>Feature sequence01 258 470 gene locus_tag LOCUS_00010 258 470 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093358.1 protein_id gnl|my_center|LOCUS_00010 496 846 gene locus_tag LOCUS_00020 496 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 980 1195 gene locus_tag LOCUS_00030 980 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1497 1270 gene locus_tag LOCUS_00040 1497 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 1668 2015 gene locus_tag LOCUS_00050 1668 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3673 2507 gene locus_tag LOCUS_00060 3673 2507 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978381.1 protein_id gnl|my_center|LOCUS_00060 3772 4431 gene locus_tag LOCUS_00070 3772 4431 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225604.1 protein_id gnl|my_center|LOCUS_00070 5061 4441 gene locus_tag LOCUS_00080 5061 4441 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030130.1 protein_id gnl|my_center|LOCUS_00080 5098 5895 gene locus_tag LOCUS_00090 5098 5895 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728739.1 protein_id gnl|my_center|LOCUS_00090 6607 6050 gene locus_tag LOCUS_00100 6607 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6862 7032 gene locus_tag LOCUS_00110 6862 7032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7336 7097 gene locus_tag LOCUS_00120 7336 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7854 7456 gene locus_tag LOCUS_00130 7854 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9139 7841 gene locus_tag LOCUS_00140 9139 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12789 9376 gene locus_tag LOCUS_00150 12789 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13307 13122 gene locus_tag LOCUS_00160 13307 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13392 14645 gene locus_tag LOCUS_00170 13392 14645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 15230 14718 gene locus_tag LOCUS_00180 15230 14718 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_00180 15450 16850 gene locus_tag LOCUS_00190 15450 16850 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_00190 17532 16861 gene locus_tag LOCUS_00200 17532 16861 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327688.1 protein_id gnl|my_center|LOCUS_00200 18991 17621 gene locus_tag LOCUS_00210 18991 17621 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918707.1 protein_id gnl|my_center|LOCUS_00210 19992 18988 gene locus_tag LOCUS_00220 19992 18988 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777121.1 protein_id gnl|my_center|LOCUS_00220 20940 20032 gene locus_tag LOCUS_00230 20940 20032 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030799.1 protein_id gnl|my_center|LOCUS_00230 22436 20937 gene locus_tag LOCUS_00240 22436 20937 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030798.1 protein_id gnl|my_center|LOCUS_00240 22731 22417 gene locus_tag LOCUS_00250 22731 22417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24191 23043 gene locus_tag LOCUS_00260 24191 23043 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030796.1 protein_id gnl|my_center|LOCUS_00260 25612 24242 gene locus_tag LOCUS_00270 25612 24242 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_00270 25744 27492 gene locus_tag LOCUS_00280 25744 27492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803733.1 protein_id gnl|my_center|LOCUS_00280 27507 28445 gene locus_tag LOCUS_00290 27507 28445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_00290 28442 29428 gene locus_tag LOCUS_00300 28442 29428 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_00300 29428 30468 gene locus_tag LOCUS_00310 29428 30468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_00310 30465 31448 gene locus_tag LOCUS_00320 30465 31448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_00320 32868 31666 gene locus_tag LOCUS_00330 32868 31666 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028602.1 protein_id gnl|my_center|LOCUS_00330 32901 33938 gene locus_tag LOCUS_00340 32901 33938 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_00340 34097 36466 gene locus_tag LOCUS_00350 34097 36466 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069655.1 protein_id gnl|my_center|LOCUS_00350 36586 37032 gene locus_tag LOCUS_00360 36586 37032 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978086.1 protein_id gnl|my_center|LOCUS_00360 37130 37345 gene locus_tag LOCUS_00370 37130 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37940 37365 gene locus_tag LOCUS_00380 37940 37365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39017 38094 gene locus_tag LOCUS_00390 39017 38094 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225862.1 protein_id gnl|my_center|LOCUS_00390 40333 39014 gene locus_tag LOCUS_00400 40333 39014 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225860.1 protein_id gnl|my_center|LOCUS_00400 42049 40547 gene locus_tag LOCUS_00410 42049 40547 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225861.1 protein_id gnl|my_center|LOCUS_00410 42798 42049 gene locus_tag LOCUS_00420 42798 42049 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225859.1 protein_id gnl|my_center|LOCUS_00420 43838 42795 gene locus_tag LOCUS_00430 43838 42795 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_00430 44790 43969 gene locus_tag LOCUS_00440 44790 43969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45011 46129 gene locus_tag LOCUS_00450 45011 46129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 47179 46223 gene locus_tag LOCUS_00460 47179 46223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47559 47176 gene locus_tag LOCUS_00470 47559 47176 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030855.1 protein_id gnl|my_center|LOCUS_00470 47679 48347 gene locus_tag LOCUS_00480 47679 48347 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030853.1 protein_id gnl|my_center|LOCUS_00480 49599 48406 gene locus_tag LOCUS_00490 49599 48406 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485432.1 protein_id gnl|my_center|LOCUS_00490 50842 49667 gene locus_tag LOCUS_00500 50842 49667 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486965.1 protein_id gnl|my_center|LOCUS_00500 51143 52963 gene locus_tag LOCUS_00510 51143 52963 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_00510 54131 53028 gene locus_tag LOCUS_00520 gene lysN 54131 53028 CDS product 2-aminoadipate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227918.1 protein_id gnl|my_center|LOCUS_00520 55317 54232 gene locus_tag LOCUS_00530 55317 54232 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_00530 56130 55363 gene locus_tag LOCUS_00540 56130 55363 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082824.1 protein_id gnl|my_center|LOCUS_00540 57189 56197 gene locus_tag LOCUS_00550 57189 56197 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028519.1 protein_id gnl|my_center|LOCUS_00550 57641 58687 gene locus_tag LOCUS_00560 57641 58687 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_00560 60779 58722 gene locus_tag LOCUS_00570 60779 58722 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225090.1 protein_id gnl|my_center|LOCUS_00570 62466 60991 gene locus_tag LOCUS_00580 62466 60991 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031143.1 protein_id gnl|my_center|LOCUS_00580 62778 63059 gene locus_tag LOCUS_00590 62778 63059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 63376 62972 gene locus_tag LOCUS_00600 63376 62972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 63622 66057 gene locus_tag LOCUS_00610 63622 66057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66162 67604 gene locus_tag LOCUS_00620 66162 67604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67717 69522 gene locus_tag LOCUS_00630 67717 69522 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228163.1 protein_id gnl|my_center|LOCUS_00630 70554 69565 gene locus_tag LOCUS_00640 70554 69565 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225255.1 protein_id gnl|my_center|LOCUS_00640 70993 70709 gene locus_tag LOCUS_00650 70993 70709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976610.1 protein_id gnl|my_center|LOCUS_00650 71594 71163 gene locus_tag LOCUS_00660 71594 71163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71476 71733 gene locus_tag LOCUS_00670 71476 71733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72047 78028 gene locus_tag LOCUS_00680 72047 78028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 78034 80289 gene locus_tag LOCUS_00690 78034 80289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 80726 80313 gene locus_tag LOCUS_00700 80726 80313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 80913 82109 gene locus_tag LOCUS_00710 80913 82109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 88101 82117 gene locus_tag LOCUS_00720 88101 82117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 88172 89374 gene locus_tag LOCUS_00730 88172 89374 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 protein_id gnl|my_center|LOCUS_00730 90289 89387 gene locus_tag LOCUS_00740 gene suhB 90289 89387 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172639.1 protein_id gnl|my_center|LOCUS_00740 91013 90270 gene locus_tag LOCUS_00750 91013 90270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 91983 91021 gene locus_tag LOCUS_00760 91983 91021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91880 92116 gene locus_tag LOCUS_00770 91880 92116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 92691 92134 gene locus_tag LOCUS_00780 92691 92134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 92813 93577 gene locus_tag LOCUS_00790 92813 93577 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977515.1 protein_id gnl|my_center|LOCUS_00790 94844 93594 gene locus_tag LOCUS_00800 94844 93594 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977624.1 protein_id gnl|my_center|LOCUS_00800 95259 96434 gene locus_tag LOCUS_00810 95259 96434 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_00810 96617 98044 gene locus_tag LOCUS_00820 96617 98044 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_00820 98992 98120 gene locus_tag LOCUS_00830 98992 98120 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_00830 99183 99794 gene locus_tag LOCUS_00840 99183 99794 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090991.1 protein_id gnl|my_center|LOCUS_00840 100112 100327 gene locus_tag LOCUS_00850 gene iscX 100112 100327 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812452.1 protein_id gnl|my_center|LOCUS_00850 101705 100368 gene locus_tag LOCUS_00860 101705 100368 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_00860 101924 102928 gene locus_tag LOCUS_00870 101924 102928 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224183.1 protein_id gnl|my_center|LOCUS_00870 104133 102988 gene locus_tag LOCUS_00880 104133 102988 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270458.1 protein_id gnl|my_center|LOCUS_00880 105386 104220 gene locus_tag LOCUS_00890 105386 104220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 105619 106164 gene locus_tag LOCUS_00900 105619 106164 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030468.1 protein_id gnl|my_center|LOCUS_00900 106334 107863 gene locus_tag LOCUS_00910 106334 107863 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028977.1 protein_id gnl|my_center|LOCUS_00910 109552 107888 gene locus_tag LOCUS_00920 109552 107888 CDS product bifunctional 3'-5' exonuclease/DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228747.1 protein_id gnl|my_center|LOCUS_00920 110633 109713 gene locus_tag LOCUS_00930 110633 109713 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_00930 110864 111247 gene locus_tag LOCUS_00940 110864 111247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031411.1 protein_id gnl|my_center|LOCUS_00940 111338 113185 gene locus_tag LOCUS_00950 111338 113185 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225751.1 protein_id gnl|my_center|LOCUS_00950 113839 113198 gene locus_tag LOCUS_00960 113839 113198 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028237.1 protein_id gnl|my_center|LOCUS_00960 113903 115144 gene locus_tag LOCUS_00970 113903 115144 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869305.1 protein_id gnl|my_center|LOCUS_00970 115241 116557 gene locus_tag LOCUS_00980 115241 116557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 118947 116572 gene locus_tag LOCUS_00990 118947 116572 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027316.1 protein_id gnl|my_center|LOCUS_00990 119684 118944 gene locus_tag LOCUS_01000 119684 118944 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978139.1 protein_id gnl|my_center|LOCUS_01000 121183 119681 gene locus_tag LOCUS_01010 gene zwf 121183 119681 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_01010 122749 121271 gene locus_tag LOCUS_01020 122749 121271 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035939.1 protein_id gnl|my_center|LOCUS_01020 124223 122961 gene locus_tag LOCUS_01030 124223 122961 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_01030 124182 124442 gene locus_tag LOCUS_01040 124182 124442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 125089 124331 gene locus_tag LOCUS_01050 125089 124331 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027942.1 protein_id gnl|my_center|LOCUS_01050 125135 125548 gene locus_tag LOCUS_01060 125135 125548 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_01060 125646 127001 gene locus_tag LOCUS_01070 125646 127001 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_01070 127029 127298 gene locus_tag LOCUS_01080 127029 127298 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975653.1 protein_id gnl|my_center|LOCUS_01080 127314 127601 gene locus_tag LOCUS_01090 127314 127601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 127685 128233 gene locus_tag LOCUS_01100 127685 128233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 130041 128266 gene locus_tag LOCUS_01110 130041 128266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 130392 130048 gene locus_tag LOCUS_01120 130392 130048 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250172.1 protein_id gnl|my_center|LOCUS_01120 131123 130389 gene locus_tag LOCUS_01130 131123 130389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 131416 131120 gene locus_tag LOCUS_01140 131416 131120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 131852 131409 gene locus_tag LOCUS_01150 131852 131409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 132019 131849 gene locus_tag LOCUS_01160 132019 131849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 132210 132539 gene locus_tag LOCUS_01170 132210 132539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 133101 132562 gene locus_tag LOCUS_01180 133101 132562 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205719408.1 protein_id gnl|my_center|LOCUS_01180 134825 133098 gene locus_tag LOCUS_01190 134825 133098 CDS product hydrogenase maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089664.1 protein_id gnl|my_center|LOCUS_01190 135101 135457 gene locus_tag LOCUS_01200 gene hypA 135101 135457 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258629.1 protein_id gnl|my_center|LOCUS_01200 135457 136230 gene locus_tag LOCUS_01210 gene hypB 135457 136230 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258628.1 protein_id gnl|my_center|LOCUS_01210 136227 138614 gene locus_tag LOCUS_01220 gene hypF 136227 138614 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 protein_id gnl|my_center|LOCUS_01220 138577 138870 gene locus_tag LOCUS_01230 138577 138870 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_01230 138867 140000 gene locus_tag LOCUS_01240 gene hypD 138867 140000 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_01240 139993 141075 gene locus_tag LOCUS_01250 gene hypE 139993 141075 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 protein_id gnl|my_center|LOCUS_01250 141608 141105 gene locus_tag LOCUS_01260 141608 141105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 141586 143052 gene locus_tag LOCUS_01270 141586 143052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225642.1 protein_id gnl|my_center|LOCUS_01270 143049 144170 gene locus_tag LOCUS_01280 143049 144170 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225647.1 protein_id gnl|my_center|LOCUS_01280 144167 145963 gene locus_tag LOCUS_01290 144167 145963 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 protein_id gnl|my_center|LOCUS_01290 145956 146501 gene locus_tag LOCUS_01300 145956 146501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 146498 147103 gene locus_tag LOCUS_01310 146498 147103 CDS product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225634.1 protein_id gnl|my_center|LOCUS_01310 147115 147321 gene locus_tag LOCUS_01320 147115 147321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 147355 147510 gene locus_tag LOCUS_01330 147355 147510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 148140 147562 gene locus_tag LOCUS_01340 148140 147562 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971771.1 protein_id gnl|my_center|LOCUS_01340 148363 150000 gene locus_tag LOCUS_01350 148363 150000 CDS product ubiquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031531.1 protein_id gnl|my_center|LOCUS_01350 150446 150057 gene locus_tag LOCUS_01360 150446 150057 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971910.1 protein_id gnl|my_center|LOCUS_01360 152158 150443 gene locus_tag LOCUS_01370 gene ctaD 152158 150443 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971911.1 protein_id gnl|my_center|LOCUS_01370 152340 152504 gene locus_tag LOCUS_01380 152340 152504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 152631 152840 gene locus_tag LOCUS_01390 152631 152840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 152930 153154 gene locus_tag LOCUS_01400 152930 153154 CDS product DUF6458 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975139.1 protein_id gnl|my_center|LOCUS_01400 153700 153158 gene locus_tag LOCUS_01410 153700 153158 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_01410 154259 153735 gene locus_tag LOCUS_01420 154259 153735 CDS product DUF6328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971855.1 protein_id gnl|my_center|LOCUS_01420 154604 154278 gene locus_tag LOCUS_01430 154604 154278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972272.1 protein_id gnl|my_center|LOCUS_01430 154732 155391 gene locus_tag LOCUS_01440 154732 155391 CDS product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974454.1 protein_id gnl|my_center|LOCUS_01440 156393 155428 gene locus_tag LOCUS_01450 156393 155428 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031568.1 protein_id gnl|my_center|LOCUS_01450 157167 156454 gene locus_tag LOCUS_01460 157167 156454 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 protein_id gnl|my_center|LOCUS_01460 157362 158066 gene locus_tag LOCUS_01470 157362 158066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 158121 159620 gene locus_tag LOCUS_01480 158121 159620 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971830.1 protein_id gnl|my_center|LOCUS_01480 160933 159605 gene locus_tag LOCUS_01490 160933 159605 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080026.1 protein_id gnl|my_center|LOCUS_01490 161240 162199 gene locus_tag LOCUS_01500 161240 162199 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030715.1 protein_id gnl|my_center|LOCUS_01500 162273 163925 gene locus_tag LOCUS_01510 162273 163925 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_01510 163922 164977 gene locus_tag LOCUS_01520 163922 164977 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030717.1 protein_id gnl|my_center|LOCUS_01520 164974 165537 gene locus_tag LOCUS_01530 164974 165537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 165534 166598 gene locus_tag LOCUS_01540 165534 166598 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030719.1 protein_id gnl|my_center|LOCUS_01540 166595 167557 gene locus_tag LOCUS_01550 166595 167557 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030720.1 protein_id gnl|my_center|LOCUS_01550 167554 168774 gene locus_tag LOCUS_01560 167554 168774 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030721.1 protein_id gnl|my_center|LOCUS_01560 168771 169364 gene locus_tag LOCUS_01570 168771 169364 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030722.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 169397 170794 gene locus_tag LOCUS_01580 gene rfaE2 169397 170794 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270276.1 protein_id gnl|my_center|LOCUS_01580 170791 171852 gene locus_tag LOCUS_01590 170791 171852 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483893.1 protein_id gnl|my_center|LOCUS_01590 171849 172061 gene locus_tag LOCUS_01600 171849 172061 CDS product DUF6480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971811.1 protein_id gnl|my_center|LOCUS_01600 172896 172039 gene locus_tag LOCUS_01610 172896 172039 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_01610 173029 173682 gene locus_tag LOCUS_01620 173029 173682 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325244.1 protein_id gnl|my_center|LOCUS_01620 173666 173884 gene locus_tag LOCUS_01630 173666 173884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 174929 173937 gene locus_tag LOCUS_01640 174929 173937 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027336.1 protein_id gnl|my_center|LOCUS_01640 175456 174926 gene locus_tag LOCUS_01650 175456 174926 CDS product DUF1360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226138.1 protein_id gnl|my_center|LOCUS_01650 175921 175505 gene locus_tag LOCUS_01660 175921 175505 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027424.1 protein_id gnl|my_center|LOCUS_01660 178111 175985 gene locus_tag LOCUS_01670 178111 175985 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111053.1 protein_id gnl|my_center|LOCUS_01670 178320 178520 gene locus_tag LOCUS_01680 178320 178520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 178631 181021 gene locus_tag LOCUS_01690 178631 181021 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_01690 181250 181753 gene locus_tag LOCUS_01700 181250 181753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01700 184436 181779 gene locus_tag LOCUS_01710 184436 181779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 185668 184559 gene locus_tag LOCUS_01720 185668 184559 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228346.1 protein_id gnl|my_center|LOCUS_01720 188103 185674 gene locus_tag LOCUS_01730 188103 185674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 188556 188107 gene locus_tag LOCUS_01740 188556 188107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 190370 188553 gene locus_tag LOCUS_01750 190370 188553 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225166.1 protein_id gnl|my_center|LOCUS_01750 191996 190581 gene locus_tag LOCUS_01760 191996 190581 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730043.1 protein_id gnl|my_center|LOCUS_01760 193399 192041 gene locus_tag LOCUS_01770 gene papA3 193399 192041 CDS product acyltransferase PapA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898759.1 protein_id gnl|my_center|LOCUS_01770 193632 194441 gene locus_tag LOCUS_01780 193632 194441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 194465 194734 gene locus_tag LOCUS_01790 194465 194734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 194731 195999 gene locus_tag LOCUS_01800 gene fabF 194731 195999 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257800.1 protein_id gnl|my_center|LOCUS_01800 199069 196019 gene locus_tag LOCUS_01810 199069 196019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 199252 200352 gene locus_tag LOCUS_01820 199252 200352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 200863 200966 gene locus_tag LOCUS_t00010 200863 200966 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 201251 202006 gene locus_tag LOCUS_01830 201251 202006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 202732 202058 gene locus_tag LOCUS_01840 202732 202058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 203150 204313 gene locus_tag LOCUS_01850 203150 204313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 205021 204257 gene locus_tag LOCUS_01860 205021 204257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 205218 205952 gene locus_tag LOCUS_01870 205218 205952 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730773.1 protein_id gnl|my_center|LOCUS_01870 206013 208085 gene locus_tag LOCUS_01880 206013 208085 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027517.1 protein_id gnl|my_center|LOCUS_01880 209462 208062 gene locus_tag LOCUS_01890 209462 208062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484585.1 protein_id gnl|my_center|LOCUS_01890 209685 210485 gene locus_tag LOCUS_01900 209685 210485 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_01900 211156 210524 gene locus_tag LOCUS_01910 211156 210524 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_01910 211497 211177 gene locus_tag LOCUS_01920 211497 211177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01920 212153 212629 gene locus_tag LOCUS_01930 212153 212629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01930 213943 212729 gene locus_tag LOCUS_01940 213943 212729 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 protein_id gnl|my_center|LOCUS_01940 215009 214035 gene locus_tag LOCUS_01950 215009 214035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 216465 215068 gene locus_tag LOCUS_01960 216465 215068 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226651.1 protein_id gnl|my_center|LOCUS_01960 217100 216531 gene locus_tag LOCUS_01970 217100 216531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 217585 221610 gene locus_tag LOCUS_01980 217585 221610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 221808 222269 gene locus_tag LOCUS_01990 221808 222269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 222721 222266 gene locus_tag LOCUS_02000 222721 222266 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031480.1 protein_id gnl|my_center|LOCUS_02000 225618 222844 gene locus_tag LOCUS_02010 225618 222844 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_02010 226290 225748 gene locus_tag LOCUS_02020 226290 225748 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223304.1 protein_id gnl|my_center|LOCUS_02020 226420 227862 gene locus_tag LOCUS_02030 226420 227862 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223303.1 protein_id gnl|my_center|LOCUS_02030 228294 227935 gene locus_tag LOCUS_02040 228294 227935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 228584 229033 gene locus_tag LOCUS_02050 228584 229033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 230010 229153 gene locus_tag LOCUS_02060 230010 229153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 231060 230482 gene locus_tag LOCUS_02070 231060 230482 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971313.1 protein_id gnl|my_center|LOCUS_02070 231539 231057 gene locus_tag LOCUS_02080 231539 231057 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065754.1 protein_id gnl|my_center|LOCUS_02080 231815 232969 gene locus_tag LOCUS_02090 231815 232969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 233456 235339 gene locus_tag LOCUS_02100 233456 235339 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206512.1 protein_id gnl|my_center|LOCUS_02100 235409 236071 gene locus_tag LOCUS_02110 235409 236071 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704554.1 protein_id gnl|my_center|LOCUS_02110 236188 236526 gene locus_tag LOCUS_02120 236188 236526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 236511 237236 gene locus_tag LOCUS_02130 236511 237236 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224231.1 protein_id gnl|my_center|LOCUS_02130 237357 238283 gene locus_tag LOCUS_02140 237357 238283 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037214.1 protein_id gnl|my_center|LOCUS_02140 239420 238371 gene locus_tag LOCUS_02150 239420 238371 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_02150 240421 239420 gene locus_tag LOCUS_02160 240421 239420 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026990.1 protein_id gnl|my_center|LOCUS_02160 243277 240551 gene locus_tag LOCUS_02170 243277 240551 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228256.1 protein_id gnl|my_center|LOCUS_02170 244053 244937 gene locus_tag LOCUS_02180 244053 244937 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_02180 245362 246102 gene locus_tag LOCUS_02190 245362 246102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 246703 246560 gene locus_tag LOCUS_02200 246703 246560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 247055 247363 gene locus_tag LOCUS_02210 247055 247363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 247482 247871 gene locus_tag LOCUS_02220 247482 247871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 248938 248039 gene locus_tag LOCUS_02230 248938 248039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 249752 249474 gene locus_tag LOCUS_02240 249752 249474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 249952 249749 gene locus_tag LOCUS_02250 249952 249749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 249970 250536 gene locus_tag LOCUS_02260 249970 250536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 251003 250581 gene locus_tag LOCUS_02270 251003 250581 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 protein_id gnl|my_center|LOCUS_02270 251489 251199 gene locus_tag LOCUS_02280 251489 251199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 251475 251975 gene locus_tag LOCUS_02290 251475 251975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02290 252236 252535 gene locus_tag LOCUS_02300 252236 252535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 253265 252990 gene locus_tag LOCUS_02310 253265 252990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 253978 254568 gene locus_tag LOCUS_02320 253978 254568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 254665 255171 gene locus_tag LOCUS_02330 254665 255171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 255723 255436 gene locus_tag LOCUS_02340 255723 255436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 255791 256462 gene locus_tag LOCUS_02350 255791 256462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 257140 256541 gene locus_tag LOCUS_02360 257140 256541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109036344.1 protein_id gnl|my_center|LOCUS_02360 257305 257838 gene locus_tag LOCUS_02370 257305 257838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 257835 260819 gene locus_tag LOCUS_02380 gene afsR 257835 260819 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_02380 260885 261499 gene locus_tag LOCUS_02390 260885 261499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 264223 261617 gene locus_tag LOCUS_02400 264223 261617 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031112.1 protein_id gnl|my_center|LOCUS_02400 264155 264487 gene locus_tag LOCUS_02410 264155 264487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 264798 266012 gene locus_tag LOCUS_02420 264798 266012 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730842.1 protein_id gnl|my_center|LOCUS_02420 266041 266898 gene locus_tag LOCUS_02430 266041 266898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 266895 267656 gene locus_tag LOCUS_02440 266895 267656 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230025.1 protein_id gnl|my_center|LOCUS_02440 267775 268275 gene locus_tag LOCUS_02450 267775 268275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 269588 268302 gene locus_tag LOCUS_02460 269588 268302 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226539.1 protein_id gnl|my_center|LOCUS_02460 269838 271022 gene locus_tag LOCUS_02470 269838 271022 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224575.1 protein_id gnl|my_center|LOCUS_02470 271101 271895 gene locus_tag LOCUS_02480 gene thpD 271101 271895 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_02480 271965 295631 gene locus_tag LOCUS_02490 271965 295631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 295631 295843 gene locus_tag LOCUS_02500 295631 295843 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_02500 295912 297033 gene locus_tag LOCUS_02510 295912 297033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 297030 297920 gene locus_tag LOCUS_02520 297030 297920 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552044.1 protein_id gnl|my_center|LOCUS_02520 297917 298966 gene locus_tag LOCUS_02530 gene dmpG 297917 298966 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552043.1 protein_id gnl|my_center|LOCUS_02530 299044 300027 gene locus_tag LOCUS_02540 299044 300027 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226606.1 protein_id gnl|my_center|LOCUS_02540 300024 300806 gene locus_tag LOCUS_02550 300024 300806 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 protein_id gnl|my_center|LOCUS_02550 301970 300837 gene locus_tag LOCUS_02560 301970 