUS_23850 51981 50809 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_23850 52144 52857 gene locus_tag LOCUS_23860 52144 52857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 52854 53639 gene locus_tag LOCUS_23870 52854 53639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 54847 53726 gene locus_tag LOCUS_23880 gene menC 54847 53726 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225317.1 protein_id gnl|my_center|LOCUS_23880 55628 54858 gene locus_tag LOCUS_23890 55628 54858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225316.1 protein_id gnl|my_center|LOCUS_23890 56152 55961 gene locus_tag LOCUS_23900 56152 55961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 56607 56149 gene locus_tag LOCUS_23910 56607 56149 CDS product MSMEG_6728 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971750.1 protein_id gnl|my_center|LOCUS_23910 58554 56785 gene locus_tag LOCUS_23920 58554 56785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226966.1 protein_id gnl|my_center|LOCUS_23920 58897 59580 gene locus_tag LOCUS_23930 58897 59580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 59586 59924 gene locus_tag LOCUS_23940 59586 59924 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596149.1 protein_id gnl|my_center|LOCUS_23940 59921 60667 gene locus_tag LOCUS_23950 59921 60667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 61379 60681 gene locus_tag LOCUS_23960 gene sfp 61379 60681 CDS product 4'-phosphopantetheinyl transferase Sfp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573004.1 protein_id gnl|my_center|LOCUS_23960 61513 62310 gene locus_tag LOCUS_23970 61513 62310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 62440 62513 gene locus_tag LOCUS_t00320 62440 62513 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 63121 66009 gene locus_tag LOCUS_23980 63121 66009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 65990 66415 gene locus_tag LOCUS_23990 65990 66415 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977672.1 protein_id gnl|my_center|LOCUS_23990 66412 66762 gene locus_tag LOCUS_24000 66412 66762 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977673.1 protein_id gnl|my_center|LOCUS_24000 66743 67348 gene locus_tag LOCUS_24010 66743 67348 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027617.1 protein_id gnl|my_center|LOCUS_24010 67720 69465 gene locus_tag LOCUS_24020 67720 69465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_24020 69462 71369 gene locus_tag LOCUS_24030 69462 71369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_24030 71459 72547 gene locus_tag LOCUS_24040 71459 72547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 72624 73220 gene locus_tag LOCUS_24050 72624 73220 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_24050 73319 74146 gene locus_tag LOCUS_24060 73319 74146 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_24060 74281 75393 gene locus_tag LOCUS_24070 74281 75393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 75690 75553 gene locus_tag LOCUS_24080 75690 75553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 76489 76145 gene locus_tag LOCUS_24090 76489 76145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466777.1 protein_id gnl|my_center|LOCUS_24090 76663 77253 gene locus_tag LOCUS_24100 76663 77253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 78866 77340 gene locus_tag LOCUS_24110 78866 77340 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877353.1 protein_id gnl|my_center|LOCUS_24110 79408 79034 gene locus_tag LOCUS_24120 79408 79034 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222011.1 protein_id gnl|my_center|LOCUS_24120 81158 79716 gene locus_tag LOCUS_24130 81158 79716 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_24130 81637 83244 gene locus_tag LOCUS_24140 81637 83244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 83581 83342 gene locus_tag LOCUS_24150 83581 83342 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_24150 84486 83953 gene locus_tag LOCUS_24160 84486 83953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 85814 84672 gene locus_tag LOCUS_24170 85814 84672 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224352.1 protein_id gnl|my_center|LOCUS_24170 86168 87574 gene locus_tag LOCUS_24180 86168 87574 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226360.1 protein_id gnl|my_center|LOCUS_24180 87588 88850 gene locus_tag LOCUS_24190 87588 88850 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226359.1 protein_id gnl|my_center|LOCUS_24190 90533 88971 gene locus_tag LOCUS_24200 90533 88971 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_24200 92568 91006 gene locus_tag LOCUS_24210 92568 91006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 93062 95521 gene locus_tag LOCUS_24220 gene leuS 93062 95521 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_24220 96399 95689 gene locus_tag LOCUS_24230 gene lexA 96399 95689 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_24230 96639 97361 gene locus_tag LOCUS_24240 96639 97361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 98058 97894 gene locus_tag LOCUS_24250 98058 97894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 98003 98335 gene locus_tag LOCUS_24260 98003 98335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 98485 101343 gene locus_tag LOCUS_24270 98485 101343 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_24270 101470 101622 gene locus_tag LOCUS_24280 101470 101622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 101935 102336 gene locus_tag LOCUS_24290 101935 102336 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229383.1 protein_id gnl|my_center|LOCUS_24290 102828 102346 gene locus_tag LOCUS_24300 102828 102346 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114472.1 protein_id gnl|my_center|LOCUS_24300 102876 103502 gene locus_tag LOCUS_24310 102876 103502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 105173 103533 gene locus_tag LOCUS_24320 105173 103533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 105718 105407 gene locus_tag LOCUS_24330 105718 105407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 105693 105968 gene locus_tag LOCUS_24340 105693 105968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 106143 106445 gene locus_tag LOCUS_24350 106143 106445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 106687 106517 gene locus_tag LOCUS_24360 106687 106517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 107117 107956 gene locus_tag LOCUS_24370 107117 107956 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727715.1 protein_id gnl|my_center|LOCUS_24370 108376 108621 gene locus_tag LOCUS_24380 108376 108621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_24380 109174 110478 gene locus_tag LOCUS_24390 109174 110478 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_24390 111344 110562 gene locus_tag LOCUS_24400 111344 110562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 111785 113626 gene locus_tag LOCUS_24410 111785 113626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 114233 116581 gene locus_tag LOCUS_24420 114233 116581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 117844 116585 gene locus_tag LOCUS_24430 117844 116585 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258369.1 protein_id gnl|my_center|LOCUS_24430 118187 119938 gene locus_tag LOCUS_24440 118187 119938 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051713212.1 protein_id gnl|my_center|LOCUS_24440 120863 119967 gene locus_tag LOCUS_24450 120863 119967 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046421936.1 protein_id gnl|my_center|LOCUS_24450 121496 120864 gene locus_tag LOCUS_24460 121496 120864 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230112.1 protein_id gnl|my_center|LOCUS_24460 122274 121519 gene locus_tag LOCUS_24470 122274 121519 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 protein_id gnl|my_center|LOCUS_24470 124031 122430 gene locus_tag LOCUS_24480 124031 122430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 124412 124990 gene locus_tag LOCUS_24490 124412 124990 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_24490 125182 127266 gene locus_tag LOCUS_24500 125182 127266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 127474 129207 gene locus_tag LOCUS_24510 127474 129207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 130315 130088 gene locus_tag LOCUS_24520 130315 130088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 130620 132713 gene locus_tag LOCUS_24530 130620 132713 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_24530 132818 133537 gene locus_tag LOCUS_24540 132818 133537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 134230 133658 gene locus_tag LOCUS_24550 134230 133658 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_24550 136924 134390 gene locus_tag LOCUS_24560 136924 134390 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_24560 138011 137118 gene locus_tag LOCUS_24570 138011 137118 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466843.1 protein_id gnl|my_center|LOCUS_24570 138204 140861 gene locus_tag LOCUS_24580 138204 140861 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_24580 140984 141574 gene locus_tag LOCUS_24590 140984 141574 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_24590 141584 142726 gene locus_tag LOCUS_24600 141584 142726 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_24600 142723 143535 gene locus_tag LOCUS_24610 142723 143535 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224290.1 protein_id gnl|my_center|LOCUS_24610 146286 143557 gene locus_tag LOCUS_24620 146286 143557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 146840 146367 gene locus_tag LOCUS_24630 146840 146367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 147370 146837 gene locus_tag LOCUS_24640 147370 146837 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854968.1 protein_id gnl|my_center|LOCUS_24640 147699 148193 gene locus_tag LOCUS_24650 147699 148193 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_24650 148298 148621 gene locus_tag LOCUS_24660 148298 148621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 150156 148723 gene locus_tag LOCUS_24670 150156 148723 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060587.1 protein_id gnl|my_center|LOCUS_24670 151570 150338 gene locus_tag LOCUS_24680 151570 150338 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_24680 151975 151736 gene locus_tag LOCUS_24690 151975 151736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 152988 152032 gene locus_tag LOCUS_24700 152988 152032 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_24700 153938 152985 gene locus_tag LOCUS_24710 153938 152985 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_24710 155283 154120 gene locus_tag LOCUS_24720 gene fasR 155283 154120 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_24720 155879 155352 gene locus_tag LOCUS_24730 155879 155352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 157052 155898 gene locus_tag LOCUS_24740 157052 155898 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222139.1 protein_id gnl|my_center|LOCUS_24740 157486 157145 gene locus_tag LOCUS_24750 157486 157145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 157380 157685 gene locus_tag LOCUS_24760 157380 157685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 157706 158335 gene locus_tag LOCUS_24770 157706 158335 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_24770 158307 158519 gene locus_tag LOCUS_24780 158307 158519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 161194 158438 gene locus_tag LOCUS_24790 gene aceE 161194 158438 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_24790 161604 161798 gene locus_tag LOCUS_24800 161604 161798 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285998.1 protein_id gnl|my_center|LOCUS_24800 161862 162224 gene locus_tag LOCUS_24810 161862 162224 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_24810 162383 162811 gene locus_tag LOCUS_24820 162383 162811 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224000.1 protein_id gnl|my_center|LOCUS_24820 162956 163414 gene locus_tag LOCUS_24830 162956 163414 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_24830 163454 163786 gene locus_tag LOCUS_24840 163454 163786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 163915 163989 gene locus_tag LOCUS_t00330 163915 163989 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 165382 164351 gene locus_tag LOCUS_24850 165382 164351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222703.1 protein_id gnl|my_center|LOCUS_24850 165656 166768 gene locus_tag LOCUS_24860 165656 166768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 167113 166904 gene locus_tag LOCUS_24870 167113 166904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 167219 167722 gene locus_tag LOCUS_24880 167219 167722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 167709 168131 gene locus_tag LOCUS_24890 167709 168131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 169004 169627 gene locus_tag LOCUS_24900 169004 169627 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 protein_id gnl|my_center|LOCUS_24900 169635 170597 gene locus_tag LOCUS_24910 169635 170597 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027138.1 protein_id gnl|my_center|LOCUS_24910 170968 170576 gene locus_tag LOCUS_24920 170968 170576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 171806 171093 gene locus_tag LOCUS_24930 171806 171093 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227864.1 protein_id gnl|my_center|LOCUS_24930 173410 171803 gene locus_tag LOCUS_24940 173410 171803 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227865.1 protein_id gnl|my_center|LOCUS_24940 173545 174933 gene locus_tag LOCUS_24950 173545 174933 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_24950 175960 174962 gene locus_tag LOCUS_24960 175960 174962 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 protein_id gnl|my_center|LOCUS_24960 176166 176888 gene locus_tag LOCUS_24970 176166 176888 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226433.1 protein_id gnl|my_center|LOCUS_24970 176885 178054 gene locus_tag LOCUS_24980 176885 178054 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229913.1 protein_id gnl|my_center|LOCUS_24980 178531 180639 gene locus_tag LOCUS_24990 178531 180639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229912.1 protein_id gnl|my_center|LOCUS_24990 181670 180729 gene locus_tag LOCUS_25000 181670 180729 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_25000 181879 183576 gene locus_tag LOCUS_25010 181879 183576 CDS product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528172.1 protein_id gnl|my_center|LOCUS_25010 184357 183626 gene locus_tag LOCUS_25020 184357 183626 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_25020 184555 188424 gene locus_tag LOCUS_25030 gene hrpA 184555 188424 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_25030 189168 188491 gene locus_tag LOCUS_25040 189168 188491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 189948 189274 gene locus_tag LOCUS_25050 189948 189274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 190174 190692 gene locus_tag LOCUS_25060 190174 190692 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026075.1 protein_id gnl|my_center|LOCUS_25060 190962 193529 gene locus_tag LOCUS_25070 190962 193529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 194740 193643 gene locus_tag LOCUS_25080 194740 193643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 196369 195455 gene locus_tag LOCUS_25090 196369 195455 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_25090 196991 197926 gene locus_tag LOCUS_25100 196991 197926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 200076 197968 gene locus_tag LOCUS_25110 200076 197968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325800.1 protein_id gnl|my_center|LOCUS_25110 200221 200397 gene locus_tag LOCUS_25120 200221 200397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 201551 200613 gene locus_tag LOCUS_25130 201551 200613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_25130 204196 201548 gene locus_tag LOCUS_25140 204196 201548 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227899.1 protein_id gnl|my_center|LOCUS_25140 205429 204416 gene locus_tag LOCUS_25150 205429 204416 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_25150 206183 207025 gene locus_tag LOCUS_25160 206183 207025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 207022 208050 gene locus_tag LOCUS_25170 207022 208050 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394598.1 protein_id gnl|my_center|LOCUS_25170 209380 207977 gene locus_tag LOCUS_25180 209380 207977 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_25180 209622 210506 gene locus_tag LOCUS_25190 209622 210506 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_25190 210555 211295 gene locus_tag LOCUS_25200 210555 211295 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_25200 211292 212620 gene locus_tag LOCUS_25210 211292 212620 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028261.1 protein_id gnl|my_center|LOCUS_25210 213070 213255 gene locus_tag LOCUS_25220 213070 213255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 213888 213376 gene locus_tag LOCUS_25230 213888 213376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 214540 215154 gene locus_tag LOCUS_25240 214540 215154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 215154 215687 gene locus_tag LOCUS_25250 215154 215687 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039407.1 protein_id gnl|my_center|LOCUS_25250 216515 215769 gene locus_tag LOCUS_25260 216515 215769 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412657.1 protein_id gnl|my_center|LOCUS_25260 218415 216586 gene locus_tag LOCUS_25270 218415 216586 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_25270 218957 218655 gene locus_tag LOCUS_25280 218957 218655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 219525 218962 gene locus_tag LOCUS_25290 219525 218962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 221648 219522 gene locus_tag LOCUS_25300 221648 219522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 220175 220086 gene locus_tag LOCUS_t00340 220175 220086 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 222803 222204 gene locus_tag LOCUS_25310 222803 222204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 223469 229750 gene locus_tag LOCUS_25320 223469 229750 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_25320 229842 232787 gene locus_tag LOCUS_25330 229842 232787 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_25330 232787 236968 gene locus_tag LOCUS_25340 232787 236968 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_25340 237424 237008 gene locus_tag LOCUS_25350 237424 237008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 237596 238348 gene locus_tag LOCUS_25360 237596 238348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 239066 238380 gene locus_tag LOCUS_25370 239066 238380 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230982.1 protein_id gnl|my_center|LOCUS_25370 239211 239741 gene locus_tag LOCUS_25380 239211 239741 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229981.1 protein_id gnl|my_center|LOCUS_25380 239849 240808 gene locus_tag LOCUS_25390 239849 240808 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461138.1 protein_id gnl|my_center|LOCUS_25390 240846 241598 gene locus_tag LOCUS_25400 240846 241598 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_25400 242693 241668 gene locus_tag LOCUS_25410 242693 241668 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_25410 244368 242860 gene locus_tag LOCUS_25420 244368 242860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 246929 244797 gene locus_tag LOCUS_25430 246929 244797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 247658 247122 gene locus_tag LOCUS_25440 247658 247122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 249230 248016 gene locus_tag LOCUS_25450 249230 248016 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270408.1 protein_id gnl|my_center|LOCUS_25450 249529 249996 gene locus_tag LOCUS_25460 249529 249996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 249993 251720 gene locus_tag LOCUS_25470 249993 251720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 253208 251823 gene locus_tag LOCUS_25480 253208 251823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 252360 252264 gene locus_tag LOCUS_t00350 252360 252264 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 254997 253696 gene locus_tag LOCUS_25490 254997 253696 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_25490 256248 255013 gene locus_tag LOCUS_25500 256248 255013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_25500 256478 257728 gene locus_tag LOCUS_25510 256478 257728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 258733 257744 gene locus_tag LOCUS_25520 258733 257744 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728851.1 protein_id gnl|my_center|LOCUS_25520 258781 259599 gene locus_tag LOCUS_25530 258781 259599 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_25530 260058 259882 gene locus_tag LOCUS_25540 260058 259882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 260513 261166 gene locus_tag LOCUS_25550 260513 261166 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_25550 261174 262535 gene locus_tag LOCUS_25560 261174 262535 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_25560 262987 263286 gene locus_tag LOCUS_25570 262987 263286 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_25570 263315 264142 gene locus_tag LOCUS_25580 263315 264142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 264282 265667 gene locus_tag LOCUS_25590 264282 265667 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 protein_id gnl|my_center|LOCUS_25590 266015 265731 gene locus_tag LOCUS_25600 266015 265731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 266177 267457 gene locus_tag LOCUS_25610 266177 267457 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231015.1 protein_id gnl|my_center|LOCUS_25610 267498 267935 gene locus_tag LOCUS_25620 gene dut 267498 267935 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_25620 268023 268697 gene locus_tag LOCUS_25630 268023 268697 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_25630 268746 269159 gene locus_tag LOCUS_25640 268746 269159 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_25640 269156 269890 gene locus_tag LOCUS_25650 269156 269890 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230310.1 protein_id gnl|my_center|LOCUS_25650 270610 269951 gene locus_tag LOCUS_25660 270610 269951 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_25660 271272 270610 gene locus_tag LOCUS_25670 271272 270610 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_25670 271431 273461 gene locus_tag LOCUS_25680 271431 273461 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_25680 273458 274750 gene locus_tag LOCUS_25690 273458 274750 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_25690 275336 274812 gene locus_tag LOCUS_25700 275336 274812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 275506 276429 gene locus_tag LOCUS_25710 275506 276429 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_25710 276506 277963 gene locus_tag LOCUS_25720 276506 277963 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_25720 277963 280659 gene locus_tag LOCUS_25730 277963 280659 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_25730 280823 280954 gene locus_tag LOCUS_25740 280823 280954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 281808 281215 gene locus_tag LOCUS_25750 281808 281215 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219470533.1 protein_id gnl|my_center|LOCUS_25750 282536 281814 gene locus_tag LOCUS_25760 282536 281814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 282946 283653 gene locus_tag LOCUS_25770 282946 283653 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_25770 283838 286585 gene locus_tag LOCUS_25780 gene acnA 283838 286585 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_25780 287206 286946 gene locus_tag LOCUS_25790 287206 286946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 287401 288159 gene locus_tag LOCUS_25800 287401 288159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 288398 289507 gene locus_tag LOCUS_25810 288398 289507 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_25810 289616 290473 gene locus_tag LOCUS_25820 289616 290473 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897420.1 protein_id gnl|my_center|LOCUS_25820 290470 291720 gene locus_tag LOCUS_25830 290470 291720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878529.1 protein_id gnl|my_center|LOCUS_25830 291765 292976 gene locus_tag LOCUS_25840 291765 292976 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_25840 293110 295005 gene locus_tag LOCUS_25850 gene dxs 293110 295005 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_25850 295037 296044 gene locus_tag LOCUS_25860 295037 296044 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 protein_id gnl|my_center|LOCUS_25860 296570 298081 gene locus_tag LOCUS_25870 296570 298081 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_25870 298709 298071 gene locus_tag LOCUS_25880 298709 298071 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_25880 299231 298839 gene locus_tag LOCUS_25890 299231 298839 CDS product protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978099.1 protein_id gnl|my_center|LOCUS_25890 300705 299476 gene locus_tag LOCUS_25900 300705 299476 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_25900 301319 300702 gene locus_tag LOCUS_25910 301319 300702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 301688 302725 gene locus_tag LOCUS_25920 gene hemE 301688 302725 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_25920 303979 302849 gene locus_tag LOCUS_25930 303979 302849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 304166 305665 gene locus_tag LOCUS_25940 gene hemG 304166 305665 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_25940 305631 306332 gene locus_tag LOCUS_25950 305631 306332 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_25950 306492 307445 gene locus_tag LOCUS_25960 306492 307445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 307815 307402 gene locus_tag LOCUS_25970 gene msrB 307815 307402 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_25970 308212 309231 gene locus_tag LOCUS_25980 gene ligD 308212 309231 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_25980 309679 311166 gene locus_tag LOCUS_25990 309679 311166 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028022.1 protein_id gnl|my_center|LOCUS_25990 312354 311191 gene locus_tag LOCUS_26000 312354 311191 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_26000 313085 312351 gene locus_tag LOCUS_26010 313085 312351 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_26010 315291 313150 gene locus_tag LOCUS_26020 gene glgX 315291 313150 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 protein_id gnl|my_center|LOCUS_26020 315893 315465 gene locus_tag LOCUS_26030 315893 315465 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_26030 317719 316016 gene locus_tag LOCUS_26040 317719 316016 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_26040 318010 318750 gene locus_tag LOCUS_26050 318010 318750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 319520 318771 gene locus_tag LOCUS_26060 319520 318771 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_26060 320230 319502 gene locus_tag LOCUS_26070 320230 319502 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_26070 320567 320424 gene locus_tag LOCUS_26080 320567 320424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_26080 322246 320564 gene locus_tag LOCUS_26090 gene sirA 322246 320564 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_26090 322848 324110 gene locus_tag LOCUS_26100 322848 324110 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230479.1 protein_id gnl|my_center|LOCUS_26100 324434 325534 gene locus_tag LOCUS_26110 gene rsgA 324434 325534 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_26110 326477 326166 gene locus_tag LOCUS_26120 326477 326166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 327564 326560 gene locus_tag LOCUS_26130 327564 326560 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 protein_id gnl|my_center|LOCUS_26130 327824 328021 gene locus_tag LOCUS_26140 327824 328021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 328099 329604 gene locus_tag LOCUS_26150 328099 329604 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971785.1 protein_id gnl|my_center|LOCUS_26150 329678 331372 gene locus_tag LOCUS_26160 329678 331372 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_26160 332658 331354 gene locus_tag LOCUS_26170 332658 331354 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234232.1 protein_id gnl|my_center|LOCUS_26170 334778 332802 gene locus_tag LOCUS_26180 334778 332802 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029854.1 protein_id gnl|my_center|LOCUS_26180 337875 334999 gene locus_tag LOCUS_26190 337875 334999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 338679 337888 gene locus_tag LOCUS_26200 338679 337888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 339087 340742 gene locus_tag LOCUS_26210 339087 340742 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_26210 341143 342534 gene locus_tag LOCUS_26220 341143 342534 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_26220 342608 343480 gene locus_tag LOCUS_26230 342608 343480 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 protein_id gnl|my_center|LOCUS_26230 343512 344051 gene locus_tag LOCUS_26240 343512 344051 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_26240 344048 346447 gene locus_tag LOCUS_26250 344048 346447 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259305.1 protein_id gnl|my_center|LOCUS_26250 348195 346633 gene locus_tag LOCUS_26260 348195 346633 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227262.1 protein_id gnl|my_center|LOCUS_26260 348339 351281 gene locus_tag LOCUS_26270 348339 351281 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486951.1 protein_id gnl|my_center|LOCUS_26270 351806 351399 gene locus_tag LOCUS_26280 351806 351399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 351937 352797 gene locus_tag LOCUS_26290 351937 352797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 352775 352981 gene locus_tag LOCUS_26300 352775 352981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 353414 354469 gene locus_tag LOCUS_26310 353414 354469 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113032.1 protein_id gnl|my_center|LOCUS_26310 354763 356223 gene locus_tag LOCUS_26320 354763 356223 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_26320 357207 356224 gene locus_tag LOCUS_26330 gene cydB 357207 356224 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_26330 358657 357233 gene locus_tag LOCUS_26340 358657 357233 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_26340 358958 359692 gene locus_tag LOCUS_26350 358958 359692 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_26350 359749 360861 gene locus_tag LOCUS_26360 gene dhbC 359749 360861 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_26360 360845 362404 gene locus_tag LOCUS_26370 360845 362404 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_26370 362416 363066 gene locus_tag LOCUS_26380 362416 363066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26380 363059 363316 gene locus_tag LOCUS_26390 363059 363316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26390 363313 370110 gene locus_tag LOCUS_26400 gene dhbF 363313 370110 CDS product non-ribosomal peptide synthetase DhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968094.1 protein_id gnl|my_center|LOCUS_26400 370107 371612 gene locus_tag LOCUS_26410 370107 371612 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_26410 372805 371678 gene locus_tag LOCUS_26420 372805 371678 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900009.1 protein_id gnl|my_center|LOCUS_26420 373959 372817 gene locus_tag LOCUS_26430 373959 372817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 376088 373974 gene locus_tag LOCUS_26440 376088 373974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 376145 377125 gene locus_tag LOCUS_26450 376145 377125 CDS product amonabactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 protein_id gnl|my_center|LOCUS_26450 377255 377944 gene locus_tag LOCUS_26460 377255 377944 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_26460 378092 378844 gene locus_tag LOCUS_26470 378092 378844 CDS product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259307.1 protein_id gnl|my_center|LOCUS_26470 379206 381290 gene locus_tag LOCUS_26480 379206 381290 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067631220.1 protein_id gnl|my_center|LOCUS_26480 381287 383137 gene locus_tag LOCUS_26490 381287 383137 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_26490 383155 383817 gene locus_tag LOCUS_26500 383155 383817 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227682.1 protein_id gnl|my_center|LOCUS_26500 384397 383867 gene locus_tag LOCUS_26510 384397 383867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26510 384506 385672 gene locus_tag LOCUS_26520 384506 385672 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728197.1 protein_id gnl|my_center|LOCUS_26520 385669 387174 gene locus_tag LOCUS_26530 385669 387174 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_26530 387600 387178 gene locus_tag LOCUS_26540 387600 387178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 388105 387638 gene locus_tag LOCUS_26550 388105 387638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 388910 388116 gene locus_tag LOCUS_26560 388910 388116 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876909.1 protein_id gnl|my_center|LOCUS_26560 389952 388915 gene locus_tag LOCUS_26570 389952 388915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 390080 391243 gene locus_tag LOCUS_26580 390080 391243 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222355.1 protein_id gnl|my_center|LOCUS_26580 391346 392284 gene locus_tag LOCUS_26590 gene arcC 391346 392284 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_26590 392301 393407 gene locus_tag LOCUS_26600 392301 393407 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_26600 393448 393984 gene locus_tag LOCUS_26610 393448 393984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 394064 394789 gene locus_tag LOCUS_26620 394064 394789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 394913 396091 gene locus_tag LOCUS_26630 gene aroC 394913 396091 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_26630 396091 396624 gene locus_tag LOCUS_26640 396091 396624 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742170.1 protein_id gnl|my_center|LOCUS_26640 396621 397697 gene locus_tag LOCUS_26650 gene aroB 396621 397697 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_26650 397733 398185 gene locus_tag LOCUS_26660 gene aroQ 397733 398185 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994916.1 protein_id gnl|my_center|LOCUS_26660 398320 398985 gene locus_tag LOCUS_26670 398320 398985 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230311.1 protein_id gnl|my_center|LOCUS_26670 400375 399032 gene locus_tag LOCUS_26680 400375 399032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 400514 402700 gene locus_tag LOCUS_26690 400514 402700 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229470.1 protein_id gnl|my_center|LOCUS_26690 403496 402681 gene locus_tag LOCUS_26700 gene lieB 403496 402681 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_26700 404443 403496 gene locus_tag LOCUS_26710 404443 403496 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_26710 404520 405368 gene locus_tag LOCUS_26720 404520 405368 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_26720 405431 405805 gene locus_tag LOCUS_26730 405431 405805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 405866 406243 gene locus_tag LOCUS_26740 405866 406243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 406243 406572 gene locus_tag LOCUS_26750 406243 406572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 408080 407061 gene locus_tag LOCUS_26760 408080 407061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 408031 408291 gene locus_tag LOCUS_26770 408031 408291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 408951 408451 gene locus_tag LOCUS_26780 408951 408451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 409188 409676 gene locus_tag LOCUS_26790 409188 409676 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 protein_id gnl|my_center|LOCUS_26790 410772 409771 gene locus_tag LOCUS_26800 410772 409771 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_26800 410977 412194 gene locus_tag LOCUS_26810 410977 412194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 protein_id gnl|my_center|LOCUS_26810 412962 412210 gene locus_tag LOCUS_26820 412962 412210 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_26820 413174 412947 gene locus_tag LOCUS_26830 413174 412947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 413339 413725 gene locus_tag LOCUS_26840 413339 413725 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084283.1 protein_id gnl|my_center|LOCUS_26840 413998 414657 gene locus_tag LOCUS_26850 413998 414657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 414667 417690 gene locus_tag LOCUS_26860 414667 417690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 419328 417787 gene locus_tag LOCUS_26870 419328 417787 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384516.1 protein_id gnl|my_center|LOCUS_26870 419518 420954 gene locus_tag LOCUS_26880 419518 420954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 421541 423019 gene locus_tag LOCUS_26890 421541 423019 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030540.1 protein_id gnl|my_center|LOCUS_26890 423196 424212 gene locus_tag LOCUS_26900 gene menC 423196 424212 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_26900 425759 424218 gene locus_tag LOCUS_26910 425759 424218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26910 427447 425966 gene locus_tag LOCUS_26920 427447 425966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 427576 428703 gene locus_tag LOCUS_26930 427576 428703 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_26930 428704 432882 gene locus_tag LOCUS_26940 428704 432882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 433658 432918 gene locus_tag LOCUS_26950 433658 432918 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_26950 435912 433699 gene locus_tag LOCUS_26960 435912 433699 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 protein_id gnl|my_center|LOCUS_26960 436275 436060 gene locus_tag LOCUS_26970 436275 436060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 436160 437479 gene locus_tag LOCUS_26980 436160 437479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 438465 437611 gene locus_tag LOCUS_26990 438465 437611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_26990 439490 438510 gene locus_tag LOCUS_27000 439490 438510 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_27000 440169 439480 gene locus_tag LOCUS_27010 440169 439480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 440860 440267 gene locus_tag LOCUS_27020 440860 440267 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_27020 440913 442616 gene locus_tag LOCUS_27030 440913 442616 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_27030 442625 444583 gene locus_tag LOCUS_27040 442625 444583 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229660.1 protein_id gnl|my_center|LOCUS_27040 444580 445560 gene locus_tag LOCUS_27050 444580 445560 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223361.1 protein_id gnl|my_center|LOCUS_27050 445557 446756 gene locus_tag LOCUS_27060 445557 446756 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_27060 448466 446793 gene locus_tag LOCUS_27070 448466 446793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 449552 448587 gene locus_tag LOCUS_27080 449552 448587 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_27080 450466 449534 gene locus_tag LOCUS_27090 450466 449534 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_27090 450677 452224 gene locus_tag LOCUS_27100 450677 452224 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223948.1 protein_id gnl|my_center|LOCUS_27100 452387 452593 gene locus_tag LOCUS_27110 452387 452593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 452713 453522 gene locus_tag LOCUS_27120 452713 453522 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_27120 453595 453861 gene locus_tag LOCUS_27130 453595 453861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 454654 453896 gene locus_tag LOCUS_27140 454654 453896 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225024.1 protein_id gnl|my_center|LOCUS_27140 455355 454651 gene locus_tag LOCUS_27150 455355 454651 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225025.1 protein_id gnl|my_center|LOCUS_27150 455452 456885 gene locus_tag LOCUS_27160 455452 456885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 456882 457574 gene locus_tag LOCUS_27170 456882 457574 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223180.1 protein_id gnl|my_center|LOCUS_27170 458336 457581 gene locus_tag LOCUS_27180 458336 457581 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228441.1 protein_id gnl|my_center|LOCUS_27180 460136 458508 gene locus_tag LOCUS_27190 460136 458508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 460840 460391 gene locus_tag LOCUS_27200 460840 460391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031366.1 protein_id gnl|my_center|LOCUS_27200 461763 460876 gene locus_tag LOCUS_27210 461763 460876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 463370 461979 gene locus_tag LOCUS_27220 463370 461979 CDS product S8/S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972149.1 protein_id gnl|my_center|LOCUS_27220 463507 466131 gene locus_tag LOCUS_27230 463507 466131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27230 466704 468365 gene locus_tag LOCUS_27240 gene ctaD 466704 468365 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_27240 468431 469429 gene locus_tag LOCUS_27250 468431 469429 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_27250 469905 469444 gene locus_tag LOCUS_27260 469905 469444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 470399 469938 gene locus_tag LOCUS_27270 470399 469938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 470578 470784 gene locus_tag LOCUS_27280 470578 470784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 470869 472065 gene locus_tag LOCUS_27290 470869 472065 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037667486.1 protein_id gnl|my_center|LOCUS_27290 472757 472239 gene locus_tag LOCUS_27300 472757 472239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 473185 473955 gene locus_tag LOCUS_27310 473185 473955 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_27310 473952 474389 gene locus_tag LOCUS_27320 473952 474389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977612.1 protein_id gnl|my_center|LOCUS_27320 474423 476147 gene locus_tag LOCUS_27330 474423 476147 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027655.1 protein_id gnl|my_center|LOCUS_27330 476303 476632 gene locus_tag LOCUS_27340 476303 476632 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_27340 476629 478239 gene locus_tag LOCUS_27350 476629 478239 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_27350 480101 478386 gene locus_tag LOCUS_27360 gene polX 480101 478386 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_27360 480186 482279 gene locus_tag LOCUS_27370 