300837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226538.1 protein_id gnl|my_center|LOCUS_02560 302063 303025 gene locus_tag LOCUS_02570 302063 303025 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230441.1 protein_id gnl|my_center|LOCUS_02570 303022 303819 gene locus_tag LOCUS_02580 303022 303819 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230442.1 protein_id gnl|my_center|LOCUS_02580 303879 304505 gene locus_tag LOCUS_02590 303879 304505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 304502 306127 gene locus_tag LOCUS_02600 304502 306127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 306157 306744 gene locus_tag LOCUS_02610 306157 306744 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_02610 308341 307382 gene locus_tag LOCUS_02620 308341 307382 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028521.1 protein_id gnl|my_center|LOCUS_02620 309167 308529 gene locus_tag LOCUS_02630 309167 308529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 310088 309273 gene locus_tag LOCUS_02640 310088 309273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 310385 312769 gene locus_tag LOCUS_02650 310385 312769 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269956.1 protein_id gnl|my_center|LOCUS_02650 314754 313825 gene locus_tag LOCUS_02660 314754 313825 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026921.1 protein_id gnl|my_center|LOCUS_02660 315747 314947 gene locus_tag LOCUS_02670 315747 314947 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 protein_id gnl|my_center|LOCUS_02670 316550 316215 gene locus_tag LOCUS_02680 316550 316215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 316793 317458 gene locus_tag LOCUS_02690 316793 317458 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_02690 317464 318114 gene locus_tag LOCUS_02700 317464 318114 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 protein_id gnl|my_center|LOCUS_02700 318312 319250 gene locus_tag LOCUS_02710 318312 319250 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_02710 319817 320383 gene locus_tag LOCUS_02720 319817 320383 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727862.1 protein_id gnl|my_center|LOCUS_02720 320526 321398 gene locus_tag LOCUS_02730 320526 321398 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_02730 321622 323883 gene locus_tag LOCUS_02740 gene pflB 321622 323883 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 protein_id gnl|my_center|LOCUS_02740 323880 324641 gene locus_tag LOCUS_02750 gene pflA 323880 324641 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390067.1 protein_id gnl|my_center|LOCUS_02750 325294 324650 gene locus_tag LOCUS_02760 325294 324650 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026928.1 protein_id gnl|my_center|LOCUS_02760 325625 328282 gene locus_tag LOCUS_02770 gene adhE 325625 328282 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137036.1 protein_id gnl|my_center|LOCUS_02770 328658 329881 gene locus_tag LOCUS_02780 328658 329881 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_02780 329930 330931 gene locus_tag LOCUS_02790 gene argF 329930 330931 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_02790 330963 331919 gene locus_tag LOCUS_02800 330963 331919 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148616319.1 protein_id gnl|my_center|LOCUS_02800 331916 333448 gene locus_tag LOCUS_02810 331916 333448 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706444.1 protein_id gnl|my_center|LOCUS_02810 333691 334344 gene locus_tag LOCUS_02820 333691 334344 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_02820 336254 334542 gene locus_tag LOCUS_02830 336254 334542 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_02830 337815 336412 gene locus_tag LOCUS_02840 gene hemG 337815 336412 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_02840 338037 339578 gene locus_tag LOCUS_02850 338037 339578 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974998.1 protein_id gnl|my_center|LOCUS_02850 339595 340608 gene locus_tag LOCUS_02860 gene cydB 339595 340608 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_02860 341131 340640 gene locus_tag LOCUS_02870 341131 340640 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400656.1 protein_id gnl|my_center|LOCUS_02870 341422 341961 gene locus_tag LOCUS_02880 341422 341961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229066.1 protein_id gnl|my_center|LOCUS_02880 341942 342601 gene locus_tag LOCUS_02890 341942 342601 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 protein_id gnl|my_center|LOCUS_02890 343032 342580 gene locus_tag LOCUS_02900 343032 342580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 343570 345141 gene locus_tag LOCUS_02910 343570 345141 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_02910 345784 345410 gene locus_tag LOCUS_02920 345784 345410 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749484.1 protein_id gnl|my_center|LOCUS_02920 346035 345781 gene locus_tag LOCUS_02930 346035 345781 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039368.1 protein_id gnl|my_center|LOCUS_02930 346250 346092 gene locus_tag LOCUS_02940 346250 346092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 347393 346461 gene locus_tag LOCUS_02950 gene coxFIC1 347393 346461 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_02950 347495 348400 gene locus_tag LOCUS_02960 347495 348400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 349166 348627 gene locus_tag LOCUS_02970 349166 348627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 350162 349170 gene locus_tag LOCUS_02980 350162 349170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 350841 350602 gene locus_tag LOCUS_02990 350841 350602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 350923 351270 gene locus_tag LOCUS_03000 350923 351270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 351353 351619 gene locus_tag LOCUS_03010 351353 351619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 352288 351794 gene locus_tag LOCUS_03020 352288 351794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 352675 352322 gene locus_tag LOCUS_03030 352675 352322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 353962 353114 gene locus_tag LOCUS_03040 353962 353114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 353934 354173 gene locus_tag LOCUS_03050 353934 354173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 354922 354134 gene locus_tag LOCUS_03060 354922 354134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 356010 354919 gene locus_tag LOCUS_03070 356010 354919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 356555 356899 gene locus_tag LOCUS_03080 356555 356899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03080 357921 357244 gene locus_tag LOCUS_03090 357921 357244 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727149.1 protein_id gnl|my_center|LOCUS_03090 358347 358937 gene locus_tag LOCUS_03100 358347 358937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 359099 360418 gene locus_tag LOCUS_03110 359099 360418 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479749.1 protein_id gnl|my_center|LOCUS_03110 360471 361595 gene locus_tag LOCUS_03120 360471 361595 CDS product catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227457.1 protein_id gnl|my_center|LOCUS_03120 361892 361704 gene locus_tag LOCUS_03130 361892 361704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 362134 361883 gene locus_tag LOCUS_03140 362134 361883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 362292 362471 gene locus_tag LOCUS_03150 362292 362471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 362631 363647 gene locus_tag LOCUS_03160 362631 363647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 363652 363795 gene locus_tag LOCUS_03170 363652 363795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 364039 364224 gene locus_tag LOCUS_03180 364039 364224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 364375 364644 gene locus_tag LOCUS_03190 364375 364644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 365156 364605 gene locus_tag LOCUS_03200 365156 364605 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626529.1 protein_id gnl|my_center|LOCUS_03200 366835 365255 gene locus_tag LOCUS_03210 366835 365255 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_03210 366966 368228 gene locus_tag LOCUS_03220 366966 368228 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390922.1 protein_id gnl|my_center|LOCUS_03220 368261 368623 gene locus_tag LOCUS_03230 368261 368623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03230 368620 369186 gene locus_tag LOCUS_03240 368620 369186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 369255 369443 gene locus_tag LOCUS_03250 369255 369443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 369960 371477 gene locus_tag LOCUS_03260 gene gndA 369960 371477 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027484.1 protein_id gnl|my_center|LOCUS_03260 371542 371952 gene locus_tag LOCUS_03270 371542 371952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 372054 372944 gene locus_tag LOCUS_03280 372054 372944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 373503 372952 gene locus_tag LOCUS_03290 373503 372952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 376245 373651 gene locus_tag LOCUS_03300 376245 373651 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_03300 379064 376566 gene locus_tag LOCUS_03310 379064 376566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 380218 379061 gene locus_tag LOCUS_03320 380218 379061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 381360 380215 gene locus_tag LOCUS_03330 381360 380215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 382775 381357 gene locus_tag LOCUS_03340 382775 381357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 384043 382772 gene locus_tag LOCUS_03350 384043 382772 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060759.1 protein_id gnl|my_center|LOCUS_03350 384994 384341 gene locus_tag LOCUS_03360 384994 384341 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031847.1 protein_id gnl|my_center|LOCUS_03360 386736 385027 gene locus_tag LOCUS_03370 386736 385027 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003961897.1 protein_id gnl|my_center|LOCUS_03370 387310 386870 gene locus_tag LOCUS_03380 387310 386870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 387705 387436 gene locus_tag LOCUS_03390 387705 387436 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975653.1 protein_id gnl|my_center|LOCUS_03390 388625 387861 gene locus_tag LOCUS_03400 388625 387861 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974001.1 protein_id gnl|my_center|LOCUS_03400 388730 388996 gene locus_tag LOCUS_03410 388730 388996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 388993 390216 gene locus_tag LOCUS_03420 388993 390216 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_03420 390213 392495 gene locus_tag LOCUS_03430 390213 392495 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028362.1 protein_id gnl|my_center|LOCUS_03430 393662 392610 gene locus_tag LOCUS_03440 393662 392610 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_03440 393781 394659 gene locus_tag LOCUS_03450 393781 394659 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029967.1 protein_id gnl|my_center|LOCUS_03450 395574 394684 gene locus_tag LOCUS_03460 395574 394684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 396995 395961 gene locus_tag LOCUS_03470 396995 395961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 397470 397015 gene locus_tag LOCUS_03480 397470 397015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 398335 397487 gene locus_tag LOCUS_03490 398335 397487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 399484 398468 gene locus_tag LOCUS_03500 399484 398468 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 protein_id gnl|my_center|LOCUS_03500 400202 399888 gene locus_tag LOCUS_03510 400202 399888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 400534 400932 gene locus_tag LOCUS_03520 400534 400932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 401117 401755 gene locus_tag LOCUS_03530 401117 401755 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030853.1 protein_id gnl|my_center|LOCUS_03530 401752 402426 gene locus_tag LOCUS_03540 401752 402426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 402593 404587 gene locus_tag LOCUS_03550 402593 404587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230344.1 protein_id gnl|my_center|LOCUS_03550 404749 405936 gene locus_tag LOCUS_03560 404749 405936 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078653353.1 protein_id gnl|my_center|LOCUS_03560 407020 406073 gene locus_tag LOCUS_03570 407020 406073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 408278 407205 gene locus_tag LOCUS_03580 408278 407205 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112356.1 protein_id gnl|my_center|LOCUS_03580 409248 408376 gene locus_tag LOCUS_03590 gene dapF 409248 408376 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224258.1 protein_id gnl|my_center|LOCUS_03590 409567 410952 gene locus_tag LOCUS_03600 409567 410952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 411714 410959 gene locus_tag LOCUS_03610 411714 410959 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079692.1 protein_id gnl|my_center|LOCUS_03610 411849 414035 gene locus_tag LOCUS_03620 411849 414035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 414224 415426 gene locus_tag LOCUS_03630 414224 415426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 416880 415471 gene locus_tag LOCUS_03640 416880 415471 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644775.1 protein_id gnl|my_center|LOCUS_03640 417080 416877 gene locus_tag LOCUS_03650 417080 416877 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243183.1 protein_id gnl|my_center|LOCUS_03650 424272 417085 gene locus_tag LOCUS_03660 gene dhbF 424272 417085 CDS product non-ribosomal peptide synthetase DhbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968094.1 protein_id gnl|my_center|LOCUS_03660 424428 425561 gene locus_tag LOCUS_03670 424428 425561 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900009.1 protein_id gnl|my_center|LOCUS_03670 426644 425643 gene locus_tag LOCUS_03680 426644 425643 CDS product amonabactin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705834.1 protein_id gnl|my_center|LOCUS_03680 427056 426853 gene locus_tag LOCUS_03690 427056 426853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 427526 427167 gene locus_tag LOCUS_03700 427526 427167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 427766 428992 gene locus_tag LOCUS_03710 427766 428992 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716613.1 protein_id gnl|my_center|LOCUS_03710 429103 430461 gene locus_tag LOCUS_03720 gene glnA3 429103 430461 CDS product gamma-glutamylpolyamine synthetase GlnA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031340.1 protein_id gnl|my_center|LOCUS_03720 430463 431608 gene locus_tag LOCUS_03730 430463 431608 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028051.1 protein_id gnl|my_center|LOCUS_03730 431750 432040 gene locus_tag LOCUS_03740 431750 432040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 432053 432295 gene locus_tag LOCUS_03750 432053 432295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 433464 432283 gene locus_tag LOCUS_03760 433464 432283 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921469.1 protein_id gnl|my_center|LOCUS_03760 433631 435217 gene locus_tag LOCUS_03770 433631 435217 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230951.1 protein_id gnl|my_center|LOCUS_03770 435286 436530 gene locus_tag LOCUS_03780 435286 436530 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070937859.1 protein_id gnl|my_center|LOCUS_03780 436583 437887 gene locus_tag LOCUS_03790 436583 437887 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027469.1 protein_id gnl|my_center|LOCUS_03790 438012 438950 gene locus_tag LOCUS_03800 438012 438950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 439911 438979 gene locus_tag LOCUS_03810 439911 438979 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_03810 441664 440048 gene locus_tag LOCUS_03820 441664 440048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 441893 442939 gene locus_tag LOCUS_03830 441893 442939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 442941 443996 gene locus_tag LOCUS_03840 442941 443996 CDS product family 2 encapsulin nanocompartment cargo protein polyprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223417.1 protein_id gnl|my_center|LOCUS_03840 444641 444027 gene locus_tag LOCUS_03850 444641 444027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 444826 447045 gene locus_tag LOCUS_03860 444826 447045 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030601.1 protein_id gnl|my_center|LOCUS_03860 448758 447118 gene locus_tag LOCUS_03870 448758 447118 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 protein_id gnl|my_center|LOCUS_03870 448907 449779 gene locus_tag LOCUS_03880 448907 449779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 450432 449806 gene locus_tag LOCUS_03890 450432 449806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 451811 450588 gene locus_tag LOCUS_03900 451811 450588 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 protein_id gnl|my_center|LOCUS_03900 451961 452605 gene locus_tag LOCUS_03910 451961 452605 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977621.1 protein_id gnl|my_center|LOCUS_03910 453175 452606 gene locus_tag LOCUS_03920 gene def 453175 452606 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325677.1 protein_id gnl|my_center|LOCUS_03920 453385 454623 gene locus_tag LOCUS_03930 453385 454623 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977619.1 protein_id gnl|my_center|LOCUS_03930 454654 455382 gene locus_tag LOCUS_03940 454654 455382 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977618.1 protein_id gnl|my_center|LOCUS_03940 455500 456525 gene locus_tag LOCUS_03950 455500 456525 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977617.1 protein_id gnl|my_center|LOCUS_03950 456628 457605 gene locus_tag LOCUS_03960 456628 457605 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977616.1 protein_id gnl|my_center|LOCUS_03960 457729 457887 gene locus_tag LOCUS_03970 457729 457887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325678.1 protein_id gnl|my_center|LOCUS_03970 458315 457902 gene locus_tag LOCUS_03980 458315 457902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 458519 459349 gene locus_tag LOCUS_03990 458519 459349 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869145.1 protein_id gnl|my_center|LOCUS_03990 460526 459363 gene locus_tag LOCUS_04000 460526 459363 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_04000 461374 460658 gene locus_tag LOCUS_04010 gene bioD 461374 460658 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027666.1 protein_id gnl|my_center|LOCUS_04010 462702 461398 gene locus_tag LOCUS_04020 462702 461398 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027665.1 protein_id gnl|my_center|LOCUS_04020 463987 462695 gene locus_tag LOCUS_04030 gene bioB 463987 462695 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027664.1 protein_id gnl|my_center|LOCUS_04030 464133 465287 gene locus_tag LOCUS_04040 464133 465287 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977587.1 protein_id gnl|my_center|LOCUS_04040 465496 465308 gene locus_tag LOCUS_04050 465496 465308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 466465 465596 gene locus_tag LOCUS_04060 466465 465596 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_04060 466708 467136 gene locus_tag LOCUS_04070 466708 467136 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027663.1 protein_id gnl|my_center|LOCUS_04070 467872 467384 gene locus_tag LOCUS_04080 467872 467384 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977591.1 protein_id gnl|my_center|LOCUS_04080 468705 468379 gene locus_tag LOCUS_04090 468705 468379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977592.1 protein_id gnl|my_center|LOCUS_04090 469346 468711 gene locus_tag LOCUS_04100 469346 468711 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977593.1 protein_id gnl|my_center|LOCUS_04100 469423 469755 gene locus_tag LOCUS_04110 469423 469755 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977594.1 protein_id gnl|my_center|LOCUS_04110 469927 470229 gene locus_tag LOCUS_04120 469927 470229 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977595.1 protein_id gnl|my_center|LOCUS_04120 470226 470552 gene locus_tag LOCUS_04130 470226 470552 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977596.1 protein_id gnl|my_center|LOCUS_04130 470545 472266 gene locus_tag LOCUS_04140 470545 472266 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977597.1 protein_id gnl|my_center|LOCUS_04140 472279 472986 gene locus_tag LOCUS_04150 472279 472986 CDS product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027662.1 protein_id gnl|my_center|LOCUS_04150 473069 473758 gene locus_tag LOCUS_04160 gene ureG 473069 473758 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977599.1 protein_id gnl|my_center|LOCUS_04160 473755 474564 gene locus_tag LOCUS_04170 473755 474564 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027661.1 protein_id gnl|my_center|LOCUS_04170 474745 476352 gene locus_tag LOCUS_04180 474745 476352 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027660.1 protein_id gnl|my_center|LOCUS_04180 476786 477139 gene locus_tag LOCUS_04190 476786 477139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 477941 477201 gene locus_tag LOCUS_04200 477941 477201 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_04200 478201 478803 gene locus_tag LOCUS_04210 478201 478803 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031857.1 protein_id gnl|my_center|LOCUS_04210 478841 479143 gene locus_tag LOCUS_04220 478841 479143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 479197 479694 gene locus_tag LOCUS_04230 479197 479694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 479691 479972 gene locus_tag LOCUS_04240 479691 479972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 480079 480762 gene locus_tag LOCUS_04250 480079 480762 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_04250 480814 481692 gene locus_tag LOCUS_04260 480814 481692 CDS product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 protein_id gnl|my_center|LOCUS_04260 481920 483269 gene locus_tag LOCUS_04270 481920 483269 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027670.1 protein_id gnl|my_center|LOCUS_04270 483266 484279 gene locus_tag LOCUS_04280 483266 484279 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977578.1 protein_id gnl|my_center|LOCUS_04280 484333 485127 gene locus_tag LOCUS_04290 484333 485127 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977577.1 protein_id gnl|my_center|LOCUS_04290 485238 486671 gene locus_tag LOCUS_04300 gene purB 485238 486671 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027671.1 protein_id gnl|my_center|LOCUS_04300 486674 487216 gene locus_tag LOCUS_04310 gene mug 486674 487216 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027672.1 protein_id gnl|my_center|LOCUS_04310 487287 488444 gene locus_tag LOCUS_04320 487287 488444 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977569.1 protein_id gnl|my_center|LOCUS_04320 489227 488478 gene locus_tag LOCUS_04330 489227 488478 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027677.1 protein_id gnl|my_center|LOCUS_04330 489447 490205 gene locus_tag LOCUS_04340 489447 490205 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977492.1 protein_id gnl|my_center|LOCUS_04340 491127 490243 gene locus_tag LOCUS_04350 491127 490243 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977567.1 protein_id gnl|my_center|LOCUS_04350 491316 492146 gene locus_tag LOCUS_04360 491316 492146 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 protein_id gnl|my_center|LOCUS_04360 492258 493868 gene locus_tag LOCUS_04370 492258 493868 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027698.1 protein_id gnl|my_center|LOCUS_04370 493929 495290 gene locus_tag LOCUS_04380 493929 495290 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_04380 495417 496808 gene locus_tag LOCUS_04390 495417 496808 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027701.1 protein_id gnl|my_center|LOCUS_04390 496835 498556 gene locus_tag LOCUS_04400 496835 498556 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027703.1 protein_id gnl|my_center|LOCUS_04400 498802 499191 gene locus_tag LOCUS_04410 498802 499191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 499244 499534 gene locus_tag LOCUS_04420 499244 499534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 499639 500130 gene locus_tag LOCUS_04430 499639 500130 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977532.1 protein_id gnl|my_center|LOCUS_04430 503494 500075 gene locus_tag LOCUS_04440 503494 500075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 504657 503491 gene locus_tag LOCUS_04450 504657 503491 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977530.1 protein_id gnl|my_center|LOCUS_04450 505502 504876 gene locus_tag LOCUS_04460 505502 504876 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_04460 505602 506009 gene locus_tag LOCUS_04470 505602 506009 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_04470 506092 506679 gene locus_tag LOCUS_04480 506092 506679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 507185 506613 gene locus_tag LOCUS_04490 507185 506613 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977517.1 protein_id gnl|my_center|LOCUS_04490 507238 508152 gene locus_tag LOCUS_04500 507238 508152 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 protein_id gnl|my_center|LOCUS_04500 509098 508193 gene locus_tag LOCUS_04510 509098 508193 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026972.1 protein_id gnl|my_center|LOCUS_04510 509246 509965 gene locus_tag LOCUS_04520 509246 509965 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026973.1 protein_id gnl|my_center|LOCUS_04520 510598 510077 gene locus_tag LOCUS_04530 510598 510077 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_04530 511429 510764 gene locus_tag LOCUS_04540 511429 510764 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_04540 511392 511652 gene locus_tag LOCUS_04550 511392 511652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 512559 511609 gene locus_tag LOCUS_04560 512559 511609 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027203.1 protein_id gnl|my_center|LOCUS_04560 512660 514153 gene locus_tag LOCUS_04570 512660 514153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027202.1 protein_id gnl|my_center|LOCUS_04570 515090 515968 gene locus_tag LOCUS_04580 515090 515968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 515968 517140 gene locus_tag LOCUS_04590 515968 517140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 517238 517606 gene locus_tag LOCUS_04600 517238 517606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 517742 519661 gene locus_tag LOCUS_04610 517742 519661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 520449 519790 gene locus_tag LOCUS_04620 520449 519790 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977095.1 protein_id gnl|my_center|LOCUS_04620 520424 520705 gene locus_tag LOCUS_04630 520424 520705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 520796 523003 gene locus_tag LOCUS_04640 520796 523003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 523080 523856 gene locus_tag LOCUS_04650 523080 523856 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027093.1 protein_id gnl|my_center|LOCUS_04650 523871 524269 gene locus_tag LOCUS_04660 523871 524269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 524278 525111 gene locus_tag LOCUS_04670 524278 525111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 525506 526429 gene locus_tag LOCUS_04680 525506 526429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 526371 526724 gene locus_tag LOCUS_04690 526371 526724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 526780 527991 gene locus_tag LOCUS_04700 526780 527991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 528546 528094 gene locus_tag LOCUS_04710 528546 528094 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977512.1 protein_id gnl|my_center|LOCUS_04710 528689 529711 gene locus_tag LOCUS_04720 528689 529711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027716.1 protein_id gnl|my_center|LOCUS_04720 530582 529737 gene locus_tag LOCUS_04730 530582 529737 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027718.1 protein_id gnl|my_center|LOCUS_04730 531804 530671 gene locus_tag LOCUS_04740 gene tuf 531804 530671 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977508.1 protein_id gnl|my_center|LOCUS_04740 532105 532863 gene locus_tag LOCUS_04750 532105 532863 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027720.1 protein_id gnl|my_center|LOCUS_04750 533128 533745 gene locus_tag LOCUS_04760 533128 533745 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977728.1 protein_id gnl|my_center|LOCUS_04760 533915 535279 gene locus_tag LOCUS_04770 533915 535279 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479549.1 protein_id gnl|my_center|LOCUS_04770 536441 535212 gene locus_tag LOCUS_04780 536441 535212 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_04780 536754 537431 gene locus_tag LOCUS_04790 536754 537431 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027583.1 protein_id gnl|my_center|LOCUS_04790 537466 538503 gene locus_tag LOCUS_04800 537466 538503 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027584.1 protein_id gnl|my_center|LOCUS_04800 538727 539560 gene locus_tag LOCUS_04810 538727 539560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027585.1 protein_id gnl|my_center|LOCUS_04810 541013 539955 gene locus_tag LOCUS_04820 541013 539955 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977714.1 protein_id gnl|my_center|LOCUS_04820 542841 541327 gene locus_tag LOCUS_04830 542841 541327 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027586.1 protein_id gnl|my_center|LOCUS_04830 543179 543661 gene locus_tag LOCUS_04840 543179 543661 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977712.1 protein_id gnl|my_center|LOCUS_04840 543786 544427 gene locus_tag LOCUS_04850 543786 544427 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977711.1 protein_id gnl|my_center|LOCUS_04850 544511 545434 gene locus_tag LOCUS_04860 544511 545434 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029243.1 protein_id gnl|my_center|LOCUS_04860 545870 545448 gene locus_tag LOCUS_04870 545870 545448 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_04870 545969 547087 gene locus_tag LOCUS_04880 545969 547087 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027605.1 protein_id gnl|my_center|LOCUS_04880 547172 547933 gene locus_tag LOCUS_04890 547172 547933 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027371.1 protein_id gnl|my_center|LOCUS_04890 547930 549399 gene locus_tag LOCUS_04900 547930 549399 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027372.1 protein_id gnl|my_center|LOCUS_04900 549369 550076 gene locus_tag LOCUS_04910 549369 550076 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978042.1 protein_id gnl|my_center|LOCUS_04910 550121 551290 gene locus_tag LOCUS_04920 550121 551290 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838427.1 protein_id gnl|my_center|LOCUS_04920 551424 552650 gene locus_tag LOCUS_04930 551424 552650 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227054.1 protein_id gnl|my_center|LOCUS_04930 554541 552745 gene locus_tag LOCUS_04940 554541 552745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_04940 554700 555143 gene locus_tag LOCUS_04950 554700 555143 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027607.1 protein_id gnl|my_center|LOCUS_04950 556866 555253 gene locus_tag LOCUS_04960 556866 555253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225282.1 protein_id gnl|my_center|LOCUS_04960 557025 558830 gene locus_tag LOCUS_04970 557025 558830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230756.1 protein_id gnl|my_center|LOCUS_04970 558827 560608 gene locus_tag LOCUS_04980 558827 560608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027610.1 protein_id gnl|my_center|LOCUS_04980 561429 560638 gene locus_tag LOCUS_04990 561429 560638 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977680.1 protein_id gnl|my_center|LOCUS_04990 561563 564076 gene locus_tag LOCUS_05000 561563 564076 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027613.1 protein_id gnl|my_center|LOCUS_05000 565098 564130 gene locus_tag LOCUS_05010 565098 564130 CDS product DUF6397 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027615.1 protein_id gnl|my_center|LOCUS_05010 565578 565234 gene locus_tag LOCUS_05020 565578 565234 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977676.1 protein_id gnl|my_center|LOCUS_05020 565854 566150 gene locus_tag LOCUS_05030 565854 566150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150469750.1 protein_id gnl|my_center|LOCUS_05030 566309 567217 gene locus_tag LOCUS_05040 566309 567217 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227738.1 protein_id gnl|my_center|LOCUS_05040 567220 568518 gene locus_tag LOCUS_05050 567220 568518 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103941653.1 protein_id gnl|my_center|LOCUS_05050 568524 569546 gene locus_tag LOCUS_05060 568524 569546 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227740.1 protein_id gnl|my_center|LOCUS_05060 569780 569598 gene locus_tag LOCUS_05070 569780 569598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325661.1 protein_id gnl|my_center|LOCUS_05070 569948 572833 gene locus_tag LOCUS_05080 569948 572833 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030777.1 protein_id gnl|my_center|LOCUS_05080 572830 573774 gene locus_tag LOCUS_05090 572830 573774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 574092 573853 gene locus_tag LOCUS_05100 574092 573853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 574373 574870 gene locus_tag LOCUS_05110 574373 574870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 575663 574818 gene locus_tag LOCUS_05120 575663 574818 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027645.1 protein_id gnl|my_center|LOCUS_05120 575888 577105 gene locus_tag LOCUS_05130 575888 577105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 577252 578652 gene locus_tag LOCUS_05140 577252 578652 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_05140 578827 580221 gene locus_tag LOCUS_05150 578827 580221 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_05150 580434 580240 gene locus_tag LOCUS_05160 580434 580240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977636.1 protein_id gnl|my_center|LOCUS_05160 580733 584125 gene locus_tag LOCUS_05170 gene lysX 580733 584125 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 protein_id gnl|my_center|LOCUS_05170 587149 584162 gene locus_tag LOCUS_05180 587149 584162 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027462.1 protein_id gnl|my_center|LOCUS_05180 589272 587197 gene locus_tag LOCUS_05190 589272 587197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 590554 589334 gene locus_tag LOCUS_05200 590554 589334 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027463.1 protein_id gnl|my_center|LOCUS_05200 591402 590572 gene locus_tag LOCUS_05210 591402 590572 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027464.1 protein_id gnl|my_center|LOCUS_05210 592358 591402 gene locus_tag LOCUS_05220 592358 591402 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977909.1 protein_id gnl|my_center|LOCUS_05220 593675 592383 gene locus_tag LOCUS_05230 593675 592383 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977908.1 protein_id gnl|my_center|LOCUS_05230 593798 594850 gene locus_tag LOCUS_05240 593798 594850 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027465.1 protein_id gnl|my_center|LOCUS_05240 594948 595946 gene locus_tag LOCUS_05250 594948 595946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 596042 597637 gene locus_tag LOCUS_05260 596042 597637 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030930.1 protein_id gnl|my_center|LOCUS_05260 597634 598629 gene locus_tag LOCUS_05270 597634 598629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270309.1 protein_id gnl|my_center|LOCUS_05270 598622 599449 gene locus_tag LOCUS_05280 598622 599449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469199.1 protein_id gnl|my_center|LOCUS_05280 599446 600408 gene locus_tag LOCUS_05290 599446 600408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030933.1 protein_id gnl|my_center|LOCUS_05290 600401 601150 gene locus_tag LOCUS_05300 600401 601150 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972523.1 protein_id gnl|my_center|LOCUS_05300 601147 601695 gene locus_tag LOCUS_05310 601147 601695 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_05310 601739 604453 gene locus_tag LOCUS_05320 601739 604453 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484949.1 protein_id gnl|my_center|LOCUS_05320 604450 605310 gene locus_tag LOCUS_05330 604450 605310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028540.1 protein_id gnl|my_center|LOCUS_05330 605778 605311 gene locus_tag LOCUS_05340 605778 605311 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963527.1 protein_id gnl|my_center|LOCUS_05340 606781 605861 gene locus_tag LOCUS_05350 606781 605861 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092227.1 protein_id gnl|my_center|LOCUS_05350 607689 606778 gene locus_tag LOCUS_05360 607689 606778 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225233.1 protein_id gnl|my_center|LOCUS_05360 607655 608422 gene locus_tag LOCUS_05370 607655 608422 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_05370 608419 609288 gene locus_tag LOCUS_05380 608419 609288 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_05380 609285 610037 gene locus_tag LOCUS_05390 609285 610037 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225237.1 protein_id gnl|my_center|LOCUS_05390 610034 611107 gene locus_tag LOCUS_05400 610034 611107 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_05400 611104 611946 gene locus_tag LOCUS_05410 611104 611946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223235.1 protein_id gnl|my_center|LOCUS_05410 612336 612004 gene locus_tag LOCUS_05420 612336 612004 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081319.1 protein_id gnl|my_center|LOCUS_05420 613078 612329 gene locus_tag LOCUS_05430 613078 612329 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 protein_id gnl|my_center|LOCUS_05430 613158 613598 gene locus_tag LOCUS_05440 613158 613598 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056723.1 protein_id gnl|my_center|LOCUS_05440 614762 613605 gene locus_tag LOCUS_05450 614762 613605 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_05450 615383 614772 gene locus_tag LOCUS_05460 gene kstR2 615383 614772 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 protein_id gnl|my_center|LOCUS_05460 616198 615398 gene locus_tag LOCUS_05470 616198 615398 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_05470 616244 617095 gene locus_tag LOCUS_05480 616244 617095 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_05480 617095 618237 gene locus_tag LOCUS_05490 617095 618237 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113160.1 protein_id gnl|my_center|LOCUS_05490 618234 619427 gene locus_tag LOCUS_05500 618234 619427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 619465 620973 gene locus_tag LOCUS_05510 619465 620973 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897270.1 protein_id gnl|my_center|LOCUS_05510 621078 621593 gene locus_tag LOCUS_05520 621078 621593 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027573.1 protein_id gnl|my_center|LOCUS_05520 622106 621693 gene locus_tag LOCUS_05530 622106 621693 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972459.1 protein_id gnl|my_center|LOCUS_05530 622584 622117 gene locus_tag LOCUS_05540 622584 622117 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_05540 623182 622595 gene locus_tag LOCUS_05550 623182 622595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 624693 623179 gene locus_tag LOCUS_05560 624693 623179 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971914.1 protein_id gnl|my_center|LOCUS_05560 625420 624710 gene locus_tag LOCUS_05570 625420 624710 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971612.1 protein_id gnl|my_center|LOCUS_05570 626304 625510 gene locus_tag LOCUS_05580 626304 625510 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 protein_id gnl|my_center|LOCUS_05580 626392 628038 gene locus_tag LOCUS_05590 626392 628038 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226548.1 protein_id gnl|my_center|LOCUS_05590 628035 628799 gene locus_tag LOCUS_05600 628035 628799 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_05600 629862 628774 gene locus_tag LOCUS_05610 629862 628774 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023513.1 protein_id gnl|my_center|LOCUS_05610 633670 629864 gene locus_tag LOCUS_05620 633670 629864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 633958 634488 gene locus_tag LOCUS_05630 633958 634488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 634530 635285 gene locus_tag LOCUS_05640 634530 635285 CDS product DUF4239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977928.1 protein_id gnl|my_center|LOCUS_05640 635513 636796 gene locus_tag LOCUS_05650 gene egtA 635513 636796 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027438.1 protein_id gnl|my_center|LOCUS_05650 636793 638124 gene locus_tag LOCUS_05660 gene egtB 636793 638124 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027439.1 protein_id gnl|my_center|LOCUS_05660 638124 638924 gene locus_tag LOCUS_05670 gene egtC 638124 638924 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027440.1 protein_id gnl|my_center|LOCUS_05670 638921 639883 gene locus_tag LOCUS_05680 gene egtD 638921 639883 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027441.1 protein_id gnl|my_center|LOCUS_05680 640005 642017 gene locus_tag LOCUS_05690 640005 642017 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486780.1 protein_id gnl|my_center|LOCUS_05690 642069 644414 gene locus_tag LOCUS_05700 642069 644414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 644451 644948 gene locus_tag LOCUS_05710 644451 644948 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977923.1 protein_id gnl|my_center|LOCUS_05710 645039 645524 gene locus_tag LOCUS_05720 645039 645524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 645538 646116 gene locus_tag LOCUS_05730 645538 646116 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 protein_id gnl|my_center|LOCUS_05730 646888 646103 gene locus_tag LOCUS_05740 646888 646103 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_05740 647008 647337 gene locus_tag LOCUS_05750 647008 647337 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815632.1 protein_id gnl|my_center|LOCUS_05750 647370 647582 gene locus_tag LOCUS_05760 647370 647582 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325534.1 protein_id gnl|my_center|LOCUS_05760 648518 647607 gene locus_tag LOCUS_05770 648518 647607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 649361 648597 gene locus_tag LOCUS_05780 649361 648597 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977603.1 protein_id gnl|my_center|LOCUS_05780 649801 649481 gene locus_tag LOCUS_05790 649801 649481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 649923 651281 gene locus_tag LOCUS_05800 649923 651281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_05800 654644 651285 gene locus_tag LOCUS_05810 654644 651285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224789.1 protein_id gnl|my_center|LOCUS_05810 654759 655478 gene locus_tag LOCUS_05820 654759 655478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05820 656113 655460 gene locus_tag LOCUS_05830 656113 655460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 656236 659421 gene locus_tag LOCUS_05840 gene cypB 656236 659421 CDS product bifunctional cytochrome P450/NADPH--P450 reductase CypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246174.1 protein_id gnl|my_center|LOCUS_05840 659548 660240 gene locus_tag LOCUS_05850 659548 660240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 660324 661343 gene locus_tag LOCUS_05860 660324 661343 CDS product phosphatidylinositol-specific phospholipase C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230297.1 protein_id gnl|my_center|LOCUS_05860 661758 664064 gene locus_tag LOCUS_05870 661758 664064 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027470.1 protein_id gnl|my_center|LOCUS_05870 664176 665618 gene locus_tag LOCUS_05880 664176 665618 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027457.1 protein_id gnl|my_center|LOCUS_05880 666907 665624 gene locus_tag LOCUS_05890 666907 665624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 667880 667005 gene locus_tag LOCUS_05900 667880 667005 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_05900 669184 668009 gene locus_tag LOCUS_05910 669184 668009 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228864.1 protein_id gnl|my_center|LOCUS_05910 671701 669293 gene locus_tag LOCUS_05920 671701 669293 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027445.1 protein_id gnl|my_center|LOCUS_05920 671841 672527 gene locus_tag LOCUS_05930 671841 672527 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_05930 672520 673644 gene locus_tag LOCUS_05940 672520 673644 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029200.1 protein_id gnl|my_center|LOCUS_05940 673798 674016 gene locus_tag LOCUS_05950 673798 674016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 675136 673970 gene locus_tag LOCUS_05960 675136 673970 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414559.1 protein_id gnl|my_center|LOCUS_05960 675527 677134 gene locus_tag LOCUS_05970 675527 677134 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225277.1 protein_id gnl|my_center|LOCUS_05970 677207 677797 gene locus_tag LOCUS_05980 677207 677797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 679132 677918 gene locus_tag LOCUS_05990 679132 677918 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_05990 680508 679288 gene locus_tag LOCUS_06000 680508 679288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 681151 680501 gene locus_tag LOCUS_06010 681151 680501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228866.1 protein_id gnl|my_center|LOCUS_06010 681636 681148 gene locus_tag LOCUS_06020 681636 681148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 681924 683669 gene locus_tag LOCUS_06030 681924 683669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 684237 683716 gene locus_tag LOCUS_06040 684237 683716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 684303 684917 gene locus_tag LOCUS_06050 684303 684917 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079730.1 protein_id gnl|my_center|LOCUS_06050 687153 685033 gene locus_tag LOCUS_06060 687153 685033 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228686.1 protein_id gnl|my_center|LOCUS_06060 687529 687143 gene locus_tag LOCUS_06070 687529 687143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067284479.1 protein_id gnl|my_center|LOCUS_06070 687787 688767 gene locus_tag LOCUS_06080 687787 688767 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223253.1 protein_id gnl|my_center|LOCUS_06080 689639 688926 gene locus_tag LOCUS_06090 689639 688926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972703.1 protein_id gnl|my_center|LOCUS_06090 690892 689639 gene locus_tag LOCUS_06100 690892 689639 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030748.1 protein_id gnl|my_center|LOCUS_06100 691084 692514 gene locus_tag LOCUS_06110 gene rox 691084 692514 CDS product rifampin monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877344.1 protein_id gnl|my_center|LOCUS_06110 696242 692583 gene locus_tag LOCUS_06120 gene cobN 696242 692583 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729378.1 protein_id gnl|my_center|LOCUS_06120 696488 697846 gene locus_tag LOCUS_06130 696488 697846 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228826.1 protein_id gnl|my_center|LOCUS_06130 697894 698547 gene locus_tag LOCUS_06140 697894 698547 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_06140 698544 700106 gene locus_tag LOCUS_06150 698544 700106 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086498.1 protein_id gnl|my_center|LOCUS_06150 700963 700199 gene locus_tag LOCUS_06160 700963 700199 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975552.1 protein_id gnl|my_center|LOCUS_06160 701041 702186 gene locus_tag LOCUS_06170 701041 702186 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390744.1 protein_id gnl|my_center|LOCUS_06170 702989 702195 gene locus_tag LOCUS_06180 702989 702195 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485278.1 protein_id gnl|my_center|LOCUS_06180 702924 703535 gene locus_tag LOCUS_06190 702924 703535 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974964.1 protein_id gnl|my_center|LOCUS_06190 704336 703557 gene locus_tag LOCUS_06200 gene cobM 704336 703557 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228819.1 protein_id gnl|my_center|LOCUS_06200 705623 704409 gene locus_tag LOCUS_06210 705623 704409 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269017.1 protein_id gnl|my_center|LOCUS_06210 705749 706819 gene locus_tag LOCUS_06220 gene tsaD 705749 706819 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775962.1 protein_id gnl|my_center|LOCUS_06220 706867 709515 gene locus_tag LOCUS_06230 gene alaS 706867 709515 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093585.1 protein_id gnl|my_center|LOCUS_06230 707752 707844 gene locus_tag LOCUS_t00020 707752 707844 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 709587 709946 gene locus_tag LOCUS_06240 709587 709946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 709939 710208 gene locus_tag LOCUS_06250 709939 710208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 711813 710260 gene locus_tag LOCUS_06260 711813 710260 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 protein_id gnl|my_center|LOCUS_06260 712158 712397 gene locus_tag LOCUS_06270 gene chpG 712158 712397 CDS product chaplin ChpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449696.1 protein_id gnl|my_center|LOCUS_06270 712640 712461 gene locus_tag LOCUS_06280 712640 712461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 713513 712719 gene locus_tag LOCUS_06290 713513 712719 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030982.1 protein_id gnl|my_center|LOCUS_06290 713903 714892 gene locus_tag LOCUS_06300 713903 714892 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976055.1 protein_id gnl|my_center|LOCUS_06300 714924 716474 gene locus_tag LOCUS_06310 714924 716474 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028557.1 protein_id gnl|my_center|LOCUS_06310 716464 717438 gene locus_tag LOCUS_06320 716464 717438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06320 717450 718364 gene locus_tag LOCUS_06330 717450 718364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06330 718375 719289 gene locus_tag LOCUS_06340 718375 719289 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028558.1 protein_id gnl|my_center|LOCUS_06340 720376 719474 gene locus_tag LOCUS_06350 720376 719474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 721403 720387 gene locus_tag LOCUS_06360 721403 720387 CDS product ParB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173142140.1 protein_id gnl|my_center|LOCUS_06360 721671 722120 gene locus_tag LOCUS_06370 721671 722120 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223693.1 protein_id gnl|my_center|LOCUS_06370 722117 722890 gene locus_tag LOCUS_06380 722117 722890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 723316 722900 gene locus_tag LOCUS_06390 723316 722900 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230457.1 protein_id gnl|my_center|LOCUS_06390 724031 723399 gene locus_tag LOCUS_06400 724031 723399 CDS product DUF3156 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227628.1 protein_id gnl|my_center|LOCUS_06400 724158 724589 gene locus_tag LOCUS_06410 724158 724589 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224922.1 protein_id gnl|my_center|LOCUS_06410 724687 725082 gene locus_tag LOCUS_06420 724687 725082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 725152 725637 gene locus_tag LOCUS_06430 725152 725637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 727717 725609 gene locus_tag LOCUS_06440 727717 725609 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031409.1 protein_id gnl|my_center|LOCUS_06440 728467 727880 gene locus_tag LOCUS_06450 728467 727880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 729361 728708 gene locus_tag LOCUS_06460 729361 728708 CDS product DUF4360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028347.1 protein_id gnl|my_center|LOCUS_06460 729802 730164 gene locus_tag LOCUS_06470 729802 730164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 731028 730198 gene locus_tag LOCUS_06480 731028 730198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 731889 731329 gene locus_tag LOCUS_06490 731889 731329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 732080 732910 gene locus_tag LOCUS_06500 732080 732910 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975294.1 protein_id gnl|my_center|LOCUS_06500 733986 733018 gene locus_tag LOCUS_06510 733986 733018 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029804.1 protein_id gnl|my_center|LOCUS_06510 734086 735081 gene locus_tag LOCUS_06520 gene pvcA 734086 735081 CDS product paerucumarin biosynthesis protein PvcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113733.1 protein_id gnl|my_center|LOCUS_06520 735272 735021 gene locus_tag LOCUS_06530 735272 735021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 735276 735980 gene locus_tag LOCUS_06540 735276 735980 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945936.1 protein_id gnl|my_center|LOCUS_06540 738656 735984 gene locus_tag LOCUS_06550 738656 735984 CDS product SpoIIE family protein phosphatase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009676.1 protein_id gnl|my_center|LOCUS_06550 738847 739164 gene locus_tag LOCUS_06560 738847 739164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 741519 739300 gene locus_tag LOCUS_06570 741519 739300 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031369.1 protein_id gnl|my_center|LOCUS_06570 742642 741689 gene locus_tag LOCUS_06580 gene cbcC 742642 741689 CDS product carbohydrate-binding protein CbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027945.1 protein_id gnl|my_center|LOCUS_06580 743082 742897 gene locus_tag LOCUS_06590 743082 742897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 743453 743830 gene locus_tag LOCUS_06600 743453 743830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 744055 744501 gene locus_tag LOCUS_06610 744055 744501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 745209 744526 gene locus_tag LOCUS_06620 745209 744526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 745910 745575 gene locus_tag LOCUS_06630 745910 745575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06630 746266 746523 gene locus_tag LOCUS_06640 746266 746523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 747110 746622 gene locus_tag LOCUS_06650 747110 746622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06650 747289 748110 gene locus_tag LOCUS_06660 747289 748110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 748760 748041 gene locus_tag LOCUS_06670 748760 748041 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326297.1 protein_id gnl|my_center|LOCUS_06670 748794 749288 gene locus_tag LOCUS_06680 748794 749288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 750382 749333 gene locus_tag LOCUS_06690 750382 749333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 751334 750423 gene locus_tag LOCUS_06700 751334 750423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 752256 751366 gene locus_tag LOCUS_06710 752256 751366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 752472 753353 gene locus_tag LOCUS_06720 752472 753353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 753717 754961 gene locus_tag LOCUS_06730 753717 754961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 755030 755878 gene locus_tag LOCUS_06740 755030 755878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 755884 757146 gene locus_tag LOCUS_06750 755884 757146 CDS product 2-deoxy-scyllo-inosose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986649.1 protein_id gnl|my_center|LOCUS_06750 757139 758134 gene locus_tag LOCUS_06760 757139 758134 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_06760 758131 759045 gene locus_tag LOCUS_06770 758131 759045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 759042 760013 gene locus_tag LOCUS_06780 759042 760013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 760013 760954 gene locus_tag LOCUS_06790 760013 760954 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763496.1 protein_id gnl|my_center|LOCUS_06790 760951 762102 gene locus_tag LOCUS_06800 760951 762102 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222158.1 protein_id gnl|my_center|LOCUS_06800 762119 762895 gene locus_tag LOCUS_06810 762119 762895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 762961 763575 gene locus_tag LOCUS_06820 762961 763575 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_06820 763586 764602 gene locus_tag LOCUS_06830 763586 764602 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 protein_id gnl|my_center|LOCUS_06830 764632 765492 gene locus_tag LOCUS_06840 gene galT 764632 765492 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 protein_id gnl|my_center|LOCUS_06840 766700 765564 gene locus_tag LOCUS_06850 766700 765564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 766753 767337 gene locus_tag LOCUS_06860 gene gmhB 766753 767337 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_06860 767334 768296 gene locus_tag LOCUS_06870 gene galE 767334 768296 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_06870 769275 768331 gene locus_tag LOCUS_06880 769275 768331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 769431 771251 gene locus_tag LOCUS_06890 769431 771251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_06890 771248 773113 gene locus_tag LOCUS_06900 771248 773113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 protein_id gnl|my_center|LOCUS_06900 773147 773650 gene locus_tag LOCUS_06910 773147 773650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 774937 773723 gene locus_tag LOCUS_06920 774937 773723 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070937859.1 protein_id gnl|my_center|LOCUS_06920 775740 774934 gene locus_tag LOCUS_06930 775740 774934 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_06930 776354 775836 gene locus_tag LOCUS_06940 776354 775836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 776513 778057 gene locus_tag LOCUS_06950 776513 778057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030046.1 protein_id gnl|my_center|LOCUS_06950 778178 778660 gene locus_tag LOCUS_06960 778178 778660 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222322.1 protein_id gnl|my_center|LOCUS_06960 778746 781871 gene locus_tag LOCUS_06970 778746 781871 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113040.1 protein_id gnl|my_center|LOCUS_06970 781868 783082 gene locus_tag LOCUS_06980 781868 783082 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222787.1 protein_id gnl|my_center|LOCUS_06980 783133 784329 gene locus_tag LOCUS_06990 783133 784329 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227439.1 protein_id gnl|my_center|LOCUS_06990 785989 784343 gene locus_tag LOCUS_07000 785989 784343 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027264.1 protein_id gnl|my_center|LOCUS_07000 786792 786187 gene locus_tag LOCUS_07010 786792 786187 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226186.1 protein_id gnl|my_center|LOCUS_07010 787819 786695 gene locus_tag LOCUS_07020 787819 786695 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968231.1 protein_id gnl|my_center|LOCUS_07020 789204 788020 gene locus_tag LOCUS_07030 789204 788020 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 protein_id gnl|my_center|LOCUS_07030 790179 789250 gene locus_tag LOCUS_07040 790179 789250 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228152.1 protein_id gnl|my_center|LOCUS_07040 790931 790176 gene locus_tag LOCUS_07050 790931 790176 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228151.1 protein_id gnl|my_center|LOCUS_07050 791692 790928 gene locus_tag LOCUS_07060 791692 790928 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228150.1 protein_id gnl|my_center|LOCUS_07060 792897 791689 gene locus_tag LOCUS_07070 792897 791689 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228149.1 protein_id gnl|my_center|LOCUS_07070 793983 793048 gene locus_tag LOCUS_07080 793983 793048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228148.1 protein_id gnl|my_center|LOCUS_07080 802057 794399 gene locus_tag LOCUS_07090 802057 794399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 803055 802054 gene locus_tag LOCUS_07100 803055 802054 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030242.1 protein_id gnl|my_center|LOCUS_07100 803259 803900 gene locus_tag LOCUS_07110 803259 803900 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227881.1 protein_id gnl|my_center|LOCUS_07110 803929 805011 gene locus_tag LOCUS_07120 803929 805011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 805008 807269 gene locus_tag LOCUS_07130 805008 807269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 807266 808141 gene locus_tag LOCUS_07140 807266 808141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 808225 808947 gene locus_tag LOCUS_07150 808225 808947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 808944 809219 gene locus_tag LOCUS_07160 808944 809219 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228849.1 protein_id gnl|my_center|LOCUS_07160 810136 809474 gene locus_tag LOCUS_07170 810136 809474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 810917 811729 gene locus_tag LOCUS_07180 810917 811729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 811969 814785 gene locus_tag LOCUS_07190 811969 814785 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061075.1 protein_id gnl|my_center|LOCUS_07190 814782 815441 gene locus_tag LOCUS_07200 814782 815441 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_07200 815438 816094 gene locus_tag LOCUS_07210 815438 816094 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095681.1 protein_id gnl|my_center|LOCUS_07210 816176 816976 gene locus_tag LOCUS_07220 816176 816976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 819566 816981 gene locus_tag LOCUS_07230 819566 816981 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455818.1 protein_id gnl|my_center|LOCUS_07230 820214 819600 gene locus_tag LOCUS_07240 820214 819600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 820472 821341 gene locus_tag LOCUS_07250 820472 821341 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978710.1 protein_id gnl|my_center|LOCUS_07250 821606 822463 gene locus_tag LOCUS_07260 821606 822463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 822551 822739 gene locus_tag LOCUS_07270 822551 822739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 822746 823231 gene locus_tag LOCUS_07280 822746 823231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07280 823143 823433 gene locus_tag LOCUS_07290 823143 823433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07290 824197 823598 gene locus_tag LOCUS_07300 824197 823598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 824288 824734 gene locus_tag LOCUS_07310 824288 824734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 825519 824902 gene locus_tag LOCUS_07320 825519 824902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07320 825911 825687 gene locus_tag LOCUS_07330 825911 825687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 826015 826548 gene locus_tag LOCUS_07340 826015 826548 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895382.1 protein_id gnl|my_center|LOCUS_07340 826545 829247 gene locus_tag LOCUS_07350 826545 829247 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227290.1 protein_id gnl|my_center|LOCUS_07350 829494 830147 gene locus_tag LOCUS_07360 829494 830147 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_07360 830258 830779 gene locus_tag LOCUS_07370 830258 830779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225541.1 protein_id gnl|my_center|LOCUS_07370 831192 832370 gene locus_tag LOCUS_07380 831192 832370 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_07380 832367 832822 gene locus_tag LOCUS_07390 832367 832822 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862045.1 protein_id gnl|my_center|LOCUS_07390 832819 833622 gene locus_tag LOCUS_07400 832819 833622 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_07400 833624 834445 gene locus_tag LOCUS_07410 833624 834445 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_07410 834442 835782 gene locus_tag LOCUS_07420 834442 835782 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_07420 835879 836163 gene locus_tag LOCUS_07430 835879 836163 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272729.1 protein_id gnl|my_center|LOCUS_07430 837226 836201 gene locus_tag LOCUS_07440 837226 836201 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976697.1 protein_id gnl|my_center|LOCUS_07440 837562 839931 gene locus_tag LOCUS_07450 gene ppsA 837562 839931 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838605.1 protein_id gnl|my_center|LOCUS_07450 839935 840624 gene locus_tag LOCUS_07460 839935 