480186 482279 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484486.1 protein_id gnl|my_center|LOCUS_27370 482349 482816 gene locus_tag LOCUS_27380 482349 482816 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530125.1 protein_id gnl|my_center|LOCUS_27380 482872 484101 gene locus_tag LOCUS_27390 482872 484101 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026832.1 protein_id gnl|my_center|LOCUS_27390 484107 484505 gene locus_tag LOCUS_27400 484107 484505 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066815.1 protein_id gnl|my_center|LOCUS_27400 485562 484549 gene locus_tag LOCUS_27410 485562 484549 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_27410 485689 486729 gene locus_tag LOCUS_27420 gene add 485689 486729 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228060.1 protein_id gnl|my_center|LOCUS_27420 486800 487111 gene locus_tag LOCUS_27430 486800 487111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 487248 488519 gene locus_tag LOCUS_27440 gene cypC 487248 488519 CDS product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 protein_id gnl|my_center|LOCUS_27440 488524 488943 gene locus_tag LOCUS_27450 488524 488943 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005123490.1 protein_id gnl|my_center|LOCUS_27450 489691 489011 gene locus_tag LOCUS_27460 489691 489011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 489808 490578 gene locus_tag LOCUS_27470 489808 490578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 490702 491640 gene locus_tag LOCUS_27480 490702 491640 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496031.1 protein_id gnl|my_center|LOCUS_27480 491644 492321 gene locus_tag LOCUS_27490 491644 492321 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897325.1 protein_id gnl|my_center|LOCUS_27490 492328 493854 gene locus_tag LOCUS_27500 492328 493854 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855409.1 protein_id gnl|my_center|LOCUS_27500 494352 495629 gene locus_tag LOCUS_27510 494352 495629 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730345.1 protein_id gnl|my_center|LOCUS_27510 495673 496605 gene locus_tag LOCUS_27520 495673 496605 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026993.1 protein_id gnl|my_center|LOCUS_27520 496607 497506 gene locus_tag LOCUS_27530 496607 497506 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896545.1 protein_id gnl|my_center|LOCUS_27530 499504 497897 gene locus_tag LOCUS_27540 499504 497897 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 protein_id gnl|my_center|LOCUS_27540 500734 499652 gene locus_tag LOCUS_27550 500734 499652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088345.1 protein_id gnl|my_center|LOCUS_27550 501690 500731 gene locus_tag LOCUS_27560 501690 500731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836213.1 protein_id gnl|my_center|LOCUS_27560 502751 501687 gene locus_tag LOCUS_27570 502751 501687 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_27570 503868 502858 gene locus_tag LOCUS_27580 503868 502858 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868769.1 protein_id gnl|my_center|LOCUS_27580 505830 504784 gene locus_tag LOCUS_27590 505830 504784 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229442.1 protein_id gnl|my_center|LOCUS_27590 506598 506053 gene locus_tag LOCUS_27600 506598 506053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 506899 506825 gene locus_tag LOCUS_t00360 506899 506825 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 506985 506912 gene locus_tag LOCUS_t00370 506985 506912 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 507323 507625 gene locus_tag LOCUS_27610 507323 507625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_27610 507638 509458 gene locus_tag LOCUS_27620 gene glmS 507638 509458 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_27620 510232 509537 gene locus_tag LOCUS_27630 510232 509537 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_27630 511859 510420 gene locus_tag LOCUS_27640 511859 510420 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681425.1 protein_id gnl|my_center|LOCUS_27640 512069 512659 gene locus_tag LOCUS_27650 512069 512659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 protein_id gnl|my_center|LOCUS_27650 513121 513972 gene locus_tag LOCUS_27660 513121 513972 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_27660 515564 514158 gene locus_tag LOCUS_27670 515564 514158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 517824 515803 gene locus_tag LOCUS_27680 517824 515803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 518339 517821 gene locus_tag LOCUS_27690 518339 517821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 520079 518844 gene locus_tag LOCUS_27700 gene glgC 520079 518844 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805186.1 protein_id gnl|my_center|LOCUS_27700 520159 521337 gene locus_tag LOCUS_27710 gene glgA 520159 521337 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805185.1 protein_id gnl|my_center|LOCUS_27710 521393 522103 gene locus_tag LOCUS_27720 gene pgeF 521393 522103 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173521163.1 protein_id gnl|my_center|LOCUS_27720 523261 522116 gene locus_tag LOCUS_27730 gene yghO 523261 522116 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_27730 523596 524561 gene locus_tag LOCUS_27740 523596 524561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 525092 524658 gene locus_tag LOCUS_27750 525092 524658 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_27750 525318 526772 gene locus_tag LOCUS_27760 525318 526772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899645.1 protein_id gnl|my_center|LOCUS_27760 527005 529296 gene locus_tag LOCUS_27770 527005 529296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 529873 530058 gene locus_tag LOCUS_27780 529873 530058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 531100 530309 gene locus_tag LOCUS_27790 531100 530309 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894901.1 protein_id gnl|my_center|LOCUS_27790 531294 533366 gene locus_tag LOCUS_27800 531294 533366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 533587 536328 gene locus_tag LOCUS_27810 533587 536328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 537283 538506 gene locus_tag LOCUS_27820 537283 538506 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_27820 538748 539785 gene locus_tag LOCUS_27830 538748 539785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 539988 541334 gene locus_tag LOCUS_27840 539988 541334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 544189 541652 gene locus_tag LOCUS_27850 544189 541652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 544651 544307 gene locus_tag LOCUS_27860 544651 544307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 546878 544941 gene locus_tag LOCUS_27870 546878 544941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 547663 546875 gene locus_tag LOCUS_27880 547663 546875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 548319 550193 gene locus_tag LOCUS_27890 548319 550193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 550602 551804 gene locus_tag LOCUS_27900 550602 551804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 553285 551858 gene locus_tag LOCUS_27910 553285 551858 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_27910 555078 553306 gene locus_tag LOCUS_27920 555078 553306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 555820 555296 gene locus_tag LOCUS_27930 555820 555296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 556515 557420 gene locus_tag LOCUS_27940 556515 557420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 557719 559101 gene locus_tag LOCUS_27950 557719 559101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 560426 559134 gene locus_tag LOCUS_27960 560426 559134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 561782 560529 gene locus_tag LOCUS_27970 561782 560529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 563251 562451 gene locus_tag LOCUS_27980 563251 562451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 564445 563783 gene locus_tag LOCUS_27990 564445 563783 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_27990 565793 564438 gene locus_tag LOCUS_28000 565793 564438 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_28000 566332 567204 gene locus_tag LOCUS_28010 566332 567204 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230746.1 protein_id gnl|my_center|LOCUS_28010 568439 567252 gene locus_tag LOCUS_28020 gene fahA 568439 567252 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224839.1 protein_id gnl|my_center|LOCUS_28020 569776 568574 gene locus_tag LOCUS_28030 569776 568574 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083253.1 protein_id gnl|my_center|LOCUS_28030 570481 571644 gene locus_tag LOCUS_28040 570481 571644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 571783 572046 gene locus_tag LOCUS_28050 571783 572046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 572933 571938 gene locus_tag LOCUS_28060 572933 571938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 573303 574520 gene locus_tag LOCUS_28070 573303 574520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 574517 575458 gene locus_tag LOCUS_28080 574517 575458 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_28080 576286 577155 gene locus_tag LOCUS_28090 576286 577155 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047906135.1 protein_id gnl|my_center|LOCUS_28090 577187 578353 gene locus_tag LOCUS_28100 577187 578353 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112840.1 protein_id gnl|my_center|LOCUS_28100 578387 579289 gene locus_tag LOCUS_28110 578387 579289 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064791.1 protein_id gnl|my_center|LOCUS_28110 580619 579393 gene locus_tag LOCUS_28120 580619 579393 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385236.1 protein_id gnl|my_center|LOCUS_28120 580884 581564 gene locus_tag LOCUS_28130 580884 581564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 581593 582234 gene locus_tag LOCUS_28140 581593 582234 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401571.1 protein_id gnl|my_center|LOCUS_28140 582443 583693 gene locus_tag LOCUS_28150 582443 583693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618904.1 protein_id gnl|my_center|LOCUS_28150 585149 583647 gene locus_tag LOCUS_28160 585149 583647 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388869.1 protein_id gnl|my_center|LOCUS_28160 585254 586165 gene locus_tag LOCUS_28170 585254 586165 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123743405.1 protein_id gnl|my_center|LOCUS_28170 588875 586368 gene locus_tag LOCUS_28180 588875 586368 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 protein_id gnl|my_center|LOCUS_28180 589555 589001 gene locus_tag LOCUS_28190 589555 589001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 589954 590955 gene locus_tag LOCUS_28200 589954 590955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 591367 592686 gene locus_tag LOCUS_28210 591367 592686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 592980 593855 gene locus_tag LOCUS_28220 592980 593855 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892164.1 protein_id gnl|my_center|LOCUS_28220 593857 594372 gene locus_tag LOCUS_28230 593857 594372 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892165.1 protein_id gnl|my_center|LOCUS_28230 594369 596759 gene locus_tag LOCUS_28240 594369 596759 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900133.1 protein_id gnl|my_center|LOCUS_28240 596808 597839 gene locus_tag LOCUS_28250 596808 597839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 597909 598796 gene locus_tag LOCUS_28260 597909 598796 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401863.1 protein_id gnl|my_center|LOCUS_28260 598954 599772 gene locus_tag LOCUS_28270 598954 599772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 599846 601015 gene locus_tag LOCUS_28280 599846 601015 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727166.1 protein_id gnl|my_center|LOCUS_28280 601988 601023 gene locus_tag LOCUS_28290 601988 601023 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727160.1 protein_id gnl|my_center|LOCUS_28290 603609 602203 gene locus_tag LOCUS_28300 603609 602203 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971610.1 protein_id gnl|my_center|LOCUS_28300 604754 603882 gene locus_tag LOCUS_28310 604754 603882 CDS product gallate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_28310 605091 604747 gene locus_tag LOCUS_28320 605091 604747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 605979 605104 gene locus_tag LOCUS_28330 gene folD 605979 605104 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207454.1 protein_id gnl|my_center|LOCUS_28330 606862 605993 gene locus_tag LOCUS_28340 gene purU 606862 605993 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893574.1 protein_id gnl|my_center|LOCUS_28340 607791 606862 gene locus_tag LOCUS_28350 607791 606862 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971608.1 protein_id gnl|my_center|LOCUS_28350 609026 608841 gene locus_tag LOCUS_28360 609026 608841 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_28360 609349 610185 gene locus_tag LOCUS_28370 609349 610185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 610173 611639 gene locus_tag LOCUS_28380 gene crtI 610173 611639 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225928.1 protein_id gnl|my_center|LOCUS_28380 611636 612796 gene locus_tag LOCUS_28390 611636 612796 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141357.1 protein_id gnl|my_center|LOCUS_28390 613334 612714 gene locus_tag LOCUS_28400 gene plsY 613334 612714 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_28400 613309 614025 gene locus_tag LOCUS_28410 613309 614025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 614981 614043 gene locus_tag LOCUS_28420 gene plsX 614981 614043 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 protein_id gnl|my_center|LOCUS_28420 615877 614978 gene locus_tag LOCUS_28430 615877 614978 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026911.1 protein_id gnl|my_center|LOCUS_28430 616542 618641 gene locus_tag LOCUS_28440 616542 618641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 618836 620191 gene locus_tag LOCUS_28450 618836 620191 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878184.1 protein_id gnl|my_center|LOCUS_28450 620264 621205 gene locus_tag LOCUS_28460 620264 621205 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031643.1 protein_id gnl|my_center|LOCUS_28460 621202 622086 gene locus_tag LOCUS_28470 621202 622086 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031642.1 protein_id gnl|my_center|LOCUS_28470 623770 622133 gene locus_tag LOCUS_28480 623770 622133 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_28480 624842 623904 gene locus_tag LOCUS_28490 624842 623904 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032738944.1 protein_id gnl|my_center|LOCUS_28490 625779 624826 gene locus_tag LOCUS_28500 625779 624826 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051281.1 protein_id gnl|my_center|LOCUS_28500 627300 625918 gene locus_tag LOCUS_28510 627300 625918 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114086.1 protein_id gnl|my_center|LOCUS_28510 627418 628461 gene locus_tag LOCUS_28520 627418 628461 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803824.1 protein_id gnl|my_center|LOCUS_28520 629940 628468 gene locus_tag LOCUS_28530 gene crtI 629940 628468 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225924.1 protein_id gnl|my_center|LOCUS_28530 631673 630147 gene locus_tag LOCUS_28540 631673 630147 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131344932.1 protein_id gnl|my_center|LOCUS_28540 632691 631735 gene locus_tag LOCUS_28550 632691 631735 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_28550 633709 632702 gene locus_tag LOCUS_28560 633709 632702 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_28560 635060 633702 gene locus_tag LOCUS_28570 635060 633702 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 protein_id gnl|my_center|LOCUS_28570 635523 638837 gene locus_tag LOCUS_28580 635523 638837 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226454.1 protein_id gnl|my_center|LOCUS_28580 639501 639307 gene locus_tag LOCUS_28590 639501 639307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 640758 639709 gene locus_tag LOCUS_28600 640758 639709 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_28600 642318 640987 gene locus_tag LOCUS_28610 642318 640987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 642797 642723 gene locus_tag LOCUS_t00380 642797 642723 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 642874 642803 gene locus_tag LOCUS_t00390 642874 642803 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 642985 642912 gene locus_tag LOCUS_t00400 642985 642912 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 1067 1333 gene locus_tag LOCUS_28620 1067 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 2137 2529 gene locus_tag LOCUS_28630 2137 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 4909 3566 gene locus_tag LOCUS_28640 4909 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 6794 5067 gene locus_tag LOCUS_28650 gene argS 6794 5067 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804295.1 protein_id gnl|my_center|LOCUS_28650 7900 6989 gene locus_tag LOCUS_28660 gene plsX 7900 6989 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 protein_id gnl|my_center|LOCUS_28660 7853 8128 gene locus_tag LOCUS_28670 7853 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 9115 8468 gene locus_tag LOCUS_28680 9115 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 9315 10685 gene locus_tag LOCUS_28690 9315 10685 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_28690 11367 11122 gene locus_tag LOCUS_28700 11367 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 12001 11465 gene locus_tag LOCUS_28710 12001 11465 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_28710 12888 12058 gene locus_tag LOCUS_28720 12888 12058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_28720 13813 12881 gene locus_tag LOCUS_28730 13813 12881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975816.1 protein_id gnl|my_center|LOCUS_28730 14448 16076 gene locus_tag LOCUS_28740 14448 16076 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_28740 16947 16150 gene locus_tag LOCUS_28750 16947 16150 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230769.1 protein_id gnl|my_center|LOCUS_28750 17256 17603 gene locus_tag LOCUS_28760 17256 17603 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230291.1 protein_id gnl|my_center|LOCUS_28760 17665 18501 gene locus_tag LOCUS_28770 gene otsB 17665 18501 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_28770 19965 18529 gene locus_tag LOCUS_28780 19965 18529 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_28780 20095 20646 gene locus_tag LOCUS_28790 20095 20646 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284042.1 protein_id gnl|my_center|LOCUS_28790 21098 22417 gene locus_tag LOCUS_28800 gene thrC 21098 22417 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_28800 22431 22706 gene locus_tag LOCUS_28810 22431 22706 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_28810 23140 23340 gene locus_tag LOCUS_28820 23140 23340 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_28820 23696 25318 gene locus_tag LOCUS_28830 gene groL 23696 25318 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_28830 27477 25447 gene locus_tag LOCUS_28840 27477 25447 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_28840 27656 27447 gene locus_tag LOCUS_28850 27656 27447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 27984 28439 gene locus_tag LOCUS_28860 27984 28439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 30263 28617 gene locus_tag LOCUS_28870 30263 28617 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_28870 31142 30483 gene locus_tag LOCUS_28880 31142 30483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 33541 31142 gene locus_tag LOCUS_28890 33541 31142 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230251.1 protein_id gnl|my_center|LOCUS_28890 33918 34541 gene locus_tag LOCUS_28900 33918 34541 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_28900 34605 34991 gene locus_tag LOCUS_28910 34605 34991 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_28910 36665 35061 gene locus_tag LOCUS_28920 36665 35061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 36745 37596 gene locus_tag LOCUS_28930 36745 37596 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_28930 37705 40815 gene locus_tag LOCUS_28940 37705 40815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_28940 41221 40868 gene locus_tag LOCUS_28950 41221 40868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 41489 42919 gene locus_tag LOCUS_28960 41489 42919 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230209.1 protein_id gnl|my_center|LOCUS_28960 44500 43007 gene locus_tag LOCUS_28970 44500 43007 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226022.1 protein_id gnl|my_center|LOCUS_28970 44641 45093 gene locus_tag LOCUS_28980 44641 45093 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_28980 45422 45871 gene locus_tag LOCUS_28990 45422 45871 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230207.1 protein_id gnl|my_center|LOCUS_28990 45892 47349 gene locus_tag LOCUS_29000 45892 47349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_29000 47905 48708 gene locus_tag LOCUS_29010 47905 48708 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_29010 48765 51968 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggctcacccccacgtgcgtggggaggac 52170 54899 gene locus_tag LOCUS_29020 52170 54899 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229117.1 protein_id gnl|my_center|LOCUS_29020 54929 56467 gene locus_tag LOCUS_29030 54929 56467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 56467 57135 gene locus_tag LOCUS_29040 56467 57135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 57132 58253 gene locus_tag LOCUS_29050 gene cas7e 57132 58253 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_29050 58250 58990 gene locus_tag LOCUS_29060 gene cas5e 58250 58990 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227611.1 protein_id gnl|my_center|LOCUS_29060 58987 59613 gene locus_tag LOCUS_29070 gene cas6e 58987 59613 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_29070 59610 60608 gene locus_tag LOCUS_29080 gene cas1e 59610 60608 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_29080 60612 60944 gene locus_tag LOCUS_29090 60612 60944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 60963 63060 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcctccccacgcacgtgggggtgagccg 66901 63521 gene locus_tag LOCUS_29100 66901 63521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 67626 66901 gene locus_tag LOCUS_29110 67626 66901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729189.1 protein_id gnl|my_center|LOCUS_29110 68704 67628 gene locus_tag LOCUS_29120 68704 67628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 69337 70485 gene locus_tag LOCUS_29130 69337 70485 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803997.1 protein_id gnl|my_center|LOCUS_29130 70668 71267 gene locus_tag LOCUS_29140 gene thpR 70668 71267 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_29140 72211 71867 gene locus_tag LOCUS_29150 72211 71867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29150 72837 72121 gene locus_tag LOCUS_29160 72837 72121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29160 72966 74138 gene locus_tag LOCUS_29170 72966 74138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 74502 74116 gene locus_tag LOCUS_29180 74502 74116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 74635 75915 gene locus_tag LOCUS_29190 gene lhgO 74635 75915 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 protein_id gnl|my_center|LOCUS_29190 75950 76663 gene locus_tag LOCUS_29200 gene phoP 75950 76663 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_29200 76685 78229 gene locus_tag LOCUS_29210 gene phoR 76685 78229 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403870.1 protein_id gnl|my_center|LOCUS_29210 80129 78291 gene locus_tag LOCUS_29220 80129 78291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 80600 80307 gene locus_tag LOCUS_29230 80600 80307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 80488 81537 gene locus_tag LOCUS_29240 80488 81537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 81534 82334 gene locus_tag LOCUS_29250 81534 82334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222425.1 protein_id gnl|my_center|LOCUS_29250 82331 83587 gene locus_tag LOCUS_29260 82331 83587 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222426.1 protein_id gnl|my_center|LOCUS_29260 83648 84343 gene locus_tag LOCUS_29270 83648 84343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 84525 85256 gene locus_tag LOCUS_29280 84525 85256 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064128.1 protein_id gnl|my_center|LOCUS_29280 86450 85359 gene locus_tag LOCUS_29290 86450 85359 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866892.1 protein_id gnl|my_center|LOCUS_29290 86886 86455 gene locus_tag LOCUS_29300 86886 86455 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971919.1 protein_id gnl|my_center|LOCUS_29300 87530 87324 gene locus_tag LOCUS_29310 87530 87324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 88104 87652 gene locus_tag LOCUS_29320 88104 87652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 90036 88258 gene locus_tag LOCUS_29330 90036 88258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 91034 90033 gene locus_tag LOCUS_29340 91034 90033 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224960.1 protein_id gnl|my_center|LOCUS_29340 91634 92647 gene locus_tag LOCUS_29350 91634 92647 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086676092.1 protein_id gnl|my_center|LOCUS_29350 93556 92687 gene locus_tag LOCUS_29360 93556 92687 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_29360 93849 93586 gene locus_tag LOCUS_29370 93849 93586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 94241 93846 gene locus_tag LOCUS_29380 94241 93846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29380 94548 94829 gene locus_tag LOCUS_29390 94548 94829 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228661.1 protein_id gnl|my_center|LOCUS_29390 94914 95126 gene locus_tag LOCUS_29400 94914 95126 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228663.1 protein_id gnl|my_center|LOCUS_29400 95332 97671 gene locus_tag LOCUS_29410 95332 97671 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_29410 97780 98313 gene locus_tag LOCUS_29420 97780 98313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 98411 99199 gene locus_tag LOCUS_29430 98411 99199 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028258.1 protein_id gnl|my_center|LOCUS_29430 99199 100047 gene locus_tag LOCUS_29440 99199 100047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 100206 100976 gene locus_tag LOCUS_29450 100206 100976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 101624 101007 gene locus_tag LOCUS_29460 gene mftR 101624 101007 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112053.1 protein_id gnl|my_center|LOCUS_29460 102001 102804 gene locus_tag LOCUS_29470 102001 102804 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893578.1 protein_id gnl|my_center|LOCUS_29470 102912 103739 gene locus_tag LOCUS_29480 102912 103739 CDS product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730987.1 protein_id gnl|my_center|LOCUS_29480 103784 104695 gene locus_tag LOCUS_29490 103784 104695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902122.1 protein_id gnl|my_center|LOCUS_29490 104813 105709 gene locus_tag LOCUS_29500 104813 105709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 106501 105746 gene locus_tag LOCUS_29510 106501 105746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 106674 106994 gene locus_tag LOCUS_29520 106674 106994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 107194 107541 gene locus_tag LOCUS_29530 107194 107541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 108193 109392 gene locus_tag LOCUS_29540 gene hppD 108193 109392 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083248.1 protein_id gnl|my_center|LOCUS_29540 109674 110669 gene locus_tag LOCUS_29550 109674 110669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 110666 111331 gene locus_tag LOCUS_29560 110666 111331 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_29560 111455 111802 gene locus_tag LOCUS_29570 111455 111802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 111802 114519 gene locus_tag LOCUS_29580 111802 114519 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_29580 114906 115841 gene locus_tag LOCUS_29590 114906 115841 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 protein_id gnl|my_center|LOCUS_29590 115882 117015 gene locus_tag LOCUS_29600 115882 117015 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_29600 117130 117963 gene locus_tag LOCUS_29610 117130 117963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 117960 119117 gene locus_tag LOCUS_29620 117960 119117 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222997.1 protein_id gnl|my_center|LOCUS_29620 119114 119773 gene locus_tag LOCUS_29630 119114 119773 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972782.1 protein_id gnl|my_center|LOCUS_29630 119904 120695 gene locus_tag LOCUS_29640 gene pgmB 119904 120695 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_29640 121829 120714 gene locus_tag LOCUS_29650 121829 120714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 122881 121826 gene locus_tag LOCUS_29660 122881 121826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 123717 123136 gene locus_tag LOCUS_29670 123717 123136 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224423.1 protein_id gnl|my_center|LOCUS_29670 125187 123859 gene locus_tag LOCUS_29680 125187 123859 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230084.1 protein_id gnl|my_center|LOCUS_29680 125268 126146 gene locus_tag LOCUS_29690 gene sigJ 125268 126146 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_29690 127557 126307 gene locus_tag LOCUS_29700 127557 126307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 128284 128502 gene locus_tag LOCUS_29710 128284 128502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 128628 129602 gene locus_tag LOCUS_29720 128628 129602 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715389.1 protein_id gnl|my_center|LOCUS_29720 129926 131173 gene locus_tag LOCUS_29730 129926 131173 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230153.1 protein_id gnl|my_center|LOCUS_29730 131346 132656 gene locus_tag LOCUS_29740 131346 132656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 132852 134207 gene locus_tag LOCUS_29750 132852 134207 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971610.1 protein_id gnl|my_center|LOCUS_29750 134968 134285 gene locus_tag LOCUS_29760 134968 134285 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_29760 136623 134965 gene locus_tag LOCUS_29770 136623 134965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 137513 137022 gene locus_tag LOCUS_29780 137513 137022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 137712 139373 gene locus_tag LOCUS_29790 137712 139373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 139496 139726 gene locus_tag LOCUS_29800 139496 139726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 139940 141439 gene locus_tag LOCUS_29810 139940 141439 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_29810 141504 141710 gene locus_tag LOCUS_29820 141504 141710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 141748 142311 gene locus_tag LOCUS_29830 141748 142311 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728592.1 protein_id gnl|my_center|LOCUS_29830 142368 142904 gene locus_tag LOCUS_29840 142368 142904 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_29840 143402 142911 gene locus_tag LOCUS_29850 143402 142911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 143630 145174 gene locus_tag LOCUS_29860 143630 145174 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_29860 145171 146160 gene locus_tag LOCUS_29870 145171 146160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_29870 145183 145280 gene locus_tag LOCUS_t00410 145183 145280 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 146160 147056 gene locus_tag LOCUS_29880 146160 147056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_29880 147077 148060 gene locus_tag LOCUS_29890 147077 148060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_29890 148053 148733 gene locus_tag LOCUS_29900 148053 148733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 protein_id gnl|my_center|LOCUS_29900 148766 149593 gene locus_tag LOCUS_29910 148766 149593 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895400.1 protein_id gnl|my_center|LOCUS_29910 150248 149838 gene locus_tag LOCUS_29920 150248 149838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 150471 151313 gene locus_tag LOCUS_29930 150471 151313 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731143.1 protein_id gnl|my_center|LOCUS_29930 152781 151339 gene locus_tag LOCUS_29940 152781 151339 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285813.1 protein_id gnl|my_center|LOCUS_29940 152890 153384 gene locus_tag LOCUS_29950 152890 153384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 153962 155254 gene locus_tag LOCUS_29960 153962 155254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 155430 155603 gene locus_tag LOCUS_29970 155430 155603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 155600 156313 gene locus_tag LOCUS_29980 155600 156313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 156821 156324 gene locus_tag LOCUS_29990 156821 156324 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 protein_id gnl|my_center|LOCUS_29990 156972 159140 gene locus_tag LOCUS_30000 156972 159140 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226971.1 protein_id gnl|my_center|LOCUS_30000 159557 159150 gene locus_tag LOCUS_30010 159557 159150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 159585 160619 gene locus_tag LOCUS_30020 159585 160619 CDS product glycoside hydrolase family 11 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028255.1 protein_id gnl|my_center|LOCUS_30020 161630 160734 gene locus_tag LOCUS_30030 gene blaOXA 161630 160734 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_30030 162012 161764 gene locus_tag LOCUS_30040 162012 161764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 162340 163218 gene locus_tag LOCUS_30050 162340 163218 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_30050 164232 163270 gene locus_tag LOCUS_30060 164232 163270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 164457 165761 gene locus_tag LOCUS_30070 164457 165761 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222229.1 protein_id gnl|my_center|LOCUS_30070 165993 167312 gene locus_tag LOCUS_30080 165993 167312 CDS product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 protein_id gnl|my_center|LOCUS_30080 167330 167237 gene locus_tag LOCUS_t00420 167330 167237 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 167315 168337 gene locus_tag LOCUS_30090 167315 168337 CDS product DUF5602 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888230.1 protein_id gnl|my_center|LOCUS_30090 169256 168417 gene locus_tag LOCUS_30100 169256 168417 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060859.1 protein_id gnl|my_center|LOCUS_30100 169318 169911 gene locus_tag LOCUS_30110 169318 169911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 171493 169865 gene locus_tag LOCUS_30120 171493 169865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 172386 171490 gene locus_tag LOCUS_30130 172386 171490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837952.1 protein_id gnl|my_center|LOCUS_30130 173082 172390 gene locus_tag LOCUS_30140 173082 172390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 174441 173248 gene locus_tag LOCUS_30150 174441 173248 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199888163.1 protein_id gnl|my_center|LOCUS_30150 174767 174504 gene locus_tag LOCUS_30160 174767 174504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30160 175165 174785 gene locus_tag LOCUS_30170 175165 174785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30170 175305 176483 gene locus_tag LOCUS_30180 175305 176483 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728069.1 protein_id gnl|my_center|LOCUS_30180 178298 176655 gene locus_tag LOCUS_30190 178298 176655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 180429 179113 gene locus_tag LOCUS_30200 180429 179113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 180738 181172 gene locus_tag LOCUS_30210 180738 181172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 181648 181445 gene locus_tag LOCUS_30220 181648 181445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 182112 181594 gene locus_tag LOCUS_30230 182112 181594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 182286 182678 gene locus_tag LOCUS_30240 182286 182678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 182680 185148 gene locus_tag LOCUS_30250 182680 185148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 185663 185187 gene locus_tag LOCUS_30260 185663 185187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 185956 185696 gene locus_tag LOCUS_30270 185956 185696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 186102 186569 gene locus_tag LOCUS_30280 186102 186569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30280 187418 186576 gene locus_tag LOCUS_30290 187418 186576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 187729 188436 gene locus_tag LOCUS_30300 187729 188436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 188500 189489 gene locus_tag LOCUS_30310 188500 189489 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407527.1 protein_id gnl|my_center|LOCUS_30310 189493 190377 gene locus_tag LOCUS_30320 189493 190377 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421555.