840624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 840678 841367 gene locus_tag LOCUS_07470 840678 841367 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_07470 841360 842010 gene locus_tag LOCUS_07480 841360 842010 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030862048.1 protein_id gnl|my_center|LOCUS_07480 842149 842847 gene locus_tag LOCUS_07490 842149 842847 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978717.1 protein_id gnl|my_center|LOCUS_07490 845261 842853 gene locus_tag LOCUS_07500 845261 842853 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027248.1 protein_id gnl|my_center|LOCUS_07500 846275 845397 gene locus_tag LOCUS_07510 846275 845397 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866806.1 protein_id gnl|my_center|LOCUS_07510 847343 846402 gene locus_tag LOCUS_07520 847343 846402 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026893.1 protein_id gnl|my_center|LOCUS_07520 847484 848164 gene locus_tag LOCUS_07530 847484 848164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 848434 848360 gene locus_tag LOCUS_t00030 848434 848360 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 848782 852072 gene locus_tag LOCUS_07540 848782 852072 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441479.1 protein_id gnl|my_center|LOCUS_07540 853087 852167 gene locus_tag LOCUS_07550 853087 852167 CDS product chitosanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228755.1 protein_id gnl|my_center|LOCUS_07550 854416 853214 gene locus_tag LOCUS_07560 854416 853214 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_07560 855112 854465 gene locus_tag LOCUS_07570 855112 854465 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027536.1 protein_id gnl|my_center|LOCUS_07570 855229 855789 gene locus_tag LOCUS_07580 855229 855789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 856657 855809 gene locus_tag LOCUS_07590 856657 855809 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485738.1 protein_id gnl|my_center|LOCUS_07590 856956 856714 gene locus_tag LOCUS_07600 856956 856714 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976841.1 protein_id gnl|my_center|LOCUS_07600 857826 856960 gene locus_tag LOCUS_07610 857826 856960 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976840.1 protein_id gnl|my_center|LOCUS_07610 857963 858442 gene locus_tag LOCUS_07620 857963 858442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 859266 858475 gene locus_tag LOCUS_07630 859266 858475 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972223.1 protein_id gnl|my_center|LOCUS_07630 859407 860198 gene locus_tag LOCUS_07640 859407 860198 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972225.1 protein_id gnl|my_center|LOCUS_07640 861676 860282 gene locus_tag LOCUS_07650 861676 860282 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031169.1 protein_id gnl|my_center|LOCUS_07650 863604 861673 gene locus_tag LOCUS_07660 gene dxs 863604 861673 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031168.1 protein_id gnl|my_center|LOCUS_07660 864838 863672 gene locus_tag LOCUS_07670 gene ispG 864838 863672 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031167.1 protein_id gnl|my_center|LOCUS_07670 865866 864844 gene locus_tag LOCUS_07680 gene hpnH 865866 864844 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972231.1 protein_id gnl|my_center|LOCUS_07680 866528 865872 gene locus_tag LOCUS_07690 866528 865872 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972232.1 protein_id gnl|my_center|LOCUS_07690 868546 866528 gene locus_tag LOCUS_07700 gene shc 868546 866528 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031166.1 protein_id gnl|my_center|LOCUS_07700 869745 868681 gene locus_tag LOCUS_07710 869745 868681 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107420324.1 protein_id gnl|my_center|LOCUS_07710 871280 869820 gene locus_tag LOCUS_07720 gene hpnE 871280 869820 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031164.1 protein_id gnl|my_center|LOCUS_07720 872364 871414 gene locus_tag LOCUS_07730 gene hpnD 872364 871414 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483877.1 protein_id gnl|my_center|LOCUS_07730 873260 872361 gene locus_tag LOCUS_07740 gene hpnC 873260 872361 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031161.1 protein_id gnl|my_center|LOCUS_07740 874451 873663 gene locus_tag LOCUS_07750 874451 873663 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972238.1 protein_id gnl|my_center|LOCUS_07750 875379 874444 gene locus_tag LOCUS_07760 875379 874444 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972239.1 protein_id gnl|my_center|LOCUS_07760 876352 875471 gene locus_tag LOCUS_07770 876352 875471 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031159.1 protein_id gnl|my_center|LOCUS_07770 877143 876364 gene locus_tag LOCUS_07780 877143 876364 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270333.1 protein_id gnl|my_center|LOCUS_07780 878182 877121 gene locus_tag LOCUS_07790 878182 877121 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972242.1 protein_id gnl|my_center|LOCUS_07790 878922 878170 gene locus_tag LOCUS_07800 878922 878170 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031156.1 protein_id gnl|my_center|LOCUS_07800 880799 878919 gene locus_tag LOCUS_07810 880799 878919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 881160 882146 gene locus_tag LOCUS_07820 gene galE 881160 882146 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_07820 882241 883188 gene locus_tag LOCUS_07830 882241 883188 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_07830 883279 883890 gene locus_tag LOCUS_07840 gene idi 883279 883890 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 protein_id gnl|my_center|LOCUS_07840 884371 883865 gene locus_tag LOCUS_07850 884371 883865 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327856.1 protein_id gnl|my_center|LOCUS_07850 884569 885321 gene locus_tag LOCUS_07860 884569 885321 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972249.1 protein_id gnl|my_center|LOCUS_07860 886106 885477 gene locus_tag LOCUS_07870 886106 885477 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_07870 887141 886152 gene locus_tag LOCUS_07880 887141 886152 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_07880 887258 888124 gene locus_tag LOCUS_07890 887258 888124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972252.1 protein_id gnl|my_center|LOCUS_07890 888160 890589 gene locus_tag LOCUS_07900 888160 890589 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031148.1 protein_id gnl|my_center|LOCUS_07900 891424 890600 gene locus_tag LOCUS_07910 891424 890600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 892341 891421 gene locus_tag LOCUS_07920 892341 891421 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975592.1 protein_id gnl|my_center|LOCUS_07920 892474 893652 gene locus_tag LOCUS_07930 892474 893652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 893649 894311 gene locus_tag LOCUS_07940 893649 894311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227310.1 protein_id gnl|my_center|LOCUS_07940 894483 896081 gene locus_tag LOCUS_07950 gene fadD8 894483 896081 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191317023.1 protein_id gnl|my_center|LOCUS_07950 897382 896066 gene locus_tag LOCUS_07960 897382 896066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 898426 897473 gene locus_tag LOCUS_07970 898426 897473 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015276.1 protein_id gnl|my_center|LOCUS_07970 899456 898446 gene locus_tag LOCUS_07980 899456 898446 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_07980 899632 900324 gene locus_tag LOCUS_07990 899632 900324 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998217.1 protein_id gnl|my_center|LOCUS_07990 900400 902037 gene locus_tag LOCUS_08000 900400 902037 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972254.1 protein_id gnl|my_center|LOCUS_08000 902364 906530 gene locus_tag LOCUS_08010 902364 906530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 906527 907933 gene locus_tag LOCUS_08020 906527 907933 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227789.1 protein_id gnl|my_center|LOCUS_08020 907994 908374 gene locus_tag LOCUS_08030 907994 908374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 908459 909196 gene locus_tag LOCUS_08040 908459 909196 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877685.1 protein_id gnl|my_center|LOCUS_08040 909266 910705 gene locus_tag LOCUS_08050 909266 910705 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811314.1 protein_id gnl|my_center|LOCUS_08050 910726 911919 gene locus_tag LOCUS_08060 910726 911919 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228149.1 protein_id gnl|my_center|LOCUS_08060 911935 913113 gene locus_tag LOCUS_08070 911935 913113 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 protein_id gnl|my_center|LOCUS_08070 913110 914177 gene locus_tag LOCUS_08080 913110 914177 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_08080 914294 915511 gene locus_tag LOCUS_08090 914294 915511 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_08090 915508 916650 gene locus_tag LOCUS_08100 915508 916650 CDS product long-chain specific acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031182.1 protein_id gnl|my_center|LOCUS_08100 916699 917913 gene locus_tag LOCUS_08110 916699 917913 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031140.1 protein_id gnl|my_center|LOCUS_08110 918098 920266 gene locus_tag LOCUS_08120 918098 920266 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031141.1 protein_id gnl|my_center|LOCUS_08120 921028 920303 gene locus_tag LOCUS_08130 921028 920303 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031142.1 protein_id gnl|my_center|LOCUS_08130 922728 921184 gene locus_tag LOCUS_08140 922728 921184 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_08140 922897 924888 gene locus_tag LOCUS_08150 922897 924888 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189868312.1 protein_id gnl|my_center|LOCUS_08150 925011 926558 gene locus_tag LOCUS_08160 925011 926558 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_08160 927462 926569 gene locus_tag LOCUS_08170 927462 926569 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109726.1 protein_id gnl|my_center|LOCUS_08170 928262 927462 gene locus_tag LOCUS_08180 928262 927462 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082932.1 protein_id gnl|my_center|LOCUS_08180 928370 928942 gene locus_tag LOCUS_08190 928370 928942 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185798.1 protein_id gnl|my_center|LOCUS_08190 930005 929067 gene locus_tag LOCUS_08200 930005 929067 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_08200 930125 930331 gene locus_tag LOCUS_08210 930125 930331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028395.1 protein_id gnl|my_center|LOCUS_08210 930328 930519 gene locus_tag LOCUS_08220 930328 930519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 930634 932688 gene locus_tag LOCUS_08230 930634 932688 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_08230 933394 932696 gene locus_tag LOCUS_08240 933394 932696 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031135.1 protein_id gnl|my_center|LOCUS_08240 933475 933774 gene locus_tag LOCUS_08250 933475 933774 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972271.1 protein_id gnl|my_center|LOCUS_08250 935032 933935 gene locus_tag LOCUS_08260 935032 933935 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_08260 935135 935965 gene locus_tag LOCUS_08270 935135 935965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 936181 936588 gene locus_tag LOCUS_08280 936181 936588 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972274.1 protein_id gnl|my_center|LOCUS_08280 938181 936619 gene locus_tag LOCUS_08290 938181 936619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027315.1 protein_id gnl|my_center|LOCUS_08290 938783 938247 gene locus_tag LOCUS_08300 938783 938247 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_08300 939077 939589 gene locus_tag LOCUS_08310 939077 939589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 940531 939602 gene locus_tag LOCUS_08320 940531 939602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08320 940923 942446 gene locus_tag LOCUS_08330 940923 942446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 942446 945775 gene locus_tag LOCUS_08340 942446 945775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 945772 946968 gene locus_tag LOCUS_08350 945772 946968 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_08350 948611 947025 gene locus_tag LOCUS_08360 948611 947025 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223342.1 protein_id gnl|my_center|LOCUS_08360 950200 948752 gene locus_tag LOCUS_08370 950200 948752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014309.1 protein_id gnl|my_center|LOCUS_08370 950491 951945 gene locus_tag LOCUS_08380 950491 951945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 951957 952280 gene locus_tag LOCUS_08390 951957 952280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 953654 952332 gene locus_tag LOCUS_08400 953654 952332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 954550 953663 gene locus_tag LOCUS_08410 954550 953663 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_08410 955233 954544 gene locus_tag LOCUS_08420 955233 954544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 955396 955241 gene locus_tag LOCUS_08430 955396 955241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 957078 955474 gene locus_tag LOCUS_08440 957078 955474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 959444 957075 gene locus_tag LOCUS_08450 959444 957075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 960784 959441 gene locus_tag LOCUS_08460 960784 959441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 963068 960786 gene locus_tag LOCUS_08470 963068 960786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 964802 963180 gene locus_tag LOCUS_08480 964802 963180 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225605.1 protein_id gnl|my_center|LOCUS_08480 967241 964875 gene locus_tag LOCUS_08490 967241 964875 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030980.1 protein_id gnl|my_center|LOCUS_08490 968119 967301 gene locus_tag LOCUS_08500 968119 967301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 968292 968207 gene locus_tag LOCUS_t00040 968292 968207 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 968399 969760 gene locus_tag LOCUS_08510 968399 969760 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031025.1 protein_id gnl|my_center|LOCUS_08510 969834 970655 gene locus_tag LOCUS_08520 gene fdhD 969834 970655 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_08520 973229 970728 gene locus_tag LOCUS_08530 973229 970728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 973913 973410 gene locus_tag LOCUS_08540 973913 973410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 974059 974991 gene locus_tag LOCUS_08550 974059 974991 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486386.1 protein_id gnl|my_center|LOCUS_08550 975270 977189 gene locus_tag LOCUS_08560 975270 977189 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031005.1 protein_id gnl|my_center|LOCUS_08560 978215 977199 gene locus_tag LOCUS_08570 978215 977199 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972424.1 protein_id gnl|my_center|LOCUS_08570 978305 979216 gene locus_tag LOCUS_08580 978305 979216 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972425.1 protein_id gnl|my_center|LOCUS_08580 979383 981209 gene locus_tag LOCUS_08590 979383 981209 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972428.1 protein_id gnl|my_center|LOCUS_08590 981331 982173 gene locus_tag LOCUS_08600 981331 982173 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031003.1 protein_id gnl|my_center|LOCUS_08600 982524 982219 gene locus_tag LOCUS_08610 982524 982219 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972439.1 protein_id gnl|my_center|LOCUS_08610 982716 984497 gene locus_tag LOCUS_08620 982716 984497 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_08620 987102 984709 gene locus_tag LOCUS_08630 987102 984709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 987266 987847 gene locus_tag LOCUS_08640 987266 987847 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_08640 987969 988730 gene locus_tag LOCUS_08650 987969 988730 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976314.1 protein_id gnl|my_center|LOCUS_08650 990203 988818 gene locus_tag LOCUS_08660 990203 988818 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030990.1 protein_id gnl|my_center|LOCUS_08660 990782 990480 gene locus_tag LOCUS_08670 990782 990480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 991015 992442 gene locus_tag LOCUS_08680 991015 992442 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110423.1 protein_id gnl|my_center|LOCUS_08680 992513 994390 gene locus_tag LOCUS_08690 992513 994390 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_08690 995013 994603 gene locus_tag LOCUS_08700 995013 994603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 995103 995729 gene locus_tag LOCUS_08710 995103 995729 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_08710 995853 996314 gene locus_tag LOCUS_08720 995853 996314 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026937.1 protein_id gnl|my_center|LOCUS_08720 996521 997786 gene locus_tag LOCUS_08730 996521 997786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 998869 997808 gene locus_tag LOCUS_08740 998869 997808 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030985.1 protein_id gnl|my_center|LOCUS_08740 1000153 998954 gene locus_tag LOCUS_08750 1000153 998954 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485736.1 protein_id gnl|my_center|LOCUS_08750 1000310 1001143 gene locus_tag LOCUS_08760 1000310 1001143 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030973.1 protein_id gnl|my_center|LOCUS_08760 1001154 1001504 gene locus_tag LOCUS_08770 1001154 1001504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972485.1 protein_id gnl|my_center|LOCUS_08770 1002572 1001898 gene locus_tag LOCUS_08780 1002572 1001898 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112245808.1 protein_id gnl|my_center|LOCUS_08780 1005115 1002569 gene locus_tag LOCUS_08790 1005115 1002569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08790 1005342 1005112 gene locus_tag LOCUS_08800 1005342 1005112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08800 1005980 1005348 gene locus_tag LOCUS_08810 1005980 1005348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08810 1007688 1006018 gene locus_tag LOCUS_08820 1007688 1006018 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243083.1 protein_id gnl|my_center|LOCUS_08820 1008899 1007685 gene locus_tag LOCUS_08830 gene dhbC 1008899 1007685 CDS product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 protein_id gnl|my_center|LOCUS_08830 1009802 1009008 gene locus_tag LOCUS_08840 1009802 1009008 CDS product 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244476.1 protein_id gnl|my_center|LOCUS_08840 1009964 1010770 gene locus_tag LOCUS_08850 1009964 1010770 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_08850 1012807 1010810 gene locus_tag LOCUS_08860 1012807 1010810 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972490.1 protein_id gnl|my_center|LOCUS_08860 1014305 1012875 gene locus_tag LOCUS_08870 1014305 1012875 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030958.1 protein_id gnl|my_center|LOCUS_08870 1014513 1014295 gene locus_tag LOCUS_08880 1014513 1014295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1015363 1014620 gene locus_tag LOCUS_08890 1015363 1014620 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030956.1 protein_id gnl|my_center|LOCUS_08890 1017699 1015360 gene locus_tag LOCUS_08900 1017699 1015360 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485626.1 protein_id gnl|my_center|LOCUS_08900 1020105 1017847 gene locus_tag LOCUS_08910 1020105 1017847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668834.1 protein_id gnl|my_center|LOCUS_08910 1019999 1020244 gene locus_tag LOCUS_08920 1019999 1020244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1020910 1020452 gene locus_tag LOCUS_08930 1020910 1020452 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972496.1 protein_id gnl|my_center|LOCUS_08930 1021062 1021481 gene locus_tag LOCUS_08940 1021062 1021481 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030950.1 protein_id gnl|my_center|LOCUS_08940 1022086 1021451 gene locus_tag LOCUS_08950 1022086 1021451 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030949.1 protein_id gnl|my_center|LOCUS_08950 1022481 1024235 gene locus_tag LOCUS_08960 1022481 1024235 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030948.1 protein_id gnl|my_center|LOCUS_08960 1024336 1025196 gene locus_tag LOCUS_08970 1024336 1025196 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972504.1 protein_id gnl|my_center|LOCUS_08970 1025422 1025252 gene locus_tag LOCUS_08980 1025422 1025252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1025570 1026907 gene locus_tag LOCUS_08990 gene ccrA 1025570 1026907 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283587.1 protein_id gnl|my_center|LOCUS_08990 1026959 1028938 gene locus_tag LOCUS_09000 1026959 1028938 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030947.1 protein_id gnl|my_center|LOCUS_09000 1028935 1029906 gene locus_tag LOCUS_09010 1028935 1029906 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030946.1 protein_id gnl|my_center|LOCUS_09010 1029910 1030422 gene locus_tag LOCUS_09020 1029910 1030422 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_09020 1030424 1031629 gene locus_tag LOCUS_09030 1030424 1031629 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_09030 1031831 1032487 gene locus_tag LOCUS_09040 1031831 1032487 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972510.1 protein_id gnl|my_center|LOCUS_09040 1032474 1033334 gene locus_tag LOCUS_09050 gene pssA 1032474 1033334 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_09050 1034617 1033496 gene locus_tag LOCUS_09060 1034617 1033496 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093457344.1 protein_id gnl|my_center|LOCUS_09060 1035704 1034685 gene locus_tag LOCUS_09070 1035704 1034685 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_09070 1036791 1035751 gene locus_tag LOCUS_09080 1036791 1035751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1037742 1037008 gene locus_tag LOCUS_09090 1037742 1037008 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_09090 1037998 1039680 gene locus_tag LOCUS_09100 1037998 1039680 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 protein_id gnl|my_center|LOCUS_09100 1039774 1040493 gene locus_tag LOCUS_09110 1039774 1040493 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030941.1 protein_id gnl|my_center|LOCUS_09110 1041103 1040591 gene locus_tag LOCUS_09120 1041103 1040591 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030939.1 protein_id gnl|my_center|LOCUS_09120 1042610 1041129 gene locus_tag LOCUS_09130 1042610 1041129 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_09130 1042736 1042969 gene locus_tag LOCUS_09140 1042736 1042969 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895203.1 protein_id gnl|my_center|LOCUS_09140 1042976 1043581 gene locus_tag LOCUS_09150 1042976 1043581 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094669.1 protein_id gnl|my_center|LOCUS_09150 1043666 1044256 gene locus_tag LOCUS_09160 1043666 1044256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1044258 1045781 gene locus_tag LOCUS_09170 1044258 1045781 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243007.1 protein_id gnl|my_center|LOCUS_09170 1045768 1046589 gene locus_tag LOCUS_09180 1045768 1046589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1048052 1046637 gene locus_tag LOCUS_09190 1048052 1046637 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972529.1 protein_id gnl|my_center|LOCUS_09190 1048926 1048078 gene locus_tag LOCUS_09200 1048926 1048078 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972533.1 protein_id gnl|my_center|LOCUS_09200 1050809 1049004 gene locus_tag LOCUS_09210 1050809 1049004 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327729.1 protein_id gnl|my_center|LOCUS_09210 1050882 1051967 gene locus_tag LOCUS_09220 1050882 1051967 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327718.1 protein_id gnl|my_center|LOCUS_09220 1053560 1052010 gene locus_tag LOCUS_09230 1053560 1052010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1054737 1053736 gene locus_tag LOCUS_09240 1054737 1053736 CDS product TIGR03842 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030901.1 protein_id gnl|my_center|LOCUS_09240 1056159 1054759 gene locus_tag LOCUS_09250 gene hydA 1056159 1054759 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_09250 1057472 1056156 gene locus_tag LOCUS_09260 1057472 1056156 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222142.1 protein_id gnl|my_center|LOCUS_09260 1058251 1057469 gene locus_tag LOCUS_09270 1058251 1057469 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972568.1 protein_id gnl|my_center|LOCUS_09270 1058135 1058488 gene locus_tag LOCUS_09280 1058135 1058488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1058485 1059048 gene locus_tag LOCUS_09290 1058485 1059048 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228982.1 protein_id gnl|my_center|LOCUS_09290 1060125 1059070 gene locus_tag LOCUS_09300 1060125 1059070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1062081 1060222 gene locus_tag LOCUS_09310 gene ggt 1062081 1060222 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030896.1 protein_id gnl|my_center|LOCUS_09310 1063336 1062440 gene locus_tag LOCUS_09320 1063336 1062440 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_09320 1064901 1063435 gene locus_tag LOCUS_09330 1064901 1063435 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031825.1 protein_id gnl|my_center|LOCUS_09330 1065704 1064904 gene locus_tag LOCUS_09340 1065704 1064904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 1066642 1065701 gene locus_tag LOCUS_09350 1066642 1065701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031823.1 protein_id gnl|my_center|LOCUS_09350 1068186 1066639 gene locus_tag LOCUS_09360 1068186 1066639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030775978.1 protein_id gnl|my_center|LOCUS_09360 1068545 1069576 gene locus_tag LOCUS_09370 1068545 1069576 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 protein_id gnl|my_center|LOCUS_09370 1069610 1070632 gene locus_tag LOCUS_09380 1069610 1070632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1070644 1072011 gene locus_tag LOCUS_09390 1070644 1072011 CDS product Y4yA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002161.1 protein_id gnl|my_center|LOCUS_09390 1071454 1071376 gene locus_tag LOCUS_t00050 1071454 1071376 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1072057 1073121 gene locus_tag LOCUS_09400 1072057 1073121 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066877081.1 protein_id gnl|my_center|LOCUS_09400 1073121 1074548 gene locus_tag LOCUS_09410 1073121 1074548 CDS product NorM family multidrug efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114349.1 protein_id gnl|my_center|LOCUS_09410 1075563 1074604 gene locus_tag LOCUS_09420 1075563 1074604 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_09420 1075673 1076302 gene locus_tag LOCUS_09430 1075673 1076302 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_09430 1076299 1077228 gene locus_tag LOCUS_09440 1076299 1077228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1077965 1077384 gene locus_tag LOCUS_09450 1077965 1077384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1078206 1079432 gene locus_tag LOCUS_09460 1078206 1079432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1080801 1079569 gene locus_tag LOCUS_09470 1080801 1079569 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226635.1 protein_id gnl|my_center|LOCUS_09470 1081803 1080835 gene locus_tag LOCUS_09480 gene cysK 1081803 1080835 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_09480 1082461 1081853 gene locus_tag LOCUS_09490 1082461 1081853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1083837 1082467 gene locus_tag LOCUS_09500 1083837 1082467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226215.1 protein_id gnl|my_center|LOCUS_09500 1084257 1085138 gene locus_tag LOCUS_09510 1084257 1085138 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226150.1 protein_id gnl|my_center|LOCUS_09510 1085135 1085923 gene locus_tag LOCUS_09520 1085135 1085923 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_09520 1086000 1086965 gene locus_tag LOCUS_09530 gene cysK 1086000 1086965 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393469.1 protein_id gnl|my_center|LOCUS_09530 1087056 1088879 gene locus_tag LOCUS_09540 gene asnB 1087056 1088879 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_09540 1088876 1089931 gene locus_tag LOCUS_09550 1088876 1089931 CDS product PrpF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040164.1 protein_id gnl|my_center|LOCUS_09550 1089901 1091031 gene locus_tag LOCUS_09560 1089901 1091031 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_09560 1091019 1092440 gene locus_tag LOCUS_09570 1091019 1092440 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097095.1 protein_id gnl|my_center|LOCUS_09570 1092446 1093657 gene locus_tag LOCUS_09580 1092446 1093657 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896017.1 protein_id gnl|my_center|LOCUS_09580 1093677 1094285 gene locus_tag LOCUS_09590 1093677 1094285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1094346 1094636 gene locus_tag LOCUS_09600 1094346 1094636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1094748 1095209 gene locus_tag LOCUS_09610 gene nsrR 1094748 1095209 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031657.1 protein_id gnl|my_center|LOCUS_09610 1095595 1095236 gene locus_tag LOCUS_09620 1095595 1095236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1095569 1096522 gene locus_tag LOCUS_09630 1095569 1096522 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971715.1 protein_id gnl|my_center|LOCUS_09630 1097412 1096534 gene locus_tag LOCUS_09640 1097412 1096534 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224233.1 protein_id gnl|my_center|LOCUS_09640 1098053 1097409 gene locus_tag LOCUS_09650 1098053 1097409 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224234.1 protein_id gnl|my_center|LOCUS_09650 1098988 1098071 gene locus_tag LOCUS_09660 1098988 1098071 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224235.1 protein_id gnl|my_center|LOCUS_09660 1099771 1099004 gene locus_tag LOCUS_09670 1099771 1099004 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_09670 1100004 1100819 gene locus_tag LOCUS_09680 1100004 1100819 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_09680 1101337 1100897 gene locus_tag LOCUS_09690 1101337 1100897 CDS product DUF6278 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972582.1 protein_id gnl|my_center|LOCUS_09690 1101503 1103548 gene locus_tag LOCUS_09700 1101503 1103548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1101773 1101676 gene locus_tag LOCUS_t00060 1101773 1101676 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1104411 1103632 gene locus_tag LOCUS_09710 1104411 1103632 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030841.1 protein_id gnl|my_center|LOCUS_09710 1105148 1104492 gene locus_tag LOCUS_09720 1105148 1104492 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972584.1 protein_id gnl|my_center|LOCUS_09720 1107288 1105195 gene locus_tag LOCUS_09730 1107288 1105195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1105930 1105839 gene locus_tag LOCUS_t00070 1105930 1105839 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1107616 1107278 gene locus_tag LOCUS_09740 1107616 1107278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1108247 1107981 gene locus_tag LOCUS_09750 1108247 1107981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1108401 1109552 gene locus_tag LOCUS_09760 1108401 1109552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1109594 1110718 gene locus_tag LOCUS_09770 1109594 1110718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1110694 1111986 gene locus_tag LOCUS_09780 1110694 1111986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1111904 1112965 gene locus_tag LOCUS_09790 1111904 1112965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1112966 1114189 gene locus_tag LOCUS_09800 1112966 1114189 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539126.1 protein_id gnl|my_center|LOCUS_09800 1114517 1114798 gene locus_tag LOCUS_09810 1114517 1114798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 1115763 1115098 gene locus_tag LOCUS_09820 1115763 1115098 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224249.1 protein_id gnl|my_center|LOCUS_09820 1115854 1117269 gene locus_tag LOCUS_09830 1115854 1117269 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_09830 1117266 1117661 gene locus_tag LOCUS_09840 1117266 1117661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1118548 1118042 gene locus_tag LOCUS_09850 1118548 1118042 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_09850 1118699 1119205 gene locus_tag LOCUS_09860 1118699 1119205 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972016.1 protein_id gnl|my_center|LOCUS_09860 1119387 1120016 gene locus_tag LOCUS_09870 1119387 1120016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222220.1 protein_id gnl|my_center|LOCUS_09870 1120444 1120190 gene locus_tag LOCUS_09880 1120444 1120190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1121057 1120497 gene locus_tag LOCUS_09890 1121057 1120497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972665.1 protein_id gnl|my_center|LOCUS_09890 1122184 1121063 gene locus_tag LOCUS_09900 1122184 1121063 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_09900 1123263 1122388 gene locus_tag LOCUS_09910 1123263 1122388 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030774.1 protein_id gnl|my_center|LOCUS_09910 1124300 1123260 gene locus_tag LOCUS_09920 1124300 1123260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972668.1 protein_id gnl|my_center|LOCUS_09920 1125277 1124297 gene locus_tag LOCUS_09930 1125277 1124297 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030773.1 protein_id gnl|my_center|LOCUS_09930 1126261 1125512 gene locus_tag LOCUS_09940 1126261 1125512 CDS product myo-inositol degradation transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030772.1 protein_id gnl|my_center|LOCUS_09940 1127582 1126371 gene locus_tag LOCUS_09950 1127582 1126371 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_09950 1128324 1127728 gene locus_tag LOCUS_09960 1128324 1127728 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027533.1 protein_id gnl|my_center|LOCUS_09960 1128920 1128339 gene locus_tag LOCUS_09970 1128920 1128339 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228192.1 protein_id gnl|my_center|LOCUS_09970 1129475 1129035 gene locus_tag LOCUS_09980 1129475 1129035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1129634 1130287 gene locus_tag LOCUS_09990 1129634 1130287 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031170.1 protein_id gnl|my_center|LOCUS_09990 1130284 1130433 gene locus_tag LOCUS_10000 1130284 1130433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1130453 1131118 gene locus_tag LOCUS_10010 1130453 1131118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229430.1 protein_id gnl|my_center|LOCUS_10010 1131112 1131633 gene locus_tag LOCUS_10020 gene sat4 1131112 1131633 CDS product streptothricin N-acetyltransferase Sat4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627290.1 protein_id gnl|my_center|LOCUS_10020 1132745 1131573 gene locus_tag LOCUS_10030 gene alc 1132745 1131573 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030765.1 protein_id gnl|my_center|LOCUS_10030 1134076 1132745 gene locus_tag LOCUS_10040 gene allB 1134076 1132745 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_10040 1134271 1135044 gene locus_tag LOCUS_10050 gene allR 1134271 1135044 CDS product allantoin degradation transcriptional regulator AllR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972681.1 protein_id gnl|my_center|LOCUS_10050 1135511 1135149 gene locus_tag LOCUS_10060 1135511 1135149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1135679 1136284 gene locus_tag LOCUS_10070 1135679 1136284 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030764.1 protein_id gnl|my_center|LOCUS_10070 1136386 1137984 gene locus_tag LOCUS_10080 gene aceB 1136386 1137984 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030763.1 protein_id gnl|my_center|LOCUS_10080 1139576 1138053 gene locus_tag LOCUS_10090 1139576 1138053 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095368.1 protein_id gnl|my_center|LOCUS_10090 1141082 1139658 gene locus_tag LOCUS_10100 1141082 1139658 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972712.1 protein_id gnl|my_center|LOCUS_10100 1142633 1141230 gene locus_tag LOCUS_10110 1142633 1141230 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030742.1 protein_id gnl|my_center|LOCUS_10110 1143584 1142691 gene locus_tag LOCUS_10120 gene pucL 1143584 1142691 CDS product urate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972716.1 protein_id gnl|my_center|LOCUS_10120 1143938 1143588 gene locus_tag LOCUS_10130 gene uraH 1143938 1143588 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030741.1 protein_id gnl|my_center|LOCUS_10130 1144465 1143935 gene locus_tag LOCUS_10140 gene uraD 1144465 1143935 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_10140 1144923 1144537 gene locus_tag LOCUS_10150 1144923 1144537 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972719.1 protein_id gnl|my_center|LOCUS_10150 1145168 1144920 gene locus_tag LOCUS_10160 1145168 1144920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063646595.1 protein_id gnl|my_center|LOCUS_10160 1145271 1146065 gene locus_tag LOCUS_10170 1145271 1146065 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972721.1 protein_id gnl|my_center|LOCUS_10170 1146235 1147125 gene locus_tag LOCUS_10180 1146235 1147125 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972722.1 protein_id gnl|my_center|LOCUS_10180 1147137 1148924 gene locus_tag LOCUS_10190 gene gcl 1147137 1148924 CDS product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125316584.1 protein_id gnl|my_center|LOCUS_10190 1149082 1149846 gene locus_tag LOCUS_10200 1149082 1149846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030736.1 protein_id gnl|my_center|LOCUS_10200 1151734 1150088 gene locus_tag LOCUS_10210 gene lbuL 1151734 1150088 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_10210 1153461 1151731 gene locus_tag LOCUS_10220 gene ibuL 1153461 1151731 CDS product isobutyrate:CoA ligase IbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030731.1 protein_id gnl|my_center|LOCUS_10220 1153959 1154366 gene locus_tag LOCUS_10230 1153959 1154366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1154483 1155859 gene locus_tag LOCUS_10240 gene lysA 1154483 1155859 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230687.1 protein_id gnl|my_center|LOCUS_10240 1156381 1155893 gene locus_tag LOCUS_10250 1156381 1155893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1156460 1157080 gene locus_tag LOCUS_10260 1156460 1157080 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729576.1 protein_id gnl|my_center|LOCUS_10260 1157115 1157282 gene locus_tag LOCUS_10270 1157115 1157282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1157373 1157600 gene locus_tag LOCUS_10280 1157373 1157600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1158007 1159590 gene locus_tag LOCUS_10290 1158007 1159590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1159614 1160192 gene locus_tag LOCUS_10300 1159614 1160192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1160228 1160899 gene locus_tag LOCUS_10310 1160228 1160899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1161023 1162126 gene locus_tag LOCUS_10320 1161023 1162126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1162320 1166678 gene locus_tag LOCUS_10330 1162320 1166678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1166712 1167347 gene locus_tag LOCUS_10340 1166712 1167347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1168026 1167412 gene locus_tag LOCUS_10350 1168026 1167412 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_10350 1168866 1168075 gene locus_tag LOCUS_10360 gene trpC 1168866 1168075 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087578.1 protein_id gnl|my_center|LOCUS_10360 1169932 1168871 gene locus_tag LOCUS_10370 gene trpD 1169932 1168871 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087577.1 protein_id gnl|my_center|LOCUS_10370 1172063 1169922 gene locus_tag LOCUS_10380 1172063 1169922 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 protein_id gnl|my_center|LOCUS_10380 1172915 1172202 gene locus_tag LOCUS_10390 1172915 1172202 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_10390 1173676 1172912 gene locus_tag LOCUS_10400 1173676 1172912 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397506.1 protein_id gnl|my_center|LOCUS_10400 1174393 1173803 gene locus_tag LOCUS_10410 gene pdxH 1174393 1173803 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392632.1 protein_id gnl|my_center|LOCUS_10410 1175708 1174440 gene locus_tag LOCUS_10420 1175708 1174440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1176630 1175980 gene locus_tag LOCUS_10430 1176630 1175980 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886771.1 protein_id gnl|my_center|LOCUS_10430 1177531 1176728 gene locus_tag LOCUS_10440 1177531 1176728 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226786.1 protein_id gnl|my_center|LOCUS_10440 1180326 1177576 gene locus_tag LOCUS_10450 gene mgtA 1180326 1177576 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112338.1 protein_id gnl|my_center|LOCUS_10450 1181558 1180884 gene locus_tag LOCUS_10460 1181558 1180884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1181982 1182650 gene locus_tag LOCUS_10470 1181982 1182650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1182676 1183245 gene locus_tag LOCUS_10480 1182676 1183245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1184396 1183269 gene locus_tag LOCUS_10490 1184396 1183269 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030710.1 protein_id gnl|my_center|LOCUS_10490 1185868 1184408 gene locus_tag LOCUS_10500 1185868 1184408 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030709.1 protein_id gnl|my_center|LOCUS_10500 1188437 1186059 gene locus_tag LOCUS_10510 1188437 1186059 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030708.1 protein_id gnl|my_center|LOCUS_10510 1188921 1188442 gene locus_tag LOCUS_10520 1188921 1188442 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226423.1 protein_id gnl|my_center|LOCUS_10520 1189799 1188912 gene locus_tag LOCUS_10530 1189799 1188912 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030706.1 protein_id gnl|my_center|LOCUS_10530 1190030 1191712 gene locus_tag LOCUS_10540 1190030 1191712 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030705.1 protein_id gnl|my_center|LOCUS_10540 1191846 1192721 gene locus_tag LOCUS_10550 1191846 1192721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972756.1 protein_id gnl|my_center|LOCUS_10550 1194284 1192722 gene locus_tag LOCUS_10560 1194284 1192722 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030750.1 protein_id gnl|my_center|LOCUS_10560 1194333 1195832 gene locus_tag LOCUS_10570 1194333 1195832 CDS product IucA/IucC family siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030749.1 protein_id gnl|my_center|LOCUS_10570 1195924 1197420 gene locus_tag LOCUS_10580 1195924 1197420 CDS product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030688.1 protein_id gnl|my_center|LOCUS_10580 1197423 1197914 gene locus_tag LOCUS_10590 1197423 1197914 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030689.1 protein_id gnl|my_center|LOCUS_10590 1198765 1198040 gene locus_tag LOCUS_10600 1198765 1198040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1198834 1201356 gene locus_tag LOCUS_10610 1198834 1201356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1201607 1202089 gene locus_tag LOCUS_10620 1201607 1202089 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865215.1 protein_id gnl|my_center|LOCUS_10620 1203145 1202165 gene locus_tag LOCUS_10630 1203145 1202165 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030695.1 protein_id gnl|my_center|LOCUS_10630 1203096 1203380 gene locus_tag LOCUS_10640 1203096 1203380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1203573 1204319 gene locus_tag LOCUS_10650 1203573 1204319 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030697.1 protein_id gnl|my_center|LOCUS_10650 1204377 1204685 gene locus_tag LOCUS_10660 1204377 1204685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1205698 1204601 gene locus_tag LOCUS_10670 gene rsgA 1205698 1204601 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_10670 1206981 1205887 gene locus_tag LOCUS_10680 1206981 1205887 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972813.1 protein_id gnl|my_center|LOCUS_10680 1207303 1208562 gene locus_tag LOCUS_10690 1207303 1208562 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222293.1 protein_id gnl|my_center|LOCUS_10690 1208587 1209183 gene locus_tag LOCUS_10700 1208587 1209183 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030654.1 protein_id gnl|my_center|LOCUS_10700 1209525 1211225 gene locus_tag LOCUS_10710 gene sirA 1209525 1211225 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972818.1 protein_id gnl|my_center|LOCUS_10710 1211222 1211398 gene locus_tag LOCUS_10720 1211222 1211398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_10720 1211385 1212068 gene locus_tag LOCUS_10730 1211385 1212068 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972820.1 protein_id gnl|my_center|LOCUS_10730 1212050 1212649 gene locus_tag LOCUS_10740 gene cysC 1212050 1212649 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164276380.1 protein_id gnl|my_center|LOCUS_10740 1212646 1213557 gene locus_tag LOCUS_10750 gene cysD 1212646 1213557 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972822.1 protein_id gnl|my_center|LOCUS_10750 1213560 1214885 gene locus_tag LOCUS_10760 1213560 1214885 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972823.1 protein_id gnl|my_center|LOCUS_10760 1215054 1216157 gene locus_tag LOCUS_10770 1215054 1216157 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_10770 1216213 1217025 gene locus_tag LOCUS_10780 1216213 1217025 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972825.1 protein_id gnl|my_center|LOCUS_10780 1217012 1217944 gene locus_tag LOCUS_10790 1217012 1217944 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030651.1 protein_id gnl|my_center|LOCUS_10790 1217956 1218720 gene locus_tag LOCUS_10800 1217956 1218720 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030650.1 protein_id gnl|my_center|LOCUS_10800 1218838 1218710 gene locus_tag LOCUS_10810 1218838 1218710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1218896 1221682 gene locus_tag LOCUS_10820 1218896 1221682 CDS product NACHT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028942.1 protein_id gnl|my_center|LOCUS_10820 1222311 1221679 gene locus_tag LOCUS_10830 1222311 1221679 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_10830 1222521 1223387 gene locus_tag LOCUS_10840 1222521 1223387 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030643.1 protein_id gnl|my_center|LOCUS_10840 1224352 1223414 gene locus_tag LOCUS_10850 1224352 1223414 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023149.1 protein_id gnl|my_center|LOCUS_10850 1224540 1224854 gene locus_tag LOCUS_10860 1224540 1224854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1224872 1225381 gene locus_tag LOCUS_10870 1224872 1225381 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_10870 1225486 1225707 gene locus_tag LOCUS_10880 1225486 1225707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1226601 1225759 gene locus_tag LOCUS_10890 1226601 1225759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1226486 1226815 gene locus_tag LOCUS_10900 1226486 1226815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1227483 1226749 gene locus_tag LOCUS_10910 1227483 1226749 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030642.1 protein_id gnl|my_center|LOCUS_10910 1228863 1227613 gene locus_tag LOCUS_10920 1228863 1227613 CDS product SAV2148 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030641.1 protein_id gnl|my_center|LOCUS_10920 1229148 1231295 gene locus_tag LOCUS_10930 gene glgX 1229148 1231295 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030640.1 protein_id gnl|my_center|LOCUS_10930 1231421 1233790 gene locus_tag LOCUS_10940 gene treY 1231421 1233790 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030639.1 protein_id gnl|my_center|LOCUS_10940 1233835 1235574 gene locus_tag LOCUS_10950 gene treZ 1233835 1235574 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030636.1 protein_id gnl|my_center|LOCUS_10950 1235698 1235994 gene locus_tag LOCUS_10960 1235698 1235994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975314.1 protein_id gnl|my_center|LOCUS_10960 1236404 1235997 gene locus_tag LOCUS_10970 gene msrB 1236404 1235997 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_10970 1237825 1236431 gene locus_tag LOCUS_10980 gene murC 1237825 1236431 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030625.1 protein_id gnl|my_center|LOCUS_10980 1238544 1237894 gene locus_tag LOCUS_10990 1238544 1237894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029548.1 protein_id gnl|my_center|LOCUS_10990 1239758 1238541 gene locus_tag LOCUS_11000 1239758 1238541 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 protein_id gnl|my_center|LOCUS_11000 1240012 1239755 gene locus_tag LOCUS_11010 1240012 1239755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1239933 1240997 gene locus_tag LOCUS_11020 1239933 1240997 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_11020 1240994 1241671 gene locus_tag LOCUS_11030 1240994 1241671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_11030 1242196 1241693 gene locus_tag LOCUS_11040 1242196 1241693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972862.1 protein_id gnl|my_center|LOCUS_11040 1243152 1242376 gene locus_tag LOCUS_11050 1243152 1242376 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030623.1 protein_id gnl|my_center|LOCUS_11050 1243402 1243202 gene locus_tag LOCUS_11060 1243402 1243202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1243362 1244351 gene locus_tag LOCUS_11070 gene zapE 1243362 1244351 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485435.1 protein_id gnl|my_center|LOCUS_11070 1244348 1245244 gene locus_tag LOCUS_11080 1244348 1245244 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030618.1 protein_id gnl|my_center|LOCUS_11080 1246167 1245241 gene locus_tag LOCUS_11090 1246167 1245241 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230336.1 protein_id gnl|my_center|LOCUS_11090 1246367 1246218 gene locus_tag LOCUS_11100 1246367 1246218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1247835 1246405 gene locus_tag LOCUS_11110 gene lpdA 1247835 1246405 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_11110 1247922 1248872 gene locus_tag LOCUS_11120 1247922 1248872 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228693.1 protein_id gnl|my_center|LOCUS_11120 1248869 1249591 gene locus_tag LOCUS_11130 1248869 1249591 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030616.1 protein_id gnl|my_center|LOCUS_11130 1249865 1250068 gene locus_tag LOCUS_11140 1249865 1250068 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974279.1 protein_id gnl|my_center|LOCUS_11140 1250237 1250551 gene locus_tag LOCUS_11150 1250237 1250551 CDS product SCO5918 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975207.1 protein_id gnl|my_center|LOCUS_11150 1251094 1251444 gene locus_tag LOCUS_11160 1251094 1251444 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974275.1 protein_id gnl|my_center|LOCUS_11160 1251605 1252861 gene locus_tag LOCUS_11170 1251605 1252861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_11170 1255080 1252969 gene locus_tag LOCUS_11180 1255080 1252969 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 1255236 1255640 gene locus_tag LOCUS_11190 1255236 1255640 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228278.1 protein_id gnl|my_center|LOCUS_11190 1256367 1255666 gene locus_tag LOCUS_11200 1256367 1255666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1256703 1257560 gene locus_tag LOCUS_11210 1256703 1257560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1257567 1258568 gene locus_tag LOCUS_11220 1257567 1258568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1258688 1260259 gene locus_tag LOCUS_11230 1258688 1260259 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485448.1 protein_id gnl|my_center|LOCUS_11230 1261042 1260317 gene locus_tag LOCUS_11240 1261042 1260317 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_11240 1262504 1261047 gene locus_tag LOCUS_11250 gene hemG 1262504 1261047 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224513.1 protein_id gnl|my_center|LOCUS_11250 1262650 1263843 gene locus_tag LOCUS_11260 1262650 1263843 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031117.1 protein_id gnl|my_center|LOCUS_11260 1263903 1264631 gene locus_tag LOCUS_11270 gene pcaH 1263903 1264631 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031116.1 protein_id gnl|my_center|LOCUS_11270 1264631 1265173 gene locus_tag LOCUS_11280 gene pcaG 1264631 1265173 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031115.1 protein_id gnl|my_center|LOCUS_11280 1266381 1265317 gene locus_tag LOCUS_11290 gene hemE 1266381 1265317 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972892.1 protein_id gnl|my_center|LOCUS_11290 1266473 1267135 gene locus_tag LOCUS_11300 1266473 1267135 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_11300 1267420 1268079 gene locus_tag LOCUS_11310 1267420 1268079 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972894.1 protein_id gnl|my_center|LOCUS_11310 1268161 1269438 gene locus_tag LOCUS_11320 1268161 1269438 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972895.1 protein_id gnl|my_center|LOCUS_11320 1269665 1270885 gene locus_tag LOCUS_11330 1269665 1270885 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030603.1 protein_id gnl|my_center|LOCUS_11330 1270882 1273008 gene locus_tag LOCUS_11340 1270882 1273008 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030602.1 protein_id gnl|my_center|LOCUS_11340 1274081 1273074 gene locus_tag LOCUS_11350 1274081 1273074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228831.1 protein_id gnl|my_center|LOCUS_11350 1274100 1275245 gene locus_tag LOCUS_11360 1274100 1275245 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_11360 1275485 1277668 gene locus_tag LOCUS_11370 1275485 1277668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1277672 1278934 gene locus_tag LOCUS_11380 gene pgsB 1277672 1278934 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227883.1 protein_id gnl|my_center|LOCUS_11380 1278931 1279413 gene locus_tag LOCUS_11390 gene pgsC 1278931 1279413 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943109.1 protein_id gnl|my_center|LOCUS_11390 1279431 1280528 gene locus_tag LOCUS_11400 1279431 1280528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1281687 1280677 gene locus_tag LOCUS_11410 1281687 1280677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972904.1 protein_id gnl|my_center|LOCUS_11410 1281796 1282221 gene locus_tag LOCUS_11420 1281796 1282221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_11420 1283780 1282254 gene locus_tag LOCUS_11430 1283780 1282254 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972907.1 protein_id gnl|my_center|LOCUS_11430 1285952 1283982 gene locus_tag LOCUS_11440 gene dxs 1285952 1283982 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972908.1 protein_id gnl|my_center|LOCUS_11440 1287465 1286185 gene locus_tag LOCUS_11450 1287465 1286185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 protein_id gnl|my_center|LOCUS_11450 1288244 1287462 gene locus_tag LOCUS_11460 1288244 1287462 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 protein_id gnl|my_center|LOCUS_11460 1289367 1288258 gene locus_tag LOCUS_11470 1289367 1288258 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972913.1 protein_id gnl|my_center|LOCUS_11470 1290792 1289587 gene locus_tag LOCUS_11480 1290792 1289587 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_11480 1291946 1291020 gene locus_tag LOCUS_11490 1291946 1291020 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_11490 1292863 1291946 gene locus_tag LOCUS_11500 1292863 1291946 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776380.1 protein_id gnl|my_center|LOCUS_11500 1294303 1292873 gene locus_tag LOCUS_11510 gene ngcE 1294303 1292873 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_11510 1294753 1298628 gene locus_tag LOCUS_11520 1294753 1298628 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226484.1 protein_id gnl|my_center|LOCUS_11520 1298651 1299100 gene locus_tag LOCUS_11530 1298651 1299100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1299746 1299570 gene locus_tag LOCUS_11540 1299746 1299570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1300415 1300029 gene locus_tag LOCUS_11550 1300415 1300029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1304393 1300440 gene locus_tag LOCUS_11560 1304393 1300440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1304692 1305192 gene locus_tag LOCUS_11570 1304692 1305192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972728.1 protein_id gnl|my_center|LOCUS_11570 1305262 1306851 gene locus_tag LOCUS_11580 1305262 1306851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1307319 1306915 gene locus_tag LOCUS_11590 1307319 1306915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1307213 1308838 gene locus_tag LOCUS_11600 1307213 1308838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1309104 1310054 gene locus_tag LOCUS_11610 1309104 1310054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1310717 1311685 gene locus_tag LOCUS_11620 1310717 1311685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11620 1311847 1312737 gene locus_tag LOCUS_11630 1311847 1312737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1312883 1313827 gene locus_tag LOCUS_11640 1312883 1313827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1315273 1313957 gene locus_tag LOCUS_11650 1315273 1313957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1315728 1315396 gene locus_tag LOCUS_11660 1315728 1315396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1316141 1315851 gene locus_tag LOCUS_11670 1316141 1315851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1319070 1316356 gene locus_tag LOCUS_11680 gene acnA 1319070 1316356 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972923.1 protein_id gnl|my_center|LOCUS_11680 1319356 1319565 gene locus_tag LOCUS_11690 1319356 1319565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1320667 1319774 gene locus_tag LOCUS_11700 1320667 1319774 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727741.1 protein_id gnl|my_center|LOCUS_11700 1320855 1321409 gene locus_tag LOCUS_11710 1320855 1321409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1321509 1323038 gene locus_tag LOCUS_11720 1321509 1323038 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_11720 1323193 1324416 gene locus_tag LOCUS_11730 1323193 1324416 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 protein_id gnl|my_center|LOCUS_11730 1325107 1324484 gene locus_tag LOCUS_11740 1325107 1324484 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091626.1 protein_id gnl|my_center|LOCUS_11740 1325652 1325254 gene locus_tag LOCUS_11750 1325652 1325254 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973036.1 protein_id gnl|my_center|LOCUS_11750 1326833 1325649 gene locus_tag LOCUS_11760 1326833 1325649 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973037.1 protein_id gnl|my_center|LOCUS_11760 1326983 1328671 gene locus_tag LOCUS_11770 gene ambL 1326983 1328671 CDS product aminobenozate:CoA ligase AmbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485583.1 protein_id gnl|my_center|LOCUS_11770 1328664 1329500 gene locus_tag LOCUS_11780 1328664 1329500 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030580.1 protein_id gnl|my_center|LOCUS_11780 1331956 1329686 gene locus_tag LOCUS_11790 1331956 1329686 CDS product bifunctional salicylyl-CoA 5-hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030579.1 protein_id gnl|my_center|LOCUS_11790 1332768 1331941 gene locus_tag LOCUS_11800 1332768 1331941 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973042.1 protein_id gnl|my_center|LOCUS_11800 1333929 1332928 gene locus_tag LOCUS_11810 gene argF 1333929 1332928 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030578.1 protein_id gnl|my_center|LOCUS_11810 1335294 1334062 gene locus_tag LOCUS_11820 1335294 1334062 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973047.1 protein_id gnl|my_center|LOCUS_11820 1338207 1335469 gene locus_tag LOCUS_11830 1338207 1335469 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030575.1 protein_id gnl|my_center|LOCUS_11830 1339772 1338204 gene locus_tag LOCUS_11840 1339772 1338204 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042159660.1 protein_id gnl|my_center|LOCUS_11840 1340742 1339807 gene locus_tag LOCUS_11850 gene mmuM 1340742 1339807 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030679.1 protein_id gnl|my_center|LOCUS_11850 1341103 1341333 gene locus_tag LOCUS_11860 1341103 1341333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1341812 1341354 gene locus_tag LOCUS_11870 1341812 1341354 CDS product DUF6099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030573.1 protein_id gnl|my_center|LOCUS_11870 1342282 1341932 gene locus_tag LOCUS_11880 1342282 1341932 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_11880 1343592 1342444 gene locus_tag LOCUS_11890 1343592 1342444 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973054.1 protein_id gnl|my_center|LOCUS_11890 1344026 1343619 gene locus_tag LOCUS_11900 1344026 1343619 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030864086.1 protein_id gnl|my_center|LOCUS_11900 1344268 1344873 gene locus_tag LOCUS_11910 1344268 1344873 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976533.1 protein_id gnl|my_center|LOCUS_11910 1344921 1345748 gene locus_tag LOCUS_11920 1344921 1345748 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 protein_id gnl|my_center|LOCUS_11920 1346612 1345797 gene locus_tag LOCUS_11930 1346612 1345797 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_11930 1347241 1346609 gene locus_tag LOCUS_11940 1347241 1346609 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_11940 1347820 1349712 gene locus_tag LOCUS_11950 1347820 1349712 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031049.1 protein_id gnl|my_center|LOCUS_11950 1352315 1350171 gene locus_tag LOCUS_11960 1352315 1350171 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972355.1 protein_id gnl|my_center|LOCUS_11960 1353832 1352699 gene locus_tag LOCUS_11970 1353832 1352699 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_11970 1354099 1353875 gene locus_tag LOCUS_11980 1354099 1353875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1356272 1354779 gene locus_tag LOCUS_11990 1356272 1354779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1356533 1356273 gene locus_tag LOCUS_12000 1356533 1356273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1356716 1357360 gene locus_tag LOCUS_12010 1356716 1357360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1358615 1357341 gene locus_tag LOCUS_12020 1358615 1357341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1359191 1359736 gene locus_tag LOCUS_12030 1359191 1359736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1360097 1359777 gene locus_tag LOCUS_12040 1360097 1359777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1361355 1361900 gene locus_tag LOCUS_12050 1361355 1361900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1362102 1362644 gene locus_tag LOCUS_12060 1362102 1362644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1362637 1363869 gene locus_tag LOCUS_12070 1362637 1363869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028352.1 protein_id gnl|my_center|LOCUS_12070 1363896 1364684 gene locus_tag LOCUS_12080 1363896 1364684 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027621.1 protein_id gnl|my_center|LOCUS_12080 1364847 1365896 gene locus_tag LOCUS_12090 1364847 1365896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1365896 1366447 gene locus_tag LOCUS_12100 1365896 1366447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1367359 1366475 gene locus_tag LOCUS_12110 1367359 1366475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1368021 1367356 gene locus_tag LOCUS_12120 1368021 1367356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1368523 1368350 gene locus_tag LOCUS_12130 1368523 1368350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1368854 1369357 gene locus_tag LOCUS_12140 1368854 1369357 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027345.1 protein_id gnl|my_center|LOCUS_12140 1369998 1369699 gene locus_tag LOCUS_12150 1369998 1369699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1369967 1371052 gene locus_tag LOCUS_12160 gene glf 1369967 1371052 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101279.1 protein_id gnl|my_center|LOCUS_12160 1371073 1372038 gene locus_tag LOCUS_12170 1371073 1372038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1372055 