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30320 190526 191485 gene locus_tag LOCUS_30330 190526 191485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 191486 192583 gene locus_tag LOCUS_30340 191486 192583 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_30340 192623 193987 gene locus_tag LOCUS_30350 192623 193987 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005135613.1 protein_id gnl|my_center|LOCUS_30350 194699 193989 gene locus_tag LOCUS_30360 194699 193989 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972089.1 protein_id gnl|my_center|LOCUS_30360 195694 194825 gene locus_tag LOCUS_30370 195694 194825 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529371.1 protein_id gnl|my_center|LOCUS_30370 197160 195694 gene locus_tag LOCUS_30380 197160 195694 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_30380 198652 197222 gene locus_tag LOCUS_30390 198652 197222 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545384.1 protein_id gnl|my_center|LOCUS_30390 199544 198645 gene locus_tag LOCUS_30400 199544 198645 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729452.1 protein_id gnl|my_center|LOCUS_30400 200737 199541 gene locus_tag LOCUS_30410 200737 199541 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041861981.1 protein_id gnl|my_center|LOCUS_30410 202125 200806 gene locus_tag LOCUS_30420 202125 200806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 202517 202122 gene locus_tag LOCUS_30430 202517 202122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 204475 202514 gene locus_tag LOCUS_30440 204475 202514 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 protein_id gnl|my_center|LOCUS_30440 205415 204468 gene locus_tag LOCUS_30450 205415 204468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 206098 205595 gene locus_tag LOCUS_30460 gene cutC 206098 205595 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846892.1 protein_id gnl|my_center|LOCUS_30460 206949 206095 gene locus_tag LOCUS_30470 206949 206095 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728714.1 protein_id gnl|my_center|LOCUS_30470 209327 206946 gene locus_tag LOCUS_30480 209327 206946 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728713.1 protein_id gnl|my_center|LOCUS_30480 209899 209324 gene locus_tag LOCUS_30490 209899 209324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 211503 210070 gene locus_tag LOCUS_30500 211503 210070 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930446.1 protein_id gnl|my_center|LOCUS_30500 212342 211503 gene locus_tag LOCUS_30510 212342 211503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 protein_id gnl|my_center|LOCUS_30510 213156 212386 gene locus_tag LOCUS_30520 213156 212386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 214586 213156 gene locus_tag LOCUS_30530 214586 213156 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810930.1 protein_id gnl|my_center|LOCUS_30530 215686 214631 gene locus_tag LOCUS_30540 215686 214631 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368516.1 protein_id gnl|my_center|LOCUS_30540 216546 215710 gene locus_tag LOCUS_30550 216546 215710 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 protein_id gnl|my_center|LOCUS_30550 217552 216806 gene locus_tag LOCUS_30560 217552 216806 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233792.1 protein_id gnl|my_center|LOCUS_30560 217711 218373 gene locus_tag LOCUS_30570 217711 218373 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086436.1 protein_id gnl|my_center|LOCUS_30570 219382 218633 gene locus_tag LOCUS_30580 219382 218633 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_30580 219508 220293 gene locus_tag LOCUS_30590 219508 220293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 220595 221053 gene locus_tag LOCUS_30600 220595 221053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 221788 221366 gene locus_tag LOCUS_30610 221788 221366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 221954 222262 gene locus_tag LOCUS_30620 221954 222262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 222259 223461 gene locus_tag LOCUS_30630 222259 223461 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227700.1 protein_id gnl|my_center|LOCUS_30630 224003 223779 gene locus_tag LOCUS_30640 224003 223779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 225976 224324 gene locus_tag LOCUS_30650 225976 224324 CDS product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 protein_id gnl|my_center|LOCUS_30650 226902 225982 gene locus_tag LOCUS_30660 226902 225982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_30660 227618 226899 gene locus_tag LOCUS_30670 227618 226899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 227891 227688 gene locus_tag LOCUS_30680 227891 227688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 228216 227881 gene locus_tag LOCUS_30690 228216 227881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 228122 229183 gene locus_tag LOCUS_30700 228122 229183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 229890 229354 gene locus_tag LOCUS_30710 229890 229354 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223343.1 protein_id gnl|my_center|LOCUS_30710 231002 230121 gene locus_tag LOCUS_30720 231002 230121 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328848.1 protein_id gnl|my_center|LOCUS_30720 231058 231666 gene locus_tag LOCUS_30730 231058 231666 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230968.1 protein_id gnl|my_center|LOCUS_30730 232896 231970 gene locus_tag LOCUS_30740 232896 231970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 232958 233293 gene locus_tag LOCUS_30750 232958 233293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 234031 233555 gene locus_tag LOCUS_30760 234031 233555 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030185.1 protein_id gnl|my_center|LOCUS_30760 234475 234053 gene locus_tag LOCUS_30770 234475 234053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30770 235127 235054 gene locus_tag LOCUS_t00430 235127 235054 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 235292 236038 gene locus_tag LOCUS_30780 235292 236038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 236365 237471 gene locus_tag LOCUS_30790 236365 237471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 238221 237619 gene locus_tag LOCUS_30800 238221 237619 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230042.1 protein_id gnl|my_center|LOCUS_30800 239375 238569 gene locus_tag LOCUS_30810 239375 238569 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_30810 240294 240473 gene locus_tag LOCUS_30820 240294 240473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 242414 240912 gene locus_tag LOCUS_30830 242414 240912 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_30830 243060 242479 gene locus_tag LOCUS_30840 243060 242479 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_30840 243085 243990 gene locus_tag LOCUS_30850 gene galU 243085 243990 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_30850 244006 245238 gene locus_tag LOCUS_30860 244006 245238 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_30860 245314 245814 gene locus_tag LOCUS_30870 gene moaC 245314 245814 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_30870 245811 246290 gene locus_tag LOCUS_30880 245811 246290 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_30880 246388 247017 gene locus_tag LOCUS_30890 246388 247017 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_30890 247142 247999 gene locus_tag LOCUS_30900 247142 247999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 248048 248126 gene locus_tag LOCUS_t00440 248048 248126 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 249408 248197 gene locus_tag LOCUS_30910 249408 248197 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_30910 249599 249408 gene locus_tag LOCUS_30920 249599 249408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 250953 249580 gene locus_tag LOCUS_30930 gene repSA 250953 249580 CDS product replication initiator protein RepSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030196.1 protein_id gnl|my_center|LOCUS_30930 251307 251170 gene locus_tag LOCUS_30940 251307 251170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 251478 251341 gene locus_tag LOCUS_30950 251478 251341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 251669 251475 gene locus_tag LOCUS_30960 251669 251475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 252215 251835 gene locus_tag LOCUS_30970 252215 251835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 252990 252223 gene locus_tag LOCUS_30980 252990 252223 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028863.1 protein_id gnl|my_center|LOCUS_30980 253193 253008 gene locus_tag LOCUS_30990 253193 253008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 254690 253290 gene locus_tag LOCUS_31000 254690 253290 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028864.1 protein_id gnl|my_center|LOCUS_31000 254977 254789 gene locus_tag LOCUS_31010 254977 254789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 255306 254977 gene locus_tag LOCUS_31020 255306 254977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 256188 255397 gene locus_tag LOCUS_31030 256188 255397 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030352.1 protein_id gnl|my_center|LOCUS_31030 256255 256680 gene locus_tag LOCUS_31040 256255 256680 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950169.1 protein_id gnl|my_center|LOCUS_31040 258085 258531 gene locus_tag LOCUS_31050 258085 258531 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976424.1 protein_id gnl|my_center|LOCUS_31050 258663 259403 gene locus_tag LOCUS_31060 258663 259403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354257.1 protein_id gnl|my_center|LOCUS_31060 260386 259430 gene locus_tag LOCUS_31070 260386 259430 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_31070 260520 261221 gene locus_tag LOCUS_31080 260520 261221 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_31080 261502 262713 gene locus_tag LOCUS_31090 261502 262713 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_31090 263893 262811 gene locus_tag LOCUS_31100 263893 262811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 264836 263913 gene locus_tag LOCUS_31110 264836 263913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 266176 264857 gene locus_tag LOCUS_31120 266176 264857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 266315 266767 gene locus_tag LOCUS_31130 266315 266767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 266764 267141 gene locus_tag LOCUS_31140 266764 267141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 268021 267173 gene locus_tag LOCUS_31150 268021 267173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 268238 268990 gene locus_tag LOCUS_31160 268238 268990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 270006 269047 gene locus_tag LOCUS_31170 270006 269047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974288.1 protein_id gnl|my_center|LOCUS_31170 271536 270142 gene locus_tag LOCUS_31180 271536 270142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 273120 271564 gene locus_tag LOCUS_31190 273120 271564 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_31190 273358 274215 gene locus_tag LOCUS_31200 gene rsmI 273358 274215 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_31200 275811 274240 gene locus_tag LOCUS_31210 275811 274240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 275989 277227 gene locus_tag LOCUS_31220 275989 277227 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_31220 277287 279071 gene locus_tag LOCUS_31230 gene metG 277287 279071 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467759.1 protein_id gnl|my_center|LOCUS_31230 279061 279918 gene locus_tag LOCUS_31240 279061 279918 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_31240 281834 282913 gene locus_tag LOCUS_31250 281834 282913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 283054 283905 gene locus_tag LOCUS_31260 gene rsmA 283054 283905 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_31260 284091 283915 gene locus_tag LOCUS_31270 284091 283915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 285107 284283 gene locus_tag LOCUS_31280 285107 284283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31280 286728 285247 gene locus_tag LOCUS_31290 286728 285247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 288440 286734 gene locus_tag LOCUS_31300 288440 286734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31300 288835 289788 gene locus_tag LOCUS_31310 288835 289788 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021269012.1 protein_id gnl|my_center|LOCUS_31310 289791 291614 gene locus_tag LOCUS_31320 289791 291614 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_31320 292214 291663 gene locus_tag LOCUS_31330 gene tamR 292214 291663 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_31330 292352 293149 gene locus_tag LOCUS_31340 292352 293149 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_31340 294042 293200 gene locus_tag LOCUS_31350 294042 293200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31350 294323 293946 gene locus_tag LOCUS_31360 294323 293946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 295136 294411 gene locus_tag LOCUS_31370 295136 294411 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 protein_id gnl|my_center|LOCUS_31370 298549 295268 gene locus_tag LOCUS_31380 298549 295268 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226391.1 protein_id gnl|my_center|LOCUS_31380 299707 298808 gene locus_tag LOCUS_31390 299707 298808 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223623.1 protein_id gnl|my_center|LOCUS_31390 301796 299700 gene locus_tag LOCUS_31400 301796 299700 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_31400 302768 301872 gene locus_tag LOCUS_31410 302768 301872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 303868 302894 gene locus_tag LOCUS_31420 303868 302894 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086857074.1 protein_id gnl|my_center|LOCUS_31420 304125 304197 gene locus_tag LOCUS_t00450 304125 304197 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 304642 304331 gene locus_tag LOCUS_31430 304642 304331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 304550 305968 gene locus_tag LOCUS_31440 gene glmU 304550 305968 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_31440 305970 306947 gene locus_tag LOCUS_31450 305970 306947 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_31450 307079 307660 gene locus_tag LOCUS_31460 307079 307660 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_31460 308004 308618 gene locus_tag LOCUS_31470 gene pth 308004 308618 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229969.1 protein_id gnl|my_center|LOCUS_31470 308713 309786 gene locus_tag LOCUS_31480 308713 309786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 309795 310709 gene locus_tag LOCUS_31490 gene cysD 309795 310709 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466878.1 protein_id gnl|my_center|LOCUS_31490 310709 311971 gene locus_tag LOCUS_31500 310709 311971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 312146 313114 gene locus_tag LOCUS_31510 312146 313114 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122762.1 protein_id gnl|my_center|LOCUS_31510 313111 314019 gene locus_tag LOCUS_31520 313111 314019 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390838.1 protein_id gnl|my_center|LOCUS_31520 314019 314810 gene locus_tag LOCUS_31530 314019 314810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 314882 315691 gene locus_tag LOCUS_31540 314882 315691 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230274.1 protein_id gnl|my_center|LOCUS_31540 316648 315713 gene locus_tag LOCUS_31550 316648 315713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 317559 316636 gene locus_tag LOCUS_31560 317559 316636 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_31560 318695 317556 gene locus_tag LOCUS_31570 318695 317556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 320140 318692 gene locus_tag LOCUS_31580 320140 318692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 320934 320134 gene locus_tag LOCUS_31590 320934 320134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 321235 322266 gene locus_tag LOCUS_31600 321235 322266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 323208 322279 gene locus_tag LOCUS_31610 323208 322279 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_31610 324455 323208 gene locus_tag LOCUS_31620 324455 323208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 325587 324859 gene locus_tag LOCUS_31630 325587 324859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 325685 329299 gene locus_tag LOCUS_31640 gene mfd 325685 329299 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_31640 329422 330030 gene locus_tag LOCUS_31650 329422 330030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 330046 331017 gene locus_tag LOCUS_31660 330046 331017 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_31660 331184 332461 gene locus_tag LOCUS_31670 gene eno 331184 332461 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_31670 332466 332921 gene locus_tag LOCUS_31680 332466 332921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31680 333010 333531 gene locus_tag LOCUS_31690 333010 333531 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_31690 333528 334478 gene locus_tag LOCUS_31700 333528 334478 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_31700 334525 335322 gene locus_tag LOCUS_31710 334525 335322 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406360.1 protein_id gnl|my_center|LOCUS_31710 335613 336941 gene locus_tag LOCUS_31720 335613 336941 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_31720 337382 337455 gene locus_tag LOCUS_t00460 337382 337455 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 338128 338913 gene locus_tag LOCUS_31730 338128 338913 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_31730 339115 339342 gene locus_tag LOCUS_31740 339115 339342 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975729.1 protein_id gnl|my_center|LOCUS_31740 340651 339434 gene locus_tag LOCUS_31750 340651 339434 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_31750 342143 340770 gene locus_tag LOCUS_31760 342143 340770 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084957161.1 protein_id gnl|my_center|LOCUS_31760 342650 344020 gene locus_tag LOCUS_31770 342650 344020 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_31770 344125 345363 gene locus_tag LOCUS_31780 344125 345363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 346538 345360 gene locus_tag LOCUS_31790 346538 345360 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086843653.1 protein_id gnl|my_center|LOCUS_31790 346682 346924 gene locus_tag LOCUS_31800 346682 346924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 346958 348097 gene locus_tag LOCUS_31810 346958 348097 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_31810 348611 348171 gene locus_tag LOCUS_31820 348611 348171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 350667 348694 gene locus_tag LOCUS_31830 350667 348694 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_31830 352158 350710 gene locus_tag LOCUS_31840 352158 350710 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_31840 352274 353464 gene locus_tag LOCUS_31850 352274 353464 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403248.1 protein_id gnl|my_center|LOCUS_31850 353909 353526 gene locus_tag LOCUS_31860 353909 353526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 354217 353906 gene locus_tag LOCUS_31870 354217 353906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 354347 355711 gene locus_tag LOCUS_31880 354347 355711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 355760 357124 gene locus_tag LOCUS_31890 355760 357124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 358184 357576 gene locus_tag LOCUS_31900 358184 357576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 359731 358523 gene locus_tag LOCUS_31910 359731 358523 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225403.1 protein_id gnl|my_center|LOCUS_31910 360409 359765 gene locus_tag LOCUS_31920 360409 359765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_31920 362432 360483 gene locus_tag LOCUS_31930 362432 360483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 363341 362439 gene locus_tag LOCUS_31940 363341 362439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 364432 363461 gene locus_tag LOCUS_31950 364432 363461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 364794 364456 gene locus_tag LOCUS_31960 364794 364456 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078066.1 protein_id gnl|my_center|LOCUS_31960 364914 366125 gene locus_tag LOCUS_31970 gene ilvA 364914 366125 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_31970 367467 366163 gene locus_tag LOCUS_31980 367467 366163 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_31980 367448 368350 gene locus_tag LOCUS_31990 367448 368350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 368488 370587 gene locus_tag LOCUS_32000 368488 370587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 371742 370609 gene locus_tag LOCUS_32010 371742 370609 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909511.1 protein_id gnl|my_center|LOCUS_32010 372342 372121 gene locus_tag LOCUS_32020 372342 372121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 373964 372579 gene locus_tag LOCUS_32030 373964 372579 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228803.1 protein_id gnl|my_center|LOCUS_32030 376018 374111 gene locus_tag LOCUS_32040 376018 374111 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_32040 376285 376028 gene locus_tag LOCUS_32050 376285 376028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32050 376625 376416 gene locus_tag LOCUS_32060 376625 376416 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_32060 376964 376758 gene locus_tag LOCUS_32070 376964 376758 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224345.1 protein_id gnl|my_center|LOCUS_32070 377841 376978 gene locus_tag LOCUS_32080 377841 376978 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_32080 377951 378319 gene locus_tag LOCUS_32090 377951 378319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 378350 378901 gene locus_tag LOCUS_32100 378350 378901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 381138 378898 gene locus_tag LOCUS_32110 gene fxsT 381138 378898 CDS product FxSxx-COOH system tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190714.1 protein_id gnl|my_center|LOCUS_32110 379397 379493 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 381446 381135 gene locus_tag LOCUS_32120 381446 381135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 381963 381763 gene locus_tag LOCUS_32130 381963 381763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 382105 383283 gene locus_tag LOCUS_32140 382105 383283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 385466 383292 gene locus_tag LOCUS_32150 385466 383292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 385700 386392 gene locus_tag LOCUS_32160 385700 386392 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804420.1 protein_id gnl|my_center|LOCUS_32160 386389 387981 gene locus_tag LOCUS_32170 386389 387981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 388502 388200 gene locus_tag LOCUS_32180 388502 388200 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_32180 388730 388512 gene locus_tag LOCUS_32190 388730 388512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 389720 388836 gene locus_tag LOCUS_32200 gene mca 389720 388836 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_32200 389849 390289 gene locus_tag LOCUS_32210 389849 390289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 390369 390869 gene locus_tag LOCUS_32220 gene greA 390369 390869 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_32220 391120 392679 gene locus_tag LOCUS_32230 391120 392679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 393309 392692 gene locus_tag LOCUS_32240 393309 392692 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_32240 393614 394153 gene locus_tag LOCUS_32250 393614 394153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229818.1 protein_id gnl|my_center|LOCUS_32250 394533 396335 gene locus_tag LOCUS_32260 394533 396335 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_32260 396748 397509 gene locus_tag LOCUS_32270 396748 397509 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_32270 397752 399116 gene locus_tag LOCUS_32280 397752 399116 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_32280 399712 399149 gene locus_tag LOCUS_32290 399712 399149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 401162 399723 gene locus_tag LOCUS_32300 401162 399723 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224878.1 protein_id gnl|my_center|LOCUS_32300 401837 401199 gene locus_tag LOCUS_32310 gene afsQ1 401837 401199 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_32310 402254 402889 gene locus_tag LOCUS_32320 402254 402889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 403182 405146 gene locus_tag LOCUS_32330 403182 405146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 406556 405156 gene locus_tag LOCUS_32340 406556 405156 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_32340 409095 406612 gene locus_tag LOCUS_32350 409095 406612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 410337 409159 gene locus_tag LOCUS_32360 410337 409159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 412438 410783 gene locus_tag LOCUS_32370 412438 410783 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_32370 413273 412449 gene locus_tag LOCUS_32380 413273 412449 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877118.1 protein_id gnl|my_center|LOCUS_32380 413464 414951 gene locus_tag LOCUS_32390 413464 414951 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_32390 415035 415721 gene locus_tag LOCUS_32400 415035 415721 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_32400 416841 415801 gene locus_tag LOCUS_32410 gene glpX 416841 415801 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_32410 417086 417727 gene locus_tag LOCUS_32420 417086 417727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 417801 418418 gene locus_tag LOCUS_32430 417801 418418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 418704 418423 gene locus_tag LOCUS_32440 418704 418423 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030026.1 protein_id gnl|my_center|LOCUS_32440 418801 419295 gene locus_tag LOCUS_32450 418801 419295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 420484 419270 gene locus_tag LOCUS_32460 gene xseA 420484 419270 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_32460 421663 420524 gene locus_tag LOCUS_32470 421663 420524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 421840 422748 gene locus_tag LOCUS_32480 421840 422748 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296404.1 protein_id gnl|my_center|LOCUS_32480 423209 423610 gene locus_tag LOCUS_32490 423209 423610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 424955 424128 gene locus_tag LOCUS_32500 424955 424128 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226844.1 protein_id gnl|my_center|LOCUS_32500 425245 425859 gene locus_tag LOCUS_32510 425245 425859 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228949.1 protein_id gnl|my_center|LOCUS_32510 426521 425865 gene locus_tag LOCUS_32520 426521 425865 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167022464.1 protein_id gnl|my_center|LOCUS_32520 426626 427525 gene locus_tag LOCUS_32530 426626 427525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 428101 427484 gene locus_tag LOCUS_32540 428101 427484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 429516 428125 gene locus_tag LOCUS_32550 429516 428125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 429596 430684 gene locus_tag LOCUS_32560 gene ychF 429596 430684 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_32560 430844 431638 gene locus_tag LOCUS_32570 430844 431638 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978338.1 protein_id gnl|my_center|LOCUS_32570 432070 432975 gene locus_tag LOCUS_32580 432070 432975 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 protein_id gnl|my_center|LOCUS_32580 433961 434809 gene locus_tag LOCUS_32590 433961 434809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 434861 435145 gene locus_tag LOCUS_32600 434861 435145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 435181 437955 gene locus_tag LOCUS_32610 435181 437955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 437980 440505 gene locus_tag LOCUS_32620 437980 440505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 440502 442901 gene locus_tag LOCUS_32630 440502 442901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 442914 443606 gene locus_tag LOCUS_32640 442914 443606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 443603 444718 gene locus_tag LOCUS_32650 443603 444718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 444890 445291 gene locus_tag LOCUS_32660 444890 445291 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_32660 445485 446891 gene locus_tag LOCUS_32670 445485 446891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 447820 447047 gene locus_tag LOCUS_32680 447820 447047 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_32680 449741 447822 gene locus_tag LOCUS_32690 449741 447822 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_32690 450572 449754 gene locus_tag LOCUS_32700 450572 449754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_32700 450800 450988 gene locus_tag LOCUS_32710 450800 450988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 451425 452633 gene locus_tag LOCUS_32720 451425 452633 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_32720 453181 452639 gene locus_tag LOCUS_32730 453181 452639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 453423 453184 gene locus_tag LOCUS_32740 453423 453184 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559389.1 protein_id gnl|my_center|LOCUS_32740 453546 454349 gene locus_tag LOCUS_32750 453546 454349 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_32750 456453 454354 gene locus_tag LOCUS_32760 456453 454354 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_32760 456514 457404 gene locus_tag LOCUS_32770 gene mshB 456514 457404 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089212260.1 protein_id gnl|my_center|LOCUS_32770 457408 458097 gene locus_tag LOCUS_32780 457408 458097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 458145 458597 gene locus_tag LOCUS_32790 458145 458597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 458771 459745 gene locus_tag LOCUS_32800 458771 459745 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_32800 461152 459767 gene locus_tag LOCUS_32810 gene cysS 461152 459767 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_32810 463063 461222 gene locus_tag LOCUS_32820 463063 461222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 465203 463137 gene locus_tag LOCUS_32830 465203 463137 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_32830 467611 465323 gene locus_tag LOCUS_32840 467611 465323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 468728 467949 gene locus_tag LOCUS_32850 468728 467949 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_32850 469999 468884 gene locus_tag LOCUS_32860 469999 468884 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_32860 470328 470086 gene locus_tag LOCUS_32870 470328 470086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 470408 470758 gene locus_tag LOCUS_32880 470408 470758 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_32880 470764 471855 gene locus_tag LOCUS_32890 gene dapC 470764 471855 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222936.1 protein_id gnl|my_center|LOCUS_32890 471882 472529 gene locus_tag LOCUS_32900 471882 472529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 473442 472507 gene locus_tag LOCUS_32910 473442 472507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091319978.1 protein_id gnl|my_center|LOCUS_32910 473587 474648 gene locus_tag LOCUS_32920 gene dapE 473587 474648 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_32920 475005 475766 gene locus_tag LOCUS_32930 475005 475766 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_32930 475908 476492 gene locus_tag LOCUS_32940 475908 476492 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898770.1 protein_id gnl|my_center|LOCUS_32940 476566 477360 gene locus_tag LOCUS_32950 476566 477360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 477357 477935 gene locus_tag LOCUS_32960 477357 477935 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_32960 478719 477922 gene locus_tag LOCUS_32970 478719 477922 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_32970 479522 478716 gene locus_tag LOCUS_32980 479522 478716 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_32980 480127 479717 gene locus_tag LOCUS_32990 480127 479717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 480205 481671 gene locus_tag LOCUS_33000 480205 481671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 482347 481700 gene locus_tag LOCUS_33010 482347 481700 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_33010 482541 483158 gene locus_tag LOCUS_33020 gene sigE 482541 483158 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_33020 483155 483694 gene locus_tag LOCUS_33030 483155 483694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 483691 484269 gene locus_tag LOCUS_33040 483691 484269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 484375 485949 gene locus_tag LOCUS_33050 484375 485949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 486025 486417 gene locus_tag LOCUS_33060 486025 486417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 487372 486428 gene locus_tag LOCUS_33070 487372 486428 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_33070 488396 487398 gene locus_tag LOCUS_33080 488396 487398 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027748.1 protein_id gnl|my_center|LOCUS_33080 488527 489849 gene locus_tag LOCUS_33090 488527 489849 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_33090 489867 490349 gene locus_tag LOCUS_33100 489867 490349 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_33100 490878 490393 gene locus_tag LOCUS_33110 490878 490393 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897002.1 protein_id gnl|my_center|LOCUS_33110 491027 492166 gene locus_tag LOCUS_33120 491027 492166 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_33120 492526 493632 gene locus_tag LOCUS_33130 492526 493632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 493666 494637 gene locus_tag LOCUS_33140 493666 494637 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803896.1 protein_id gnl|my_center|LOCUS_33140 494725 498276 gene locus_tag LOCUS_33150 494725 498276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 498694 498296 gene locus_tag LOCUS_33160 498694 498296 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223006.1 protein_id gnl|my_center|LOCUS_33160 498849 499406 gene locus_tag LOCUS_33170 498849 499406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_33170 499503 500207 gene locus_tag LOCUS_33180 499503 500207 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229801.1 protein_id gnl|my_center|LOCUS_33180 500214 501122 gene locus_tag LOCUS_33190 500214 501122 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_33190 502050 501160 gene locus_tag LOCUS_33200 502050 501160 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_33200 504062 502242 gene locus_tag LOCUS_33210 504062 502242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 504301 504963 gene locus_tag LOCUS_33220 504301 504963 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_33220 505460 505233 gene locus_tag LOCUS_33230 505460 505233 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223016.1 protein_id gnl|my_center|LOCUS_33230 506291 505671 gene locus_tag LOCUS_33240 506291 505671 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_33240 506653 506414 gene locus_tag LOCUS_33250 506653 506414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 507745 506756 gene locus_tag LOCUS_33260 507745 506756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 507827 508831 gene locus_tag LOCUS_33270 507827 508831 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227088.1 protein_id gnl|my_center|LOCUS_33270 509751 509302 gene locus_tag LOCUS_33280 509751 509302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 510002 510973 gene locus_tag LOCUS_33290 510002 510973 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_33290 511091 512272 gene locus_tag LOCUS_33300 gene moeZ 511091 512272 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_33300 512883 512368 gene locus_tag LOCUS_33310 512883 512368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 512912 513118 gene locus_tag LOCUS_33320 512912 513118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 513357 513049 gene locus_tag LOCUS_33330 513357 513049 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_33330 513830 513333 gene locus_tag LOCUS_33340 513830 513333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 513937 514722 gene locus_tag LOCUS_33350 513937 514722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 514716 516044 gene locus_tag LOCUS_33360 514716 516044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 516132 516974 gene locus_tag LOCUS_33370 516132 516974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 516995 518191 gene locus_tag LOCUS_33380 gene mycP 516995 518191 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_33380 518314 518700 gene locus_tag LOCUS_33390 518314 518700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 518761 519057 gene locus_tag LOCUS_33400 518761 519057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 519132 522230 gene locus_tag LOCUS_33410 519132 522230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 522960 526205 gene locus_tag LOCUS_33420 522960 526205 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223038.1 protein_id gnl|my_center|LOCUS_33420 526199 529543 gene locus_tag LOCUS_33430 gene adnB 526199 529543 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416833.1 protein_id gnl|my_center|LOCUS_33430 530692 529550 gene locus_tag LOCUS_33440 530692 529550 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038170.1 protein_id gnl|my_center|LOCUS_33440 532359 530746 gene locus_tag LOCUS_33450 532359 530746 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_33450 534136 532493 gene locus_tag LOCUS_33460 534136 532493 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038167.1 protein_id gnl|my_center|LOCUS_33460 535299 534133 gene locus_tag LOCUS_33470 535299 534133 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054234.1 protein_id gnl|my_center|LOCUS_33470 535414 536316 gene locus_tag LOCUS_33480 gene nudC 535414 536316 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_33480 536634 536383 gene locus_tag LOCUS_33490 536634 536383 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_33490 537722 536802 gene locus_tag LOCUS_33500 537722 536802 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921634.1 protein_id gnl|my_center|LOCUS_33500 537613 537822 gene locus_tag LOCUS_33510 537613 537822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 537937 540057 gene locus_tag LOCUS_33520 537937 540057 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_33520 540086 540955 gene locus_tag LOCUS_33530 540086 540955 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_33530 541091 541381 gene locus_tag LOCUS_33540 541091 541381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 541519 541785 gene locus_tag LOCUS_33550 541519 541785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 541838 542029 gene locus_tag LOCUS_33560 541838 542029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 543656 542310 gene locus_tag LOCUS_33570 543656 542310 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_33570 544738 543653 gene locus_tag LOCUS_33580 544738 543653 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_33580 545100 545531 gene locus_tag LOCUS_33590 545100 545531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 545528 546205 gene locus_tag LOCUS_33600 545528 546205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 547121 546180 gene locus_tag LOCUS_33610 547121 546180 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230440.1 protein_id gnl|my_center|LOCUS_33610 547012 547299 gene locus_tag LOCUS_33620 547012 547299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 547868 547281 gene locus_tag LOCUS_33630 547868 547281 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_33630 549103 547865 gene locus_tag LOCUS_33640 549103 547865 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_33640 549275 550312 gene locus_tag LOCUS_33650 549275 550312 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_33650 550355 550786 gene locus_tag LOCUS_33660 550355 550786 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_33660 550813 551880 gene locus_tag LOCUS_33670 550813 551880 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_33670 552123 555050 gene locus_tag LOCUS_33680 552123 555050 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_33680 555180 555254 gene locus_tag LOCUS_t00470 555180 555254 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 555459 556055 gene locus_tag LOCUS_33690 555459 556055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 556175 556561 gene locus_tag LOCUS_33700 556175 556561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 557074 556727 gene locus_tag LOCUS_33710 557074 556727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 558360 556990 gene locus_tag LOCUS_33720 558360 556990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 560449 559244 gene locus_tag LOCUS_33730 560449 559244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729905.1 protein_id gnl|my_center|LOCUS_33730 561473 560481 gene locus_tag LOCUS_33740 561473 560481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729908.1 protein_id gnl|my_center|LOCUS_33740 561913 561479 gene locus_tag LOCUS_33750 561913 561479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33750 562425 561910 gene locus_tag LOCUS_33760 562425 561910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33760 564034 562418 gene locus_tag LOCUS_33770 564034 562418 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729906.1 protein_id gnl|my_center|LOCUS_33770 565859 564051 gene locus_tag LOCUS_33780 565859 564051 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729909.1 protein_id gnl|my_center|LOCUS_33780 566858 565887 gene locus_tag LOCUS_33790 566858 565887 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729904.1 protein_id gnl|my_center|LOCUS_33790 569014 567230 gene locus_tag LOCUS_33800 569014 567230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803734.1 protein_id gnl|my_center|LOCUS_33800 569931 569011 gene locus_tag LOCUS_33810 569931 569011 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892452.1 protein_id gnl|my_center|LOCUS_33810 570906 569938 gene locus_tag LOCUS_33820 570906 569938 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727399.1 protein_id gnl|my_center|LOCUS_33820 572506 570911 gene locus_tag LOCUS_33830 572506 570911 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727398.1 protein_id gnl|my_center|LOCUS_33830 573712 572636 gene locus_tag LOCUS_33840 573712 572636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 575022 573745 gene locus_tag LOCUS_33850 575022 573745 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551559.1 protein_id gnl|my_center|LOCUS_33850 576282 575050 gene locus_tag LOCUS_33860 576282 575050 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729911.1 protein_id gnl|my_center|LOCUS_33860 576896 577429 gene locus_tag LOCUS_33870 576896 577429 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_33870 577892 579103 gene locus_tag LOCUS_33880 577892 579103 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_33880 579992 579228 gene locus_tag LOCUS_33890 579992 579228 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877865.1 protein_id gnl|my_center|LOCUS_33890 580273 580755 gene locus_tag LOCUS_33900 580273 580755 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467392.1 protein_id gnl|my_center|LOCUS_33900 580771 581949 gene locus_tag LOCUS_33910 580771 581949 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973241.1 protein_id gnl|my_center|LOCUS_33910 583631 582372 gene locus_tag LOCUS_33920 583631 582372 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_33920 584368 583628 gene locus_tag LOCUS_33930 584368 583628 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283980.1 protein_id gnl|my_center|LOCUS_33930 584499 584984 gene locus_tag LOCUS_33940 584499 584984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 586260 585226 gene locus_tag LOCUS_33950 586260 585226 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061388.1 protein_id gnl|my_center|LOCUS_33950 586715 586257 gene locus_tag LOCUS_33960 586715 586257 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225950675.1 protein_id gnl|my_center|LOCUS_33960 587637 586795 gene locus_tag LOCUS_33970 587637 586795 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063667.1 protein_id gnl|my_center|LOCUS_33970 588015 587644 gene locus_tag LOCUS_33980 588015 587644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 587963 588376 gene locus_tag LOCUS_33990 587963 588376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 588373 589518 gene locus_tag LOCUS_34000 588373 589518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_34000 589515 590975 gene locus_tag LOCUS_34010 589515 590975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_34010 590972 592357 gene locus_tag LOCUS_34020 590972 592357 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_34020 592753 592370 gene locus_tag LOCUS_34030 592753 592370 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529398.1 protein_id gnl|my_center|LOCUS_34030 595023 592813 gene locus_tag LOCUS_34040 595023 592813 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_34040 594982 595629 gene locus_tag LOCUS_34050 594982 595629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 595895 596161 gene locus_tag LOCUS_34060 595895 596161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 596833 598767 gene locus_tag LOCUS_34070 596833 598767 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230654.1 protein_id gnl|my_center|LOCUS_34070 599061 601337 gene locus_tag LOCUS_34080 599061 601337 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731969.1 protein_id gnl|my_center|LOCUS_34080 601405 601770 gene locus_tag LOCUS_34090 601405 601770 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975124.1 protein_id gnl|my_center|LOCUS_34090 601767 602759 gene locus_tag LOCUS_34100 601767 602759 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029244.1 protein_id gnl|my_center|LOCUS_34100 602765 603748 gene locus_tag LOCUS_34110 602765 603748 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_34110 604975 603803 gene locus_tag LOCUS_34120 gene tuf 604975 603803 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 protein_id gnl|my_center|LOCUS_34120 605341 605075 gene locus_tag LOCUS_34130 605341 605075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 605453 606640 gene locus_tag LOCUS_34140 605453 606640 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466963.1 protein_id gnl|my_center|LOCUS_34140 607088 606717 gene locus_tag LOCUS_34150 607088 606717 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065018.1 protein_id gnl|my_center|LOCUS_34150 607454 607813 gene locus_tag LOCUS_34160 607454 607813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 608503 607850 gene locus_tag LOCUS_34170 608503 607850 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_34170 609875 608517 gene locus_tag LOCUS_34180 gene accC 609875 608517 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 protein_id gnl|my_center|LOCUS_34180 610536 609886 gene locus_tag LOCUS_34190 610536 609886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 612215 610533 gene locus_tag LOCUS_34200 612215 610533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 612551 614446 gene locus_tag LOCUS_34210 612551 614446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 614508 614831 gene locus_tag LOCUS_34220 614508 614831 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227257.1 protein_id gnl|my_center|LOCUS_34220 614828 615259 gene locus_tag LOCUS_34230 614828 615259 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973653.1 protein_id gnl|my_center|LOCUS_34230 615256 616506 gene locus_tag LOCUS_34240 615256 616506 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973891.1 protein_id gnl|my_center|LOCUS_34240 616512 617771 gene locus_tag LOCUS_34250 616512 617771 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182663097.1 protein_id gnl|my_center|LOCUS_34250 617810 618073 gene locus_tag LOCUS_34260 617810 618073 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_34260 618079 618558 gene locus_tag LOCUS_34270 618079 618558 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973657.1 protein_id gnl|my_center|LOCUS_34270 618555 619205 gene locus_tag LOCUS_34280 618555 619205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 619306 619686 gene locus_tag LOCUS_34290 619306 619686 CDS product SchA/CurD-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227245.1 protein_id gnl|my_center|LOCUS_34290 619766 620287 gene locus_tag LOCUS_34300 619766 620287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 620581 620279 gene locus_tag LOCUS_34310 620581 620279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 621330 620935 gene locus_tag LOCUS_34320 621330 620935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence005 468 1691 gene locus_tag LOCUS_34330 468 1691 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225761.1 protein_id gnl|my_center|LOCUS_34330 3023 1785 gene locus_tag LOCUS_34340 3023 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3329 4348 gene locus_tag LOCUS_34350 3329 4348 CDS product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 protein_id gnl|my_center|LOCUS_34350 5196 5267 gene locus_tag LOCUS_t00480 5196 5267 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5303 5378 gene locus_tag LOCUS_t00490 5303 5378 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5392 5464 gene locus_tag LOCUS_t00500 5392 5464 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5675 5749 gene locus_tag LOCUS_t00510 5675 5749 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5947 6021 gene locus_tag LOCUS_t00520 5947 6021 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6195 6271 gene locus_tag LOCUS_t00530 6195 6271 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6565 6639 gene locus_tag LOCUS_t00540 6565 6639 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7954 6749 gene locus_tag LOCUS_34360 7954 6749 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029904.1 protein_id gnl|my_center|LOCUS_34360 8010 8477 gene locus_tag LOCUS_34370 8010 8477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 8532 9212 gene locus_tag LOCUS_34380 gene leuE 8532 9212 CDS product leucine efflux protein LeuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192135.1 protein_id gnl|my_center|LOCUS_34380 9459 10112 gene locus_tag LOCUS_34390 9459 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 10302 10970 gene locus_tag LOCUS_34400 10302 10970 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013527.1 protein_id gnl|my_center|LOCUS_34400 11031 11759 gene locus_tag LOCUS_34410 11031 11759 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612370.1 protein_id gnl|my_center|LOCUS_34410 12549 12097 gene locus_tag LOCUS_34420 12549 12097 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_34420 12850 13842 gene locus_tag LOCUS_34430 12850 13842 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227097.1 protein_id gnl|my_center|LOCUS_34430 15017 13860 gene locus_tag LOCUS_34440 15017 13860 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031727.1 protein_id gnl|my_center|LOCUS_34440 15518 16012 gene locus_tag LOCUS_34450 15518 16012 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_34450 17164 16214 gene locus_tag LOCUS_34460 17164 16214 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401873.1 protein_id gnl|my_center|LOCUS_34460 18165 17263 gene locus_tag LOCUS_34470 18165 17263 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727013.1 protein_id gnl|my_center|LOCUS_34470 19583 18189 gene locus_tag LOCUS_34480 19583 18189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_34480 20647 19793 gene locus_tag LOCUS_34490 20647 19793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 protein_id gnl|my_center|LOCUS_34490 21513 20644 gene locus_tag LOCUS_34500 21513 20644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 protein_id gnl|my_center|LOCUS_34500 22800 21526 gene locus_tag LOCUS_34510 22800 21526 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973358.1 protein_id gnl|my_center|LOCUS_34510 23969 22809 gene locus_tag LOCUS_34520 23969 22809 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286312.1 protein_id gnl|my_center|LOCUS_34520 25525 24092 gene locus_tag LOCUS_34530 25525 24092 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_34530 25852 26295 gene locus_tag LOCUS_34540 25852 26295 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_34540 26524 27831 gene locus_tag LOCUS_34550 26524 27831 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803818.1 protein_id gnl|my_center|LOCUS_34550 28488 27841 gene locus_tag LOCUS_34560 28488 27841 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258352.1 protein_id gnl|my_center|LOCUS_34560 29480 28536 gene locus_tag LOCUS_34570 29480 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 30762 29545 gene locus_tag LOCUS_34580 gene rlmN 30762 29545 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_34580 30881 31909 gene locus_tag LOCUS_34590 30881 31909 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200269.1 protein_id gnl|my_center|LOCUS_34590 32888 31929 gene locus_tag LOCUS_34600 32888 31929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34600 34074 33517 gene locus_tag LOCUS_34610 gene frr 34074 33517 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_34610 34854 34084 gene locus_tag LOCUS_34620 gene pyrH 34854 34084 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_34620 35860 35027 gene locus_tag LOCUS_34630 gene tsf 35860 35027 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_34630 36865 35990 gene locus_tag LOCUS_34640 gene rpsB 36865 35990 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_34640 36771 37049 gene locus_tag LOCUS_34650 36771 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 37254 37493 gene locus_tag LOCUS_34660 37254 37493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 37927 37643 gene locus_tag LOCUS_34670 37927 37643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 38010 38612 gene locus_tag LOCUS_34680 38010 38612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34680 38893 39489 gene locus_tag LOCUS_34690 38893 39489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 39913 40224 gene locus_tag LOCUS_34700 39913 40224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34700 41826 40417 gene locus_tag LOCUS_34710 41826 40417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 43771 42113 gene locus_tag LOCUS_34720 43771 42113 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_34720 44125 43772 gene locus_tag LOCUS_34730 44125 43772 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_34730 44912 44589 gene locus_tag LOCUS_34740 44912 44589 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096226.1 protein_id gnl|my_center|LOCUS_34740 45698 45012 gene locus_tag LOCUS_34750 45698 45012 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_34750 46524 45820 gene locus_tag LOCUS_34760 46524 45820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 47426 46521 gene locus_tag LOCUS_34770 47426 46521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34770 47903 47538 gene locus_tag LOCUS_34780 gene rplS 47903 47538 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223853.1 protein_id gnl|my_center|LOCUS_34780 49031 48198 gene locus_tag LOCUS_34790 gene trmD 49031 48198 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_34790 49546 49031 gene locus_tag LOCUS_34800 gene rimM 49546 49031 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142459073.1 protein_id gnl|my_center|LOCUS_34800 50028 49786 gene locus_tag LOCUS_34810 50028 49786 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_34810 50485 50030 gene locus_tag LOCUS_34820 gene rpsP 50485 50030 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728340.1 protein_id gnl|my_center|LOCUS_34820 50947 50810 gene locus_tag LOCUS_34830 50947 50810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 52539 50986 gene locus_tag LOCUS_34840 gene ffh 52539 50986 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_34840 53486 52917 gene locus_tag LOCUS_34850 53486 52917 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224365.1 protein_id gnl|my_center|LOCUS_34850 53889 53506 gene locus_tag LOCUS_34860 53889 53506 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_34860 54317 53895 gene locus_tag LOCUS_34870 54317 53895 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_34870 57529 54314 gene locus_tag LOCUS_34880 57529 54314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 59630 59031 gene locus_tag LOCUS_34890 59630 59031 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_34890 60069 59611 gene locus_tag LOCUS_34900 60069 59611 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973458.1 protein_id gnl|my_center|LOCUS_34900 60537 60124 gene locus_tag LOCUS_34910 60537 60124 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_34910 63335 60543 gene locus_tag LOCUS_34920 63335 60543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 64822 63719 gene locus_tag LOCUS_34930 64822 63719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 65597 65001 gene locus_tag LOCUS_34940 65597 65001 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_34940 65920 65618 gene locus_tag LOCUS_34950 65920 65618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 66438 66016 gene locus_tag LOCUS_34960 66438 66016 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_34960 69039 66730 gene locus_tag LOCUS_34970 69039 66730 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_34970 69400 69062 gene locus_tag LOCUS_34980 69400 69062 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223833.1 protein_id gnl|my_center|LOCUS_34980 70719 69397 gene locus_tag LOCUS_34990 70719 69397 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 protein_id gnl|my_center|LOCUS_34990 72133 71189 gene locus_tag LOCUS_35000 72133 71189 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_35000 73495 72335 gene locus_tag LOCUS_35010 gene hutI 73495 72335 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_35010 74937 73492 gene locus_tag LOCUS_35020 74937 73492 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727478.1 protein_id gnl|my_center|LOCUS_35020 76313 74976 gene locus_tag LOCUS_35030 76313 74976 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_35030 78117 76537 gene locus_tag LOCUS_35040 78117 76537 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_35040 78740 78477 gene locus_tag LOCUS_35050 78740 78477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 80446 79094 gene locus_tag LOCUS_35060 80446 79094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 81458 80577 gene locus_tag LOCUS_35070 81458 80577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 81893 83041 gene locus_tag LOCUS_35080 gene gcvT 81893 83041 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_35080 83038 83427 gene locus_tag LOCUS_35090 gene gcvH 83038 83427 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_35090 83670 85046 gene locus_tag LOCUS_35100 83670 85046 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_35100 85547 86770 gene locus_tag LOCUS_35110 85547 86770 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229894.1 protein_id gnl|my_center|LOCUS_35110 86757 88085 gene locus_tag LOCUS_35120 86757 88085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 90634 88097 gene locus_tag LOCUS_35130 90634 88097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 90812 91027 gene locus_tag LOCUS_35140 90812 91027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 91614 91234 gene locus_tag LOCUS_35150 91614 91234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 91848 93881 gene locus_tag LOCUS_35160 91848 93881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 94647 96146 gene locus_tag LOCUS_35170 94647 96146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 96560 96048 gene locus_tag LOCUS_35180 96560 96048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 97255 96563 gene locus_tag LOCUS_35190 97255 96563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 97464 98699 gene locus_tag LOCUS_35200 97464 98699 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_35200 99055 98729 gene locus_tag LOCUS_35210 99055 98729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 99307 99783 gene locus_tag LOCUS_35220 gene bcp 99307 99783 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_35220 99832 100026 gene locus_tag LOCUS_35230 99832 100026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 100017 100091 gene locus_tag LOCUS_t00550 100017 100091 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 100388 101584 gene locus_tag LOCUS_35240 100388 101584 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_35240 101581 102270 gene locus_tag LOCUS_35250 101581 102270 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_35250 102461 103231 gene locus_tag LOCUS_35260 102461 103231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_35260 103235 105769 gene locus_tag LOCUS_35270 103235 105769 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_35270 106087 105815 gene locus_tag LOCUS_35280 106087 105815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 106921 106148 gene locus_tag LOCUS_35290 106921 106148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 107657 107046 gene locus_tag LOCUS_35300 gene rdgB 107657 107046 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_35300 108391 107654 gene locus_tag LOCUS_35310 gene rph 108391 107654 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_35310 109140 108388 gene locus_tag LOCUS_35320 109140 108388 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_35320 110025 109150 gene locus_tag LOCUS_35330 gene murI 110025 109150 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908178.1 protein_id gnl|my_center|LOCUS_35330 110938 110123 gene locus_tag LOCUS_35340 110938 110123 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327314.1 protein_id gnl|my_center|LOCUS_35340 111562 111071 gene locus_tag LOCUS_35350 111562 111071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 111605 113095 gene locus_tag LOCUS_35360 111605 113095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 113970 113179 gene locus_tag LOCUS_35370 113970 113179 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228128.1 protein_id gnl|my_center|LOCUS_35370 115051 114104 gene locus_tag LOCUS_35380 115051 114104 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_35380 115358 115080 gene locus_tag LOCUS_35390 115358 115080 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_35390 116085 115672 gene locus_tag LOCUS_35400 116085 115672 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 protein_id gnl|my_center|LOCUS_35400 116629 116096 gene locus_tag LOCUS_35410 116629 116096 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_35410 116924 116694 gene locus_tag LOCUS_35420 116924 116694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 117048 118355 gene locus_tag LOCUS_35430 117048 118355 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_35430 118405 118980 gene locus_tag LOCUS_35440 118405 118980 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_35440 119467 118991 gene locus_tag LOCUS_35450 119467 118991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 121349 119589 gene locus_tag LOCUS_35460 121349 119589 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929967.1 protein_id gnl|my_center|LOCUS_35460 121304 121231 gene locus_tag LOCUS_t00560 121304 121231 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 122194 121430 gene locus_tag LOCUS_35470 122194 121430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 123257 122358 gene locus_tag LOCUS_35480 123257 122358 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229676.1 protein_id gnl|my_center|LOCUS_35480 123765 123517 gene locus_tag LOCUS_35490 123765 123517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 125422 123941 gene locus_tag LOCUS_35500 125422 123941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_35500 126343 125765 gene locus_tag LOCUS_35510 126343 125765 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_35510 127906 126497 gene locus_tag LOCUS_35520 127906 126497 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_35520 129190 128255 gene locus_tag LOCUS_35530 129190 128255 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223501.1 protein_id gnl|my_center|LOCUS_35530 130982 129315 gene locus_tag LOCUS_35540 130982 129315 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_35540 131170 132948 gene locus_tag LOCUS_35550 131170 132948 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229919.1 protein_id gnl|my_center|LOCUS_35550 133780 133085 gene locus_tag LOCUS_35560 133780 133085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 134110 135426 gene locus_tag LOCUS_35570 134110 135426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 135434 136228 gene locus_tag LOCUS_35580 135434 136228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 137242 136256 gene locus_tag LOCUS_35590 gene meaB 137242 136256 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_35590 138476 137289 gene locus_tag LOCUS_35600 138476 137289 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_35600 138580 139008 gene locus_tag LOCUS_35610 gene mce 138580 139008 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_35610 139283 140611 gene locus_tag LOCUS_35620 139283 140611 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068425.1 protein_id gnl|my_center|LOCUS_35620 140809 142059 gene locus_tag LOCUS_35630 140809 142059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 142871 142092 gene locus_tag LOCUS_35640 142871 142092 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_35640 143703 142993 gene locus_tag LOCUS_35650 143703 142993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 144058 143729 gene locus_tag LOCUS_35660 144058 143729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 144240 144899 gene locus_tag LOCUS_35670 gene nucS 144240 144899 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_35670 145036 145878 gene locus_tag LOCUS_35680 145036 145878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230181.1 protein_id gnl|my_center|LOCUS_35680 146011 146862 gene locus_tag LOCUS_35690 146011 146862 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227225.1 protein_id gnl|my_center|LOCUS_35690 146871 148136 gene locus_tag LOCUS_35700 146871 148136 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230183.1 protein_id gnl|my_center|LOCUS_35700 148136 148789 gene locus_tag LOCUS_35710 148136 148789 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_35710 148872 150356 gene locus_tag LOCUS_35720 148872 150356 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_35720 150479 151042 gene locus_tag LOCUS_35730 150479 151042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 151261 151824 gene locus_tag LOCUS_35740 151261 151824 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_35740 152256 151861 gene locus_tag LOCUS_35750 152256 151861 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_35750 152683 152282 gene locus_tag LOCUS_35760 152683 152282 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_35760 154167 152734 gene locus_tag LOCUS_35770 gene atpD 154167 152734 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896328.1 protein_id gnl|my_center|LOCUS_35770 155071 154169 gene locus_tag LOCUS_35780 155071 154169 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229523.1 protein_id gnl|my_center|LOCUS_35780 156727 155075 gene locus_tag LOCUS_35790 gene atpA 156727 155075 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896330.1 protein_id gnl|my_center|LOCUS_35790 157567 156767 gene locus_tag LOCUS_35800 157567 156767 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_35800 158207 157653 gene locus_tag LOCUS_35810 158207 157653 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_35810 158472 158242 gene locus_tag LOCUS_35820 gene atpE 158472 158242 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_35820 159382 158564 gene locus_tag LOCUS_35830 gene atpB 159382 158564 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_35830 159656 159441 gene locus_tag LOCUS_35840 159656 159441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 160154 159729 gene locus_tag LOCUS_35850 160154 159729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 161975 160338 gene locus_tag LOCUS_35860 161975 160338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 163295 162036 gene locus_tag LOCUS_35870 163295 162036 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 protein_id gnl|my_center|LOCUS_35870 163976 163590 gene locus_tag LOCUS_35880 163976 163590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 165677 163989 gene locus_tag LOCUS_35890 165677 163989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 166935 165814 gene locus_tag LOCUS_35900 166935 165814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 167882 167028 gene locus_tag LOCUS_35910 gene prmC 167882 167028 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_35910 168948 167893 gene locus_tag LOCUS_35920 gene prfA 168948 167893 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_35920 169369 169157 gene locus_tag LOCUS_35930 gene rpmE 169369 169157 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775950.1 protein_id gnl|my_center|LOCUS_35930 171739 169766 gene locus_tag LOCUS_35940 gene rho 171739 169766 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030205.1 protein_id gnl|my_center|LOCUS_35940 171729 172196 gene locus_tag LOCUS_35950 171729 172196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 173242 172211 gene locus_tag LOCUS_35960 gene thrB 173242 172211 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_35960 174333 173275 gene locus_tag LOCUS_35970 gene thrC 174333 173275 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_35970 174937 176523 gene locus_tag LOCUS_35980 174937 176523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 178310 176541 gene locus_tag LOCUS_35990 178310 176541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 178468 178307 gene locus_tag LOCUS_36000 178468 178307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 179619 178465 gene locus_tag LOCUS_36010 179619 178465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 181198 179882 gene locus_tag LOCUS_36020 181198 179882 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_36020 182634 181213 gene locus_tag LOCUS_36030 gene lysA 182634 181213 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_36030 183521 183027 gene locus_tag LOCUS_36040 183521 183027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 183897 183658 gene locus_tag LOCUS_36050 183897 183658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 184416 184057 gene locus_tag LOCUS_36060 184416 184057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 186785 185079 gene locus_tag LOCUS_36070 gene treS 186785 185079 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_36070 188712 187048 gene locus_tag LOCUS_36080 188712 187048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 188843 190912 gene locus_tag LOCUS_36090 188843 190912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 191371 190961 gene locus_tag LOCUS_36100 191371 190961 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 protein_id gnl|my_center|LOCUS_36100 191438 192130 gene locus_tag LOCUS_36110 191438 192130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 194393 192132 gene locus_tag LOCUS_36120 194393 192132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 195204 194452 gene locus_tag LOCUS_36130 195204 194452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_36130 195747 195241 gene locus_tag LOCUS_36140 195747 195241 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225030.1 protein_id gnl|my_center|LOCUS_36140 195876 197132 gene locus_tag LOCUS_36150 195876 197132 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 protein_id gnl|my_center|LOCUS_36150 197289 198617 gene locus_tag LOCUS_36160 197289 198617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_36160 198630 200177 gene locus_tag LOCUS_36170 198630 200177 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_36170 200221 201126 gene locus_tag LOCUS_36180 200221 201126 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_36180 201324 201986 gene locus_tag LOCUS_36190 201324 201986 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223644.1 protein_id gnl|my_center|LOCUS_36190 202020 202310 gene locus_tag LOCUS_36200 202020 202310 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726762.1 protein_id gnl|my_center|LOCUS_36200 203300 202320 gene locus_tag LOCUS_36210 203300 202320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811522.1 protein_id gnl|my_center|LOCUS_36210 204090 203320 gene locus_tag LOCUS_36220 204090 203320 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222334.1 protein_id gnl|my_center|LOCUS_36220 205576 204233 gene locus_tag LOCUS_36230 205576 204233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 207151 205850 gene locus_tag LOCUS_36240 207151 205850 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_36240 208100 209029 gene locus_tag LOCUS_36250 208100 209029 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_36250 209239 209736 gene locus_tag LOCUS_36260 209239 209736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 210684 209812 gene locus_tag LOCUS_36270 210684 209812 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052908.1 protein_id gnl|my_center|LOCUS_36270 211774 210686 gene locus_tag LOCUS_36280 211774 210686 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_36280 213016 211778 gene locus_tag LOCUS_36290 213016 211778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 214043 213039 gene locus_tag LOCUS_36300 214043 213039 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_36300 214201 216267 gene locus_tag LOCUS_36310 214201 216267 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_36310 216645 216274 gene locus_tag LOCUS_36320 216645 216274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 217291 217043 gene locus_tag LOCUS_36330 217291 217043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 217508 217284 gene locus_tag LOCUS_36340 217508 217284 CDS product DUF6158 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030977.1 protein_id gnl|my_center|LOCUS_36340 217893 217537 gene locus_tag LOCUS_36350 217893 217537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 217892 218935 gene locus_tag LOCUS_36360 217892 218935 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_36360 219523 219023 gene locus_tag LOCUS_36370 219523 219023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 220008 220244 gene locus_tag LOCUS_36380 220008 220244 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230745.1 protein_id gnl|my_center|LOCUS_36380 221607 220519 gene locus_tag LOCUS_36390 221607 220519 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029660.1 protein_id gnl|my_center|LOCUS_36390 222397 221936 gene locus_tag LOCUS_36400 222397 221936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 223864 222815 gene locus_tag LOCUS_36410 223864 222815 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224650.1 protein_id gnl|my_center|LOCUS_36410 225363 224041 gene locus_tag LOCUS_36420 225363 224041 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031701.1 protein_id gnl|my_center|LOCUS_36420 226335 225772 gene locus_tag LOCUS_36430 226335 225772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 226348 227748 gene locus_tag LOCUS_36440 gene lpdA 226348 227748 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_36440 228501 227848 gene locus_tag LOCUS_36450 228501 227848 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522757.1 protein_id gnl|my_center|LOCUS_36450 229010 228495 gene locus_tag LOCUS_36460 229010 228495 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_36460 230099 229191 gene locus_tag LOCUS_36470 230099 229191 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226103.1 protein_id gnl|my_center|LOCUS_36470 230129 230563 gene locus_tag LOCUS_36480 gene rplK 230129 230563 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 protein_id gnl|my_center|LOCUS_36480 231333 230590 gene locus_tag LOCUS_36490 231333 230590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 232606 231344 gene locus_tag LOCUS_36500 232606 231344 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116948659.1 protein_id gnl|my_center|LOCUS_36500 233392 232724 gene locus_tag LOCUS_36510 233392 232724 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229632.1 protein_id gnl|my_center|LOCUS_36510 234540 233389 gene locus_tag LOCUS_36520 234540 233389 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229631.1 protein_id gnl|my_center|LOCUS_36520 235030 234812 gene locus_tag LOCUS_36530 235030 234812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 235568 235347 gene locus_tag LOCUS_36540 235568 235347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 236424 235588 gene locus_tag LOCUS_36550 236424 235588 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971565.1 protein_id gnl|my_center|LOCUS_36550 238176 237286 gene locus_tag LOCUS_36560 238176 237286 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230653.1 protein_id gnl|my_center|LOCUS_36560 240162 238216 gene locus_tag LOCUS_36570 240162 238216 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028768.1 protein_id gnl|my_center|LOCUS_36570 240300 241130 gene locus_tag LOCUS_36580 240300 241130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 242199 241396 gene locus_tag LOCUS_36590 242199 241396 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027452.1 protein_id gnl|my_center|LOCUS_36590 243103 242516 gene locus_tag LOCUS_36600 243103 242516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 243578 243360 gene locus_tag LOCUS_36610 243578 243360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 243669 244829 gene locus_tag LOCUS_36620 243669 244829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 245117 244869 gene locus_tag LOCUS_36630 245117 244869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 245349 246293 gene locus_tag LOCUS_36640 245349 246293 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877324.1 protein_id gnl|my_center|LOCUS_36640 247032 246379 gene locus_tag LOCUS_36650 247032 246379 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 protein_id gnl|my_center|LOCUS_36650 247313 247029 gene locus_tag LOCUS_36660 247313 247029 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391158.1 protein_id gnl|my_center|LOCUS_36660 247492 249192 gene locus_tag LOCUS_36670 247492 249192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 251264 249189 gene locus_tag LOCUS_36680 251264 249189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 251151 251489 gene locus_tag LOCUS_36690 251151 251489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 251632 251805 gene locus_tag LOCUS_36700 251632 251805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 252879 251983 gene locus_tag LOCUS_36710 252879 251983 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067240.1 protein_id gnl|my_center|LOCUS_36710 253973 252876 gene locus_tag LOCUS_36720 253973 252876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_36720 254512 253970 gene locus_tag LOCUS_36730 254512 253970 CDS product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 protein_id gnl|my_center|LOCUS_36730 254921 254673 gene locus_tag LOCUS_36740 254921 254673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 255394 255167 gene locus_tag LOCUS_36750 255394 255167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 255299 256123 gene locus_tag LOCUS_36760 255299 256123 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200876252.1 protein_id gnl|my_center|LOCUS_36760 257708 256251 gene locus_tag LOCUS_36770 gene mftF 257708 256251 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112043.1 protein_id gnl|my_center|LOCUS_36770 258760 257912 gene locus_tag LOCUS_36780 258760 257912 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_36780 260325 259036 gene locus_tag LOCUS_36790 260325 259036 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244067.1 protein_id gnl|my_center|LOCUS_36790 261514 260399 gene locus_tag LOCUS_36800 261514 260399 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416075.1 protein_id gnl|my_center|LOCUS_36800 262553 261588 gene locus_tag LOCUS_36810 262553 261588 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224046.1 protein_id gnl|my_center|LOCUS_36810 264024 262540 gene locus_tag LOCUS_36820 264024 262540 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193515.1 protein_id gnl|my_center|LOCUS_36820 265147 264038 gene locus_tag LOCUS_36830 265147 264038 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894835.1 protein_id gnl|my_center|LOCUS_36830 266449 265316 gene locus_tag LOCUS_36840 266449 265316 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_36840 267576 266446 gene locus_tag LOCUS_36850 267576 266446 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210652.1 protein_id gnl|my_center|LOCUS_36850 268424 267573 gene locus_tag LOCUS_36860 268424 267573 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_36860 269445 268432 gene locus_tag LOCUS_36870 269445 268432 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808548.1 protein_id gnl|my_center|LOCUS_36870 270947 269442 gene locus_tag LOCUS_36880 270947 269442 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459198.1 protein_id gnl|my_center|LOCUS_36880 271637 271425 gene locus_tag LOCUS_36890 271637 271425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 271767 272882 gene locus_tag LOCUS_36900 271767 272882 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_36900 272907 273911 gene locus_tag LOCUS_36910 272907 273911 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487479.1 protein_id gnl|my_center|LOCUS_36910 274167 275315 gene locus_tag LOCUS_36920 274167 275315 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 protein_id gnl|my_center|LOCUS_36920 276985 275501 gene locus_tag LOCUS_36930 276985 275501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726877.1 protein_id gnl|my_center|LOCUS_36930 277545 277123 gene locus_tag LOCUS_36940 277545 277123 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929743.1 protein_id gnl|my_center|LOCUS_36940 278705 277551 gene locus_tag LOCUS_36950 278705 277551 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807887.1 protein_id gnl|my_center|LOCUS_36950 279406 278714 gene locus_tag LOCUS_36960 279406 278714 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727992.1 protein_id gnl|my_center|LOCUS_36960 280125 279403 gene locus_tag LOCUS_36970 280125 279403 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727991.1 protein_id gnl|my_center|LOCUS_36970 281205 280282 gene locus_tag LOCUS_36980 281205 280282 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728080.1 protein_id gnl|my_center|LOCUS_36980 282121 281270 gene locus_tag LOCUS_36990 282121 281270 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064205.1 protein_id gnl|my_center|LOCUS_36990 282226 283014 gene locus_tag LOCUS_37000 282226 283014 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728083.1 protein_id gnl|my_center|LOCUS_37000 284938 282941 gene locus_tag LOCUS_37010 284938 282941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 285696 284935 gene locus_tag LOCUS_37020 285696 284935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230976.1 protein_id gnl|my_center|LOCUS_37020 286412 285810 gene locus_tag LOCUS_37030 286412 285810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 287659 286649 gene locus_tag LOCUS_37040 287659 286649 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977058.1 protein_id gnl|my_center|LOCUS_37040 289002 287710 gene locus_tag LOCUS_37050 289002 287710 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_37050 290357 289905 gene locus_tag LOCUS_37060 290357 289905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 291866 291159 gene locus_tag LOCUS_37070 291866 291159 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227772.1 protein_id gnl|my_center|LOCUS_37070 292084 291866 gene locus_tag LOCUS_37080 292084 291866 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227773.1 protein_id gnl|my_center|LOCUS_37080 293476 292439 gene locus_tag LOCUS_37090 293476 292439 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978698.1 protein_id gnl|my_center|LOCUS_37090 294562 293750 gene locus_tag LOCUS_37100 294562 293750 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_37100 294837 295742 gene locus_tag LOCUS_37110 294837 295742 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226150.1 protein_id gnl|my_center|LOCUS_37110 296430 295948 gene locus_tag LOCUS_37120 296430 295948 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230349.1 protein_id gnl|my_center|LOCUS_37120 297767 296427 gene locus_tag LOCUS_37130 297767 296427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 298996 297785 gene locus_tag LOCUS_37140 298996 297785 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259309.1 protein_id gnl|my_center|LOCUS_37140 299077 299628 gene locus_tag LOCUS_37150 299077 299628 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943415.1 protein_id gnl|my_center|LOCUS_37150 299733 300884 gene locus_tag LOCUS_37160 299733 300884 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815690.1 protein_id gnl|my_center|LOCUS_37160 301528 301454 gene locus_tag LOCUS_t00570 301528 301454 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 301679 302056 gene locus_tag LOCUS_37170 301679 302056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37170 302229 302945 gene locus_tag LOCUS_37180 302229 302945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 304236 303364 gene locus_tag LOCUS_37190 304236 303364 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728195.1 protein_id gnl|my_center|LOCUS_37190 304520 305764 gene locus_tag LOCUS_37200 304520 305764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224314.1 protein_id gnl|my_center|LOCUS_37200 305848 306831 gene locus_tag LOCUS_37210 305848 306831 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224315.1 protein_id gnl|my_center|LOCUS_37210 306828 307685 gene locus_tag LOCUS_37220 306828 307685 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224316.1 protein_id gnl|my_center|LOCUS_37220 307846 309216 gene locus_tag LOCUS_37230 307846 309216 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_37230 309213 310217 gene locus_tag LOCUS_37240 309213 310217 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031126.1 protein_id gnl|my_center|LOCUS_37240 310818 310225 gene locus_tag LOCUS_37250 310818 310225 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_37250 312131 310815 gene locus_tag LOCUS_37260 312131 310815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 312995 312168 gene locus_tag LOCUS_37270 312995 312168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_37270 313978 312992 gene locus_tag LOCUS_37280 313978 312992 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_37280 314586 314101 gene locus_tag LOCUS_37290 314586 314101 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_37290 315113 315286 gene locus_tag LOCUS_37300 315113 315286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 315573 315265 gene locus_tag LOCUS_37310 315573 315265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 315606 316472 gene locus_tag LOCUS_37320 315606 316472 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_37320 316608 316919 gene locus_tag LOCUS_37330 316608 316919 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224358.1 protein_id gnl|my_center|LOCUS_37330 317111 316920 gene locus_tag LOCUS_37340 317111 316920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 319124 317346 gene locus_tag LOCUS_37350 gene ggt 319124 317346 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 protein_id gnl|my_center|LOCUS_37350 319358 320380 gene locus_tag LOCUS_37360 319358 320380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 320713 320444 gene locus_tag LOCUS_37370 320713 320444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 320658 322193 gene locus_tag LOCUS_37380 320658 322193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 323431 322316 gene locus_tag LOCUS_37390 gene ald 323431 322316 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229678.1 protein_id gnl|my_center|LOCUS_37390 323917 325272 gene locus_tag LOCUS_37400 323917 325272 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805011.1 protein_id gnl|my_center|LOCUS_37400 326319 325387 gene locus_tag LOCUS_37410 326319 325387 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229285.1 protein_id gnl|my_center|LOCUS_37410 326451 327779 gene locus_tag LOCUS_37420 326451 327779 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730275.1 protein_id gnl|my_center|LOCUS_37420 327763 328506 gene locus_tag LOCUS_37430 327763 328506 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_37430 329523 328447 gene locus_tag LOCUS_37440 329523 328447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 333830 329520 gene locus_tag LOCUS_37450 333830 329520 CDS product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726878.1 protein_id gnl|my_center|LOCUS_37450 335178 333850 gene locus_tag LOCUS_37460 335178 333850 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841211.1 protein_id gnl|my_center|LOCUS_37460 335413 335282 gene locus_tag LOCUS_37470 335413 335282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 337131 335542 gene locus_tag LOCUS_37480 337131 335542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095415.1 protein_id gnl|my_center|LOCUS_37480 339376 337133 gene locus_tag LOCUS_37490 339376 337133 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727059.1 protein_id gnl|my_center|LOCUS_37490 340384 339473 gene locus_tag LOCUS_37500 340384 339473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 340347 341219 gene locus_tag LOCUS_37510 340347 341219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 341277 342377 gene locus_tag LOCUS_37520 341277 342377 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028175.1 protein_id gnl|my_center|LOCUS_37520 342778 342419 gene locus_tag LOCUS_37530 342778 342419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 343350 342965 gene locus_tag LOCUS_tm00010 343350 342965 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 345679 343811 gene locus_tag LOCUS_37540 345679 343811 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284244.1 protein_id gnl|my_center|LOCUS_37540 346239 345760 gene locus_tag LOCUS_37550 gene smpB 346239 345760 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_37550 347170 346262 gene locus_tag LOCUS_37560 gene ftsX 347170 346262 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_37560 347888 347199 gene locus_tag LOCUS_37570 gene ftsE 347888 347199 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_37570 348149 348343 gene locus_tag LOCUS_37580 348149 348343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 349543 348425 gene locus_tag LOCUS_37590 gene prfB 349543 348425 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_37590 349635 350723 gene locus_tag LOCUS_37600 349635 350723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 355760 350787 gene locus_tag LOCUS_37610 355760 350787 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_37610 358041 356125 gene locus_tag LOCUS_37620 358041 356125 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_37620 358960 358253 gene locus_tag LOCUS_37630 358960 358253 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228563.1 protein_id gnl|my_center|LOCUS_37630 359786 359139 gene locus_tag LOCUS_37640 359786 359139 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_37640 360338 359832 gene locus_tag LOCUS_37650 360338 359832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_37650 361037 360345 gene locus_tag LOCUS_37660 361037 360345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 362432 361077 gene locus_tag LOCUS_37670 362432 361077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 363550 362471 gene locus_tag LOCUS_37680 363550 