1373164 gene locus_tag LOCUS_12180 1372055 1373164 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_12180 1373164 1374273 gene locus_tag LOCUS_12190 1373164 1374273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1374263 1375552 gene locus_tag LOCUS_12200 1374263 1375552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1375600 1376763 gene locus_tag LOCUS_12210 1375600 1376763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1376760 1380281 gene locus_tag LOCUS_12220 1376760 1380281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1380431 1380961 gene locus_tag LOCUS_12230 1380431 1380961 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977430.1 protein_id gnl|my_center|LOCUS_12230 1381912 1381094 gene locus_tag LOCUS_12240 gene tauD 1381912 1381094 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114311.1 protein_id gnl|my_center|LOCUS_12240 1382986 1381928 gene locus_tag LOCUS_12250 1382986 1381928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1383650 1383982 gene locus_tag LOCUS_12260 1383650 1383982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1384148 1384648 gene locus_tag LOCUS_12270 1384148 1384648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1384745 1385776 gene locus_tag LOCUS_12280 1384745 1385776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972141.1 protein_id gnl|my_center|LOCUS_12280 1385844 1387376 gene locus_tag LOCUS_12290 1385844 1387376 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031371.1 protein_id gnl|my_center|LOCUS_12290 1387376 1388785 gene locus_tag LOCUS_12300 1387376 1388785 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893950.1 protein_id gnl|my_center|LOCUS_12300 1388884 1389798 gene locus_tag LOCUS_12310 1388884 1389798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1389795 1390445 gene locus_tag LOCUS_12320 1389795 1390445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1390448 1391092 gene locus_tag LOCUS_12330 1390448 1391092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1391273 1392457 gene locus_tag LOCUS_12340 1391273 1392457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 1392997 1392476 gene locus_tag LOCUS_12350 1392997 1392476 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_12350 1393571 1393071 gene locus_tag LOCUS_12360 1393571 1393071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1394047 1393568 gene locus_tag LOCUS_12370 1394047 1393568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1394605 1394117 gene locus_tag LOCUS_12380 1394605 1394117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1394932 1396686 gene locus_tag LOCUS_12390 1394932 1396686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1398079 1396739 gene locus_tag LOCUS_12400 1398079 1396739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1398609 1398124 gene locus_tag LOCUS_12410 1398609 1398124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1399858 1398677 gene locus_tag LOCUS_12420 1399858 1398677 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_12420 1401081 1399855 gene locus_tag LOCUS_12430 1401081 1399855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1401602 1401078 gene locus_tag LOCUS_12440 1401602 1401078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1402468 1401764 gene locus_tag LOCUS_12450 gene fabG 1402468 1401764 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_12450 1402698 1403570 gene locus_tag LOCUS_12460 1402698 1403570 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815084.1 protein_id gnl|my_center|LOCUS_12460 1404057 1403602 gene locus_tag LOCUS_12470 1404057 1403602 CDS product secretion protein EspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062824.1 protein_id gnl|my_center|LOCUS_12470 1404568 1405611 gene locus_tag LOCUS_12480 1404568 1405611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 1405611 1406315 gene locus_tag LOCUS_12490 1405611 1406315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1406416 1407027 gene locus_tag LOCUS_12500 1406416 1407027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1407024 1408292 gene locus_tag LOCUS_12510 1407024 1408292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1408381 1408572 gene locus_tag LOCUS_12520 1408381 1408572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1408672 1408905 gene locus_tag LOCUS_12530 1408672 1408905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1409169 1409543 gene locus_tag LOCUS_12540 1409169 1409543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1409555 1411285 gene locus_tag LOCUS_12550 1409555 1411285 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031300.1 protein_id gnl|my_center|LOCUS_12550 1411371 1411775 gene locus_tag LOCUS_12560 1411371 1411775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1413351 1411882 gene locus_tag LOCUS_12570 1413351 1411882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1413656 1413348 gene locus_tag LOCUS_12580 1413656 1413348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1413906 1413697 gene locus_tag LOCUS_12590 1413906 1413697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1414304 1413891 gene locus_tag LOCUS_12600 1414304 1413891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1414189 1415994 gene locus_tag LOCUS_12610 1414189 1415994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1416946 1416077 gene locus_tag LOCUS_12620 1416946 1416077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1417624 1417115 gene locus_tag LOCUS_12630 1417624 1417115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1418187 1417909 gene locus_tag LOCUS_12640 1418187 1417909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1418618 1418229 gene locus_tag LOCUS_12650 1418618 1418229 CDS product DUF317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031295.1 protein_id gnl|my_center|LOCUS_12650 1419323 1418865 gene locus_tag LOCUS_12660 1419323 1418865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1419393 1419809 gene locus_tag LOCUS_12670 1419393 1419809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1421598 1419853 gene locus_tag LOCUS_12680 1421598 1419853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1422712 1421840 gene locus_tag LOCUS_12690 1422712 1421840 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031279.1 protein_id gnl|my_center|LOCUS_12690 1423223 1422801 gene locus_tag LOCUS_12700 1423223 1422801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189310074.1 protein_id gnl|my_center|LOCUS_12700 1423751 1423263 gene locus_tag LOCUS_12710 1423751 1423263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1424684 1423890 gene locus_tag LOCUS_12720 1424684 1423890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029067.1 protein_id gnl|my_center|LOCUS_12720 1425428 1424739 gene locus_tag LOCUS_12730 1425428 1424739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031273.1 protein_id gnl|my_center|LOCUS_12730 1426039 1425425 gene locus_tag LOCUS_12740 1426039 1425425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1426527 1426036 gene locus_tag LOCUS_12750 1426527 1426036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031272.1 protein_id gnl|my_center|LOCUS_12750 1427198 1426524 gene locus_tag LOCUS_12760 1427198 1426524 CDS product DUF4913 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099053617.1 protein_id gnl|my_center|LOCUS_12760 1428073 1427312 gene locus_tag LOCUS_12770 1428073 1427312 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031270.1 protein_id gnl|my_center|LOCUS_12770 1428131 1428547 gene locus_tag LOCUS_12780 1428131 1428547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1428560 1429729 gene locus_tag LOCUS_12790 1428560 1429729 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029047.1 protein_id gnl|my_center|LOCUS_12790 1429986 1430294 gene locus_tag LOCUS_12800 1429986 1430294 CDS product DUF6112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031268.1 protein_id gnl|my_center|LOCUS_12800 1430294 1430998 gene locus_tag LOCUS_12810 1430294 1430998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031267.1 protein_id gnl|my_center|LOCUS_12810 1431030 1432493 gene locus_tag LOCUS_12820 1431030 1432493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1432626 1434095 gene locus_tag LOCUS_12830 1432626 1434095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137309464.1 protein_id gnl|my_center|LOCUS_12830 1434128 1434610 gene locus_tag LOCUS_12840 1434128 1434610 CDS product DUF6238 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031264.1 protein_id gnl|my_center|LOCUS_12840 1434647 1436161 gene locus_tag LOCUS_12850 1434647 1436161 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031263.1 protein_id gnl|my_center|LOCUS_12850 1436204 1436650 gene locus_tag LOCUS_12860 1436204 1436650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1436775 1436533 gene locus_tag LOCUS_12870 1436775 1436533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1436768 1437334 gene locus_tag LOCUS_12880 1436768 1437334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1437375 1438493 gene locus_tag LOCUS_12890 1437375 1438493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1438676 1438500 gene locus_tag LOCUS_12900 1438676 1438500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1438659 1439036 gene locus_tag LOCUS_12910 1438659 1439036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1439044 1439421 gene locus_tag LOCUS_12920 1439044 1439421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1439459 1439956 gene locus_tag LOCUS_12930 1439459 1439956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078625152.1 protein_id gnl|my_center|LOCUS_12930 1440062 1440478 gene locus_tag LOCUS_12940 1440062 1440478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031245.1 protein_id gnl|my_center|LOCUS_12940 1441129 1442937 gene locus_tag LOCUS_12950 1441129 1442937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1442787 1442705 gene locus_tag LOCUS_t00080 1442787 1442705 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1442934 1444121 gene locus_tag LOCUS_12960 1442934 1444121 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031229.1 protein_id gnl|my_center|LOCUS_12960 1444720 1444478 gene locus_tag LOCUS_12970 1444720 1444478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1445176 1444730 gene locus_tag LOCUS_12980 1445176 1444730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1445471 1445271 gene locus_tag LOCUS_12990 1445471 1445271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1446355 1445519 gene locus_tag LOCUS_13000 1446355 1445519 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 protein_id gnl|my_center|LOCUS_13000 1447908 1446355 gene locus_tag LOCUS_13010 1447908 1446355 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 protein_id gnl|my_center|LOCUS_13010 1451178 1448410 gene locus_tag LOCUS_13020 1451178 1448410 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_13020 1453992 1451281 gene locus_tag LOCUS_13030 1453992 1451281 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_13030 1457467 1454003 gene locus_tag LOCUS_13040 1457467 1454003 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_13040 1458572 1457673 gene locus_tag LOCUS_13050 1458572 1457673 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162624885.1 protein_id gnl|my_center|LOCUS_13050 1460207 1458879 gene locus_tag LOCUS_13060 1460207 1458879 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_13060 1462422 1460371 gene locus_tag LOCUS_13070 1462422 1460371 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973119.1 protein_id gnl|my_center|LOCUS_13070 1463664 1462537 gene locus_tag LOCUS_13080 1463664 1462537 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975925.1 protein_id gnl|my_center|LOCUS_13080 1465097 1463661 gene locus_tag LOCUS_13090 1465097 1463661 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972616.1 protein_id gnl|my_center|LOCUS_13090 1465087 1465419 gene locus_tag LOCUS_13100 1465087 1465419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1465990 1465388 gene locus_tag LOCUS_13110 1465990 1465388 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971676.1 protein_id gnl|my_center|LOCUS_13110 1466330 1465968 gene locus_tag LOCUS_13120 1466330 1465968 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971677.1 protein_id gnl|my_center|LOCUS_13120 1466770 1466327 gene locus_tag LOCUS_13130 1466770 1466327 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971678.1 protein_id gnl|my_center|LOCUS_13130 1468395 1466767 gene locus_tag LOCUS_13140 1468395 1466767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1468878 1469546 gene locus_tag LOCUS_13150 1468878 1469546 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_13150 1469632 1470309 gene locus_tag LOCUS_13160 1469632 1470309 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_13160 1471142 1470411 gene locus_tag LOCUS_13170 1471142 1470411 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973147.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13170 1471544 1471146 gene locus_tag LOCUS_13180 1471544 1471146 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327459.1 protein_id gnl|my_center|LOCUS_13180 1472319 1471630 gene locus_tag LOCUS_13190 1472319 1471630 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973149.1 protein_id gnl|my_center|LOCUS_13190 1474963 1472411 gene locus_tag LOCUS_13200 1474963 1472411 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030507.1 protein_id gnl|my_center|LOCUS_13200 1475247 1475786 gene locus_tag LOCUS_13210 gene aac(2')-Ie 1475247 1475786 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ie inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908954.1 protein_id gnl|my_center|LOCUS_13210 1477800 1475887 gene locus_tag LOCUS_13220 1477800 1475887 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029118.1 protein_id gnl|my_center|LOCUS_13220 1477904 1478413 gene locus_tag LOCUS_13230 1477904 1478413 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135782.1 protein_id gnl|my_center|LOCUS_13230 1479129 1478470 gene locus_tag LOCUS_13240 1479129 1478470 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029186.1 protein_id gnl|my_center|LOCUS_13240 1481237 1479126 gene locus_tag LOCUS_13250 gene kdpB 1481237 1479126 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_13250 1482925 1481234 gene locus_tag LOCUS_13260 gene kdpA 1482925 1481234 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029188.1 protein_id gnl|my_center|LOCUS_13260 1484157 1483387 gene locus_tag LOCUS_13270 1484157 1483387 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973152.1 protein_id gnl|my_center|LOCUS_13270 1484668 1484159 gene locus_tag LOCUS_13280 gene dut 1484668 1484159 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973153.1 protein_id gnl|my_center|LOCUS_13280 1485198 1484665 gene locus_tag LOCUS_13290 1485198 1484665 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_13290 1485207 1485752 gene locus_tag LOCUS_13300 1485207 1485752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1486770 1485946 gene locus_tag LOCUS_13310 1486770 1485946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030505.1 protein_id gnl|my_center|LOCUS_13310 1487080 1486784 gene locus_tag LOCUS_13320 1487080 1486784 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_13320 1488806 1487508 gene locus_tag LOCUS_13330 1488806 1487508 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973157.1 protein_id gnl|my_center|LOCUS_13330 1489466 1488813 gene locus_tag LOCUS_13340 1489466 1488813 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_13340 1489766 1489924 gene locus_tag LOCUS_13350 1489766 1489924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1491035 1490169 gene locus_tag LOCUS_13360 1491035 1490169 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153505920.1 protein_id gnl|my_center|LOCUS_13360 1492227 1491013 gene locus_tag LOCUS_13370 1492227 1491013 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973161.1 protein_id gnl|my_center|LOCUS_13370 1492287 1493549 gene locus_tag LOCUS_13380 1492287 1493549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973162.1 protein_id gnl|my_center|LOCUS_13380 1493491 1494846 gene locus_tag LOCUS_13390 1493491 1494846 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030501.1 protein_id gnl|my_center|LOCUS_13390 1495932 1494949 gene locus_tag LOCUS_13400 1495932 1494949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030500.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13400 1496401 1497486 gene locus_tag LOCUS_13410 gene sepH 1496401 1497486 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973165.1 protein_id gnl|my_center|LOCUS_13410 1498515 1497679 gene locus_tag LOCUS_13420 1498515 1497679 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030499.1 protein_id gnl|my_center|LOCUS_13420 1498725 1499519 gene locus_tag LOCUS_13430 1498725 1499519 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973167.1 protein_id gnl|my_center|LOCUS_13430 1500203 1499544 gene locus_tag LOCUS_13440 1500203 1499544 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973175.1 protein_id gnl|my_center|LOCUS_13440 1501467 1500259 gene locus_tag LOCUS_13450 1501467 1500259 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_13450 1502054 1501467 gene locus_tag LOCUS_13460 1502054 1501467 CDS product DUF5998 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_13460 1505277 1502137 gene locus_tag LOCUS_13470 1505277 1502137 CDS product bifunctional GNAT family N-acetyltransferase/acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030491.1 protein_id gnl|my_center|LOCUS_13470 1503372 1503463 gene locus_tag LOCUS_t00090 1503372 1503463 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1505431 1505712 gene locus_tag LOCUS_13480 1505431 1505712 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973180.1 protein_id gnl|my_center|LOCUS_13480 1506690 1505974 gene locus_tag LOCUS_13490 1506690 1505974 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030490.1 protein_id gnl|my_center|LOCUS_13490 1507688 1506885 gene locus_tag LOCUS_13500 1507688 1506885 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030489.1 protein_id gnl|my_center|LOCUS_13500 1509494 1508082 gene locus_tag LOCUS_13510 1509494 1508082 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030488.1 protein_id gnl|my_center|LOCUS_13510 1510846 1509491 gene locus_tag LOCUS_13520 1510846 1509491 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973184.1 protein_id gnl|my_center|LOCUS_13520 1511065 1513521 gene locus_tag LOCUS_13530 1511065 1513521 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030487.1 protein_id gnl|my_center|LOCUS_13530 1514695 1513607 gene locus_tag LOCUS_13540 1514695 1513607 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030486.1 protein_id gnl|my_center|LOCUS_13540 1514811 1515746 gene locus_tag LOCUS_13550 1514811 1515746 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_13550 1516773 1515730 gene locus_tag LOCUS_13560 1516773 1515730 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742105.1 protein_id gnl|my_center|LOCUS_13560 1517696 1516830 gene locus_tag LOCUS_13570 1517696 1516830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222208.1 protein_id gnl|my_center|LOCUS_13570 1518567 1517686 gene locus_tag LOCUS_13580 1518567 1517686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222207.1 protein_id gnl|my_center|LOCUS_13580 1518811 1520436 gene locus_tag LOCUS_13590 1518811 1520436 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850856.1 protein_id gnl|my_center|LOCUS_13590 1520433 1521110 gene locus_tag LOCUS_13600 1520433 1521110 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_13600 1521947 1521165 gene locus_tag LOCUS_13610 1521947 1521165 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 protein_id gnl|my_center|LOCUS_13610 1523098 1521926 gene locus_tag LOCUS_13620 1523098 1521926 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030479.1 protein_id gnl|my_center|LOCUS_13620 1525341 1523221 gene locus_tag LOCUS_13630 1525341 1523221 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973199.1 protein_id gnl|my_center|LOCUS_13630 1525728 1525994 gene locus_tag LOCUS_13640 1525728 1525994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1527108 1526143 gene locus_tag LOCUS_13650 1527108 1526143 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973201.1 protein_id gnl|my_center|LOCUS_13650 1528800 1527253 gene locus_tag LOCUS_13660 1528800 1527253 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973202.1 protein_id gnl|my_center|LOCUS_13660 1530064 1529180 gene locus_tag LOCUS_13670 gene whiH 1530064 1529180 CDS product sporulation transcriptional regulator WhiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030477.1 protein_id gnl|my_center|LOCUS_13670 1532075 1530294 gene locus_tag LOCUS_13680 1532075 1530294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1533100 1532255 gene locus_tag LOCUS_13690 1533100 1532255 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973205.1 protein_id gnl|my_center|LOCUS_13690 1535165 1533105 gene locus_tag LOCUS_13700 1535165 1533105 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031702.1 protein_id gnl|my_center|LOCUS_13700 1536811 1535318 gene locus_tag LOCUS_13710 1536811 1535318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1536969 1539134 gene locus_tag LOCUS_13720 1536969 1539134 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_13720 1539377 1539964 gene locus_tag LOCUS_13730 1539377 1539964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973208.1 protein_id gnl|my_center|LOCUS_13730 1540618 1540025 gene locus_tag LOCUS_13740 1540618 1540025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030472.1 protein_id gnl|my_center|LOCUS_13740 1541385 1540684 gene locus_tag LOCUS_13750 1541385 1540684 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030471.1 protein_id gnl|my_center|LOCUS_13750 1542344 1541451 gene locus_tag LOCUS_13760 1542344 1541451 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973213.1 protein_id gnl|my_center|LOCUS_13760 1543015 1542356 gene locus_tag LOCUS_13770 1543015 1542356 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973214.1 protein_id gnl|my_center|LOCUS_13770 1543823 1543218 gene locus_tag LOCUS_13780 1543823 1543218 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973215.1 protein_id gnl|my_center|LOCUS_13780 1544045 1543857 gene locus_tag LOCUS_13790 1544045 1543857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1547018 1544145 gene locus_tag LOCUS_13800 1547018 1544145 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030467.1 protein_id gnl|my_center|LOCUS_13800 1547665 1547132 gene locus_tag LOCUS_13810 gene nrdR 1547665 1547132 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973218.1 protein_id gnl|my_center|LOCUS_13810 1548242 1549027 gene locus_tag LOCUS_13820 gene lexA 1548242 1549027 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030466.1 protein_id gnl|my_center|LOCUS_13820 1551149 1549170 gene locus_tag LOCUS_13830 1551149 1549170 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030465.1 protein_id gnl|my_center|LOCUS_13830 1552026 1551265 gene locus_tag LOCUS_13840 1552026 1551265 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973221.1 protein_id gnl|my_center|LOCUS_13840 1553986 1552034 gene locus_tag LOCUS_13850 1553986 1552034 CDS product IucA/IucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485565.1 protein_id gnl|my_center|LOCUS_13850 1555611 1554064 gene locus_tag LOCUS_13860 1555611 1554064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1555876 1557078 gene locus_tag LOCUS_13870 1555876 1557078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973224.1 protein_id gnl|my_center|LOCUS_13870 1558654 1557152 gene locus_tag LOCUS_13880 gene hflX 1558654 1557152 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_13880 1560280 1558796 gene locus_tag LOCUS_13890 1560280 1558796 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030460.1 protein_id gnl|my_center|LOCUS_13890 1562555 1560417 gene locus_tag LOCUS_13900 1562555 1560417 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030459.1 protein_id gnl|my_center|LOCUS_13900 1563591 1562758 gene locus_tag LOCUS_13910 gene dapF 1563591 1562758 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030458.1 protein_id gnl|my_center|LOCUS_13910 1564094 1563699 gene locus_tag LOCUS_13920 1564094 1563699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1565221 1564283 gene locus_tag LOCUS_13930 gene miaA 1565221 1564283 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030456.1 protein_id gnl|my_center|LOCUS_13930 1565405 1565656 gene locus_tag LOCUS_13940 1565405 1565656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1565687 1565944 gene locus_tag LOCUS_13950 1565687 1565944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1566740 1566030 gene locus_tag LOCUS_13960 1566740 1566030 CDS product class III extradiol dioxygenase subunit B-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030454.1 protein_id gnl|my_center|LOCUS_13960 1568373 1566877 gene locus_tag LOCUS_13970 gene miaB 1568373 1566877 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_13970 1568516 1569514 gene locus_tag LOCUS_13980 1568516 1569514 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030449.1 protein_id gnl|my_center|LOCUS_13980 1570949 1569543 gene locus_tag LOCUS_13990 1570949 1569543 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224238.1 protein_id gnl|my_center|LOCUS_13990 1571672 1570962 gene locus_tag LOCUS_14000 1571672 1570962 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973245.1 protein_id gnl|my_center|LOCUS_14000 1571928 1572704 gene locus_tag LOCUS_14010 1571928 1572704 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973246.1 protein_id gnl|my_center|LOCUS_14010 1572794 1573717 gene locus_tag LOCUS_14020 1572794 1573717 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224235.1 protein_id gnl|my_center|LOCUS_14020 1573766 1574416 gene locus_tag LOCUS_14030 1573766 1574416 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224234.1 protein_id gnl|my_center|LOCUS_14030 1574413 1575312 gene locus_tag LOCUS_14040 1574413 1575312 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224233.1 protein_id gnl|my_center|LOCUS_14040 1575534 1577297 gene locus_tag LOCUS_14050 1575534 1577297 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189108986.1 protein_id gnl|my_center|LOCUS_14050 1577493 1578041 gene locus_tag LOCUS_14060 1577493 1578041 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030444.1 protein_id gnl|my_center|LOCUS_14060 1578072 1578473 gene locus_tag LOCUS_14070 1578072 1578473 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973252.1 protein_id gnl|my_center|LOCUS_14070 1579075 1578455 gene locus_tag LOCUS_14080 1579075 1578455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1580208 1579084 gene locus_tag LOCUS_14090 gene recA 1580208 1579084 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_14090 1580643 1580449 gene locus_tag LOCUS_14100 1580643 1580449 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973258.1 protein_id gnl|my_center|LOCUS_14100 1580724 1581644 gene locus_tag LOCUS_14110 1580724 1581644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715181.1 protein_id gnl|my_center|LOCUS_14110 1581874 1581641 gene locus_tag LOCUS_14120 1581874 1581641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1581765 1586516 gene locus_tag LOCUS_14130 1581765 1586516 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030438.1 protein_id gnl|my_center|LOCUS_14130 1586559 1587362 gene locus_tag LOCUS_14140 1586559 1587362 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030437.1 protein_id gnl|my_center|LOCUS_14140 1587724 1587437 gene locus_tag LOCUS_14150 1587724 1587437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1588203 1587733 gene locus_tag LOCUS_14160 1588203 1587733 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973268.1 protein_id gnl|my_center|LOCUS_14160 1588790 1588407 gene locus_tag LOCUS_14170 1588790 1588407 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_14170 1589424 1588900 gene locus_tag LOCUS_14180 1589424 1588900 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030436.1 protein_id gnl|my_center|LOCUS_14180 1590047 1589421 gene locus_tag LOCUS_14190 1590047 1589421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1591525 1590044 gene locus_tag LOCUS_14200 gene rimO 1591525 1590044 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973272.1 protein_id gnl|my_center|LOCUS_14200 1592518 1591652 gene locus_tag LOCUS_14210 1592518 1591652 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973273.1 protein_id gnl|my_center|LOCUS_14210 1595533 1592732 gene locus_tag LOCUS_14220 1595533 1592732 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973274.1 protein_id gnl|my_center|LOCUS_14220 1596315 1595626 gene locus_tag LOCUS_14230 1596315 1595626 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030434.1 protein_id gnl|my_center|LOCUS_14230 1602127 1596590 gene locus_tag LOCUS_14240 1602127 1596590 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030433.1 protein_id gnl|my_center|LOCUS_14240 1602340 1604997 gene locus_tag LOCUS_14250 1602340 1604997 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973277.1 protein_id gnl|my_center|LOCUS_14250 1605115 1605042 gene locus_tag LOCUS_t00100 1605115 1605042 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1605894 1605184 gene locus_tag LOCUS_14260 1605894 1605184 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865145.