362471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37680 364382 364155 gene locus_tag LOCUS_37690 364382 364155 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224593.1 protein_id gnl|my_center|LOCUS_37690 364270 364497 gene locus_tag LOCUS_37700 364270 364497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 365519 364494 gene locus_tag LOCUS_37710 365519 364494 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256998.1 protein_id gnl|my_center|LOCUS_37710 365618 366394 gene locus_tag LOCUS_37720 365618 366394 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230307.1 protein_id gnl|my_center|LOCUS_37720 366603 367085 gene locus_tag LOCUS_37730 366603 367085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 369965 367170 gene locus_tag LOCUS_37740 gene secA 369965 367170 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_37740 370264 370626 gene locus_tag LOCUS_37750 370264 370626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 370750 372102 gene locus_tag LOCUS_37760 370750 372102 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_37760 372799 372095 gene locus_tag LOCUS_37770 372799 372095 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_37770 373626 372919 gene locus_tag LOCUS_37780 gene raiA 373626 372919 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121791.1 protein_id gnl|my_center|LOCUS_37780 374907 374164 gene locus_tag LOCUS_37790 374907 374164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 376795 374987 gene locus_tag LOCUS_37800 376795 374987 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_37800 378902 376782 gene locus_tag LOCUS_37810 378902 376782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 379599 378922 gene locus_tag LOCUS_37820 gene mtrA 379599 378922 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_37820 380214 381188 gene locus_tag LOCUS_37830 380214 381188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495859.1 protein_id gnl|my_center|LOCUS_37830 381181 381840 gene locus_tag LOCUS_37840 381181 381840 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092089.1 protein_id gnl|my_center|LOCUS_37840 381837 383033 gene locus_tag LOCUS_37850 381837 383033 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139569.1 protein_id gnl|my_center|LOCUS_37850 383158 384186 gene locus_tag LOCUS_37860 383158 384186 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731130.1 protein_id gnl|my_center|LOCUS_37860 384186 385514 gene locus_tag LOCUS_37870 384186 385514 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731131.1 protein_id gnl|my_center|LOCUS_37870 386553 385558 gene locus_tag LOCUS_37880 386553 385558 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 protein_id gnl|my_center|LOCUS_37880 386694 387608 gene locus_tag LOCUS_37890 386694 387608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 389013 387760 gene locus_tag LOCUS_37900 gene ahcY 389013 387760 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_37900 390448 389018 gene locus_tag LOCUS_37910 gene ahcY 390448 389018 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_37910 390610 390942 gene locus_tag LOCUS_37920 390610 390942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 391974 391003 gene locus_tag LOCUS_37930 391974 391003 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_37930 393160 392045 gene locus_tag LOCUS_37940 393160 392045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 393336 393163 gene locus_tag LOCUS_37950 393336 393163 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_37950 394712 393345 gene locus_tag LOCUS_37960 394712 393345 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_37960 395285 394917 gene locus_tag LOCUS_37970 395285 394917 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_37970 395491 395886 gene locus_tag LOCUS_37980 395491 395886 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_37980 396318 396058 gene locus_tag LOCUS_37990 396318 396058 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_37990 398678 396612 gene locus_tag LOCUS_38000 398678 396612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 399026 399964 gene locus_tag LOCUS_38010 gene cofD 399026 399964 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_38010 399961 401250 gene locus_tag LOCUS_38020 399961 401250 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_38020 401431 402327 gene locus_tag LOCUS_38030 401431 402327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 402335 403438 gene locus_tag LOCUS_38040 402335 403438 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_38040 404002 403601 gene locus_tag LOCUS_38050 404002 403601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 404807 404397 gene locus_tag LOCUS_38060 404807 404397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 404944 405192 gene locus_tag LOCUS_38070 404944 405192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 405253 405426 gene locus_tag LOCUS_38080 405253 405426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 405520 406383 gene locus_tag LOCUS_38090 405520 406383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 406415 407470 gene locus_tag LOCUS_38100 406415 407470 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_38100 407681 408781 gene locus_tag LOCUS_38110 407681 408781 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_38110 408797 409750 gene locus_tag LOCUS_38120 408797 409750 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_38120 409836 412439 gene locus_tag LOCUS_38130 409836 412439 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_38130 412623 413225 gene locus_tag LOCUS_38140 412623 413225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 413471 414868 gene locus_tag LOCUS_38150 gene uxaC 413471 414868 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338259.1 protein_id gnl|my_center|LOCUS_38150 414905 415930 gene locus_tag LOCUS_38160 414905 415930 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226270.1 protein_id gnl|my_center|LOCUS_38160 415927 417138 gene locus_tag LOCUS_38170 415927 417138 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920653.1 protein_id gnl|my_center|LOCUS_38170 417214 418536 gene locus_tag LOCUS_38180 417214 418536 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037467968.1 protein_id gnl|my_center|LOCUS_38180 420178 418856 gene locus_tag LOCUS_38190 420178 418856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 420896 420297 gene locus_tag LOCUS_38200 420896 420297 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 protein_id gnl|my_center|LOCUS_38200 421360 421013 gene locus_tag LOCUS_38210 421360 421013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 421691 421374 gene locus_tag LOCUS_38220 421691 421374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 424092 421723 gene locus_tag LOCUS_38230 424092 421723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 424337 425824 gene locus_tag LOCUS_38240 424337 425824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 426253 427938 gene locus_tag LOCUS_38250 426253 427938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 428809 428324 gene locus_tag LOCUS_38260 428809 428324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 429051 430433 gene locus_tag LOCUS_38270 429051 430433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 430630 431439 gene locus_tag LOCUS_38280 430630 431439 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_38280 432349 431447 gene locus_tag LOCUS_38290 432349 431447 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_38290 433279 432512 gene locus_tag LOCUS_38300 433279 432512 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_38300 434315 433257 gene locus_tag LOCUS_38310 434315 433257 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976203.1 protein_id gnl|my_center|LOCUS_38310 435108 434359 gene locus_tag LOCUS_38320 435108 434359 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_38320 435845 435228 gene locus_tag LOCUS_38330 435845 435228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 437584 435845 gene locus_tag LOCUS_38340 437584 435845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 438096 439520 gene locus_tag LOCUS_38350 438096 439520 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_38350 440539 439541 gene locus_tag LOCUS_38360 440539 439541 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393321.1 protein_id gnl|my_center|LOCUS_38360 440730 442343 gene locus_tag LOCUS_38370 440730 442343 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_38370 443267 442362 gene locus_tag LOCUS_38380 443267 442362 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_38380 444788 443472 gene locus_tag LOCUS_38390 444788 443472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 444912 445379 gene locus_tag LOCUS_38400 444912 445379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 445995 445345 gene locus_tag LOCUS_38410 445995 445345 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731339.1 protein_id gnl|my_center|LOCUS_38410 446076 446816 gene locus_tag LOCUS_38420 446076 446816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 446975 447619 gene locus_tag LOCUS_38430 446975 447619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 448269 447625 gene locus_tag LOCUS_38440 448269 447625 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_38440 449465 448266 gene locus_tag LOCUS_38450 449465 448266 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_38450 450837 449713 gene locus_tag LOCUS_38460 450837 449713 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_38460 451144 452463 gene locus_tag LOCUS_38470 451144 452463 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_38470 453407 452466 gene locus_tag LOCUS_38480 453407 452466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 454264 453413 gene locus_tag LOCUS_38490 454264 453413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 454886 454332 gene locus_tag LOCUS_38500 gene purE 454886 454332 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_38500 456079 454889 gene locus_tag LOCUS_38510 456079 454889 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219537380.1 protein_id gnl|my_center|LOCUS_38510 456327 456887 gene locus_tag LOCUS_38520 456327 456887 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028743.1 protein_id gnl|my_center|LOCUS_38520 458354 457080 gene locus_tag LOCUS_38530 gene draK 458354 457080 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_38530 459031 458363 gene locus_tag LOCUS_38540 459031 458363 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_38540 459678 459190 gene locus_tag LOCUS_38550 gene bfr 459678 459190 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_38550 460018 459761 gene locus_tag LOCUS_38560 460018 459761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 461322 460237 gene locus_tag LOCUS_38570 461322 460237 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_38570 462421 461405 gene locus_tag LOCUS_38580 462421 461405 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_38580 463018 462506 gene locus_tag LOCUS_38590 463018 462506 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222885.1 protein_id gnl|my_center|LOCUS_38590 464122 463289 gene locus_tag LOCUS_38600 464122 463289 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_38600 466799 464172 gene locus_tag LOCUS_38610 466799 464172 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_38610 466983 468605 gene locus_tag LOCUS_38620 466983 468605 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_38620 468634 468990 gene locus_tag LOCUS_38630 468634 468990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 469087 470016 gene locus_tag LOCUS_38640 469087 470016 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469674.1 protein_id gnl|my_center|LOCUS_38640 470016 470582 gene locus_tag LOCUS_38650 470016 470582 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229654.1 protein_id gnl|my_center|LOCUS_38650 470727 472175 gene locus_tag LOCUS_38660 470727 472175 CDS product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878186.1 protein_id gnl|my_center|LOCUS_38660 472172 472672 gene locus_tag LOCUS_38670 472172 472672 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058688.1 protein_id gnl|my_center|LOCUS_38670 472859 473359 gene locus_tag LOCUS_38680 472859 473359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 473684 474556 gene locus_tag LOCUS_38690 473684 474556 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027090.1 protein_id gnl|my_center|LOCUS_38690 475617 474598 gene locus_tag LOCUS_38700 475617 474598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 476357 475614 gene locus_tag LOCUS_38710 476357 475614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 479318 476388 gene locus_tag LOCUS_38720 479318 476388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 479987 479526 gene locus_tag LOCUS_38730 479987 479526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749555.1 protein_id gnl|my_center|LOCUS_38730 480406 479984 gene locus_tag LOCUS_38740 480406 479984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 480897 480403 gene locus_tag LOCUS_38750 480897 480403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 481117 480863 gene locus_tag LOCUS_38760 481117 480863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 482038 481118 gene locus_tag LOCUS_38770 482038 481118 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974413.1 protein_id gnl|my_center|LOCUS_38770 482909 482031 gene locus_tag LOCUS_38780 482909 482031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 484210 482906 gene locus_tag LOCUS_38790 484210 482906 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029708.1 protein_id gnl|my_center|LOCUS_38790 485079 484207 gene locus_tag LOCUS_38800 485079 484207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974416.1 protein_id gnl|my_center|LOCUS_38800 485779 485081 gene locus_tag LOCUS_38810 485779 485081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029707.1 protein_id gnl|my_center|LOCUS_38810 486417 492341 gene locus_tag LOCUS_38820 486417 492341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 492945 492646 gene locus_tag LOCUS_38830 492945 492646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 493844 493572 gene locus_tag LOCUS_38840 493844 493572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 494462 494145 gene locus_tag LOCUS_38850 494462 494145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 494814 494542 gene locus_tag LOCUS_38860 494814 494542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 494904 496262 gene locus_tag LOCUS_38870 494904 496262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 496293 497117 gene locus_tag LOCUS_38880 496293 497117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 497114 497677 gene locus_tag LOCUS_38890 497114 497677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 498699 497755 gene locus_tag LOCUS_38900 498699 497755 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_38900 499805 499596 gene locus_tag LOCUS_38910 499805 499596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 499686 500576 gene locus_tag LOCUS_38920 499686 500576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 500833 501396 gene locus_tag LOCUS_38930 500833 501396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 501655 502170 gene locus_tag LOCUS_38940 501655 502170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 502216 502638 gene locus_tag LOCUS_38950 502216 502638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 502632 502787 gene locus_tag LOCUS_38960 502632 502787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 503268 507773 gene locus_tag LOCUS_38970 503268 507773 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029700.1 protein_id gnl|my_center|LOCUS_38970 508190 507921 gene locus_tag LOCUS_38980 508190 507921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 508497 510257 gene locus_tag LOCUS_38990 508497 510257 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029950.1 protein_id gnl|my_center|LOCUS_38990 510358 511764 gene locus_tag LOCUS_39000 510358 511764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_39000 513278 511971 gene locus_tag LOCUS_39010 513278 511971 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222832.1 protein_id gnl|my_center|LOCUS_39010 513468 513920 gene locus_tag LOCUS_39020 513468 513920 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727858.1 protein_id gnl|my_center|LOCUS_39020 513922 514761 gene locus_tag LOCUS_39030 513922 514761 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222820.1 protein_id gnl|my_center|LOCUS_39030 514815 516455 gene locus_tag LOCUS_39040 514815 516455 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_39040 517715 516462 gene locus_tag LOCUS_39050 517715 516462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 517881 518135 gene locus_tag LOCUS_39060 517881 518135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 518448 519632 gene locus_tag LOCUS_39070 518448 519632 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224327.1 protein_id gnl|my_center|LOCUS_39070 519619 520857 gene locus_tag LOCUS_39080 519619 520857 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_39080 521312 522232 gene locus_tag LOCUS_39090 521312 522232 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_39090 522282 523745 gene locus_tag LOCUS_39100 522282 523745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_39100 523742 524851 gene locus_tag LOCUS_39110 523742 524851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_39110 524848 526122 gene locus_tag LOCUS_39120 524848 526122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_39120 526119 526550 gene locus_tag LOCUS_39130 526119 526550 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056128.1 protein_id gnl|my_center|LOCUS_39130 526618 527901 gene locus_tag LOCUS_39140 526618 527901 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_39140 527933 528289 gene locus_tag LOCUS_39150 527933 528289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 528335 529423 gene locus_tag LOCUS_39160 528335 529423 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_39160 529420 530040 gene locus_tag LOCUS_39170 529420 530040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 530814 532094 gene locus_tag LOCUS_39180 530814 532094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 533325 532324 gene locus_tag LOCUS_39190 gene trpS 533325 532324 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222753.1 protein_id gnl|my_center|LOCUS_39190 534751 533339 gene locus_tag LOCUS_39200 534751 533339 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803904.1 protein_id gnl|my_center|LOCUS_39200 534908 535870 gene locus_tag LOCUS_39210 gene galE 534908 535870 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224287.1 protein_id gnl|my_center|LOCUS_39210 537329 536343 gene locus_tag LOCUS_39220 537329 536343 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_39220 538324 537467 gene locus_tag LOCUS_39230 538324 537467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 539850 538633 gene locus_tag LOCUS_39240 539850 538633 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222746.1 protein_id gnl|my_center|LOCUS_39240 540320 540048 gene locus_tag LOCUS_39250 540320 540048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 541451 540321 gene locus_tag LOCUS_39260 gene citZ 541451 540321 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_39260 541633 542283 gene locus_tag LOCUS_39270 541633 542283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 543150 542296 gene locus_tag LOCUS_39280 543150 542296 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_39280 543466 543272 gene locus_tag LOCUS_39290 543466 543272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 545104 543557 gene locus_tag LOCUS_39300 gene purH 545104 543557 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222720.1 protein_id gnl|my_center|LOCUS_39300 545727 545134 gene locus_tag LOCUS_39310 gene purN 545727 545134 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_39310 545936 546367 gene locus_tag LOCUS_39320 545936 546367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 547845 546340 gene locus_tag LOCUS_39330 547845 546340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027315.1 protein_id gnl|my_center|LOCUS_39330 549620 547998 gene locus_tag LOCUS_39340 549620 547998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 550371 549880 gene locus_tag LOCUS_39350 550371 549880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 551672 550749 gene locus_tag LOCUS_39360 551672 550749 CDS product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065279.1 protein_id gnl|my_center|LOCUS_39360 552971 552084 gene locus_tag LOCUS_39370 gene sucD 552971 552084 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222716.1 protein_id gnl|my_center|LOCUS_39370 554149 552971 gene locus_tag LOCUS_39380 gene sucC 554149 552971 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_39380 554927 554514 gene locus_tag LOCUS_39390 554927 554514 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_39390 555509 554964 gene locus_tag LOCUS_39400 555509 554964 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_39400 555718 556692 gene locus_tag LOCUS_39410 555718 556692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 557199 558044 gene locus_tag LOCUS_39420 557199 558044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 558144 559022 gene locus_tag LOCUS_39430 558144 559022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 561451 559115 gene locus_tag LOCUS_39440 gene pcrA 561451 559115 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_39440 561517 562233 gene locus_tag LOCUS_39450 561517 562233 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141632568.1 protein_id gnl|my_center|LOCUS_39450 563439 562339 gene locus_tag LOCUS_39460 563439 562339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 563333 563581 gene locus_tag LOCUS_39470 563333 563581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 564377 563655 gene locus_tag LOCUS_39480 564377 563655 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877763.1 protein_id gnl|my_center|LOCUS_39480 565300 564554 gene locus_tag LOCUS_39490 565300 564554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 566051 565416 gene locus_tag LOCUS_39500 566051 565416 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_39500 567256 566048 gene locus_tag LOCUS_39510 567256 566048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_39510 567391 569124 gene locus_tag LOCUS_39520 567391 569124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 569117 569416 gene locus_tag LOCUS_39530 569117 569416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 569662 570147 gene locus_tag LOCUS_39540 569662 570147 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_39540 570144 572495 gene locus_tag LOCUS_39550 570144 572495 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_39550 572492 573352 gene locus_tag LOCUS_39560 572492 573352 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_39560 573619 574263 gene locus_tag LOCUS_39570 573619 574263 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_39570 574948 574286 gene locus_tag LOCUS_39580 574948 574286 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742128.1 protein_id gnl|my_center|LOCUS_39580 >Feature sequence006 536 129 gene locus_tag LOCUS_39590 536 129 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_39590 3997 755 gene locus_tag LOCUS_39600 3997 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 4334 4663 gene locus_tag LOCUS_39610 4334 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 5035 4565 gene locus_tag LOCUS_39620 5035 4565 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184978408.1 protein_id gnl|my_center|LOCUS_39620 7482 5110 gene locus_tag LOCUS_39630 7482 5110 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226349.1 protein_id gnl|my_center|LOCUS_39630 8535 9239 gene locus_tag LOCUS_39640 8535 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 10670 9351 gene locus_tag LOCUS_39650 10670 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 10900 11385 gene locus_tag LOCUS_39660 10900 11385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 12065 11502 gene locus_tag LOCUS_39670 12065 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 12217 12489 gene locus_tag LOCUS_39680 12217 12489 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978241.1 protein_id gnl|my_center|LOCUS_39680 12839 12555 gene locus_tag LOCUS_39690 12839 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 13127 13657 gene locus_tag LOCUS_39700 13127 13657 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_39700 13857 15134 gene locus_tag LOCUS_39710 13857 15134 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871009.1 protein_id gnl|my_center|LOCUS_39710 15559 16449 gene locus_tag LOCUS_39720 15559 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 17124 17399 gene locus_tag LOCUS_39730 17124 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228535.1 protein_id gnl|my_center|LOCUS_39730 17392 18003 gene locus_tag LOCUS_39740 17392 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026379.1 protein_id gnl|my_center|LOCUS_39740 18119 20449 gene locus_tag LOCUS_39750 18119 20449 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204026380.1 protein_id gnl|my_center|LOCUS_39750 21017 20505 gene locus_tag LOCUS_39760 21017 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 22039 21575 gene locus_tag LOCUS_39770 22039 21575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 23261 22398 gene locus_tag LOCUS_39780 23261 22398 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085343.1 protein_id gnl|my_center|LOCUS_39780 23645 24235 gene locus_tag LOCUS_39790 23645 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 24600 24992 gene locus_tag LOCUS_39800 24600 24992 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228348.1 protein_id gnl|my_center|LOCUS_39800 26927 25086 gene locus_tag LOCUS_39810 26927 25086 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030966.1 protein_id gnl|my_center|LOCUS_39810 27264 27010 gene locus_tag LOCUS_39820 27264 27010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 28748 27339 gene locus_tag LOCUS_39830 gene hldE 28748 27339 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095747.1 protein_id gnl|my_center|LOCUS_39830 29349 28759 gene locus_tag LOCUS_39840 29349 28759 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226119.1 protein_id gnl|my_center|LOCUS_39840 29433 30320 gene locus_tag LOCUS_39850 29433 30320 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066795948.1 protein_id gnl|my_center|LOCUS_39850 30317 31375 gene locus_tag LOCUS_39860 30317 31375 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188751788.1 protein_id gnl|my_center|LOCUS_39860 31372 32418 gene locus_tag LOCUS_39870 31372 32418 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_39870 32837 32466 gene locus_tag LOCUS_39880 32837 32466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 33805 32933 gene locus_tag LOCUS_39890 33805 32933 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226116.1 protein_id gnl|my_center|LOCUS_39890 34491 33796 gene locus_tag LOCUS_39900 34491 33796 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226117.1 protein_id gnl|my_center|LOCUS_39900 35702 34488 gene locus_tag LOCUS_39910 35702 34488 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_39910 36628 35699 gene locus_tag LOCUS_39920 36628 35699 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_39920 37650 36625 gene locus_tag LOCUS_39930 37650 36625 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226109.1 protein_id gnl|my_center|LOCUS_39930 37837 38118 gene locus_tag LOCUS_39940 37837 38118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 38115 38885 gene locus_tag LOCUS_39950 38115 38885 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224986.1 protein_id gnl|my_center|LOCUS_39950 39495 38953 gene locus_tag LOCUS_39960 39495 38953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 39641 39492 gene locus_tag LOCUS_39970 39641 39492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 39781 40734 gene locus_tag LOCUS_39980 39781 40734 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_39980 40839 41438 gene locus_tag LOCUS_39990 40839 41438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 41573 42115 gene locus_tag LOCUS_40000 41573 42115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 42647 42102 gene locus_tag LOCUS_40010 42647 42102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 43256 42729 gene locus_tag LOCUS_40020 43256 42729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 45661 43421 gene locus_tag LOCUS_40030 gene secA2 45661 43421 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_40030 45784 46200 gene locus_tag LOCUS_40040 45784 46200 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226395.1 protein_id gnl|my_center|LOCUS_40040 46361 47218 gene locus_tag LOCUS_40050 46361 47218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 48442 47288 gene locus_tag LOCUS_40060 48442 47288 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_40060 48494 49072 gene locus_tag LOCUS_40070 48494 49072 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_40070 49167 50165 gene locus_tag LOCUS_40080 49167 50165 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_40080 50165 51370 gene locus_tag LOCUS_40090 50165 51370 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_40090 51989 51387 gene locus_tag LOCUS_40100 51989 51387 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_40100 52214 52963 gene locus_tag LOCUS_40110 52214 52963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 53299 53372 gene locus_tag LOCUS_t00580 53299 53372 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 54120 53470 gene locus_tag LOCUS_40120 54120 53470 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930016.1 protein_id gnl|my_center|LOCUS_40120 54245 55021 gene locus_tag LOCUS_40130 54245 55021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_40130 55018 57633 gene locus_tag LOCUS_40140 55018 57633 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027530.1 protein_id gnl|my_center|LOCUS_40140 58830 57682 gene locus_tag LOCUS_40150 58830 57682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 59137 58928 gene locus_tag LOCUS_40160 59137 58928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 59124 59582 gene locus_tag LOCUS_40170 59124 59582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 59626 60306 gene locus_tag LOCUS_40180 59626 60306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_40180 60317 61735 gene locus_tag LOCUS_40190 60317 61735 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976000.1 protein_id gnl|my_center|LOCUS_40190 62111 63238 gene locus_tag LOCUS_40200 62111 63238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 64881 63358 gene locus_tag LOCUS_40210 64881 63358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 65032 65679 gene locus_tag LOCUS_40220 65032 65679 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_40220 65910 67256 gene locus_tag LOCUS_40230 65910 67256 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223633.1 protein_id gnl|my_center|LOCUS_40230 67432 67926 gene locus_tag LOCUS_40240 67432 67926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 69628 67949 gene locus_tag LOCUS_40250 69628 67949 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086372.1 protein_id gnl|my_center|LOCUS_40250 70450 69833 gene locus_tag LOCUS_40260 70450 69833 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530165.1 protein_id gnl|my_center|LOCUS_40260 70500 71657 gene locus_tag LOCUS_40270 70500 71657 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230129.1 protein_id gnl|my_center|LOCUS_40270 72563 71715 gene locus_tag LOCUS_40280 gene htdY 72563 71715 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_40280 72832 73182 gene locus_tag LOCUS_40290 72832 73182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40290 73274 74536 gene locus_tag LOCUS_40300 73274 74536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40300 74712 76421 gene locus_tag LOCUS_40310 74712 76421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 77100 76405 gene locus_tag LOCUS_40320 77100 76405 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_40320 77472 78326 gene locus_tag LOCUS_40330 77472 78326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 79629 78346 gene locus_tag LOCUS_40340 79629 78346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 80859 79645 gene locus_tag LOCUS_40350 80859 79645 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_40350 81034 82080 gene locus_tag LOCUS_40360 81034 82080 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213089170.1 protein_id gnl|my_center|LOCUS_40360 82077 82595 gene locus_tag LOCUS_40370 82077 82595 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 protein_id gnl|my_center|LOCUS_40370 83681 82683 gene locus_tag LOCUS_40380 83681 82683 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_40380 84086 83700 gene locus_tag LOCUS_40390 84086 83700 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223897.1 protein_id gnl|my_center|LOCUS_40390 84710 84219 gene locus_tag LOCUS_40400 84710 84219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 85131 86474 gene locus_tag LOCUS_40410 85131 86474 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224833.1 protein_id gnl|my_center|LOCUS_40410 86861 87547 gene locus_tag LOCUS_40420 86861 87547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 87547 88539 gene locus_tag LOCUS_40430 87547 88539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 88567 89406 gene locus_tag LOCUS_40440 88567 89406 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227879.1 protein_id gnl|my_center|LOCUS_40440 89641 90381 gene locus_tag LOCUS_40450 89641 90381 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466913.1 protein_id gnl|my_center|LOCUS_40450 90764 91885 gene locus_tag LOCUS_40460 90764 91885 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089629.1 protein_id gnl|my_center|LOCUS_40460 91971 92126 gene locus_tag LOCUS_40470 91971 92126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 92126 93298 gene locus_tag LOCUS_40480 92126 93298 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726945.1 protein_id gnl|my_center|LOCUS_40480 93438 94790 gene locus_tag LOCUS_40490 93438 94790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_40490 94893 96242 gene locus_tag LOCUS_40500 94893 96242 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222506.1 protein_id gnl|my_center|LOCUS_40500 96239 97426 gene locus_tag LOCUS_40510 96239 97426 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728201.1 protein_id gnl|my_center|LOCUS_40510 97423 98592 gene locus_tag LOCUS_40520 97423 98592 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086421.1 protein_id gnl|my_center|LOCUS_40520 98601 100226 gene locus_tag LOCUS_40530 98601 100226 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384278.1 protein_id gnl|my_center|LOCUS_40530 100284 101342 gene locus_tag LOCUS_40540 100284 101342 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384277.1 protein_id gnl|my_center|LOCUS_40540 101342 102175 gene locus_tag LOCUS_40550 101342 102175 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537723.1 protein_id gnl|my_center|LOCUS_40550 102323 103993 gene locus_tag LOCUS_40560 102323 103993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729789.1 protein_id gnl|my_center|LOCUS_40560 104965 104084 gene locus_tag LOCUS_40570 104965 104084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 105558 105265 gene locus_tag LOCUS_40580 105558 105265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 105899 105531 gene locus_tag LOCUS_40590 105899 105531 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894106.1 protein_id gnl|my_center|LOCUS_40590 106925 106041 gene locus_tag LOCUS_40600 106925 106041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 108073 106922 gene locus_tag LOCUS_40610 108073 106922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40610 108764 108066 gene locus_tag LOCUS_40620 108764 108066 CDS product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728541.1 protein_id gnl|my_center|LOCUS_40620 109009 108761 gene locus_tag LOCUS_40630 109009 108761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 109650 109006 gene locus_tag LOCUS_40640 109650 109006 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467021.1 protein_id gnl|my_center|LOCUS_40640 110153 109656 gene locus_tag LOCUS_40650 110153 109656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 111951 110158 gene locus_tag LOCUS_40660 111951 110158 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_40660 113109 112042 gene locus_tag LOCUS_40670 113109 112042 CDS product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728543.1 protein_id gnl|my_center|LOCUS_40670 113564 115246 gene locus_tag LOCUS_40680 gene paaP 113564 115246 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_40680 115818 115360 gene locus_tag LOCUS_40690 115818 115360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030585.1 protein_id gnl|my_center|LOCUS_40690 116115 118946 gene locus_tag LOCUS_40700 116115 118946 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054625.1 protein_id gnl|my_center|LOCUS_40700 119365 118961 gene locus_tag LOCUS_40710 119365 118961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 119769 121145 gene locus_tag LOCUS_40720 119769 121145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468787.1 protein_id gnl|my_center|LOCUS_40720 121215 122333 gene locus_tag LOCUS_40730 121215 122333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 122330 122866 gene locus_tag LOCUS_40740 122330 122866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 122917 123786 gene locus_tag LOCUS_40750 122917 123786 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226056.1 protein_id gnl|my_center|LOCUS_40750 123881 125599 gene locus_tag LOCUS_40760 gene polX 123881 125599 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_40760 125835 125605 gene locus_tag LOCUS_40770 125835 125605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 126402 125845 gene locus_tag LOCUS_40780 126402 125845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 126283 126663 gene locus_tag LOCUS_40790 126283 126663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 126687 127274 gene locus_tag LOCUS_40800 126687 127274 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098397.1 protein_id gnl|my_center|LOCUS_40800 128158 127271 gene locus_tag LOCUS_40810 128158 127271 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_40810 128853 128155 gene locus_tag LOCUS_40820 128853 128155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 128986 129528 gene locus_tag LOCUS_40830 128986 129528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 130060 130371 gene locus_tag LOCUS_40840 130060 130371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 131644 132309 gene locus_tag LOCUS_40850 131644 132309 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931542.1 protein_id gnl|my_center|LOCUS_40850 132317 133711 gene locus_tag LOCUS_40860 132317 133711 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244910.1 protein_id gnl|my_center|LOCUS_40860 133728 134888 gene locus_tag LOCUS_40870 133728 134888 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241160.1 protein_id gnl|my_center|LOCUS_40870 134890 135564 gene locus_tag LOCUS_40880 134890 135564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889094.1 protein_id gnl|my_center|LOCUS_40880 135561 136166 gene locus_tag LOCUS_40890 135561 136166 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_40890 136201 136716 gene locus_tag LOCUS_40900 136201 136716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40900 136960 138600 gene locus_tag LOCUS_40910 136960 138600 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_40910 139725 138754 gene locus_tag LOCUS_40920 139725 138754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 140560 140288 gene locus_tag LOCUS_40930 140560 140288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 140886 142082 gene locus_tag LOCUS_40940 140886 142082 CDS product NarK/NasA family nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026930.1 protein_id gnl|my_center|LOCUS_40940 142158 145835 gene locus_tag LOCUS_40950 142158 145835 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_40950 145835 147514 gene locus_tag LOCUS_40960 gene narH 145835 147514 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_40960 147511 148161 gene locus_tag LOCUS_40970 147511 148161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40970 148158 148886 gene locus_tag LOCUS_40980 gene narI 148158 148886 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 protein_id gnl|my_center|LOCUS_40980 149172 149588 gene locus_tag LOCUS_40990 149172 149588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 149815 150354 gene locus_tag LOCUS_41000 149815 150354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 150359 150799 gene locus_tag LOCUS_41010 150359 150799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 151120 151680 gene locus_tag LOCUS_41020 151120 151680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 151807 152367 gene locus_tag LOCUS_41030 151807 152367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 152379 152906 gene locus_tag LOCUS_41040 152379 152906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 152906 153523 gene locus_tag LOCUS_41050 152906 153523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 153747 154367 gene locus_tag LOCUS_41060 153747 154367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 154638 155036 gene locus_tag LOCUS_41070 154638 155036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 155212 155691 gene locus_tag LOCUS_41080 155212 155691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 155783 155962 gene locus_tag LOCUS_41090 155783 155962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 156440 164329 gene locus_tag LOCUS_41100 156440 164329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41100 164658 165269 gene locus_tag LOCUS_41110 164658 165269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 165358 165561 gene locus_tag LOCUS_41120 165358 165561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 165631 166155 gene locus_tag LOCUS_41130 165631 166155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 167660 166536 gene locus_tag LOCUS_41140 gene cysS 167660 166536 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256641.1 protein_id gnl|my_center|LOCUS_41140 167935 168768 gene locus_tag LOCUS_41150 167935 168768 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_41150 168770 169777 gene locus_tag LOCUS_41160 168770 169777 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227277.1 protein_id gnl|my_center|LOCUS_41160 170564 169896 gene locus_tag LOCUS_41170 170564 169896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 171016 170603 gene locus_tag LOCUS_41180 171016 170603 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_41180 171708 171067 gene locus_tag LOCUS_41190 171708 171067 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286123.1 protein_id gnl|my_center|LOCUS_41190 171795 174110 gene locus_tag LOCUS_41200 171795 174110 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729203.1 protein_id gnl|my_center|LOCUS_41200 174259 175170 gene locus_tag LOCUS_41210 174259 175170 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227298.1 protein_id gnl|my_center|LOCUS_41210 175199 176050 gene locus_tag LOCUS_41220 175199 176050 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_41220 176047 176547 gene locus_tag LOCUS_41230 176047 176547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 176602 177543 gene locus_tag LOCUS_41240 176602 177543 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977963.1 protein_id gnl|my_center|LOCUS_41240 178029 178976 gene locus_tag LOCUS_41250 178029 178976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 179011 179436 gene locus_tag LOCUS_41260 179011 179436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 179433 180257 gene locus_tag LOCUS_41270 179433 180257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 180250 180516 gene locus_tag LOCUS_41280 180250 180516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 180601 181050 gene locus_tag LOCUS_41290 180601 181050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 181348 181719 gene locus_tag LOCUS_41300 181348 181719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 183489 181870 gene locus_tag LOCUS_41310 183489 181870 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_41310 184489 183491 gene locus_tag LOCUS_41320 gene porB 184489 183491 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020090.1 protein_id gnl|my_center|LOCUS_41320 185711 184494 gene locus_tag LOCUS_41330 gene porA 185711 184494 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020091.1 protein_id gnl|my_center|LOCUS_41330 186303 185704 gene locus_tag LOCUS_41340 186303 185704 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_41340 186510 187640 gene locus_tag LOCUS_41350 186510 187640 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816824.1 protein_id gnl|my_center|LOCUS_41350 187637 187972 gene locus_tag LOCUS_41360 187637 187972 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_41360 187969 189375 gene locus_tag LOCUS_41370 187969 189375 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 protein_id gnl|my_center|LOCUS_41370 190214 191512 gene locus_tag LOCUS_41380 190214 191512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 192881 191964 gene locus_tag LOCUS_41390 192881 191964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 195915 193270 gene locus_tag LOCUS_41400 195915 193270 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224292.1 protein_id gnl|my_center|LOCUS_41400 196056 197054 gene locus_tag LOCUS_41410 gene gap 196056 197054 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_41410 197104 197697 gene locus_tag LOCUS_41420 197104 197697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972086.1 protein_id gnl|my_center|LOCUS_41420 197799 199505 gene locus_tag LOCUS_41430 197799 199505 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_41430 199762 199550 gene locus_tag LOCUS_41440 199762 199550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 200399 199989 gene locus_tag LOCUS_41450 200399 199989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 200617 200901 gene locus_tag LOCUS_41460 200617 200901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 200947 202068 gene locus_tag LOCUS_41470 200947 202068 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_41470 203682 202195 gene locus_tag LOCUS_41480 203682 202195 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026894.1 protein_id gnl|my_center|LOCUS_41480 205024 204074 gene locus_tag LOCUS_41490 205024 204074 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064726614.1 protein_id gnl|my_center|LOCUS_41490 205177 206163 gene locus_tag LOCUS_41500 205177 206163 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 protein_id gnl|my_center|LOCUS_41500 206922 206395 gene locus_tag LOCUS_41510 206922 206395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 207246 207821 gene locus_tag LOCUS_41520 207246 207821 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668689.1 protein_id gnl|my_center|LOCUS_41520 208408 207995 gene locus_tag LOCUS_41530 208408 207995 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 protein_id gnl|my_center|LOCUS_41530 208579 208986 gene locus_tag LOCUS_41540 208579 208986 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_41540 209018 209503 gene locus_tag LOCUS_41550 209018 209503 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_41550 209500 211509 gene locus_tag LOCUS_41560 209500 211509 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_41560 211539 212441 gene locus_tag LOCUS_41570 211539 212441 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_41570 212449 213120 gene locus_tag LOCUS_41580 212449 213120 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_41580 213120 214607 gene locus_tag LOCUS_41590 213120 214607 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950336.1 protein_id gnl|my_center|LOCUS_41590 214604 216157 gene locus_tag LOCUS_41600 214604 216157 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_41600 216867 218264 gene locus_tag LOCUS_41610 216867 218264 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227294.1 protein_id gnl|my_center|LOCUS_41610 218276 219265 gene locus_tag LOCUS_41620 gene cydB 218276 219265 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227295.1 protein_id gnl|my_center|LOCUS_41620 219362 219922 gene locus_tag LOCUS_41630 219362 219922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 219919 220401 gene locus_tag LOCUS_41640 219919 220401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 221403 220690 gene locus_tag LOCUS_41650 221403 220690 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026928.1 protein_id gnl|my_center|LOCUS_41650 222205 221513 gene locus_tag LOCUS_41660 222205 221513 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 protein_id gnl|my_center|LOCUS_41660 222542 224851 gene locus_tag LOCUS_41670 222542 224851 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026895.1 protein_id gnl|my_center|LOCUS_41670 224938 225174 gene locus_tag LOCUS_41680 224938 225174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 225299 226177 gene locus_tag LOCUS_41690 225299 226177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 228187 226460 gene locus_tag LOCUS_41700 228187 226460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 228367 229644 gene locus_tag LOCUS_41710 228367 229644 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227556.1 protein_id gnl|my_center|LOCUS_41710 230087 229659 gene locus_tag LOCUS_41720 230087 229659 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_41720 230320 230174 gene locus_tag LOCUS_41730 230320 230174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 230470 232896 gene locus_tag LOCUS_41740 230470 232896 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223450.1 protein_id gnl|my_center|LOCUS_41740 234122 232923 gene locus_tag LOCUS_41750 234122 232923 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224141.1 protein_id gnl|my_center|LOCUS_41750 234523 235944 gene locus_tag LOCUS_41760 234523 235944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 235934 236629 gene locus_tag LOCUS_41770 235934 236629 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976324.1 protein_id gnl|my_center|LOCUS_41770 236777 237271 gene locus_tag LOCUS_41780 236777 237271 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815447.1 protein_id gnl|my_center|LOCUS_41780 241901 237417 gene locus_tag LOCUS_41790 241901 237417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223680.1 protein_id gnl|my_center|LOCUS_41790 242271 241888 gene locus_tag LOCUS_41800 242271 241888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 242578 242657 gene locus_tag LOCUS_t00590 242578 242657 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 246387 242779 gene locus_tag LOCUS_41810 246387 242779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_41810 246764 247147 gene locus_tag LOCUS_41820 246764 247147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 247604 247218 gene locus_tag LOCUS_41830 247604 247218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 249850 248030 gene locus_tag LOCUS_41840 249850 248030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 249900 251270 gene locus_tag LOCUS_41850 249900 251270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 251870 251532 gene locus_tag LOCUS_41860 251870 251532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 253056 252007 gene locus_tag LOCUS_41870 253056 252007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 254302 253793 gene locus_tag LOCUS_41880 gene mce 254302 253793 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289162.1 protein_id gnl|my_center|LOCUS_41880 255676 254363 gene locus_tag LOCUS_41890 255676 254363 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804886.1 protein_id gnl|my_center|LOCUS_41890 256396 255734 gene locus_tag LOCUS_41900 256396 255734 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230414.1 protein_id gnl|my_center|LOCUS_41900 256582 258540 gene locus_tag LOCUS_41910 256582 258540 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_41910 259483 258575 gene locus_tag LOCUS_41920 259483 258575 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_41920 260394 259483 gene locus_tag LOCUS_41930 260394 259483 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_41930 261909 260464 gene locus_tag LOCUS_41940 gene ngcE 261909 260464 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_41940 263388 262147 gene locus_tag LOCUS_41950 263388 262147 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_41950 264407 263454 gene locus_tag LOCUS_41960 264407 263454 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225340.1 protein_id gnl|my_center|LOCUS_41960 264524 265249 gene locus_tag LOCUS_41970 264524 265249 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_41970 266125 265271 gene locus_tag LOCUS_41980 266125 265271 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878192.1 protein_id gnl|my_center|LOCUS_41980 266357 267751 gene locus_tag LOCUS_41990 gene lat 266357 267751 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 protein_id gnl|my_center|LOCUS_41990 267975 267670 gene locus_tag LOCUS_42000 267975 267670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 268159 268084 gene locus_tag LOCUS_t00600 268159 268084 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 268887 268270 gene locus_tag LOCUS_42010 gene orn 268887 268270 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_42010 270372 268939 gene locus_tag LOCUS_42020 270372 268939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 271535 270453 gene locus_tag LOCUS_42030 271535 270453 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_42030 272334 271678 gene locus_tag LOCUS_42040 272334 271678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 272577 274019 gene locus_tag LOCUS_42050 272577 274019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 277884 273994 gene locus_tag LOCUS_42060 277884 273994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 279374 277935 gene locus_tag LOCUS_42070 279374 277935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 280375 279581 gene locus_tag LOCUS_42080 280375 279581 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_42080 281341 280382 gene locus_tag LOCUS_42090 281341 280382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 282174 281338 gene locus_tag LOCUS_42100 282174 281338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42100 283438 282317 gene locus_tag LOCUS_42110 283438 282317 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640455.1 protein_id gnl|my_center|LOCUS_42110 283809 283435 gene locus_tag LOCUS_42120 283809 283435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 286271 284496 gene locus_tag LOCUS_42130 286271 284496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 288287 286461 gene locus_tag LOCUS_42140 288287 286461 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_42140 289454 288816 gene locus_tag LOCUS_42150 289454 288816 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417119.1 protein_id gnl|my_center|LOCUS_42150 289626 290510 gene locus_tag LOCUS_42160 289626 290510 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067135926.1 protein_id gnl|my_center|LOCUS_42160 292391 291399 gene locus_tag LOCUS_42170 292391 291399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 292961 292446 gene locus_tag LOCUS_42180 292961 292446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 293427 293975 gene locus_tag LOCUS_42190 293427 293975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 297356 293991 gene locus_tag LOCUS_42200 297356 293991 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728047.1 protein_id gnl|my_center|LOCUS_42200 298568 297495 gene locus_tag LOCUS_42210 298568 297495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 299618 298791 gene locus_tag LOCUS_42220 299618 298791 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467152.1 protein_id gnl|my_center|LOCUS_42220 299649 300770 gene locus_tag LOCUS_42230 299649 300770 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_42230 302295 303485 gene locus_tag LOCUS_42240 gene cysS 302295 303485 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_42240 303857 303558 gene locus_tag LOCUS_42250 303857 303558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 304113 305795 gene locus_tag LOCUS_42260 304113 305795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 305792 306706 gene locus_tag LOCUS_42270 305792 306706 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031333.1 protein_id gnl|my_center|LOCUS_42270 306729 307499 gene locus_tag LOCUS_42280 306729 307499 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731472.1 protein_id gnl|my_center|LOCUS_42280 307569 308753 gene locus_tag LOCUS_42290 307569 308753 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441295.1 protein_id gnl|my_center|LOCUS_42290 309608 309192 gene locus_tag LOCUS_42300 309608 309192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 310914 309868 gene locus_tag LOCUS_42310 310914 309868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 311010 311315 gene locus_tag LOCUS_42320 311010 311315 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_42320 311848 313782 gene locus_tag LOCUS_42330 311848 313782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 314043 314831 gene locus_tag LOCUS_42340 314043 314831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 315484 314921 gene locus_tag LOCUS_42350 315484 314921 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031882.1 protein_id gnl|my_center|LOCUS_42350 316368 315655 gene locus_tag LOCUS_42360 316368 315655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 316599 316426 gene locus_tag LOCUS_42370 316599 316426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 316823 318235 gene locus_tag LOCUS_42380 316823 318235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 321059 318780 gene locus_tag LOCUS_42390 321059 318780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 322404 321439 gene locus_tag LOCUS_42400 gene dapD 322404 321439 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 protein_id gnl|my_center|LOCUS_42400 322519 323199 gene locus_tag LOCUS_42410 322519 323199 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_42410 323544 323230 gene locus_tag LOCUS_42420 323544 323230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 323829 324290 gene locus_tag LOCUS_42430 323829 324290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 324303 325700 gene locus_tag LOCUS_42440 324303 325700 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_42440 325697 326359 gene locus_tag LOCUS_42450 325697 326359 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976672.1 protein_id gnl|my_center|LOCUS_42450 326469 327119 gene locus_tag LOCUS_42460 326469 327119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 327119 327763 gene locus_tag LOCUS_42470 327119 327763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 328036 328854 gene locus_tag LOCUS_42480 328036 328854 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_42480 329879 328905 gene locus_tag LOCUS_42490 329879 328905 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224055.1 protein_id gnl|my_center|LOCUS_42490 331950 329890 gene locus_tag LOCUS_42500 331950 329890 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 protein_id gnl|my_center|LOCUS_42500 332409 333500 gene locus_tag LOCUS_42510 332409 333500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 333497 334558 gene locus_tag LOCUS_42520 333497 334558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 334697 334891 gene locus_tag LOCUS_42530 334697 334891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 334963 335145 gene locus_tag LOCUS_42540 334963 335145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 335266 336327 gene locus_tag LOCUS_42550 335266 336327 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090392.1 protein_id gnl|my_center|LOCUS_42550 336320 337210 gene locus_tag LOCUS_42560 336320 337210 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230149.1 protein_id gnl|my_center|LOCUS_42560 337207 338475 gene locus_tag LOCUS_42570 337207 338475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 338478 340346 gene locus_tag LOCUS_42580 338478 340346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028846.1 protein_id gnl|my_center|LOCUS_42580 340343 341314 gene locus_tag LOCUS_42590 340343 341314 CDS product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 protein_id gnl|my_center|LOCUS_42590 341311 341961 gene locus_tag LOCUS_42600 341311 341961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 341958 342848 gene locus_tag LOCUS_42610 341958 342848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 342867 345455 gene locus_tag LOCUS_42620 342867 345455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 345630 346475 gene locus_tag LOCUS_42630 345630 346475 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228828.1 protein_id gnl|my_center|LOCUS_42630 346472 347308 gene locus_tag LOCUS_42640 346472 347308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228829.1 protein_id gnl|my_center|LOCUS_42640 347322 347564 gene locus_tag LOCUS_42650 347322 347564 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228830.1 protein_id gnl|my_center|LOCUS_42650 347561 348076 gene locus_tag LOCUS_42660 347561 348076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 348141 349598 gene locus_tag LOCUS_42670 348141 349598 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_42670 350536 349592 gene locus_tag LOCUS_42680 350536 349592 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226775.1 protein_id gnl|my_center|LOCUS_42680 351256 350600 gene locus_tag LOCUS_42690 351256 350600 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466811.1 protein_id gnl|my_center|LOCUS_42690 352407 352333 gene locus_tag LOCUS_t00610 352407 352333 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 352706 352398 gene locus_tag LOCUS_42700 352706 352398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 352826 353638 gene locus_tag LOCUS_42710 352826 353638 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975366.1 protein_id gnl|my_center|LOCUS_42710 353792 354748 gene locus_tag LOCUS_42720 353792 354748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 354791 356284 gene locus_tag LOCUS_42730 354791 356284 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_42730 356296 356496 gene locus_tag LOCUS_42740 356296 356496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 356896 356501 gene locus_tag LOCUS_42750 356896 356501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457988.1 protein_id gnl|my_center|LOCUS_42750 358171 357212 gene locus_tag LOCUS_42760 358171 357212 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227740.1 protein_id gnl|my_center|LOCUS_42760 359476 358355 gene locus_tag LOCUS_42770 359476 358355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 protein_id gnl|my_center|LOCUS_42770 360354 359473 gene locus_tag LOCUS_42780 360354 359473 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 protein_id gnl|my_center|LOCUS_42780 361223 360342 gene locus_tag LOCUS_42790 361223 360342 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 protein_id gnl|my_center|LOCUS_42790 362326 361220 gene locus_tag LOCUS_42800 362326 361220 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 protein_id gnl|my_center|LOCUS_42800 362247 362441 gene locus_tag LOCUS_42810 362247 362441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 362805 363071 gene locus_tag LOCUS_42820 362805 363071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 363071 366571 gene locus_tag LOCUS_42830 gene dnaE 363071 366571 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_42830 366767 367696 gene locus_tag LOCUS_42840 366767 367696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 368510 367743 gene locus_tag LOCUS_42850 368510 367743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 369245 368655 gene locus_tag LOCUS_42860 369245 368655 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_42860 369414 370640 gene locus_tag LOCUS_42870 369414 370640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 372226 370715 gene locus_tag LOCUS_42880 372226 370715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 373338 372559 gene locus_tag LOCUS_42890 373338 372559 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804816.1 protein_id gnl|my_center|LOCUS_42890 373427 374209 gene locus_tag LOCUS_42900 373427 374209 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_42900 374209 375660 gene locus_tag LOCUS_42910 374209 375660 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_42910 375657 376295 gene locus_tag LOCUS_42920 375657 376295 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_42920 377094 376705 gene locus_tag LOCUS_42930 377094 376705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 377270 377734 gene locus_tag LOCUS_42940 377270 377734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 377731 378075 gene locus_tag LOCUS_42950 377731 378075 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_42950 378062 378937 gene locus_tag LOCUS_42960 378062 378937 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 protein_id gnl|my_center|LOCUS_42960 379029 380213 gene locus_tag LOCUS_42970 379029 380213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 protein_id gnl|my_center|LOCUS_42970 380309 381400 gene locus_tag LOCUS_42980 380309 381400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 381497 382339 gene locus_tag LOCUS_42990 381497 382339 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028014.1 protein_id gnl|my_center|LOCUS_42990 382336 383409 gene locus_tag LOCUS_43000 382336 383409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 383669 384901 gene locus_tag LOCUS_43010 gene cobA 383669 384901 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_43010 384937 387264 gene locus_tag LOCUS_43020 384937 387264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 387261 388901 gene locus_tag LOCUS_43030 387261 388901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 389049 389666 gene locus_tag LOCUS_43040 389049 389666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 390054 391343 gene locus_tag LOCUS_43050 390054 391343 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227346.1 protein_id gnl|my_center|LOCUS_43050 391418 393082 gene locus_tag LOCUS_43060 gene ettA 391418 393082 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_43060 394702 393149 gene locus_tag LOCUS_43070 394702 393149 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131344932.1 protein_id gnl|my_center|LOCUS_43070 395253 394846 gene locus_tag LOCUS_43080 395253 394846 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_43080 396692 395556 gene locus_tag LOCUS_43090 396692 395556 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228591.1 protein_id gnl|my_center|LOCUS_43090 397480 397208 gene locus_tag LOCUS_43100 397480 397208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 397927 399447 gene locus_tag LOCUS_43110 397927 399447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 399444 399956 gene locus_tag LOCUS_43120 399444 399956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091014.1 protein_id gnl|my_center|LOCUS_43120 402106 400022 gene locus_tag LOCUS_43130 402106 400022 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_43130 402487 402993 gene locus_tag LOCUS_43140 402487 402993 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878108.1 protein_id gnl|my_center|LOCUS_43140 403030 403230 gene locus_tag LOCUS_43150 403030 403230 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028303.1 protein_id gnl|my_center|LOCUS_43150 404394 403441 gene locus_tag LOCUS_43160 404394 403441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 404963 404478 gene locus_tag LOCUS_43170 404963 404478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 406943 405093 gene locus_tag LOCUS_43180 gene ilvD 406943 405093 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727570.1 protein_id gnl|my_center|LOCUS_43180 407885 407112 gene locus_tag LOCUS_43190 407885 407112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 408127 409563 gene locus_tag LOCUS_43200 408127 409563 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804864.1 protein_id gnl|my_center|LOCUS_43200 410589 409579 gene locus_tag LOCUS_43210 410589 409579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 413297 410730 gene locus_tag LOCUS_43220 gene pepN 413297 410730 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228585.1 protein_id gnl|my_center|LOCUS_43220 413451 414101 gene locus_tag LOCUS_43230 413451 414101 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_43230 415006 414575 gene locus_tag LOCUS_43240 415006 414575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 415082 416539 gene locus_tag LOCUS_43250 415082 416539 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_43250 416819 418225 gene locus_tag LOCUS_43260 416819 418225 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027930.1 protein_id gnl|my_center|LOCUS_43260 418768 418250 gene locus_tag LOCUS_43270 gene def 418768 418250 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224209.1 protein_id gnl|my_center|LOCUS_43270 418921 419388 gene locus_tag LOCUS_43280 418921 419388 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_43280 419684 419352 gene locus_tag LOCUS_43290 419684 419352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 419905 419744 gene locus_tag LOCUS_43300 419905 419744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 421421 420165 gene locus_tag LOCUS_43310 421421 420165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_43310 421573 422685 gene locus_tag LOCUS_43320 421573 422685 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_43320 422776 424086 gene locus_tag LOCUS_43330 422776 424086 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_43330 424090 424704 gene locus_tag LOCUS_43340 424090 424704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 425674 424691 gene locus_tag LOCUS_43350 gene axeA 425674 424691 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_43350 426692 425703 gene locus_tag LOCUS_43360 426692 425703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 428030 426843 gene locus_tag LOCUS_43370 gene galT 428030 426843 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 protein_id gnl|my_center|LOCUS_43370 428827 428027 gene locus_tag LOCUS_43380 428827 428027 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230059.1 protein_id gnl|my_center|LOCUS_43380 429681 429112 gene locus_tag LOCUS_43390 429681 429112 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_43390 429562 429780 gene locus_tag LOCUS_43400 429562 429780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 431449 429794 gene locus_tag LOCUS_43410 431449 429794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 431406 431600 gene locus_tag LOCUS_43420 431406 431600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 433126 431768 gene locus_tag LOCUS_43430 433126 431768 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228765.1 protein_id gnl|my_center|LOCUS_43430 433595 433753 gene locus_tag LOCUS_43440 433595 433753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 434087 433800 gene locus_tag LOCUS_43450 434087 433800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 434397 434326 gene locus_tag LOCUS_t00620 434397 434326 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 434485 434561 gene locus_tag LOCUS_t00630 434485 434561 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 435062 434580 gene locus_tag LOCUS_43460 435062 434580 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028967.1 protein_id gnl|my_center|LOCUS_43460 435535 436401 gene locus_tag LOCUS_43470 435535 436401 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_43470 436685 436503 gene locus_tag LOCUS_43480 436685 436503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 436711 438099 gene locus_tag LOCUS_43490 gene tig 436711 438099 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_43490 438485 439129 gene locus_tag LOCUS_43500 438485 439129 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 protein_id gnl|my_center|LOCUS_43500 439141 439785 gene locus_tag LOCUS_43510 439141 439785 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896046.1 protein_id gnl|my_center|LOCUS_43510 439969 441252 gene locus_tag LOCUS_43520 gene clpX 439969 441252 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_43520 441452 444043 gene locus_tag LOCUS_43530 441452 444043 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228497.1 protein_id gnl|my_center|LOCUS_43530 >Feature sequence007 2085 808 gene locus_tag LOCUS_43540 gene tyrS 2085 808 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027993.1 protein_id gnl|my_center|LOCUS_43540 3140 2430 gene locus_tag LOCUS_43550 3140 2430 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_43550 4611 3148 gene locus_tag LOCUS_43560 gene argH 4611 3148 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_43560 5382 4876 gene locus_tag LOCUS_43570 5382 4876 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_43570 6341 5385 gene locus_tag LOCUS_43580 gene argF 6341 5385 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776178.1 protein_id gnl|my_center|LOCUS_43580 7552 6338 gene locus_tag LOCUS_43590 7552 6338 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_43590 8452 7562 gene locus_tag LOCUS_43600 gene argB 8452 7562 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227836.1 protein_id gnl|my_center|LOCUS_43600 9603 8449 gene locus_tag LOCUS_43610 gene argJ 9603 8449 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_43610 10723 9695 gene locus_tag LOCUS_43620 gene argC 10723 9695 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227838.1 protein_id gnl|my_center|LOCUS_43620 10906 12588 gene locus_tag LOCUS_43630 10906 12588 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_43630 12774 13145 gene locus_tag LOCUS_43640 12774 13145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 14259 13153 gene locus_tag LOCUS_43650 14259 13153 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_43650 14452 15024 gene locus_tag LOCUS_43660 14452 15024 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_43660 15140 18397 gene locus_tag LOCUS_43670 15140 18397 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742126.1 protein_id gnl|my_center|LOCUS_43670 18907 18479 gene locus_tag LOCUS_43680 18907 18479 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_43680 20117 19113 gene locus_tag LOCUS_43690 20117 19113 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894835.1 protein_id gnl|my_center|LOCUS_43690 20651 21298 gene locus_tag LOCUS_43700 20651 21298 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466502.1 protein_id gnl|my_center|LOCUS_43700 21458 22663 gene locus_tag LOCUS_43710 21458 22663 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228864.1 protein_id gnl|my_center|LOCUS_43710 22866 22612 gene locus_tag LOCUS_43720 22866 22612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 22940 24826 gene locus_tag LOCUS_43730 22940 24826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 24827 25342 gene locus_tag LOCUS_43740 24827 25342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 26278 25583 gene locus_tag LOCUS_43750 gene tenA 26278 25583 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066884.1 protein_id gnl|my_center|LOCUS_43750 26658 27080 gene locus_tag LOCUS_43760 26658 27080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 29813 27195 gene locus_tag LOCUS_43770 gene pheT 29813 27195 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_43770 30913 29813 gene locus_tag LOCUS_43780 gene pheS 30913 29813 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_43780 32113 31031 gene locus_tag LOCUS_43790 32113 31031 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_43790 33136 32306 gene locus_tag LOCUS_43800 33136 32306 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_43800 33655 33272 gene locus_tag LOCUS_43810 gene rplT 33655 33272 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_43810 33875 33681 gene locus_tag LOCUS_43820 gene rpmI 33875 33681 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776198.1 protein_id gnl|my_center|LOCUS_43820 34750 34073 gene locus_tag LOCUS_43830 gene infC 34750 34073 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_43830 35806 34973 gene locus_tag LOCUS_43840 35806 34973 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_43840 36963 35803 gene locus_tag LOCUS_43850 gene mltG 36963 35803 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_43850 38081 37557 gene locus_tag LOCUS_43860 gene ruvX 38081 37557 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_43860 40791 38119 gene locus_tag LOCUS_43870 gene alaS 40791 38119 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_43870 41155 40793 gene locus_tag LOCUS_43880 41155 40793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 41508 41152 gene locus_tag LOCUS_43890 41508 41152 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_43890 42987 41632 gene locus_tag LOCUS_43900 42987 41632 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_43900 43564 43049 gene locus_tag LOCUS_43910 43564 43049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 43904 44809 gene locus_tag LOCUS_43920 43904 44809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 46693 44936 gene locus_tag LOCUS_43930 gene aspS 46693 44936 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224570.1 protein_id gnl|my_center|LOCUS_43930 47949 46690 gene locus_tag LOCUS_43940 gene hisS 47949 46690 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 protein_id gnl|my_center|LOCUS_43940 48653 47949 gene locus_tag LOCUS_43950 48653 47949 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_43950 48812 49654 gene locus_tag LOCUS_43960 48812 49654 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 protein_id gnl|my_center|LOCUS_43960 49695 50957 gene locus_tag LOCUS_43970 49695 50957 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_43970 53481 51091 gene locus_tag LOCUS_43980 gene relA 53481 51091 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_43980 54114 53590 gene locus_tag LOCUS_43990 54114 53590 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_43990 55308 54235 gene locus_tag LOCUS_44000 gene secF 55308 54235 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44000 56975 55308 gene locus_tag LOCUS_44010 gene secD 56975 55308 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_44010 57366 57004 gene locus_tag LOCUS_44020 57366 57004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 58735 57638 gene locus_tag LOCUS_44030 gene ruvB 58735 57638 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_44030 59382 58759 gene locus_tag LOCUS_44040 gene ruvA 59382 58759 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_44040 59966 59379 gene locus_tag LOCUS_44050 gene ruvC 59966 59379 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_44050 60858 60103 gene locus_tag LOCUS_44060 60858 60103 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_44060 61488 60862 gene locus_tag LOCUS_44070 gene pdxT 61488 60862 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227127.1 protein_id gnl|my_center|LOCUS_44070 63396 61720 gene locus_tag LOCUS_44080 63396 61720 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028251.1 protein_id gnl|my_center|LOCUS_44080 64495 63563 gene locus_tag LOCUS_44090 gene pdxS 64495 63563 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051767629.1 protein_id gnl|my_center|LOCUS_44090 65588 64623 gene locus_tag LOCUS_44100 65588 64623 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031120.1 protein_id gnl|my_center|LOCUS_44100 65473 65679 gene locus_tag LOCUS_44110 65473 65679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 66229 65687 gene locus_tag LOCUS_44120 66229 65687 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_44120 67429 66296 gene locus_tag LOCUS_44130 67429 66296 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_44130 68349 67426 gene locus_tag LOCUS_44140 68349 67426 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_44140 68297 68602 gene locus_tag LOCUS_44150 68297 68602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 69208 68606 gene locus_tag LOCUS_44160 69208 68606 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 protein_id gnl|my_center|LOCUS_44160 69555 71720 gene locus_tag LOCUS_44170 69555 71720 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_44170 71899 73500 gene locus_tag LOCUS_44180 71899 73500 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_44180 73842 76073 gene locus_tag LOCUS_44190 73842 76073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 76709 76155 gene locus_tag LOCUS_44200 76709 76155 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_44200 76883 78094 gene locus_tag LOCUS_44210 76883 78094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 80322 78358 gene locus_tag LOCUS_44220 gene thrS 80322 78358 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_44220 81319 80657 gene locus_tag LOCUS_44230 81319 80657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 81724 83214 gene locus_tag LOCUS_44240 81724 83214 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 protein_id gnl|my_center|LOCUS_44240 83827 83417 gene locus_tag LOCUS_44250 83827 83417 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_44250 86890 83894 gene locus_tag LOCUS_44260 86890 83894 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230257.1 protein_id gnl|my_center|LOCUS_44260 87441 88424 gene locus_tag LOCUS_44270 87441 88424 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_44270 88421 89410 gene locus_tag LOCUS_44280 88421 89410 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_44280 89685 90896 gene locus_tag LOCUS_44290 89685 90896 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_44290 91203 90901 gene locus_tag LOCUS_44300 91203 90901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 93829 91346 gene locus_tag LOCUS_44310 93829 91346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 94226 93933 gene locus_tag LOCUS_44320 94226 93933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 96981 94513 gene locus_tag LOCUS_44330 gene helR 96981 94513 CDS product RNA polymerase recycling motor ATPase HelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230689.1 protein_id gnl|my_center|LOCUS_44330 98416 97331 gene locus_tag LOCUS_44340 98416 97331 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226380.1 protein_id gnl|my_center|LOCUS_44340 98896 101130 gene locus_tag LOCUS_44350 gene pabB 98896 101130 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_44350 101677 102390 gene locus_tag LOCUS_44360 101677 102390 CDS product DUF4352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727524.1 protein_id gnl|my_center|LOCUS_44360 102529 103176 gene locus_tag LOCUS_44370 102529 103176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44370 103256 103789 gene locus_tag LOCUS_44380 103256 103789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 104355 104915 gene locus_tag LOCUS_44390 104355 104915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 104899 105732 gene locus_tag LOCUS_44400 104899 105732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 105996 106757 gene locus_tag LOCUS_44410 105996 106757 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_44410 107407 106775 gene locus_tag LOCUS_44420 gene mftR 107407 106775 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403482.1 protein_id gnl|my_center|LOCUS_44420 107444 107614 gene locus_tag LOCUS_44430 107444 107614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 107653 107955 gene locus_tag LOCUS_44440 gene mftB 107653 107955 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077617.1 protein_id gnl|my_center|LOCUS_44440 107952 109298 gene locus_tag LOCUS_44450 gene mftC 107952 109298 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112050.1 protein_id gnl|my_center|LOCUS_44450 109295 111265 gene locus_tag LOCUS_44460 109295 111265 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_44460 111262 113226 gene locus_tag LOCUS_44470 gene dgcA 111262 113226 CDS product dimethylglycine demethylation protein DgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103128.1 protein_id gnl|my_center|LOCUS_44470 113223 114248 gene locus_tag LOCUS_44480 113223 114248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 114339 115670 gene locus_tag LOCUS_44490 114339 115670 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461372.1 protein_id gnl|my_center|LOCUS_44490 115667 116047 gene locus_tag LOCUS_44500 115667 116047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 116151 117074 gene locus_tag LOCUS_44510 116151 117074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 117071 117754 gene locus_tag LOCUS_44520 gene mftE 117071 117754 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877069.1 protein_id gnl|my_center|LOCUS_44520 117896 118468 gene locus_tag LOCUS_44530 117896 118468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44530 119474 118506 gene locus_tag LOCUS_44540 119474 118506 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230702.1 protein_id gnl|my_center|LOCUS_44540 120266 122251 gene locus_tag LOCUS_44550 120266 122251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 124435 122264 gene locus_tag LOCUS_44560 124435 122264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 125846 124566 gene locus_tag LOCUS_44570 gene aldO 125846 124566 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_44570 126716 126135 gene locus_tag LOCUS_44580 126716 126135 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_44580 128159 127044 gene locus_tag LOCUS_44590 128159 127044 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206889.1 protein_id gnl|my_center|LOCUS_44590 129331 128651 gene locus_tag LOCUS_44600 129331 128651 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809856.1 protein_id gnl|my_center|LOCUS_44600 129706 130110 gene locus_tag LOCUS_44610 129706 130110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 130107 130589 gene locus_tag LOCUS_44620 130107 130589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 130507 131355 gene locus_tag LOCUS_44630 130507 131355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 131799 132167 gene locus_tag LOCUS_44640 gene glbN 131799 132167 CDS product group 1 truncated hemoglobin GlbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407730.1 protein_id gnl|my_center|LOCUS_44640 133986 132622 gene locus_tag LOCUS_44650 133986 132622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467055.1 protein_id gnl|my_center|LOCUS_44650 134265 135068 gene locus_tag LOCUS_44660 134265 135068 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225909.1 protein_id gnl|my_center|LOCUS_44660 136272 135073 gene locus_tag LOCUS_44670 136272 135073 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224575.1 protein_id gnl|my_center|LOCUS_44670 136231 136746 gene locus_tag LOCUS_44680 136231 136746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 136754 137383 gene locus_tag LOCUS_44690 136754 137383 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978121.1 protein_id gnl|my_center|LOCUS_44690 137840 138871 gene locus_tag LOCUS_44700 137840 138871 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_44700 138885 139652 gene locus_tag LOCUS_44710 138885 