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence02 195 1424 gene locus_tag LOCUS_14270 195 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2040 1405 gene locus_tag LOCUS_14280 2040 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2129 3715 gene locus_tag LOCUS_14290 2129 3715 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026958.1 protein_id gnl|my_center|LOCUS_14290 11316 3697 gene locus_tag LOCUS_14300 11316 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 12530 11511 gene locus_tag LOCUS_14310 12530 11511 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084065.1 protein_id gnl|my_center|LOCUS_14310 13550 12735 gene locus_tag LOCUS_14320 13550 12735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 13609 14004 gene locus_tag LOCUS_14330 13609 14004 CDS product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285721.1 protein_id gnl|my_center|LOCUS_14330 14610 14071 gene locus_tag LOCUS_14340 14610 14071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 15610 14750 gene locus_tag LOCUS_14350 15610 14750 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225103.1 protein_id gnl|my_center|LOCUS_14350 16874 15651 gene locus_tag LOCUS_14360 16874 15651 CDS product family 2 encapsulin nanocompartment cargo protein terpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225102.1 protein_id gnl|my_center|LOCUS_14360 17691 17095 gene locus_tag LOCUS_14370 17691 17095 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029402.1 protein_id gnl|my_center|LOCUS_14370 18473 17805 gene locus_tag LOCUS_14380 18473 17805 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878199.1 protein_id gnl|my_center|LOCUS_14380 18577 19602 gene locus_tag LOCUS_14390 18577 19602 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722868.1 protein_id gnl|my_center|LOCUS_14390 20437 19592 gene locus_tag LOCUS_14400 20437 19592 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 protein_id gnl|my_center|LOCUS_14400 21928 20549 gene locus_tag LOCUS_14410 21928 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 22082 23443 gene locus_tag LOCUS_14420 22082 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 23581 25197 gene locus_tag LOCUS_14430 23581 25197 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 protein_id gnl|my_center|LOCUS_14430 25882 25133 gene locus_tag LOCUS_14440 25882 25133 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032008.1 protein_id gnl|my_center|LOCUS_14440 27183 25879 gene locus_tag LOCUS_14450 27183 25879 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224638.1 protein_id gnl|my_center|LOCUS_14450 27299 28204 gene locus_tag LOCUS_14460 27299 28204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 28397 28813 gene locus_tag LOCUS_14470 28397 28813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 29052 30023 gene locus_tag LOCUS_14480 29052 30023 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966803.1 protein_id gnl|my_center|LOCUS_14480 31489 30161 gene locus_tag LOCUS_14490 31489 30161 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972416.1 protein_id gnl|my_center|LOCUS_14490 32606 31602 gene locus_tag LOCUS_14500 32606 31602 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167468068.1 protein_id gnl|my_center|LOCUS_14500 32829 33257 gene locus_tag LOCUS_14510 32829 33257 CDS product DUF6314 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174855167.1 protein_id gnl|my_center|LOCUS_14510 33309 34181 gene locus_tag LOCUS_14520 33309 34181 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230371.1 protein_id gnl|my_center|LOCUS_14520 35745 34171 gene locus_tag LOCUS_14530 35745 34171 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 protein_id gnl|my_center|LOCUS_14530 37997 35769 gene locus_tag LOCUS_14540 37997 35769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 44174 38046 gene locus_tag LOCUS_14550 44174 38046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 45331 44429 gene locus_tag LOCUS_14560 45331 44429 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775749.1 protein_id gnl|my_center|LOCUS_14560 45463 46617 gene locus_tag LOCUS_14570 45463 46617 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532462.1 protein_id gnl|my_center|LOCUS_14570 46716 47657 gene locus_tag LOCUS_14580 46716 47657 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227924.1 protein_id gnl|my_center|LOCUS_14580 47706 48683 gene locus_tag LOCUS_14590 47706 48683 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 protein_id gnl|my_center|LOCUS_14590 48705 49286 gene locus_tag LOCUS_14600 48705 49286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 49382 50845 gene locus_tag LOCUS_14610 49382 50845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108905338.1 protein_id gnl|my_center|LOCUS_14610 51421 50858 gene locus_tag LOCUS_14620 51421 50858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 52341 51508 gene locus_tag LOCUS_14630 52341 51508 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027251.1 protein_id gnl|my_center|LOCUS_14630 53931 52558 gene locus_tag LOCUS_14640 53931 52558 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 protein_id gnl|my_center|LOCUS_14640 55205 54045 gene locus_tag LOCUS_14650 55205 54045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421211.1 protein_id gnl|my_center|LOCUS_14650 55185 55282 gene locus_tag LOCUS_t00110 55185 55282 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 56530 55262 gene locus_tag LOCUS_14660 gene hemT 56530 55262 CDS product 5-aminolevulinic acid synthase HemT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338981.1 protein_id gnl|my_center|LOCUS_14660 57703 56711 gene locus_tag LOCUS_14670 57703 56711 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005125531.1 protein_id gnl|my_center|LOCUS_14670 57880 59094 gene locus_tag LOCUS_14680 57880 59094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742129.1 protein_id gnl|my_center|LOCUS_14680 59222 59614 gene locus_tag LOCUS_14690 59222 59614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 61165 59627 gene locus_tag LOCUS_14700 61165 59627 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229669.1 protein_id gnl|my_center|LOCUS_14700 61260 61748 gene locus_tag LOCUS_14710 61260 61748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 61982 62683 gene locus_tag LOCUS_14720 61982 62683 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028564.1 protein_id gnl|my_center|LOCUS_14720 62781 63242 gene locus_tag LOCUS_14730 62781 63242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 64065 63262 gene locus_tag LOCUS_14740 64065 63262 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030552.1 protein_id gnl|my_center|LOCUS_14740 64424 64065 gene locus_tag LOCUS_14750 64424 64065 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666054.1 protein_id gnl|my_center|LOCUS_14750 64564 65967 gene locus_tag LOCUS_14760 64564 65967 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976169.1 protein_id gnl|my_center|LOCUS_14760 66567 66067 gene locus_tag LOCUS_14770 66567 66067 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226516.1 protein_id gnl|my_center|LOCUS_14770 66917 66564 gene locus_tag LOCUS_14780 66917 66564 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226515.1 protein_id gnl|my_center|LOCUS_14780 67010 67990 gene locus_tag LOCUS_14790 67010 67990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 68207 69499 gene locus_tag LOCUS_14800 68207 69499 CDS product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186095.1 protein_id gnl|my_center|LOCUS_14800 69544 69903 gene locus_tag LOCUS_14810 69544 69903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 70038 69965 gene locus_tag LOCUS_t00120 70038 69965 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 70236 70895 gene locus_tag LOCUS_14820 70236 70895 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_14820 71005 72483 gene locus_tag LOCUS_14830 71005 72483 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727475.1 protein_id gnl|my_center|LOCUS_14830 73909 72500 gene locus_tag LOCUS_14840 73909 72500 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728146.1 protein_id gnl|my_center|LOCUS_14840 74700 74035 gene locus_tag LOCUS_14850 74700 74035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 75087 75506 gene locus_tag LOCUS_14860 75087 75506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030827.1 protein_id gnl|my_center|LOCUS_14860 76892 75573 gene locus_tag LOCUS_14870 76892 75573 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803909.1 protein_id gnl|my_center|LOCUS_14870 77095 78300 gene locus_tag LOCUS_14880 77095 78300 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977624.1 protein_id gnl|my_center|LOCUS_14880 79081 78410 gene locus_tag LOCUS_14890 79081 78410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 79381 80040 gene locus_tag LOCUS_14900 79381 80040 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 protein_id gnl|my_center|LOCUS_14900 80178 80852 gene locus_tag LOCUS_14910 80178 80852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559189.1 protein_id gnl|my_center|LOCUS_14910 81140 83011 gene locus_tag LOCUS_14920 81140 83011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 83191 84075 gene locus_tag LOCUS_14930 83191 84075 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 protein_id gnl|my_center|LOCUS_14930 84093 84689 gene locus_tag LOCUS_14940 84093 84689 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 protein_id gnl|my_center|LOCUS_14940 85660 84800 gene locus_tag LOCUS_14950 85660 84800 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206278392.1 protein_id gnl|my_center|LOCUS_14950 87189 85657 gene locus_tag LOCUS_14960 87189 85657 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467246.1 protein_id gnl|my_center|LOCUS_14960 89018 87186 gene locus_tag LOCUS_14970 89018 87186 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227173.1 protein_id gnl|my_center|LOCUS_14970 90019 89078 gene locus_tag LOCUS_14980 90019 89078 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227174.1 protein_id gnl|my_center|LOCUS_14980 91161 90016 gene locus_tag LOCUS_14990 91161 90016 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_14990 91305 91952 gene locus_tag LOCUS_15000 91305 91952 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227178.1 protein_id gnl|my_center|LOCUS_15000 92114 93760 gene locus_tag LOCUS_15010 92114 93760 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 protein_id gnl|my_center|LOCUS_15010 93783 94514 gene locus_tag LOCUS_15020 93783 94514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 96557 94884 gene locus_tag LOCUS_15030 96557 94884 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028098.1 protein_id gnl|my_center|LOCUS_15030 96447 96659 gene locus_tag LOCUS_15040 96447 96659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 98173 96794 gene locus_tag LOCUS_15050 98173 96794 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_15050 98955 98257 gene locus_tag LOCUS_15060 98955 98257 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_15060 99162 100553 gene locus_tag LOCUS_15070 99162 100553 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_15070 100596 100946 gene locus_tag LOCUS_15080 100596 100946 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030916.1 protein_id gnl|my_center|LOCUS_15080 101020 102675 gene locus_tag LOCUS_15090 101020 102675 CDS product class I tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030917.1 protein_id gnl|my_center|LOCUS_15090 102672 103790 gene locus_tag LOCUS_15100 102672 103790 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385237.1 protein_id gnl|my_center|LOCUS_15100 103991 105004 gene locus_tag LOCUS_15110 103991 105004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 105147 105878 gene locus_tag LOCUS_15120 105147 105878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 105875 106135 gene locus_tag LOCUS_15130 105875 106135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 106190 107047 gene locus_tag LOCUS_15140 106190 107047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 107336 108061 gene locus_tag LOCUS_15150 107336 108061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 108325 110880 gene locus_tag LOCUS_15160 108325 110880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 111004 111765 gene locus_tag LOCUS_15170 111004 111765 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975619.1 protein_id gnl|my_center|LOCUS_15170 111762 112748 gene locus_tag LOCUS_15180 gene pfkB 111762 112748 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028823.1 protein_id gnl|my_center|LOCUS_15180 112745 115162 gene locus_tag LOCUS_15190 112745 115162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 115589 115239 gene locus_tag LOCUS_15200 115589 115239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 116177 115737 gene locus_tag LOCUS_15210 116177 115737 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972083.1 protein_id gnl|my_center|LOCUS_15210 116258 117301 gene locus_tag LOCUS_15220 116258 117301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 116714 116812 gene locus_tag LOCUS_t00130 116714 116812 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 117391 118227 gene locus_tag LOCUS_15230 117391 118227 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848008.1 protein_id gnl|my_center|LOCUS_15230 119909 118245 gene locus_tag LOCUS_15240 119909 118245 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527813.1 protein_id gnl|my_center|LOCUS_15240 120360 121664 gene locus_tag LOCUS_15250 120360 121664 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031571.1 protein_id gnl|my_center|LOCUS_15250 121803 122675 gene locus_tag LOCUS_15260 121803 122675 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405636.1 protein_id gnl|my_center|LOCUS_15260 123809 122685 gene locus_tag LOCUS_15270 123809 122685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 123709 124071 gene locus_tag LOCUS_15280 123709 124071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 124192 125307 gene locus_tag LOCUS_15290 124192 125307 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225511.1 protein_id gnl|my_center|LOCUS_15290 126886 125321 gene locus_tag LOCUS_15300 126886 125321 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527968.1 protein_id gnl|my_center|LOCUS_15300 127577 127002 gene locus_tag LOCUS_15310 127577 127002 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228785.1 protein_id gnl|my_center|LOCUS_15310 127712 128902 gene locus_tag LOCUS_15320 127712 128902 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228781.1 protein_id gnl|my_center|LOCUS_15320 128906 129121 gene locus_tag LOCUS_15330 128906 129121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 130351 129140 gene locus_tag LOCUS_15340 130351 129140 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029132.1 protein_id gnl|my_center|LOCUS_15340 130948 130361 gene locus_tag LOCUS_15350 130948 130361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 131741 130995 gene locus_tag LOCUS_15360 131741 130995 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_15360 133237 132173 gene locus_tag LOCUS_15370 133237 132173 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028391.1 protein_id gnl|my_center|LOCUS_15370 135360 133339 gene locus_tag LOCUS_15380 135360 133339 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229532.1 protein_id gnl|my_center|LOCUS_15380 136213 135482 gene locus_tag LOCUS_15390 136213 135482 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972430.1 protein_id gnl|my_center|LOCUS_15390 137451 136240 gene locus_tag LOCUS_15400 137451 136240 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552130.1 protein_id gnl|my_center|LOCUS_15400 138272 137448 gene locus_tag LOCUS_15410 138272 137448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 138562 139347 gene locus_tag LOCUS_15420 138562 139347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 139371 139931 gene locus_tag LOCUS_15430 gene pfpI 139371 139931 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867593.1 protein_id gnl|my_center|LOCUS_15430 140030 140758 gene locus_tag LOCUS_15440 140030 140758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 140809 141483 gene locus_tag LOCUS_15450 140809 141483 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_15450 141668 142579 gene locus_tag LOCUS_15460 141668 142579 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_15460 143993 142605 gene locus_tag LOCUS_15470 143993 142605 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026997.1 protein_id gnl|my_center|LOCUS_15470 144069 145013 gene locus_tag LOCUS_15480 144069 145013 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_15480 145147 145914 gene locus_tag LOCUS_15490 145147 145914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 146132 147490 gene locus_tag LOCUS_15500 146132 147490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15500 147586 148473 gene locus_tag LOCUS_15510 147586 148473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 148457 148732 gene locus_tag LOCUS_15520 148457 148732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 148722 149585 gene locus_tag LOCUS_15530 148722 149585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 149659 150678 gene locus_tag LOCUS_15540 gene aguA 149659 150678 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704695.1 protein_id gnl|my_center|LOCUS_15540 150675 151865 gene locus_tag LOCUS_15550 150675 151865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_15550 153006 151906 gene locus_tag LOCUS_15560 153006 151906 CDS product ionic transporter y4hA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976857.1 protein_id gnl|my_center|LOCUS_15560 154446 153253 gene locus_tag LOCUS_15570 154446 153253 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031138.1 protein_id gnl|my_center|LOCUS_15570 155287 154490 gene locus_tag LOCUS_15580 155287 154490 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027518.1 protein_id gnl|my_center|LOCUS_15580 157670 155304 gene locus_tag LOCUS_15590 157670 155304 CDS product Orn/Lys/Arg decarboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229207.1 protein_id gnl|my_center|LOCUS_15590 158079 157819 gene locus_tag LOCUS_15600 158079 157819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 158384 158172 gene locus_tag LOCUS_15610 158384 158172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 159853 158600 gene locus_tag LOCUS_15620 159853 158600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 160779 160504 gene locus_tag LOCUS_15630 160779 160504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 161013 160783 gene locus_tag LOCUS_15640 161013 160783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 161148 161411 gene locus_tag LOCUS_15650 161148 161411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 161714 161424 gene locus_tag LOCUS_15660 161714 161424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 162451 161702 gene locus_tag LOCUS_15670 162451 161702 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222232.1 protein_id gnl|my_center|LOCUS_15670 162606 163139 gene locus_tag LOCUS_15680 162606 163139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953879.1 protein_id gnl|my_center|LOCUS_15680 163929 163144 gene locus_tag LOCUS_15690 163929 163144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 164563 163937 gene locus_tag LOCUS_15700 164563 163937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026862.1 protein_id gnl|my_center|LOCUS_15700 165558 164668 gene locus_tag LOCUS_15710 gene sigJ 165558 164668 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230380.1 protein_id gnl|my_center|LOCUS_15710 166544 165759 gene locus_tag LOCUS_15720 166544 165759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 167437 166628 gene locus_tag LOCUS_15730 167437 166628 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228494.1 protein_id gnl|my_center|LOCUS_15730 167573 168436 gene locus_tag LOCUS_15740 167573 168436 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228496.1 protein_id gnl|my_center|LOCUS_15740 170119 168458 gene locus_tag LOCUS_15750 170119 168458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 172674 170116 gene locus_tag LOCUS_15760 gene nirB 172674 170116 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028382.1 protein_id gnl|my_center|LOCUS_15760 173909 172686 gene locus_tag LOCUS_15770 173909 172686 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028381.1 protein_id gnl|my_center|LOCUS_15770 176026 173906 gene locus_tag LOCUS_15780 176026 173906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 176218 177363 gene locus_tag LOCUS_15790 176218 177363 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223031.1 protein_id gnl|my_center|LOCUS_15790 177363 178142 gene locus_tag LOCUS_15800 177363 178142 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943936.1 protein_id gnl|my_center|LOCUS_15800 178145 178519 gene locus_tag LOCUS_15810 178145 178519 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971524.1 protein_id gnl|my_center|LOCUS_15810 179855 178536 gene locus_tag LOCUS_15820 179855 178536 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_15820 179963 181171 gene locus_tag LOCUS_15830 179963 181171 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225085.1 protein_id gnl|my_center|LOCUS_15830 181313 182254 gene locus_tag LOCUS_15840 181313 182254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 182479 182631 gene locus_tag LOCUS_15850 182479 182631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 182628 183950 gene locus_tag LOCUS_15860 182628 183950 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011319592.1 protein_id gnl|my_center|LOCUS_15860 183987 185360 gene locus_tag LOCUS_15870 183987 185360 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230598.1 protein_id gnl|my_center|LOCUS_15870 185398 185850 gene locus_tag LOCUS_15880 185398 185850 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224896.1 protein_id gnl|my_center|LOCUS_15880 185867 186763 gene locus_tag LOCUS_15890 185867 186763 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897923.1 protein_id gnl|my_center|LOCUS_15890 186723 187601 gene locus_tag LOCUS_15900 186723 187601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224893.1 protein_id gnl|my_center|LOCUS_15900 187854 187603 gene locus_tag LOCUS_15910 187854 187603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 188508 187855 gene locus_tag LOCUS_15920 188508 187855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15920 188713 189228 gene locus_tag LOCUS_15930 188713 189228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 189517 189233 gene locus_tag LOCUS_15940 189517 189233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 190607 189639 gene locus_tag LOCUS_15950 190607 189639 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697738.1 protein_id gnl|my_center|LOCUS_15950 191334 190678 gene locus_tag LOCUS_15960 191334 190678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 191422 192015 gene locus_tag LOCUS_15970 191422 192015 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029834.1 protein_id gnl|my_center|LOCUS_15970 192087 193964 gene locus_tag LOCUS_15980 192087 193964 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_15980 194088 194663 gene locus_tag LOCUS_15990 194088 194663 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_15990 194724 195368 gene locus_tag LOCUS_16000 194724 195368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 196210 195386 gene locus_tag LOCUS_16010 196210 195386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 196423 196719 gene locus_tag LOCUS_16020 196423 196719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 196835 197692 gene locus_tag LOCUS_16030 196835 197692 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_16030 197851 198663 gene locus_tag LOCUS_16040 197851 198663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 198919 200337 gene locus_tag LOCUS_16050 198919 200337 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031846.1 protein_id gnl|my_center|LOCUS_16050 200345 201034 gene locus_tag LOCUS_16060 200345 201034 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031847.1 protein_id gnl|my_center|LOCUS_16060 201252 201902 gene locus_tag LOCUS_16070 201252 201902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 202963 201815 gene locus_tag LOCUS_16080 202963 201815 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093954241.1 protein_id gnl|my_center|LOCUS_16080 203083 203625 gene locus_tag LOCUS_16090 203083 203625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 205068 203644 gene locus_tag LOCUS_16100 205068 203644 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223898.1 protein_id gnl|my_center|LOCUS_16100 205724 205065 gene locus_tag LOCUS_16110 205724 205065 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230001.1 protein_id gnl|my_center|LOCUS_16110 205837 206007 gene locus_tag LOCUS_16120 205837 206007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972469.1 protein_id gnl|my_center|LOCUS_16120 206062 206496 gene locus_tag LOCUS_16130 206062 206496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081988.1 protein_id gnl|my_center|LOCUS_16130 207465 206557 gene locus_tag LOCUS_16140 207465 206557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 207690 207508 gene locus_tag LOCUS_16150 207690 207508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 207918 208463 gene locus_tag LOCUS_16160 207918 208463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 208536 208623 gene locus_tag LOCUS_t00140 208536 208623 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 208792 208944 gene locus_tag LOCUS_16170 208792 208944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 209234 209019 gene locus_tag LOCUS_16180 209234 209019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 209289 209501 gene locus_tag LOCUS_16190 209289 209501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 209624 209827 gene locus_tag LOCUS_16200 209624 209827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 209956 210189 gene locus_tag LOCUS_16210 209956 210189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 210189 210437 gene locus_tag LOCUS_16220 210189 210437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 210657 211154 gene locus_tag LOCUS_16230 210657 211154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 211869 211441 gene locus_tag LOCUS_16240 211869 211441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16240 212033 211866 gene locus_tag LOCUS_16250 212033 211866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16250 213585 214082 gene locus_tag LOCUS_16260 213585 214082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 214079 214462 gene locus_tag LOCUS_16270 214079 214462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 214362 214613 gene locus_tag LOCUS_16280 214362 214613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 214610 215575 gene locus_tag LOCUS_16290 gene hemC 214610 215575 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971798.1 protein_id gnl|my_center|LOCUS_16290 216580 215855 gene locus_tag LOCUS_16300 216580 215855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 218186 217401 gene locus_tag LOCUS_16310 218186 217401 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036395.1 protein_id gnl|my_center|LOCUS_16310 220605 218263 gene locus_tag LOCUS_16320 gene metE 220605 218263 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027494.1 protein_id gnl|my_center|LOCUS_16320 221306 221530 gene locus_tag LOCUS_16330 221306 221530 CDS product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228805.1 protein_id gnl|my_center|LOCUS_16330 221550 222311 gene locus_tag LOCUS_16340 221550 222311 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_16340 222517 224016 gene locus_tag LOCUS_16350 222517 224016 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109992.1 protein_id gnl|my_center|LOCUS_16350 224022 225170 gene locus_tag LOCUS_16360 224022 225170 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084251.1 protein_id gnl|my_center|LOCUS_16360 225167 226225 gene locus_tag LOCUS_16370 225167 226225 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730435.1 protein_id gnl|my_center|LOCUS_16370 226225 227148 gene locus_tag LOCUS_16380 gene mmsB 226225 227148 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088663.1 protein_id gnl|my_center|LOCUS_16380 227148 227927 gene locus_tag LOCUS_16390 227148 227927 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_16390 228657 228175 gene locus_tag LOCUS_16400 228657 228175 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930295.1 protein_id gnl|my_center|LOCUS_16400 228911 230254 gene locus_tag LOCUS_16410 228911 230254 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027469.1 protein_id gnl|my_center|LOCUS_16410 230961 230326 gene locus_tag LOCUS_16420 230961 230326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 231336 232709 gene locus_tag LOCUS_16430 231336 232709 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027384.1 protein_id gnl|my_center|LOCUS_16430 234534 232729 gene locus_tag LOCUS_16440 234534 232729 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902160.1 protein_id gnl|my_center|LOCUS_16440 235230 234688 gene locus_tag LOCUS_16450 235230 234688 CDS product DUF1707 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030637.1 protein_id gnl|my_center|LOCUS_16450 236031 235327 gene locus_tag LOCUS_16460 236031 235327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 236579 236028 gene locus_tag LOCUS_16470 236579 236028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 236951 238540 gene locus_tag LOCUS_16480 236951 238540 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269288.1 protein_id gnl|my_center|LOCUS_16480 238685 239917 gene locus_tag LOCUS_16490 238685 239917 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227089.1 protein_id gnl|my_center|LOCUS_16490 240871 240005 gene locus_tag LOCUS_16500 240871 240005 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814441.1 protein_id gnl|my_center|LOCUS_16500 241667 241197 gene locus_tag LOCUS_16510 241667 241197 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092949.1 protein_id gnl|my_center|LOCUS_16510 243330 241834 gene locus_tag LOCUS_16520 243330 241834 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742107.1 protein_id gnl|my_center|LOCUS_16520 243575 244264 gene locus_tag LOCUS_16530 243575 244264 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031734.1 protein_id gnl|my_center|LOCUS_16530 245490 244210 gene locus_tag LOCUS_16540 245490 244210 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_16540 246145 245618 gene locus_tag LOCUS_16550 246145 245618 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867895.1 protein_id gnl|my_center|LOCUS_16550 246238 247173 gene locus_tag LOCUS_16560 246238 247173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029129.1 protein_id gnl|my_center|LOCUS_16560 247260 248801 gene locus_tag LOCUS_16570 247260 248801 CDS product ABC transporter membrane-spanning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029130.1 protein_id gnl|my_center|LOCUS_16570 250304 248880 gene locus_tag LOCUS_16580 250304 248880 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_16580 250194 250409 gene locus_tag LOCUS_16590 250194 250409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 250470 250910 gene locus_tag LOCUS_16600 250470 250910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 251719 250877 gene locus_tag LOCUS_16610 251719 250877 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_16610 252345 251716 gene locus_tag LOCUS_16620 252345 251716 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_16620 253209 252520 gene locus_tag LOCUS_16630 253209 252520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 256364 253530 gene locus_tag LOCUS_16640 256364 253530 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156089687.1 protein_id gnl|my_center|LOCUS_16640 259101 256369 gene locus_tag LOCUS_16650 259101 256369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 262117 259088 gene locus_tag LOCUS_16660 262117 259088 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223082.1 protein_id gnl|my_center|LOCUS_16660 262448 263824 gene locus_tag LOCUS_16670 262448 263824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 263850 264911 gene locus_tag LOCUS_16680 gene per 263850 264911 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918896.1 protein_id gnl|my_center|LOCUS_16680 264950 266137 gene locus_tag LOCUS_16690 264950 266137 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222787.1 protein_id gnl|my_center|LOCUS_16690 266137 266331 gene locus_tag LOCUS_16700 266137 266331 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229193.1 protein_id gnl|my_center|LOCUS_16700 266394 267152 gene locus_tag LOCUS_16710 266394 267152 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222578.1 protein_id gnl|my_center|LOCUS_16710 267152 269269 gene locus_tag LOCUS_16720 gene pabB 267152 269269 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_16720 269328 274586 gene locus_tag LOCUS_16730 269328 274586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 275625 274756 gene locus_tag LOCUS_16740 gene prmC 275625 274756 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229533.1 protein_id gnl|my_center|LOCUS_16740 275823 276848 gene locus_tag LOCUS_16750 275823 276848 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229376.1 protein_id gnl|my_center|LOCUS_16750 276909 277775 gene locus_tag LOCUS_16760 276909 277775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229377.1 protein_id gnl|my_center|LOCUS_16760 306030 277870 gene locus_tag LOCUS_16770 306030 277870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 306145 309345 gene locus_tag LOCUS_16780 306145 309345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 325834 309317 gene locus_tag LOCUS_16790 325834 309317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 342874 326024 gene locus_tag LOCUS_16800 342874 326024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 353376 342910 gene locus_tag LOCUS_16810 353376 342910 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030786.1 protein_id gnl|my_center|LOCUS_16810 381752 353388 gene locus_tag LOCUS_16820 381752 353388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16820 383285 382248 gene locus_tag LOCUS_16830 gene gmd 383285 382248 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284917.1 protein_id gnl|my_center|LOCUS_16830 383866 383462 gene locus_tag LOCUS_16840 383866 383462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 384642 383935 gene locus_tag LOCUS_16850 384642 383935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 384992 385633 gene locus_tag LOCUS_16860 384992 385633 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030270.1 protein_id gnl|my_center|LOCUS_16860 386540 385641 gene locus_tag LOCUS_16870 gene pqqB 386540 385641 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229609.1 protein_id gnl|my_center|LOCUS_16870 387604 386537 gene locus_tag LOCUS_16880 gene pqqE 387604 386537 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229608.1 protein_id gnl|my_center|LOCUS_16880 387834 387601 gene locus_tag LOCUS_16890 387834 387601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 388562 387858 gene locus_tag LOCUS_16900 gene pqqC 388562 387858 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729288.1 protein_id gnl|my_center|LOCUS_16900 388782 388612 gene locus_tag LOCUS_16910 388782 388612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 389121 388840 gene locus_tag LOCUS_16920 389121 388840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 389033 389566 gene locus_tag LOCUS_16930 389033 389566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 389590 390219 gene locus_tag LOCUS_16940 389590 390219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 390189 390749 gene locus_tag LOCUS_16950 390189 390749 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_16950 393349 391730 gene locus_tag LOCUS_16960 393349 391730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 393512 393357 gene locus_tag LOCUS_16970 393512 393357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 393767 393528 gene locus_tag LOCUS_16980 393767 393528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 394886 394512 gene locus_tag LOCUS_16990 394886 394512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 396192 395428 gene locus_tag LOCUS_17000 396192 395428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 396167 396661 gene locus_tag LOCUS_17010 396167 396661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 396624 396794 gene locus_tag LOCUS_17020 396624 396794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 396990 397346 