139652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 139642 140322 gene locus_tag LOCUS_44720 139642 140322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 140231 141952 gene locus_tag LOCUS_44730 gene mrdA 140231 141952 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_44730 141960 143120 gene locus_tag LOCUS_44740 gene rodA 141960 143120 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_44740 143892 143077 gene locus_tag LOCUS_44750 143892 143077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109028630.1 protein_id gnl|my_center|LOCUS_44750 144694 143909 gene locus_tag LOCUS_44760 144694 143909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230260.1 protein_id gnl|my_center|LOCUS_44760 145519 144698 gene locus_tag LOCUS_44770 145519 144698 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230259.1 protein_id gnl|my_center|LOCUS_44770 146367 145516 gene locus_tag LOCUS_44780 146367 145516 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223278.1 protein_id gnl|my_center|LOCUS_44780 146948 147490 gene locus_tag LOCUS_44790 146948 147490 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 protein_id gnl|my_center|LOCUS_44790 148283 147525 gene locus_tag LOCUS_44800 148283 147525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537558.1 protein_id gnl|my_center|LOCUS_44800 149311 148280 gene locus_tag LOCUS_44810 149311 148280 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972350.1 protein_id gnl|my_center|LOCUS_44810 150303 149308 gene locus_tag LOCUS_44820 150303 149308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992347.1 protein_id gnl|my_center|LOCUS_44820 151268 150303 gene locus_tag LOCUS_44830 gene yclQ 151268 150303 CDS product petrobactin ABC transporter substrate-binding protein YclQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246619.1 protein_id gnl|my_center|LOCUS_44830 152766 151390 gene locus_tag LOCUS_44840 152766 151390 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_44840 153079 153618 gene locus_tag LOCUS_44850 153079 153618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 153832 154098 gene locus_tag LOCUS_44860 153832 154098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 157656 154099 gene locus_tag LOCUS_44870 157656 154099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221460661.1 protein_id gnl|my_center|LOCUS_44870 160354 158042 gene locus_tag LOCUS_44880 160354 158042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 162523 160430 gene locus_tag LOCUS_44890 162523 160430 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_44890 164033 162525 gene locus_tag LOCUS_44900 gene pkaE 164033 162525 CDS product serine/threonine protein kinase PkaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028766.1 protein_id gnl|my_center|LOCUS_44900 166041 164155 gene locus_tag LOCUS_44910 166041 164155 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230654.1 protein_id gnl|my_center|LOCUS_44910 166843 166073 gene locus_tag LOCUS_44920 166843 166073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 168786 166858 gene locus_tag LOCUS_44930 168786 166858 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204893.1 protein_id gnl|my_center|LOCUS_44930 172742 168789 gene locus_tag LOCUS_44940 gene drmA 172742 168789 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204892.1 protein_id gnl|my_center|LOCUS_44940 177069 172855 gene locus_tag LOCUS_44950 177069 172855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204891.1 protein_id gnl|my_center|LOCUS_44950 180212 177066 gene locus_tag LOCUS_44960 gene drmD 180212 177066 CDS product DISARM system SNF2-like helicase DrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204890.1 protein_id gnl|my_center|LOCUS_44960 180802 183675 gene locus_tag LOCUS_44970 180802 183675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 184159 183728 gene locus_tag LOCUS_44980 184159 183728 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865215.1 protein_id gnl|my_center|LOCUS_44980 184416 184156 gene locus_tag LOCUS_44990 184416 184156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44990 184594 185418 gene locus_tag LOCUS_45000 184594 185418 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_45000 185409 185600 gene locus_tag LOCUS_45010 185409 185600 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_45010 185735 185929 gene locus_tag LOCUS_45020 185735 185929 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_45020 186047 186241 gene locus_tag LOCUS_45030 186047 186241 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028317.1 protein_id gnl|my_center|LOCUS_45030 186549 186232 gene locus_tag LOCUS_45040 186549 186232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 187735 186734 gene locus_tag LOCUS_45050 187735 186734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45050 187956 188435 gene locus_tag LOCUS_45060 187956 188435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45060 188540 188788 gene locus_tag LOCUS_45070 188540 188788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 188836 189363 gene locus_tag LOCUS_45080 188836 189363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 189911 189360 gene locus_tag LOCUS_45090 189911 189360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 189865 190701 gene locus_tag LOCUS_45100 189865 190701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 191288 191049 gene locus_tag LOCUS_45110 191288 191049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 191188 191553 gene locus_tag LOCUS_45120 191188 191553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 191796 192818 gene locus_tag LOCUS_45130 191796 192818 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168991739.1 protein_id gnl|my_center|LOCUS_45130 192991 195324 gene locus_tag LOCUS_45140 192991 195324 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029643.1 protein_id gnl|my_center|LOCUS_45140 196630 195656 gene locus_tag LOCUS_45150 196630 195656 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_45150 197419 196916 gene locus_tag LOCUS_45160 197419 196916 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223318.1 protein_id gnl|my_center|LOCUS_45160 197514 198782 gene locus_tag LOCUS_45170 197514 198782 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_45170 198813 199439 gene locus_tag LOCUS_45180 198813 199439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 199655 202963 gene locus_tag LOCUS_45190 199655 202963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45190 203210 203022 gene locus_tag LOCUS_45200 203210 203022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 203289 208043 gene locus_tag LOCUS_45210 203289 208043 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151070226.1 protein_id gnl|my_center|LOCUS_45210 208949 208209 gene locus_tag LOCUS_45220 208949 208209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 210392 209718 gene locus_tag LOCUS_45230 210392 209718 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536888.1 protein_id gnl|my_center|LOCUS_45230 211679 210729 gene locus_tag LOCUS_45240 211679 210729 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_45240 213411 211774 gene locus_tag LOCUS_45250 213411 211774 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_45250 214678 214388 gene locus_tag LOCUS_45260 214678 214388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45260 214608 215807 gene locus_tag LOCUS_45270 214608 215807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 protein_id gnl|my_center|LOCUS_45270 216846 215863 gene locus_tag LOCUS_45280 216846 215863 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047667.1 protein_id gnl|my_center|LOCUS_45280 217476 218468 gene locus_tag LOCUS_45290 217476 218468 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_45290 220077 218443 gene locus_tag LOCUS_45300 220077 218443 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224529.1 protein_id gnl|my_center|LOCUS_45300 220240 221031 gene locus_tag LOCUS_45310 220240 221031 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_45310 221043 221732 gene locus_tag LOCUS_45320 221043 221732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 221821 223095 gene locus_tag LOCUS_45330 gene hisD 221821 223095 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703749.1 protein_id gnl|my_center|LOCUS_45330 223101 224486 gene locus_tag LOCUS_45340 223101 224486 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897902.1 protein_id gnl|my_center|LOCUS_45340 224524 226038 gene locus_tag LOCUS_45350 224524 226038 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898298.1 protein_id gnl|my_center|LOCUS_45350 226349 226173 gene locus_tag LOCUS_45360 226349 226173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45360 226348 226923 gene locus_tag LOCUS_45370 226348 226923 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_45370 227256 226930 gene locus_tag LOCUS_45380 227256 226930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 227764 228999 gene locus_tag LOCUS_45390 227764 228999 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_45390 229107 229685 gene locus_tag LOCUS_45400 229107 229685 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254574.1 protein_id gnl|my_center|LOCUS_45400 230033 231025 gene locus_tag LOCUS_45410 230033 231025 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 protein_id gnl|my_center|LOCUS_45410 231195 231578 gene locus_tag LOCUS_45420 231195 231578 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979840.1 protein_id gnl|my_center|LOCUS_45420 232423 232995 gene locus_tag LOCUS_45430 232423 232995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142256.1 protein_id gnl|my_center|LOCUS_45430 233186 234322 gene locus_tag LOCUS_45440 233186 234322 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222881.1 protein_id gnl|my_center|LOCUS_45440 234319 234969 gene locus_tag LOCUS_45450 234319 234969 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027558.1 protein_id gnl|my_center|LOCUS_45450 235078 235899 gene locus_tag LOCUS_45460 235078 235899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 236108 235905 gene locus_tag LOCUS_45470 236108 235905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 236010 236288 gene locus_tag LOCUS_45480 236010 236288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 237690 236419 gene locus_tag LOCUS_45490 237690 236419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 238898 237771 gene locus_tag LOCUS_45500 238898 237771 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027307.1 protein_id gnl|my_center|LOCUS_45500 239788 238898 gene locus_tag LOCUS_45510 239788 238898 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 protein_id gnl|my_center|LOCUS_45510 240687 239785 gene locus_tag LOCUS_45520 240687 239785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088703.1 protein_id gnl|my_center|LOCUS_45520 241490 240684 gene locus_tag LOCUS_45530 241490 240684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_45530 241831 242037 gene locus_tag LOCUS_45540 241831 242037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 243087 243641 gene locus_tag LOCUS_45550 243087 243641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 244191 244952 gene locus_tag LOCUS_45560 244191 244952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 245711 244965 gene locus_tag LOCUS_45570 245711 244965 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401662.1 protein_id gnl|my_center|LOCUS_45570 246396 245917 gene locus_tag LOCUS_45580 246396 245917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 246490 247044 gene locus_tag LOCUS_45590 246490 247044 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_45590 248738 247128 gene locus_tag LOCUS_45600 248738 247128 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851194.1 protein_id gnl|my_center|LOCUS_45600 250363 248750 gene locus_tag LOCUS_45610 250363 248750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45610 250245 250520 gene locus_tag LOCUS_45620 250245 250520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45620 251488 251072 gene locus_tag LOCUS_45630 251488 251072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45630 251730 251485 gene locus_tag LOCUS_45640 251730 251485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 252244 252606 gene locus_tag LOCUS_45650 252244 252606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 252599 254815 gene locus_tag LOCUS_45660 252599 254815 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228470.1 protein_id gnl|my_center|LOCUS_45660 255122 256573 gene locus_tag LOCUS_45670 255122 256573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 258445 256643 gene locus_tag LOCUS_45680 258445 256643 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227358.1 protein_id gnl|my_center|LOCUS_45680 260295 258442 gene locus_tag LOCUS_45690 260295 258442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227357.1 protein_id gnl|my_center|LOCUS_45690 261284 260775 gene locus_tag LOCUS_45700 261284 260775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45700 262560 261661 gene locus_tag LOCUS_45710 262560 261661 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228840.1 protein_id gnl|my_center|LOCUS_45710 263181 262636 gene locus_tag LOCUS_45720 263181 262636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 264277 265395 gene locus_tag LOCUS_45730 264277 265395 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257829.1 protein_id gnl|my_center|LOCUS_45730 265488 266024 gene locus_tag LOCUS_45740 265488 266024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45740 266457 266104 gene locus_tag LOCUS_45750 266457 266104 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031460.1 protein_id gnl|my_center|LOCUS_45750 266513 267274 gene locus_tag LOCUS_45760 266513 267274 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971996.1 protein_id gnl|my_center|LOCUS_45760 267975 269423 gene locus_tag LOCUS_45770 267975 269423 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582870.1 protein_id gnl|my_center|LOCUS_45770 269423 270370 gene locus_tag LOCUS_45780 269423 270370 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 protein_id gnl|my_center|LOCUS_45780 270367 271221 gene locus_tag LOCUS_45790 270367 271221 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 protein_id gnl|my_center|LOCUS_45790 271218 272279 gene locus_tag LOCUS_45800 271218 272279 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 protein_id gnl|my_center|LOCUS_45800 272338 273171 gene locus_tag LOCUS_45810 272338 273171 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222653.1 protein_id gnl|my_center|LOCUS_45810 273909 273493 gene locus_tag LOCUS_45820 273909 273493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45820 275414 274125 gene locus_tag LOCUS_45830 275414 274125 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_45830 281009 275916 gene locus_tag LOCUS_45840 281009 275916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 281908 281006 gene locus_tag LOCUS_45850 281908 281006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190062186.1 protein_id gnl|my_center|LOCUS_45850 283790 281901 gene locus_tag LOCUS_45860 283790 281901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 284465 284283 gene locus_tag LOCUS_45870 284465 284283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45870 284902 286446 gene locus_tag LOCUS_45880 284902 286446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 287397 286447 gene locus_tag LOCUS_45890 287397 286447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 287462 287671 gene locus_tag LOCUS_45900 287462 287671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 287886 288803 gene locus_tag LOCUS_45910 287886 288803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45910 289237 289088 gene locus_tag LOCUS_45920 289237 289088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 289772 289479 gene locus_tag LOCUS_45930 289772 289479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45930 290416 291243 gene locus_tag LOCUS_45940 290416 291243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 291490 292677 gene locus_tag LOCUS_45950 291490 292677 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223752.1 protein_id gnl|my_center|LOCUS_45950 293169 293555 gene locus_tag LOCUS_45960 293169 293555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 294714 293776 gene locus_tag LOCUS_45970 294714 293776 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_45970 295317 296462 gene locus_tag LOCUS_45980 295317 296462 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858297.1 protein_id gnl|my_center|LOCUS_45980 296459 297232 gene locus_tag LOCUS_45990 296459 297232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 297229 298224 gene locus_tag LOCUS_46000 297229 298224 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_46000 298221 299858 gene locus_tag LOCUS_46010 298221 299858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46010 299855 301567 gene locus_tag LOCUS_46020 gene cydC 299855 301567 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_46020 302135 301629 gene locus_tag LOCUS_46030 302135 301629 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125205.1 protein_id gnl|my_center|LOCUS_46030 302264 303004 gene locus_tag LOCUS_46040 302264 303004 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385801.1 protein_id gnl|my_center|LOCUS_46040 303557 303051 gene locus_tag LOCUS_46050 303557 303051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46050 304439 303594 gene locus_tag LOCUS_46060 304439 303594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46060 304818 305567 gene locus_tag LOCUS_46070 304818 305567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 306166 305738 gene locus_tag LOCUS_46080 306166 305738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 306906 307349 gene locus_tag LOCUS_46090 306906 307349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46090 308527 308054 gene locus_tag LOCUS_46100 308527 308054 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726929.1 protein_id gnl|my_center|LOCUS_46100 309699 308524 gene locus_tag LOCUS_46110 309699 308524 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728503.1 protein_id gnl|my_center|LOCUS_46110 310921 309716 gene locus_tag LOCUS_46120 310921 309716 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728502.1 protein_id gnl|my_center|LOCUS_46120 312252 311047 gene locus_tag LOCUS_46130 312252 311047 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 protein_id gnl|my_center|LOCUS_46130 313532 312399 gene locus_tag LOCUS_46140 gene sfnG 313532 312399 CDS product dimethyl sulfone monooxygenase SfnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730592.1 protein_id gnl|my_center|LOCUS_46140 313628 314536 gene locus_tag LOCUS_46150 313628 314536 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027226.1 protein_id gnl|my_center|LOCUS_46150 314716 315357 gene locus_tag LOCUS_46160 314716 315357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 316700 315483 gene locus_tag LOCUS_46170 316700 315483 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223469.1 protein_id gnl|my_center|LOCUS_46170 316911 319001 gene locus_tag LOCUS_46180 316911 319001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 319053 319676 gene locus_tag LOCUS_46190 319053 319676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46190 319775 320935 gene locus_tag LOCUS_46200 319775 320935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46200 321171 322505 gene locus_tag LOCUS_46210 321171 322505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 322607 323779 gene locus_tag LOCUS_46220 322607 323779 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138052126.1 protein_id gnl|my_center|LOCUS_46220 324601 324527 gene locus_tag LOCUS_t00640 324601 324527 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 325032 325505 gene locus_tag LOCUS_46230 325032 325505 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_46230 326231 325602 gene locus_tag LOCUS_46240 326231 325602 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_46240 326314 327807 gene locus_tag LOCUS_46250 326314 327807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977727.1 protein_id gnl|my_center|LOCUS_46250 328737 327898 gene locus_tag LOCUS_46260 328737 327898 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_46260 330442 328895 gene locus_tag LOCUS_46270 gene hutH 330442 328895 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 protein_id gnl|my_center|LOCUS_46270 330633 330706 gene locus_tag LOCUS_t00650 330633 330706 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 330729 330800 gene locus_tag LOCUS_t00660 330729 330800 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 330818 330892 gene locus_tag LOCUS_t00670 330818 330892 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 331595 330996 gene locus_tag LOCUS_46280 331595 330996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 332424 331969 gene locus_tag LOCUS_46290 332424 331969 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 protein_id gnl|my_center|LOCUS_46290 333301 332696 gene locus_tag LOCUS_46300 333301 332696 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_46300 334449 333298 gene locus_tag LOCUS_46310 334449 333298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 334700 336391 gene locus_tag LOCUS_46320 334700 336391 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_46320 336461 337558 gene locus_tag LOCUS_46330 336461 337558 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_46330 337571 338089 gene locus_tag LOCUS_46340 337571 338089 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_46340 338352 340148 gene locus_tag LOCUS_46350 338352 340148 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226167.1 protein_id gnl|my_center|LOCUS_46350 341311 340157 gene locus_tag LOCUS_46360 341311 340157 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 protein_id gnl|my_center|LOCUS_46360 342181 341354 gene locus_tag LOCUS_46370 342181 341354 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466665.1 protein_id gnl|my_center|LOCUS_46370 342551 342363 gene locus_tag LOCUS_46380 342551 342363 CDS product DUF5999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977451.1 protein_id gnl|my_center|LOCUS_46380 343655 342645 gene locus_tag LOCUS_46390 343655 342645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729219.1 protein_id gnl|my_center|LOCUS_46390 345214 343655 gene locus_tag LOCUS_46400 345214 343655 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729220.1 protein_id gnl|my_center|LOCUS_46400 346301 345243 gene locus_tag LOCUS_46410 346301 345243 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729221.1 protein_id gnl|my_center|LOCUS_46410 346625 346428 gene locus_tag LOCUS_46420 346625 346428 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226108.1 protein_id gnl|my_center|LOCUS_46420 348337 346832 gene locus_tag LOCUS_46430 gene araA 348337 346832 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226247.1 protein_id gnl|my_center|LOCUS_46430 349092 348334 gene locus_tag LOCUS_46440 349092 348334 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_46440 350839 349217 gene locus_tag LOCUS_46450 gene araB 350839 349217 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226245.1 protein_id gnl|my_center|LOCUS_46450 351920 350925 gene locus_tag LOCUS_46460 gene yjfF 351920 350925 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_46460 353053 351917 gene locus_tag LOCUS_46470 353053 351917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_46470 354594 353050 gene locus_tag LOCUS_46480 354594 353050 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_46480 355718 354735 gene locus_tag LOCUS_46490 355718 354735 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_46490 356788 355760 gene locus_tag LOCUS_46500 356788 355760 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_46500 357106 358227 gene locus_tag LOCUS_46510 gene chvE 357106 358227 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226248.1 protein_id gnl|my_center|LOCUS_46510 358237 359784 gene locus_tag LOCUS_46520 gene gguA 358237 359784 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226249.1 protein_id gnl|my_center|LOCUS_46520 359808 361067 gene locus_tag LOCUS_46530 gene gguB 359808 361067 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226250.1 protein_id gnl|my_center|LOCUS_46530 362180 361128 gene locus_tag LOCUS_46540 362180 361128 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_46540 362460 362834 gene locus_tag LOCUS_46550 362460 362834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46550 362872 364218 gene locus_tag LOCUS_46560 362872 364218 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026898.1 protein_id gnl|my_center|LOCUS_46560 364543 364193 gene locus_tag LOCUS_46570 364543 364193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141780.1 protein_id gnl|my_center|LOCUS_46570 365456 365827 gene locus_tag LOCUS_46580 365456 365827 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230453.1 protein_id gnl|my_center|LOCUS_46580 367340 367597 gene locus_tag LOCUS_46590 367340 367597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 367756 369570 gene locus_tag LOCUS_46600 367756 369570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 370063 370242 gene locus_tag LOCUS_46610 370063 370242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 373323 370432 gene locus_tag LOCUS_46620 373323 370432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 374241 373864 gene locus_tag LOCUS_46630 374241 373864 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_46630 374591 375493 gene locus_tag LOCUS_46640 374591 375493 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029177.1 protein_id gnl|my_center|LOCUS_46640 375490 376521 gene locus_tag LOCUS_46650 375490 376521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_46650 376716 376522 gene locus_tag LOCUS_46660 376716 376522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 376710 377756 gene locus_tag LOCUS_46670 376710 377756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 379347 378001 gene locus_tag LOCUS_46680 379347 378001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 379652 380362 gene locus_tag LOCUS_46690 379652 380362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46690 380516 381169 gene locus_tag LOCUS_46700 380516 381169 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055744452.1 protein_id gnl|my_center|LOCUS_46700 382335 381133 gene locus_tag LOCUS_46710 382335 381133 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876812.1 protein_id gnl|my_center|LOCUS_46710 382707 383456 gene locus_tag LOCUS_46720 382707 383456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 protein_id gnl|my_center|LOCUS_46720 383690 384682 gene locus_tag LOCUS_46730 383690 384682 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836183.1 protein_id gnl|my_center|LOCUS_46730 385664 384708 gene locus_tag LOCUS_46740 385664 384708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 385797 386201 gene locus_tag LOCUS_46750 385797 386201 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_46750 386322 387089 gene locus_tag LOCUS_46760 386322 387089 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223255.1 protein_id gnl|my_center|LOCUS_46760 387195 387467 gene locus_tag LOCUS_46770 387195 387467 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_46770 388082 387399 gene locus_tag LOCUS_46780 388082 387399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46780 388138 390663 gene locus_tag LOCUS_46790 388138 390663 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_46790 391446 390781 gene locus_tag LOCUS_46800 391446 390781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 392857 391733 gene locus_tag LOCUS_46810 gene dusB 392857 391733 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_46810 393174 393890 gene locus_tag LOCUS_46820 393174 393890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 394013 394086 gene locus_tag LOCUS_t00680 394013 394086 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 394124 394195 gene locus_tag LOCUS_t00690 394124 394195 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 2168 675 gene locus_tag LOCUS_46830 2168 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 2625 3539 gene locus_tag LOCUS_46840 2625 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46840 3549 4514 gene locus_tag LOCUS_46850 3549 4514 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_46850 5330 4554 gene locus_tag LOCUS_46860 5330 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 6139 5327 gene locus_tag LOCUS_46870 6139 5327 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153482230.1 protein_id gnl|my_center|LOCUS_46870 6408 6214 gene locus_tag LOCUS_46880 6408 6214 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_46880 10203 6529 gene locus_tag LOCUS_46890 10203 6529 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_46890 10790 11974 gene locus_tag LOCUS_46900 10790 11974 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223562.1 protein_id gnl|my_center|LOCUS_46900 12131 13024 gene locus_tag LOCUS_46910 12131 13024 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400979.1 protein_id gnl|my_center|LOCUS_46910 13304 14539 gene locus_tag LOCUS_46920 13304 14539 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223433.1 protein_id gnl|my_center|LOCUS_46920 14560 16113 gene locus_tag LOCUS_46930 14560 16113 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972412.1 protein_id gnl|my_center|LOCUS_46930 16106 17113 gene locus_tag LOCUS_46940 16106 17113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225826.1 protein_id gnl|my_center|LOCUS_46940 17147 18217 gene locus_tag LOCUS_46950 17147 18217 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225827.1 protein_id gnl|my_center|LOCUS_46950 18236 19459 gene locus_tag LOCUS_46960 18236 19459 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_46960 19456 20466 gene locus_tag LOCUS_46970 19456 20466 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225829.1 protein_id gnl|my_center|LOCUS_46970 21241 20765 gene locus_tag LOCUS_46980 21241 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_46980 21921 21253 gene locus_tag LOCUS_46990 21921 21253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_46990 22311 21973 gene locus_tag LOCUS_47000 22311 21973 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229185.1 protein_id gnl|my_center|LOCUS_47000 22631 22440 gene locus_tag LOCUS_47010 22631 22440 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 protein_id gnl|my_center|LOCUS_47010 23145 22678 gene locus_tag LOCUS_47020 23145 22678 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_47020 23218 23880 gene locus_tag LOCUS_47030 23218 23880 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_47030 24991 24413 gene locus_tag LOCUS_47040 24991 24413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 26447 25356 gene locus_tag LOCUS_47050 26447 25356 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_47050 27157 26444 gene locus_tag LOCUS_47060 27157 26444 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_47060 28459 27158 gene locus_tag LOCUS_47070 28459 27158 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 protein_id gnl|my_center|LOCUS_47070 28764 28573 gene locus_tag LOCUS_47080 28764 28573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 28733 29758 gene locus_tag LOCUS_47090 gene gmd 28733 29758 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_47090 30211 29768 gene locus_tag LOCUS_47100 30211 29768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 31608 30376 gene locus_tag LOCUS_47110 31608 30376 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020115335.1 protein_id gnl|my_center|LOCUS_47110 32221 33177 gene locus_tag LOCUS_47120 32221 33177 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_47120 33861 33247 gene locus_tag LOCUS_47130 33861 33247 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_47130 34211 34477 gene locus_tag LOCUS_47140 34211 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47140 34777 35562 gene locus_tag LOCUS_47150 34777 35562 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_47150 35579 36766 gene locus_tag LOCUS_47160 35579 36766 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228549.1 protein_id gnl|my_center|LOCUS_47160 36880 38550 gene locus_tag LOCUS_47170 36880 38550 CDS product BBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640551.1 protein_id gnl|my_center|LOCUS_47170 38645 39826 gene locus_tag LOCUS_47180 gene wecB 38645 39826 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_47180 39860 40627 gene locus_tag LOCUS_47190 39860 40627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393402.1 protein_id gnl|my_center|LOCUS_47190 40646 41899 gene locus_tag LOCUS_47200 40646 41899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 42038 42988 gene locus_tag LOCUS_47210 42038 42988 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727063.1 protein_id gnl|my_center|LOCUS_47210 43035 44237 gene locus_tag LOCUS_47220 43035 44237 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083703.1 protein_id gnl|my_center|LOCUS_47220 45837 44374 gene locus_tag LOCUS_47230 45837 44374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 46062 47168 gene locus_tag LOCUS_47240 46062 47168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972859.1 protein_id gnl|my_center|LOCUS_47240 47165 47842 gene locus_tag LOCUS_47250 47165 47842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 47839 48507 gene locus_tag LOCUS_47260 47839 48507 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030627.1 protein_id gnl|my_center|LOCUS_47260 48542 49447 gene locus_tag LOCUS_47270 48542 49447 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020544063.1 protein_id gnl|my_center|LOCUS_47270 49514 49993 gene locus_tag LOCUS_47280 49514 49993 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_47280 51739 50030 gene locus_tag LOCUS_47290 gene sppA 51739 50030 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 protein_id gnl|my_center|LOCUS_47290 53957 51762 gene locus_tag LOCUS_47300 gene glgB 53957 51762 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224470.1 protein_id gnl|my_center|LOCUS_47300 54114 54719 gene locus_tag LOCUS_47310 54114 54719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 54895 55443 gene locus_tag LOCUS_47320 54895 55443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 56807 55470 gene locus_tag LOCUS_47330 56807 55470 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224469.1 protein_id gnl|my_center|LOCUS_47330 58513 56804 gene locus_tag LOCUS_47340 gene treS 58513 56804 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031594.1 protein_id gnl|my_center|LOCUS_47340 60659 58716 gene locus_tag LOCUS_47350 60659 58716 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031595.1 protein_id gnl|my_center|LOCUS_47350 61201 63798 gene locus_tag LOCUS_47360 61201 63798 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_47360 63859 64299 gene locus_tag LOCUS_47370 63859 64299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47370 64280 65539 gene locus_tag LOCUS_47380 64280 65539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 65710 66552 gene locus_tag LOCUS_47390 65710 66552 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_47390 66549 68201 gene locus_tag LOCUS_47400 66549 68201 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918975.1 protein_id gnl|my_center|LOCUS_47400 68217 68753 gene locus_tag LOCUS_47410 68217 68753 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_47410 69185 71488 gene locus_tag LOCUS_47420 69185 71488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 71500 73389 gene locus_tag LOCUS_47430 71500 73389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 73409 74659 gene locus_tag LOCUS_47440 73409 74659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 74879 75658 gene locus_tag LOCUS_47450 74879 75658 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 protein_id gnl|my_center|LOCUS_47450 75671 76624 gene locus_tag LOCUS_47460 75671 76624 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223551.1 protein_id gnl|my_center|LOCUS_47460 76727 77884 gene locus_tag LOCUS_47470 76727 77884 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_47470 78881 77877 gene locus_tag LOCUS_47480 78881 77877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47480 78988 80061 gene locus_tag LOCUS_47490 gene mnmA 78988 80061 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_47490 80802 80158 gene locus_tag LOCUS_47500 80802 80158 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031843.1 protein_id gnl|my_center|LOCUS_47500 80943 81923 gene locus_tag LOCUS_47510 80943 81923 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_47510 82475 84652 gene locus_tag LOCUS_47520 gene ligA 82475 84652 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_47520 84733 86802 gene locus_tag LOCUS_47530 gene rmdB 84733 86802 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_47530 86961 87260 gene locus_tag LOCUS_47540 gene gatC 86961 87260 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_47540 87257 88753 gene locus_tag LOCUS_47550 gene gatA 87257 88753 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_47550 88750 90261 gene locus_tag LOCUS_47560 gene gatB 88750 90261 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_47560 90494 92584 gene locus_tag LOCUS_47570 90494 92584 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_47570 93731 92568 gene locus_tag LOCUS_47580 93731 92568 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_47580 93802 94725 gene locus_tag LOCUS_47590 93802 94725 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_47590 94946 97579 gene locus_tag LOCUS_47600 94946 97579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 97926 99668 gene locus_tag LOCUS_47610 97926 99668 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284399.1 protein_id gnl|my_center|LOCUS_47610 99682 100206 gene locus_tag LOCUS_47620 gene ilvN 99682 100206 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_47620 100264 101265 gene locus_tag LOCUS_47630 gene ilvC 100264 101265 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223583.1 protein_id gnl|my_center|LOCUS_47630 101909 101370 gene locus_tag LOCUS_47640 101909 101370 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_47640 102009 102566 gene locus_tag LOCUS_47650 102009 102566 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804263.1 protein_id gnl|my_center|LOCUS_47650 102563 103291 gene locus_tag LOCUS_47660 102563 103291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265944.1 protein_id gnl|my_center|LOCUS_47660 103288 105927 gene locus_tag LOCUS_47670 103288 105927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47670 106752 105988 gene locus_tag LOCUS_47680 106752 105988 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978033.1 protein_id gnl|my_center|LOCUS_47680 108049 107027 gene locus_tag LOCUS_47690 108049 107027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 108310 109935 gene locus_tag LOCUS_47700 gene serA 108310 109935 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_47700 110141 110272 gene locus_tag LOCUS_47710 110141 110272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47710 110328 111377 gene locus_tag LOCUS_47720 110328 111377 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_47720 111580 112677 gene locus_tag LOCUS_47730 111580 112677 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284299.1 protein_id gnl|my_center|LOCUS_47730 113448 112783 gene locus_tag LOCUS_47740 113448 112783 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_47740 113693 115291 gene locus_tag LOCUS_47750 gene cimA 113693 115291 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_47750 117039 115288 gene locus_tag LOCUS_47760 117039 115288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 117618 117226 gene locus_tag LOCUS_47770 117618 117226 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015550.1 protein_id gnl|my_center|LOCUS_47770 117760 118536 gene locus_tag LOCUS_47780 117760 118536 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_47780 118529 119923 gene locus_tag LOCUS_47790 gene gltX 118529 119923 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_47790 121978 119957 gene locus_tag LOCUS_47800 121978 119957 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226475.1 protein_id gnl|my_center|LOCUS_47800 121914 122171 gene locus_tag LOCUS_47810 121914 122171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 122157 122229 gene locus_tag LOCUS_t00700 122157 122229 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 122312 122587 gene locus_tag LOCUS_47820 122312 122587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 122557 122895 gene locus_tag LOCUS_47830 122557 122895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 122881 122956 gene locus_tag LOCUS_t00710 122881 122956 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 124934 123168 gene locus_tag LOCUS_47840 124934 123168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 125689 125006 gene locus_tag LOCUS_47850 gene ndgR 125689 125006 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_47850 125810 127195 gene locus_tag LOCUS_47860 gene leuC 125810 127195 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223619.1 protein_id gnl|my_center|LOCUS_47860 127232 127819 gene locus_tag LOCUS_47870 gene leuD 127232 127819 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_47870 127798 128073 gene locus_tag LOCUS_47880 127798 128073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47880 128131 128421 gene locus_tag LOCUS_47890 128131 128421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 128731 128504 gene locus_tag LOCUS_47900 128731 128504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030307.1 protein_id gnl|my_center|LOCUS_47900 129464 128733 gene locus_tag LOCUS_47910 gene actII 129464 128733 CDS product TetR family transcriptional regulator ActII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030045.1 protein_id gnl|my_center|LOCUS_47910 129619 131088 gene locus_tag LOCUS_47920 129619 131088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 131729 131112 gene locus_tag LOCUS_47930 gene cofC 131729 131112 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_47930 131844 132674 gene locus_tag LOCUS_47940 131844 132674 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_47940 132695 133702 gene locus_tag LOCUS_47950 132695 133702 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_47950 133699 134064 gene locus_tag LOCUS_47960 133699 134064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47960 134121 135233 gene locus_tag LOCUS_47970 134121 135233 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_47970 135779 135351 gene locus_tag LOCUS_47980 135779 135351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 136031 135798 gene locus_tag LOCUS_47990 136031 135798 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091994.1 protein_id gnl|my_center|LOCUS_47990 136218 137057 gene locus_tag LOCUS_48000 136218 137057 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_48000 137138 138046 gene locus_tag LOCUS_48010 137138 138046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 138109 138900 gene locus_tag LOCUS_48020 gene thiD 138109 138900 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_48020 139067 140584 gene locus_tag LOCUS_48030 139067 140584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 141160 140975 gene locus_tag LOCUS_48040 gene rpmB 141160 140975 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_48040 141420 143096 gene locus_tag LOCUS_48050 141420 143096 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902383.1 protein_id gnl|my_center|LOCUS_48050 143170 145416 gene locus_tag LOCUS_48060 gene recG 143170 145416 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_48060 145595 146257 gene locus_tag LOCUS_48070 gene rsmD 145595 146257 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_48070 146393 146869 gene locus_tag LOCUS_48080 gene coaD 146393 146869 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_48080 146947 147504 gene locus_tag LOCUS_48090 146947 147504 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_48090 147506 147685 gene locus_tag LOCUS_48100 gene rpmF 147506 147685 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223689.1 protein_id gnl|my_center|LOCUS_48100 147896 148663 gene locus_tag LOCUS_48110 gene rnc 147896 148663 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_48110 148682 149569 gene locus_tag LOCUS_48120 gene mutM 148682 149569 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223692.1 protein_id gnl|my_center|LOCUS_48120 149598 149891 gene locus_tag LOCUS_48130 149598 149891 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223794.1 protein_id gnl|my_center|LOCUS_48130 150078 150272 gene locus_tag LOCUS_48140 150078 150272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48140 150462 154160 gene locus_tag LOCUS_48150 150462 154160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48150 154205 155410 gene locus_tag LOCUS_48160 gene ftsY 154205 155410 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_48160 156337 156945 gene locus_tag LOCUS_48170 gene sigR 156337 156945 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_48170 157834 156998 gene locus_tag LOCUS_48180 157834 156998 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351059.1 protein_id gnl|my_center|LOCUS_48180 157926 158507 gene locus_tag LOCUS_48190 157926 158507 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_48190 158711 159535 gene locus_tag LOCUS_48200 158711 159535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 161591 159732 gene locus_tag LOCUS_48210 gene typA 161591 159732 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_48210 161788 162621 gene locus_tag LOCUS_48220 161788 162621 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974811.1 protein_id gnl|my_center|LOCUS_48220 162904 163749 gene locus_tag LOCUS_48230 162904 163749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 163828 164493 gene locus_tag LOCUS_48240 163828 164493 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222036.1 protein_id gnl|my_center|LOCUS_48240 164526 164975 gene locus_tag LOCUS_48250 164526 164975 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224170.1 protein_id gnl|my_center|LOCUS_48250 165022 165636 gene locus_tag LOCUS_48260 165022 165636 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229511.1 protein_id gnl|my_center|LOCUS_48260 165935 167206 gene locus_tag LOCUS_48270 165935 167206 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776637.1 protein_id gnl|my_center|LOCUS_48270 168343 167342 gene locus_tag LOCUS_48280 168343 167342 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284397.1 protein_id gnl|my_center|LOCUS_48280 168451 169713 gene locus_tag LOCUS_48290 168451 169713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_48290 170668 169664 gene locus_tag LOCUS_48300 170668 169664 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_48300 171030 172634 gene locus_tag LOCUS_48310 gene mdlC 171030 172634 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189354.1 protein_id gnl|my_center|LOCUS_48310 172631 173821 gene locus_tag LOCUS_48320 172631 173821 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114593.1 protein_id gnl|my_center|LOCUS_48320 173983 174840 gene locus_tag LOCUS_48330 173983 174840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 174921 176057 gene locus_tag LOCUS_48340 174921 176057 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185953.1 protein_id gnl|my_center|LOCUS_48340 176530 176159 gene locus_tag LOCUS_48350 176530 176159 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_48350 176891 176592 gene locus_tag LOCUS_48360 176891 176592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 176796 177719 gene locus_tag LOCUS_48370 176796 177719 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_48370 177758 178027 gene locus_tag LOCUS_48380 177758 178027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 178059 178760 gene locus_tag LOCUS_48390 gene mprA 178059 178760 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_48390 178789 179931 gene locus_tag LOCUS_48400 178789 179931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 180817 180497 gene locus_tag LOCUS_48410 180817 180497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 181113 181853 gene locus_tag LOCUS_48420 181113 181853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 181984 182058 gene locus_tag LOCUS_t00720 181984 182058 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 183535 182249 gene locus_tag LOCUS_48430 183535 182249 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727239.1 protein_id gnl|my_center|LOCUS_48430 184222 183764 gene locus_tag LOCUS_48440 184222 183764 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727240.1 protein_id gnl|my_center|LOCUS_48440 186321 184651 gene locus_tag LOCUS_48450 186321 184651 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726981.1 protein_id gnl|my_center|LOCUS_48450 187664 186318 gene locus_tag LOCUS_48460 187664 186318 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_48460 >Feature sequence009 1476 694 gene locus_tag LOCUS_48470 1476 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 1620 3065 gene locus_tag LOCUS_48480 1620 3065 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_48480 3131 3838 gene locus_tag LOCUS_48490 3131 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 3838 4926 gene locus_tag LOCUS_48500 3838 4926 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624176.1 protein_id gnl|my_center|LOCUS_48500 4919 5692 gene locus_tag LOCUS_48510 4919 5692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456657.1 protein_id gnl|my_center|LOCUS_48510 5689 6405 gene locus_tag LOCUS_48520 5689 6405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090548.1 protein_id gnl|my_center|LOCUS_48520 6471 7397 gene locus_tag LOCUS_48530 6471 7397 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815515.1 protein_id gnl|my_center|LOCUS_48530 7409 8509 gene locus_tag LOCUS_48540 7409 8509 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456654.1 protein_id gnl|my_center|LOCUS_48540 8678 10003 gene locus_tag LOCUS_48550 8678 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48550 10151 10942 gene locus_tag LOCUS_48560 10151 10942 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730864.1 protein_id gnl|my_center|LOCUS_48560 11298 13982 gene locus_tag LOCUS_48570 11298 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48570 13988 15052 gene locus_tag LOCUS_48580 13988 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48580 18620 15063 gene locus_tag LOCUS_48590 18620 15063 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115449.1 protein_id gnl|my_center|LOCUS_48590 19824 18811 gene locus_tag LOCUS_48600 19824 18811 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_48600 20849 19827 gene locus_tag LOCUS_48610 20849 19827 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_48610 22035 20842 gene locus_tag LOCUS_48620 22035 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48620 22193 23818 gene locus_tag LOCUS_48630 22193 23818 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030600.1 protein_id gnl|my_center|LOCUS_48630 23903 24736 gene locus_tag LOCUS_48640 23903 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 24883 25644 gene locus_tag LOCUS_48650 24883 25644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 26840 25575 gene locus_tag LOCUS_48660 26840 25575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 28468 26912 gene locus_tag LOCUS_48670 gene guaA 28468 26912 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_48670 30283 28538 gene locus_tag LOCUS_48680 30283 28538 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_48680 30475 31611 gene locus_tag LOCUS_48690 gene nagA 30475 31611 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_48690 32775 31654 gene locus_tag LOCUS_48700 32775 31654 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_48700 34314 32833 gene locus_tag LOCUS_48710 gene guaB 34314 32833 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_48710 35572 36207 gene locus_tag LOCUS_48720 35572 36207 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974204.1 protein_id gnl|my_center|LOCUS_48720 36760 36383 gene locus_tag LOCUS_48730 36760 36383 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003073549.1 protein_id gnl|my_center|LOCUS_48730 36976 37161 gene locus_tag LOCUS_48740 36976 37161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 38267 37200 gene locus_tag LOCUS_48750 38267 37200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 40278 38656 gene locus_tag LOCUS_48760 gene groL 40278 38656 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_48760 40897 40586 gene locus_tag LOCUS_48770 gene groES 40897 40586 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418028.1 protein_id gnl|my_center|LOCUS_48770 41622 41308 gene locus_tag LOCUS_48780 41622 41308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 42345 42073 gene locus_tag LOCUS_48790 42345 42073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 43612 42920 gene locus_tag LOCUS_48800 43612 42920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 43894 45117 gene locus_tag LOCUS_48810 43894 45117 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_48810 45200 46576 gene locus_tag LOCUS_48820 45200 46576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48820 47637 46606 gene locus_tag LOCUS_48830 gene tsaD 47637 46606 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_48830 48189 47722 gene locus_tag LOCUS_48840 gene rimI 48189 47722 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_48840 48833 48186 gene locus_tag LOCUS_48850 gene tsaB 48833 48186 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_48850 49449 48895 gene locus_tag LOCUS_48860 49449 48895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48860 50125 49451 gene locus_tag LOCUS_48870 50125 49451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 50752 50309 gene locus_tag LOCUS_48880 gene tsaE 50752 50309 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_48880 51801 50749 gene locus_tag LOCUS_48890 51801 50749 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_48890 52938 51811 gene locus_tag LOCUS_48900 gene alr 52938 51811 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_48900 54557 52944 gene locus_tag LOCUS_48910 54557 52944 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_48910 54958 54569 gene locus_tag LOCUS_48920 54958 54569 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_48920 55040 55978 gene locus_tag LOCUS_48930 gene coaA 55040 55978 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_48930 56669 56013 gene locus_tag LOCUS_48940 56669 56013 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 protein_id gnl|my_center|LOCUS_48940 57037 56666 gene locus_tag LOCUS_48950 57037 56666 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 protein_id gnl|my_center|LOCUS_48950 58672 57311 gene locus_tag LOCUS_48960 gene glmM 58672 57311 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_48960 59187 58669 gene locus_tag LOCUS_48970 gene rpsI 59187 58669 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776323.1 protein_id gnl|my_center|LOCUS_48970 59653 59210 gene locus_tag LOCUS_48980 gene rplM 59653 59210 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_48980 59970 60809 gene locus_tag LOCUS_48990 59970 60809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 60846 62252 gene locus_tag LOCUS_49000 60846 62252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 62425 64821 gene locus_tag LOCUS_49010 62425 64821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 65849 64869 gene locus_tag LOCUS_49020 gene truA 65849 64869 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_49020 66624 66064 gene locus_tag LOCUS_49030 66624 66064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 67864 66818 gene locus_tag LOCUS_49040 67864 66818 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_49040 68607 67981 gene locus_tag LOCUS_49050 gene rpsD 68607 67981 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_49050 69035 68628 gene locus_tag LOCUS_49060 gene rpsK 69035 68628 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_49060 69455 69075 gene locus_tag LOCUS_49070 gene rpsM 69455 69075 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_49070 70071 69850 gene locus_tag LOCUS_49080 gene infA 70071 69850 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_49080 70941 70504 gene locus_tag LOCUS_49090 70941 70504 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190249366.1 protein_id gnl|my_center|LOCUS_49090 71767 70913 gene locus_tag LOCUS_49100 gene map 71767 70913 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222621.1 protein_id gnl|my_center|LOCUS_49100 72512 71859 gene locus_tag LOCUS_49110 72512 71859 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_49110 73834 72512 gene locus_tag LOCUS_49120 gene secY 73834 72512 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_49120 74478 74023 gene locus_tag LOCUS_49130 gene rplO 74478 74023 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_49130 74663 74481 gene locus_tag LOCUS_49140 gene rpmD 74663 74481 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776359.1 protein_id gnl|my_center|LOCUS_49140 75291 74665 gene locus_tag LOCUS_49150 gene rpsE 75291 74665 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_49150 75720 75334 gene locus_tag LOCUS_49160 gene rplR 75720 75334 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_49160 76265 75723 gene locus_tag LOCUS_49170 gene rplF 76265 75723 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_49170 76683 76285 gene locus_tag LOCUS_49180 gene rpsH 76683 76285 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_49180 77025 76840 gene locus_tag LOCUS_49190 77025 76840 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_49190 77617 77042 gene locus_tag LOCUS_49200 gene rplE 77617 77042 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_49200 77937 77617 gene locus_tag LOCUS_49210 77937 77617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 78306 77938 gene locus_tag LOCUS_49220 gene rplN 78306 77938 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_49220 78696 78415 gene locus_tag LOCUS_49230 gene rpsQ 78696 78415 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_49230 78926 78693 gene locus_tag LOCUS_49240 gene rpmC 78926 78693 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_49240 79345 78926 gene locus_tag LOCUS_49250 gene rplP 79345 78926 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_49250 80159 79347 gene locus_tag LOCUS_49260 80159 79347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 80536 80159 gene locus_tag LOCUS_49270 gene rplV 80536 80159 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_49270 80839 80561 gene locus_tag LOCUS_49280 gene rpsS 80839 80561 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_49280 81684 80851 gene locus_tag LOCUS_49290 gene rplB 81684 80851 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 protein_id gnl|my_center|LOCUS_49290 82127 81825 gene locus_tag LOCUS_49300 82127 81825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49300 82777 82127 gene locus_tag LOCUS_49310 gene rplD 82777 82127 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222605.1 protein_id gnl|my_center|LOCUS_49310 83430 82774 gene locus_tag LOCUS_49320 gene rplC 83430 82774 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_49320 83753 83445 gene locus_tag LOCUS_49330 gene rpsJ 83753 83445 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_49330 85140 83947 gene locus_tag LOCUS_49340 gene tuf 85140 83947 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029795.1 protein_id gnl|my_center|LOCUS_49340 87299 85200 gene locus_tag LOCUS_49350 gene fusA 87299 85200 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_49350 87842 87372 gene locus_tag LOCUS_49360 gene rpsG 87842 87372 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_49360 88218 87844 gene locus_tag LOCUS_49370 gene rpsL 88218 87844 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_49370 92741 88866 gene locus_tag LOCUS_49380 92741 88866 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_49380 >Feature sequence010 468 2639 gene locus_tag LOCUS_49390 468 2639 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_49390 5190 2746 gene locus_tag LOCUS_49400 5190 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 5599 6039 gene locus_tag LOCUS_49410 5599 6039 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027656.1 protein_id gnl|my_center|LOCUS_49410 6158 8242 gene locus_tag LOCUS_49420 6158 8242 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256905.1 protein_id gnl|my_center|LOCUS_49420 8755 8255 gene locus_tag LOCUS_49430 8755 8255 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226533.1 protein_id gnl|my_center|LOCUS_49430 8973 8746 gene locus_tag LOCUS_49440 8973 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 9149 10108 gene locus_tag LOCUS_49450 9149 10108 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485415.1 protein_id gnl|my_center|LOCUS_49450 10180 10629 gene locus_tag LOCUS_49460 10180 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 11196 10795 gene locus_tag LOCUS_49470 11196 10795 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_49470 12210 11287 gene locus_tag LOCUS_49480 12210 11287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49480 12366 14189 gene locus_tag LOCUS_49490 12366 14189 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112395.1 protein_id gnl|my_center|LOCUS_49490 15932 14481 gene locus_tag LOCUS_49500 15932 14481 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_49500 16978 15947 gene locus_tag LOCUS_49510 16978 15947 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_49510 18090 16978 gene locus_tag LOCUS_49520 gene pdhA 18090 16978 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_49520 18519 18761 gene locus_tag LOCUS_49530 gene purS 18519 18761 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_49530 18998 19489 gene locus_tag LOCUS_49540 18998 19489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 19598 20278 gene locus_tag LOCUS_49550 gene purQ 19598 20278 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_49550 20275 22638 gene locus_tag LOCUS_49560 gene purL 20275 22638 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_49560 23670 22780 gene locus_tag LOCUS_49570 23670 22780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 24617 26071 gene locus_tag LOCUS_49580 24617 26071 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392514.1 protein_id gnl|my_center|LOCUS_49580 27438 26926 gene locus_tag LOCUS_49590 27438 26926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 29691 27595 gene locus_tag LOCUS_49600 29691 27595 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_49600 29936 30379 gene locus_tag LOCUS_49610 29936 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 31196 30408 gene locus_tag LOCUS_49620 31196 30408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 31442 32881 gene locus_tag LOCUS_49630 gene purF 31442 32881 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_49630 32972 34012 gene locus_tag LOCUS_49640 gene purM 32972 34012 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_49640 34914 34672 gene locus_tag LOCUS_49650 34914 34672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49650 36173 35070 gene locus_tag LOCUS_49660 36173 35070 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228727.1 protein_id gnl|my_center|LOCUS_49660 36415 37305 gene locus_tag LOCUS_49670 36415 37305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_49670 37562 37831 gene locus_tag LOCUS_49680 gene bldC 37562 37831 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_49680 38133 37954 gene locus_tag LOCUS_49690 38133 37954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 39144 40124 gene locus_tag LOCUS_49700 39144 40124 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223782.1 protein_id gnl|my_center|LOCUS_49700 40318 40578 gene locus_tag LOCUS_49710 40318 40578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 40846 41733 gene locus_tag LOCUS_49720 40846 41733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 43170 42082 gene locus_tag LOCUS_49730 43170 42082 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_49730 43638 43348 gene locus_tag LOCUS_49740 43638 43348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49740 44197 43868 gene locus_tag LOCUS_49750 44197 43868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 45061 44201 gene locus_tag LOCUS_49760 45061 44201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 45399 45058 gene locus_tag LOCUS_49770 45399 45058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 45886 45575 gene locus_tag LOCUS_49780 45886 45575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 46121 46465 gene locus_tag LOCUS_49790 46121 46465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 46508 48751 gene locus_tag LOCUS_49800 gene secD 46508 48751 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111870946.1 protein_id gnl|my_center|LOCUS_49800 48815 49612 gene locus_tag LOCUS_49810 48815 49612 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191689.1 protein_id gnl|my_center|LOCUS_49810 49688 51349 gene locus_tag LOCUS_49820 gene hcp 49688 51349 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390569.1 protein_id gnl|my_center|LOCUS_49820 51346 52422 gene locus_tag LOCUS_49830 51346 52422 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_49830 52662 53450 gene locus_tag LOCUS_49840 52662 53450 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 protein_id gnl|my_center|LOCUS_49840 54323 53463 gene locus_tag LOCUS_49850 54323 53463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 54680 54605 gene locus_tag LOCUS_t00730 54680 54605 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 54779 54704 gene locus_tag LOCUS_t00740 54779 54704 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 54928 54855 gene locus_tag LOCUS_t00750 54928 54855 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 56572 55013 gene locus_tag LOCUS_49860 56572 55013 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974879.1 protein_id gnl|my_center|LOCUS_49860 56653 57003 gene locus_tag LOCUS_49870 56653 57003 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_49870 57186 58496 gene locus_tag LOCUS_49880 57186 58496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315434.1 protein_id gnl|my_center|LOCUS_49880 59047 58616 gene locus_tag LOCUS_49890 59047 58616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 60036 59239 gene locus_tag LOCUS_49900 60036 59239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226900.1 protein_id gnl|my_center|LOCUS_49900 60902 60042 gene locus_tag LOCUS_49910 60902 60042 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 protein_id gnl|my_center|LOCUS_49910 61868 60948 gene locus_tag LOCUS_49920 61868 60948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 62901 62116 gene locus_tag LOCUS_49930 62901 62116 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222327.1 protein_id gnl|my_center|LOCUS_49930 >Feature sequence011 <1 979 gene locus_tag LOCUS_49940 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein 985 1788 gene locus_tag LOCUS_49950 985 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49950 3034 2210 gene locus_tag LOCUS_49960 3034 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 5352 3100 gene locus_tag LOCUS_49970 5352 3100 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084710.1 protein_id gnl|my_center|LOCUS_49970 5539 5784 gene locus_tag LOCUS_49980 5539 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49980 7580 6549 gene locus_tag LOCUS_49990 7580 6549 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_49990 9412 7979 gene locus_tag LOCUS_50000 9412 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50000 10817 9507 gene locus_tag LOCUS_50010 10817 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 12307 10814 gene locus_tag LOCUS_50020 12307 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50020 13916 12309 gene locus_tag LOCUS_50030 13916 12309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 14115 15731 gene locus_tag LOCUS_50040 14115 15731 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_50040 15894 16787 gene locus_tag LOCUS_50050 15894 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50050 18056 17067 gene locus_tag LOCUS_50060 18056 17067 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_50060 18785 18141 gene locus_tag LOCUS_50070 18785 18141 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_50070 18880 19410 gene locus_tag LOCUS_50080 18880 19410 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974353.1 protein_id gnl|my_center|LOCUS_50080 19798 19427 gene locus_tag LOCUS_50090 19798 19427 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_50090 20157 19927 gene locus_tag LOCUS_50100 20157 19927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 21091 20300 gene locus_tag LOCUS_50110 gene tpiA 21091 20300 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_50110 22297 21095 gene locus_tag LOCUS_50120 22297 21095 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224667.1 protein_id gnl|my_center|LOCUS_50120 23301 22297 gene locus_tag LOCUS_50130 gene gap 23301 22297 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224666.1 protein_id gnl|my_center|LOCUS_50130 24399 23419 gene locus_tag LOCUS_50140 gene whiA 24399 23419 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_50140 25472 24468 gene locus_tag LOCUS_50150 gene yvcK 25472 24468 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_50150 26569 25649 gene locus_tag LOCUS_50160 gene rapZ 26569 25649 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_50160 28584 26608 gene locus_tag LOCUS_50170 gene uvrC 28584 26608 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028063.1 protein_id gnl|my_center|LOCUS_50170 31068 28639 gene locus_tag LOCUS_50180 31068 28639 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030897.1 protein_id gnl|my_center|LOCUS_50180 31741 31289 gene locus_tag LOCUS_50190 31741 31289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 34802 31980 gene locus_tag LOCUS_50200 gene uvrA 34802 31980 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_50200 35131 35787 gene locus_tag LOCUS_50210 35131 35787 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_50210 36178 35876 gene locus_tag LOCUS_50220 36178 35876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50220 37037 36279 gene locus_tag LOCUS_50230 gene pssA 37037 36279 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_50230 37752 37096 gene locus_tag LOCUS_50240 37752 37096 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_50240 39326 38034 gene locus_tag LOCUS_50250 39326 38034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50250 40765 39545 gene locus_tag LOCUS_50260 40765 39545 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_50260 42452 40758 gene locus_tag LOCUS_50270 42452 40758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50270 43408 42449 gene locus_tag LOCUS_50280 43408 42449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804978.1 protein_id gnl|my_center|LOCUS_50280 44600 43629 gene locus_tag LOCUS_50290 44600 43629 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227815.1 protein_id gnl|my_center|LOCUS_50290 45793 44597 gene locus_tag LOCUS_50300 gene steA 45793 44597 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804976.1 protein_id gnl|my_center|LOCUS_50300 47809 46088 gene locus_tag LOCUS_50310 gene recN 47809 46088 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_50310 48841 47936 gene locus_tag LOCUS_50320 48841 47936 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_50320 49913 49098 gene locus_tag LOCUS_50330 49913 49098 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_50330 50133 50223 gene locus_tag LOCUS_t00760 50133 50223 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 50408 50599 gene locus_tag LOCUS_50340 50408 50599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50340 50642 50989 gene locus_tag LOCUS_50350 50642 50989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_50350 52054 51011 gene locus_tag LOCUS_50360 52054 51011 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_50360 52500 52069 gene locus_tag LOCUS_50370 52500 52069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 52606 53877 gene locus_tag LOCUS_50380 52606 53877 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_50380 54486 55427 gene locus_tag LOCUS_50390 54486 55427 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903522.1 protein_id gnl|my_center|LOCUS_50390 57615 55534 gene locus_tag LOCUS_50400 57615 55534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 >Feature sequence012 397 137 gene locus_tag LOCUS_50410 397 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 1286 963 gene locus_tag LOCUS_50420 1286 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50420 1221 2888 gene locus_tag LOCUS_50430 1221 2888 CDS product substrate-binding and VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229295.1 protein_id gnl|my_center|LOCUS_50430 3046 4110 gene locus_tag LOCUS_50440 3046 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50440 4805 4083 gene locus_tag LOCUS_50450 gene regX 4805 4083 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 protein_id gnl|my_center|LOCUS_50450 5702 4845 gene locus_tag LOCUS_50460 gene pstB 5702 4845 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_50460 6627 5737 gene locus_tag LOCUS_50470 gene pstA 6627 5737 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256173.1 protein_id gnl|my_center|LOCUS_50470 7559 6624 gene locus_tag LOCUS_50480 gene pstC 7559 6624 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_50480 8552 7563 gene locus_tag LOCUS_50490 8552 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50490 8793 9323 gene locus_tag LOCUS_50500 8793 9323 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975011.1 protein_id gnl|my_center|LOCUS_50500 9331 10140 gene locus_tag LOCUS_50510 9331 10140 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_50510 10445 10930 gene locus_tag LOCUS_50520 10445 10930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 11005 12021 gene locus_tag LOCUS_50530 11005 12021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50530 12784 12002 gene locus_tag LOCUS_50540 gene hisN 12784 12002 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_50540 13897 12869 gene locus_tag LOCUS_50550 gene rsgA 13897 12869 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_50550 15159 13867 gene locus_tag LOCUS_50560 gene aroA 15159 13867 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_50560 15313 16050 gene locus_tag LOCUS_50570 15313 16050 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_50570 16358 16687 gene locus_tag LOCUS_50580 gene dksA 16358 16687 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532995.1 protein_id gnl|my_center|LOCUS_50580 17462 16719 gene locus_tag LOCUS_50590 17462 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 17609 18292 gene locus_tag LOCUS_50600 gene sigR 17609 18292 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_50600 18289 18582 gene locus_tag LOCUS_50610 gene rsrA 18289 18582 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_50610 18610 19575 gene locus_tag LOCUS_50620 18610 19575 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113113.1 protein_id gnl|my_center|LOCUS_50620 19682 21043 gene locus_tag LOCUS_50630 19682 21043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 21027 22292 gene locus_tag LOCUS_50640 21027 22292 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495247.1 protein_id gnl|my_center|LOCUS_50640 22481 22693 gene locus_tag LOCUS_50650 22481 22693 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877243.1 protein_id gnl|my_center|LOCUS_50650 23083 22703 gene locus_tag LOCUS_50660 23083 22703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50660 23377 25086 gene locus_tag LOCUS_50670 23377 25086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50670 26799 25135 gene locus_tag LOCUS_50680 26799 25135 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_50680 26958 27626 gene locus_tag LOCUS_50690 26958 27626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 28385 27657 gene locus_tag LOCUS_50700 28385 27657 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_50700 28697 30184 gene locus_tag LOCUS_50710 28697 30184 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_50710 30666 30409 gene locus_tag LOCUS_50720 30666 30409 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_50720 31905 30943 gene locus_tag LOCUS_50730 31905 30943 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_50730 31932 32465 gene locus_tag LOCUS_50740 31932 32465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 33277 32495 gene locus_tag LOCUS_50750 33277 32495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 33726 33295 gene locus_tag LOCUS_50760 33726 33295 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_50760 34290 33886 gene locus_tag LOCUS_50770 gene sodN 34290 33886 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_50770 34374 34694 gene locus_tag LOCUS_50780 34374 34694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50780 35231 34734 gene locus_tag LOCUS_50790 35231 34734 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_50790 36158 35379 gene locus_tag LOCUS_50800 36158 35379 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_50800 36955 36155 gene locus_tag LOCUS_50810 36955 36155 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230771.1 protein_id gnl|my_center|LOCUS_50810 37803 36952 gene locus_tag LOCUS_50820 37803 36952 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583414.1 protein_id gnl|my_center|LOCUS_50820 38086 39243 gene locus_tag LOCUS_50830 38086 39243 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_50830 >Feature sequence013 2131 1694 gene locus_tag LOCUS_50840 2131 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 2145 2282 gene locus_tag LOCUS_50850 2145 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 3587 3255 gene locus_tag LOCUS_50860 3587 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 3493 4431 gene locus_tag LOCUS_50870 3493 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 4452 5582 gene locus_tag LOCUS_50880 4452 5582 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599371.1 protein_id gnl|my_center|LOCUS_50880 >Feature sequence014 3143 24 gene locus_tag LOCUS_r00020 3143 24 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3192 3825 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5382 3849 gene locus_tag LOCUS_r00030 5382 3849 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence015 2168 2305 gene locus_tag LOCUS_50890 2168 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 >Feature sequence016 249 1 gene locus_tag LOCUS_50900 249 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50900 1343 249 gene locus_tag LOCUS_50910 1343 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 1959 1420 gene locus_tag LOCUS_50920 1959 1420 CDS product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 protein_id gnl|my_center|LOCUS_50920 >Feature sequence017 329 1885 gene locus_tag LOCUS_50930 329 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50930 >Feature sequence018 >Feature sequence019 >Feature sequence020 >Feature sequence021 >Feature sequence022 1480 341 gene locus_tag LOCUS_50940 1480 341 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_50940 >Feature sequence023 1697 1491 gene locus_tag LOCUS_50950 1697 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 >Feature sequence024 202 480 gene locus_tag LOCUS_50960 202 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50960 544 711 gene locus_tag LOCUS_50970 544 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 717 1124 gene locus_tag LOCUS_50980 717 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50980 1332 1610 gene locus_tag LOCUS_50990 1332 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50990 >Feature sequence025 >Feature sequence026 >Feature sequence027 196 384 gene locus_tag LOCUS_51000 196 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 965 834 gene locus_tag LOCUS_51010 965 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 >Feature sequence028 590 366 gene locus_tag LOCUS_51020 590 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 >Feature sequence029 >Feature sequence030 >Feature sequence031 930 1145 gene locus_tag LOCUS_51030 930 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 1281 1400 gene locus_tag LOCUS_51040 1281 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51040 >Feature sequence032 202 414 gene locus_tag LOCUS_51050 202 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 >Feature sequence033 >Feature sequence034 <1280 104 gene locus_tag LOCUS_51060 <1280 104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681815.1:molecular chaperone DnaK >Feature sequence035 >Feature sequence036 >Feature sequence037 820 1107 gene locus_tag LOCUS_51070 820 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51070 >Feature sequence038 16 240 gene locus_tag LOCUS_51080 16 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51080 >Feature sequence039 273 650 gene locus_tag LOCUS_51090 273 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 834 1049 gene locus_tag LOCUS_51100 834 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51100 >Feature sequence040 >Feature sequence041 >Feature sequence042 >Feature sequence043 >Feature sequence044 249 539 gene locus_tag LOCUS_51110 249 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 >Feature sequence045 >Feature sequence046 >Feature sequence047 >Feature sequence048 >Feature sequence049 786 550 gene locus_tag LOCUS_51120 786 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51120 >Feature sequence050 181 423 gene locus_tag LOCUS_51130 181 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 >Feature sequence051 >Feature sequence052 >Feature sequence053 >Feature sequence054 >Feature sequence055 >Feature sequence056 >Feature sequence057 290 439 gene locus_tag LOCUS_51140 290 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 >Feature sequence058 >Feature sequence059 657 418 gene locus_tag LOCUS_51150 657 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 >Feature sequence060 703 548 gene locus_tag LOCUS_51160 703 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51160 >Feature sequence061 >Feature sequence062 686 555 gene locus_tag LOCUS_51170 686 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51170 >Feature sequence063 812 300 gene locus_tag LOCUS_51180 812 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 >Feature sequence064 >Feature sequence065 >Feature sequence066 >Feature sequence067 >Feature sequence068 455 297 gene locus_tag LOCUS_51190 455 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51190 >Feature sequence069 >Feature sequence070 95 15 gene locus_tag LOCUS_t00770 95 15 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 173 102 gene locus_tag LOCUS_t00780 173 102 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 246 175 gene locus_tag LOCUS_t00790 246 175 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 266 339 gene locus_tag LOCUS_t00800 266 339 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 344 417 gene locus_tag LOCUS_t00810 344 417 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 >Feature sequence072 >Feature sequence073 205 426 gene locus_tag LOCUS_51200 205 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51200 >Feature sequence074 >Feature sequence075 >Feature sequence076 >Feature sequence077 269 469 gene locus_tag LOCUS_51210 269 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 >Feature sequence078 >Feature sequence079 >Feature sequence080 >Feature sequence081 >Feature sequence082 396 196 gene locus_tag LOCUS_51220 396 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 587 393 gene locus_tag LOCUS_51230 587 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 >Feature sequence083 >Feature sequence084 >Feature sequence085 >Feature sequence086 >Feature sequence087 >Feature sequence088 >Feature sequence089 >Feature sequence090 >Feature sequence091 >Feature sequence092 >Feature sequence093 >Feature sequence094 <666 15 gene locus_tag LOCUS_51240 <666 15 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869821.1:translation elongation factor EF-1 subunit alpha >Feature sequence095 >Feature sequence096 595 314 gene locus_tag LOCUS_51250 595 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 >Feature sequence097 >Feature sequence098 >Feature sequence099 <1 650 gene locus_tag LOCUS_51260 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769616.1:molecular chaperone HtpG >Feature sequence100 526 326 gene locus_tag LOCUS_51270 526 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 >Feature sequence101 >Feature sequence102 >Feature sequence103 >Feature sequence104 >Feature sequence105 >Feature sequence106 >Feature sequence107 34 297 gene locus_tag LOCUS_51280 34 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 >Feature sequence108 >Feature sequence109 >Feature sequence110 >Feature sequence111 >Feature sequence112 >Feature sequence113 576 442 gene locus_tag LOCUS_51290 576 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51290 >Feature sequence114 >Feature sequence115 318 52 gene locus_tag LOCUS_51300 318 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 335 454 gene locus_tag LOCUS_51310 335 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51310 >Feature sequence116 >Feature sequence117 >Feature sequence118 >Feature sequence119 >Feature sequence120 >Feature sequence121 >Feature sequence122 496 158 gene locus_tag LOCUS_51320 496 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 >Feature sequence123 >Feature sequence124 >Feature sequence125 >Feature sequence126 >Feature sequence127 >Feature sequence128 50 175 gene locus_tag LOCUS_51330 50 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 >Feature sequence129 >Feature sequence130 209 3 gene locus_tag LOCUS_51340 209 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 >Feature sequence131 >Feature sequence132 >Feature sequence133 >Feature sequence134 >Feature sequence135 >Feature sequence136 >Feature sequence137 >Feature sequence138 >Feature sequence139 >Feature sequence140 >Feature sequence141 >Feature sequence142 >Feature sequence143 >Feature sequence144 >Feature sequence145 >Feature sequence146 >Feature sequence147 >Feature sequence148 >Feature sequence149 >Feature sequence150 >Feature sequence151 400 2 gene locus_tag LOCUS_51350 400 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 >Feature sequence152 >Feature sequence153 >Feature sequence154 >Feature sequence155 311 42 gene locus_tag LOCUS_51360 311 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51360 >Feature sequence156 >Feature sequence157 >Feature sequence158 >Feature sequence159 >Feature sequence160 >Feature sequence161 107 229 gene locus_tag LOCUS_51370 107 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51370 >Feature sequence162 >Feature sequence163 357 118 gene locus_tag LOCUS_51380 357 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51380 >Feature sequence164 >Feature sequence165 >Feature sequence166 >Feature sequence167 >Feature sequence168 >Feature sequence169 251 69 gene locus_tag LOCUS_51390 251 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51390 >Feature sequence170 >Feature sequence171 >Feature sequence172 >Feature sequence173 >Feature sequence174 >Feature sequence175 >Feature sequence176 >Feature sequence177 >Feature sequence178 >Feature sequence179 >Feature sequence180 >Feature sequence181 >Feature sequence182 >Feature sequence183 >Feature sequence184 >Feature sequence185 >Feature sequence186