gene locus_tag LOCUS_17030 396990 397346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 398381 398845 gene locus_tag LOCUS_17040 398381 398845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 399165 399515 gene locus_tag LOCUS_17050 399165 399515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 399672 399878 gene locus_tag LOCUS_17060 399672 399878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 401139 400948 gene locus_tag LOCUS_17070 401139 400948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 401432 401283 gene locus_tag LOCUS_17080 401432 401283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 402196 401531 gene locus_tag LOCUS_17090 402196 401531 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225799.1 protein_id gnl|my_center|LOCUS_17090 402306 403238 gene locus_tag LOCUS_17100 402306 403238 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_17100 403518 403180 gene locus_tag LOCUS_17110 403518 403180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17110 403672 403989 gene locus_tag LOCUS_17120 403672 403989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 403983 404462 gene locus_tag LOCUS_17130 403983 404462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 404707 405240 gene locus_tag LOCUS_17140 404707 405240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746474.1 protein_id gnl|my_center|LOCUS_17140 405251 406261 gene locus_tag LOCUS_17150 405251 406261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729272.1 protein_id gnl|my_center|LOCUS_17150 406283 407617 gene locus_tag LOCUS_17160 406283 407617 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227456.1 protein_id gnl|my_center|LOCUS_17160 407635 408525 gene locus_tag LOCUS_17170 407635 408525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 409193 408582 gene locus_tag LOCUS_17180 409193 408582 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588705.1 protein_id gnl|my_center|LOCUS_17180 409684 409316 gene locus_tag LOCUS_17190 409684 409316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 409566 409811 gene locus_tag LOCUS_17200 409566 409811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 409798 410343 gene locus_tag LOCUS_17210 409798 410343 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228137.1 protein_id gnl|my_center|LOCUS_17210 410697 410557 gene locus_tag LOCUS_17220 410697 410557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 410854 411477 gene locus_tag LOCUS_17230 410854 411477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 411771 411577 gene locus_tag LOCUS_17240 411771 411577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 412075 412662 gene locus_tag LOCUS_17250 412075 412662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 412805 413062 gene locus_tag LOCUS_17260 412805 413062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 413383 413054 gene locus_tag LOCUS_17270 413383 413054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 418038 413494 gene locus_tag LOCUS_17280 418038 413494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 421180 418055 gene locus_tag LOCUS_17290 421180 418055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 421520 422728 gene locus_tag LOCUS_17300 421520 422728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 422797 423531 gene locus_tag LOCUS_17310 422797 423531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 424333 423689 gene locus_tag LOCUS_17320 424333 423689 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495312.1 protein_id gnl|my_center|LOCUS_17320 424523 425086 gene locus_tag LOCUS_17330 424523 425086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 425253 426752 gene locus_tag LOCUS_17340 425253 426752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 427045 427434 gene locus_tag LOCUS_17350 427045 427434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 429592 427511 gene locus_tag LOCUS_17360 429592 427511 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031735.1 protein_id gnl|my_center|LOCUS_17360 429951 431096 gene locus_tag LOCUS_17370 429951 431096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 431120 432379 gene locus_tag LOCUS_17380 431120 432379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 432691 435243 gene locus_tag LOCUS_17390 432691 435243 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031588.1 protein_id gnl|my_center|LOCUS_17390 435731 435354 gene locus_tag LOCUS_17400 435731 435354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 438178 435923 gene locus_tag LOCUS_17410 438178 435923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 439695 438319 gene locus_tag LOCUS_17420 439695 438319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230284.1 protein_id gnl|my_center|LOCUS_17420 440891 439797 gene locus_tag LOCUS_17430 440891 439797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 441202 440903 gene locus_tag LOCUS_17440 441202 440903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 441324 443000 gene locus_tag LOCUS_17450 441324 443000 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212987816.1 protein_id gnl|my_center|LOCUS_17450 443740 447759 gene locus_tag LOCUS_17460 443740 447759 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172623.1 protein_id gnl|my_center|LOCUS_17460 447796 449016 gene locus_tag LOCUS_17470 447796 449016 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031624.1 protein_id gnl|my_center|LOCUS_17470 449979 449110 gene locus_tag LOCUS_17480 449979 449110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 450666 450037 gene locus_tag LOCUS_17490 450666 450037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 453834 450892 gene locus_tag LOCUS_17500 453834 450892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 453973 454719 gene locus_tag LOCUS_17510 453973 454719 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222336.1 protein_id gnl|my_center|LOCUS_17510 455991 454798 gene locus_tag LOCUS_17520 455991 454798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029659.1 protein_id gnl|my_center|LOCUS_17520 456090 456620 gene locus_tag LOCUS_17530 456090 456620 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229654.1 protein_id gnl|my_center|LOCUS_17530 457579 456698 gene locus_tag LOCUS_17540 457579 456698 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976361.1 protein_id gnl|my_center|LOCUS_17540 457721 458113 gene locus_tag LOCUS_17550 457721 458113 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742073.1 protein_id gnl|my_center|LOCUS_17550 458227 459204 gene locus_tag LOCUS_17560 458227 459204 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223629.1 protein_id gnl|my_center|LOCUS_17560 459900 459220 gene locus_tag LOCUS_17570 459900 459220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 460095 461720 gene locus_tag LOCUS_17580 460095 461720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 462548 461784 gene locus_tag LOCUS_17590 462548 461784 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031564.1 protein_id gnl|my_center|LOCUS_17590 462629 464218 gene locus_tag LOCUS_17600 462629 464218 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093303.1 protein_id gnl|my_center|LOCUS_17600 465316 464300 gene locus_tag LOCUS_17610 465316 464300 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815985.1 protein_id gnl|my_center|LOCUS_17610 465515 466384 gene locus_tag LOCUS_17620 465515 466384 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098166.1 protein_id gnl|my_center|LOCUS_17620 467322 466417 gene locus_tag LOCUS_17630 467322 466417 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227084.1 protein_id gnl|my_center|LOCUS_17630 468159 467323 gene locus_tag LOCUS_17640 468159 467323 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106196.1 protein_id gnl|my_center|LOCUS_17640 469466 468156 gene locus_tag LOCUS_17650 469466 468156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 469558 471696 gene locus_tag LOCUS_17660 469558 471696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 471693 472265 gene locus_tag LOCUS_17670 471693 472265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 472262 473362 gene locus_tag LOCUS_17680 472262 473362 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225858.1 protein_id gnl|my_center|LOCUS_17680 473409 473663 gene locus_tag LOCUS_17690 473409 473663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 473660 474892 gene locus_tag LOCUS_17700 473660 474892 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 protein_id gnl|my_center|LOCUS_17700 475980 474928 gene locus_tag LOCUS_17710 475980 474928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 476205 477206 gene locus_tag LOCUS_17720 476205 477206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 477983 477270 gene locus_tag LOCUS_17730 477983 477270 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_17730 478099 478896 gene locus_tag LOCUS_17740 478099 478896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 479426 478947 gene locus_tag LOCUS_17750 479426 478947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 479836 479618 gene locus_tag LOCUS_17760 479836 479618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 480639 479833 gene locus_tag LOCUS_17770 480639 479833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 481854 480706 gene locus_tag LOCUS_17780 481854 480706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971889.1 protein_id gnl|my_center|LOCUS_17780 482053 483246 gene locus_tag LOCUS_17790 482053 483246 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857806.1 protein_id gnl|my_center|LOCUS_17790 483894 483307 gene locus_tag LOCUS_17800 483894 483307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 484724 483984 gene locus_tag LOCUS_17810 484724 483984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 484903 485091 gene locus_tag LOCUS_17820 484903 485091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 485075 486802 gene locus_tag LOCUS_17830 gene polX 485075 486802 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_17830 487450 486818 gene locus_tag LOCUS_17840 487450 486818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223836.1 protein_id gnl|my_center|LOCUS_17840 487703 489949 gene locus_tag LOCUS_17850 487703 489949 CDS product terpene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030632.1 protein_id gnl|my_center|LOCUS_17850 490082 490008 gene locus_tag LOCUS_t00150 490082 490008 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 491106 490093 gene locus_tag LOCUS_17860 491106 490093 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027092.1 protein_id gnl|my_center|LOCUS_17860 491749 491114 gene locus_tag LOCUS_17870 491749 491114 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484358.1 protein_id gnl|my_center|LOCUS_17870 491898 493028 gene locus_tag LOCUS_17880 491898 493028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 494853 493042 gene locus_tag LOCUS_17890 494853 493042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 495322 494996 gene locus_tag LOCUS_17900 495322 494996 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405871.1 protein_id gnl|my_center|LOCUS_17900 496362 495448 gene locus_tag LOCUS_17910 496362 495448 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972197.1 protein_id gnl|my_center|LOCUS_17910 496469 497497 gene locus_tag LOCUS_17920 gene tdh 496469 497497 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031190.1 protein_id gnl|my_center|LOCUS_17920 497562 498749 gene locus_tag LOCUS_17930 497562 498749 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_17930 499365 498817 gene locus_tag LOCUS_17940 499365 498817 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974701.1 protein_id gnl|my_center|LOCUS_17940 499543 500769 gene locus_tag LOCUS_17950 499543 500769 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029547.1 protein_id gnl|my_center|LOCUS_17950 500766 501410 gene locus_tag LOCUS_17960 500766 501410 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029548.1 protein_id gnl|my_center|LOCUS_17960 502881 501466 gene locus_tag LOCUS_17970 502881 501466 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028961.1 protein_id gnl|my_center|LOCUS_17970 503536 502889 gene locus_tag LOCUS_17980 503536 502889 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_17980 503955 504545 gene locus_tag LOCUS_17990 503955 504545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 504538 505410 gene locus_tag LOCUS_18000 504538 505410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 506032 505460 gene locus_tag LOCUS_18010 506032 505460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 506551 506177 gene locus_tag LOCUS_18020 506551 506177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978181.1 protein_id gnl|my_center|LOCUS_18020 506996 506604 gene locus_tag LOCUS_18030 506996 506604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 507900 507094 gene locus_tag LOCUS_18040 507900 507094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978179.1 protein_id gnl|my_center|LOCUS_18040 508283 507897 gene locus_tag LOCUS_18050 508283 507897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027293.1 protein_id gnl|my_center|LOCUS_18050 508556 509044 gene locus_tag LOCUS_18060 508556 509044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 509336 510400 gene locus_tag LOCUS_18070 509336 510400 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877764.1 protein_id gnl|my_center|LOCUS_18070 510527 511219 gene locus_tag LOCUS_18080 510527 511219 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026924.1 protein_id gnl|my_center|LOCUS_18080 512983 511271 gene locus_tag LOCUS_18090 512983 511271 CDS product two-component system sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_18090 513813 513130 gene locus_tag LOCUS_18100 513813 513130 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978125.1 protein_id gnl|my_center|LOCUS_18100 513954 514910 gene locus_tag LOCUS_18110 513954 514910 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_18110 515925 514951 gene locus_tag LOCUS_18120 515925 514951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 517463 516066 gene locus_tag LOCUS_18130 517463 516066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 518290 517460 gene locus_tag LOCUS_18140 518290 517460 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850455.1 protein_id gnl|my_center|LOCUS_18140 518975 518367 gene locus_tag LOCUS_18150 518975 518367 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_18150 519960 518956 gene locus_tag LOCUS_18160 519960 518956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742152.1 protein_id gnl|my_center|LOCUS_18160 520162 521733 gene locus_tag LOCUS_18170 520162 521733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 522434 521682 gene locus_tag LOCUS_18180 522434 521682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 523642 522434 gene locus_tag LOCUS_18190 523642 522434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 523823 525070 gene locus_tag LOCUS_18200 523823 525070 CDS product streptophobe family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220451617.1 protein_id gnl|my_center|LOCUS_18200 527223 525385 gene locus_tag LOCUS_18210 527223 525385 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030250.1 protein_id gnl|my_center|LOCUS_18210 527946 527506 gene locus_tag LOCUS_18220 527946 527506 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259144.1 protein_id gnl|my_center|LOCUS_18220 528053 530422 gene locus_tag LOCUS_18230 528053 530422 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_18230 530433 531206 gene locus_tag LOCUS_18240 530433 531206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 531206 532210 gene locus_tag LOCUS_18250 531206 532210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 533295 532198 gene locus_tag LOCUS_18260 533295 532198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 533824 533420 gene locus_tag LOCUS_18270 533824 533420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 533976 534521 gene locus_tag LOCUS_18280 533976 534521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 535148 534681 gene locus_tag LOCUS_18290 535148 534681 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228499.1 protein_id gnl|my_center|LOCUS_18290 536607 535213 gene locus_tag LOCUS_18300 536607 535213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228500.1 protein_id gnl|my_center|LOCUS_18300 537751 536657 gene locus_tag LOCUS_18310 537751 536657 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030823.1 protein_id gnl|my_center|LOCUS_18310 537934 538905 gene locus_tag LOCUS_18320 537934 538905 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_18320 538994 540445 gene locus_tag LOCUS_18330 538994 540445 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229297.1 protein_id gnl|my_center|LOCUS_18330 540514 541245 gene locus_tag LOCUS_18340 540514 541245 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112978.1 protein_id gnl|my_center|LOCUS_18340 542758 541472 gene locus_tag LOCUS_18350 542758 541472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 543051 544052 gene locus_tag LOCUS_18360 543051 544052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 544049 545302 gene locus_tag LOCUS_18370 544049 545302 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243878.1 protein_id gnl|my_center|LOCUS_18370 545299 545841 gene locus_tag LOCUS_18380 545299 545841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 545884 546291 gene locus_tag LOCUS_18390 545884 546291 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974528.1 protein_id gnl|my_center|LOCUS_18390 546300 547445 gene locus_tag LOCUS_18400 546300 547445 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 protein_id gnl|my_center|LOCUS_18400 548093 547476 gene locus_tag LOCUS_18410 548093 547476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 548164 549087 gene locus_tag LOCUS_18420 548164 549087 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028976.1 protein_id gnl|my_center|LOCUS_18420 549142 550686 gene locus_tag LOCUS_18430 549142 550686 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028977.1 protein_id gnl|my_center|LOCUS_18430 551003 550728 gene locus_tag LOCUS_18440 551003 550728 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972569.1 protein_id gnl|my_center|LOCUS_18440 551051 551845 gene locus_tag LOCUS_18450 gene map 551051 551845 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972570.1 protein_id gnl|my_center|LOCUS_18450 552380 551889 gene locus_tag LOCUS_18460 552380 551889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 552837 556157 gene locus_tag LOCUS_18470 552837 556157 CDS product ALF repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030734.1 protein_id gnl|my_center|LOCUS_18470 556210 556629 gene locus_tag LOCUS_18480 556210 556629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 556731 557252 gene locus_tag LOCUS_18490 556731 557252 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978724.1 protein_id gnl|my_center|LOCUS_18490 557316 558791 gene locus_tag LOCUS_18500 557316 558791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 558886 559830 gene locus_tag LOCUS_18510 558886 559830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084071.1 protein_id gnl|my_center|LOCUS_18510 560501 559839 gene locus_tag LOCUS_18520 560501 559839 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261876.1 protein_id gnl|my_center|LOCUS_18520 561508 560498 gene locus_tag LOCUS_18530 561508 560498 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082323.1 protein_id gnl|my_center|LOCUS_18530 562390 561512 gene locus_tag LOCUS_18540 562390 561512 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721578.1 protein_id gnl|my_center|LOCUS_18540 562629 563537 gene locus_tag LOCUS_18550 562629 563537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 564039 563512 gene locus_tag LOCUS_18560 564039 563512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031317.1 protein_id gnl|my_center|LOCUS_18560 564844 564170 gene locus_tag LOCUS_18570 564844 564170 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079853.1 protein_id gnl|my_center|LOCUS_18570 566930 564861 gene locus_tag LOCUS_18580 566930 564861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 567158 568219 gene locus_tag LOCUS_18590 567158 568219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 568253 570853 gene locus_tag LOCUS_18600 gene lanKC 568253 570853 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222285.1 protein_id gnl|my_center|LOCUS_18600 570986 573502 gene locus_tag LOCUS_18610 gene lanKC 570986 573502 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_18610 573656 574198 gene locus_tag LOCUS_18620 573656 574198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 575778 574222 gene locus_tag LOCUS_18630 575778 574222 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_18630 576615 576016 gene locus_tag LOCUS_18640 576615 576016 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087440.1 protein_id gnl|my_center|LOCUS_18640 576899 576675 gene locus_tag LOCUS_18650 576899 576675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 579214 577004 gene locus_tag LOCUS_18660 579214 577004 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049717556.1 protein_id gnl|my_center|LOCUS_18660 579845 579228 gene locus_tag LOCUS_18670 579845 579228 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639392.1 protein_id gnl|my_center|LOCUS_18670 580453 579938 gene locus_tag LOCUS_18680 580453 579938 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223809.1 protein_id gnl|my_center|LOCUS_18680 583043 580506 gene locus_tag LOCUS_18690 583043 580506 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390108.1 protein_id gnl|my_center|LOCUS_18690 584407 583040 gene locus_tag LOCUS_18700 584407 583040 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014014.1 protein_id gnl|my_center|LOCUS_18700 584564 586738 gene locus_tag LOCUS_18710 584564 586738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 589633 586769 gene locus_tag LOCUS_18720 589633 586769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 590290 589640 gene locus_tag LOCUS_18730 590290 589640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 591285 590263 gene locus_tag LOCUS_18740 591285 590263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 591867 591349 gene locus_tag LOCUS_18750 591867 591349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 592106 592528 gene locus_tag LOCUS_18760 592106 592528 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227883.1 protein_id gnl|my_center|LOCUS_18760 592668 593123 gene locus_tag LOCUS_18770 592668 593123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 594726 593179 gene locus_tag LOCUS_18780 594726 593179 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029563.1 protein_id gnl|my_center|LOCUS_18780 595309 594818 gene locus_tag LOCUS_18790 595309 594818 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977591.1 protein_id gnl|my_center|LOCUS_18790 596669 595695 gene locus_tag LOCUS_18800 596669 595695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 597373 596666 gene locus_tag LOCUS_18810 597373 596666 CDS product spherulation-specific family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973799.1 protein_id gnl|my_center|LOCUS_18810 598329 597370 gene locus_tag LOCUS_18820 598329 597370 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134112038.1 protein_id gnl|my_center|LOCUS_18820 599052 598339 gene locus_tag LOCUS_18830 599052 598339 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_18830 600154 599153 gene locus_tag LOCUS_18840 600154 599153 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887356.1 protein_id gnl|my_center|LOCUS_18840 601638 600190 gene locus_tag LOCUS_18850 601638 600190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 603152 601635 gene locus_tag LOCUS_18860 gene pelF 603152 601635 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_18860 605330 603216 gene locus_tag LOCUS_18870 605330 603216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887353.1 protein_id gnl|my_center|LOCUS_18870 605281 605439 gene locus_tag LOCUS_18880 605281 605439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 606184 607338 gene locus_tag LOCUS_18890 606184 607338 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110400007.1 protein_id gnl|my_center|LOCUS_18890 607449 608390 gene locus_tag LOCUS_18900 607449 608390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 609381 608449 gene locus_tag LOCUS_18910 609381 608449 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898125.1 protein_id gnl|my_center|LOCUS_18910 610017 609448 gene locus_tag LOCUS_18920 610017 609448 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227904.1 protein_id gnl|my_center|LOCUS_18920 610135 610890 gene locus_tag LOCUS_18930 610135 610890 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730833.1 protein_id gnl|my_center|LOCUS_18930 610887 612005 gene locus_tag LOCUS_18940 610887 612005 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899004.1 protein_id gnl|my_center|LOCUS_18940 612084 612668 gene locus_tag LOCUS_18950 612084 612668 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027864.1 protein_id gnl|my_center|LOCUS_18950 613578 612673 gene locus_tag LOCUS_18960 613578 612673 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027493.1 protein_id gnl|my_center|LOCUS_18960 613817 615217 gene locus_tag LOCUS_18970 613817 615217 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027490.1 protein_id gnl|my_center|LOCUS_18970 615341 616459 gene locus_tag LOCUS_18980 615341 616459 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_18980 616586 618061 gene locus_tag LOCUS_18990 616586 618061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 618123 619451 gene locus_tag LOCUS_19000 618123 619451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 620529 619405 gene locus_tag LOCUS_19010 620529 619405 CDS product ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031466.1 protein_id gnl|my_center|LOCUS_19010 622397 620526 gene locus_tag LOCUS_19020 622397 620526 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970769.1 protein_id gnl|my_center|LOCUS_19020 622891 622394 gene locus_tag LOCUS_19030 622891 622394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970771.1 protein_id gnl|my_center|LOCUS_19030 623951 623010 gene locus_tag LOCUS_19040 623951 623010 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227667.1 protein_id gnl|my_center|LOCUS_19040 625637 624105 gene locus_tag LOCUS_19050 625637 624105 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400663.1 protein_id gnl|my_center|LOCUS_19050 627518 625641 gene locus_tag LOCUS_19060 627518 625641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 628300 627515 gene locus_tag LOCUS_19070 628300 627515 CDS product hydrogenase HycP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400661.1 protein_id gnl|my_center|LOCUS_19070 629269 628307 gene locus_tag LOCUS_19080 629269 628307 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900802.1 protein_id gnl|my_center|LOCUS_19080 631314 629266 gene locus_tag LOCUS_19090 631314 629266 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907280.1 protein_id gnl|my_center|LOCUS_19090 631921 631439 gene locus_tag LOCUS_19100 631921 631439 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400658.1 protein_id gnl|my_center|LOCUS_19100 632090 632626 gene locus_tag LOCUS_19110 632090 632626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 632704 633609 gene locus_tag LOCUS_19120 632704 633609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 634117 633692 gene locus_tag LOCUS_19130 634117 633692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 634381 635589 gene locus_tag LOCUS_19140 634381 635589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029232.1 protein_id gnl|my_center|LOCUS_19140 636625 635594 gene locus_tag LOCUS_19150 636625 635594 CDS product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 protein_id gnl|my_center|LOCUS_19150 636767 637984 gene locus_tag LOCUS_19160 636767 637984 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977624.1 protein_id gnl|my_center|LOCUS_19160 637997 638563 gene locus_tag LOCUS_19170 637997 638563 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027654.1 protein_id gnl|my_center|LOCUS_19170 638951 638505 gene locus_tag LOCUS_19180 638951 638505 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203374.1 protein_id gnl|my_center|LOCUS_19180 639016 639633 gene locus_tag LOCUS_19190 639016 639633 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978089.1 protein_id gnl|my_center|LOCUS_19190 639737 639609 gene locus_tag LOCUS_19200 639737 639609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 640137 639796 gene locus_tag LOCUS_19210 640137 639796 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_19210 640328 640143 gene locus_tag LOCUS_19220 640328 640143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 640533 642365 gene locus_tag LOCUS_19230 640533 642365 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_19230 642496 644397 gene locus_tag LOCUS_19240 642496 644397 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_19240 645477 644416 gene locus_tag LOCUS_19250 645477 644416 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_19250 646648 645587 gene locus_tag LOCUS_19260 646648 645587 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_19260 646742 647755 gene locus_tag LOCUS_19270 gene ligD 646742 647755 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_19270 647910 648416 gene locus_tag LOCUS_19280 647910 648416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 648726 648529 gene locus_tag LOCUS_19290 648726 648529 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027163.1 protein_id gnl|my_center|LOCUS_19290 649390 648830 gene locus_tag LOCUS_19300 649390 648830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 651136 649709 gene locus_tag LOCUS_19310 651136 649709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977413.1 protein_id gnl|my_center|LOCUS_19310 651468 653003 gene locus_tag LOCUS_19320 651468 653003 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031544.1 protein_id gnl|my_center|LOCUS_19320 654544 653057 gene locus_tag LOCUS_19330 654544 653057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031543.1 protein_id gnl|my_center|LOCUS_19330 654982 654590 gene locus_tag LOCUS_19340 654982 654590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 654951 655886 gene locus_tag LOCUS_19350 654951 655886 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971893.1 protein_id gnl|my_center|LOCUS_19350 656215 658143 gene locus_tag LOCUS_19360 656215 658143 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031541.1 protein_id gnl|my_center|LOCUS_19360 658727 658227 gene locus_tag LOCUS_19370 658727 658227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031540.1 protein_id gnl|my_center|LOCUS_19370 659061 658822 gene locus_tag LOCUS_19380 659061 658822 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971899.1 protein_id gnl|my_center|LOCUS_19380 660307 659141 gene locus_tag LOCUS_19390 660307 659141 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_19390 661374 660304 gene locus_tag LOCUS_19400 661374 660304 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_19400 662332 661388 gene locus_tag LOCUS_19410 662332 661388 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224428.1 protein_id gnl|my_center|LOCUS_19410 663148 662348 gene locus_tag LOCUS_19420 663148 662348 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_19420 663292 664935 gene locus_tag LOCUS_19430 663292 664935 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225732.1 protein_id gnl|my_center|LOCUS_19430 665101 667050 gene locus_tag LOCUS_19440 665101 667050 CDS product phospholipase C, phosphocholine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113149.1 protein_id gnl|my_center|LOCUS_19440 667141 668478 gene locus_tag LOCUS_19450 gene paaF 667141 668478 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031681.1 protein_id gnl|my_center|LOCUS_19450 668475 668714 gene locus_tag LOCUS_19460 668475 668714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 668990 670621 gene locus_tag LOCUS_19470 gene glsA 668990 670621 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021841.1 protein_id gnl|my_center|LOCUS_19470 672018 670720 gene locus_tag LOCUS_19480 672018 670720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 672663 673946 gene locus_tag LOCUS_19490 672663 673946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026998.1 protein_id gnl|my_center|LOCUS_19490 674642 674106 gene locus_tag LOCUS_19500 674642 674106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 674538 674774 gene locus_tag LOCUS_19510 674538 674774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 674888 675970 gene locus_tag LOCUS_19520 674888 675970 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_19520 676592 679729 gene locus_tag LOCUS_19530 gene cypB 676592 679729 CDS product bifunctional cytochrome P450/NADPH--P450 reductase CypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246174.1 protein_id gnl|my_center|LOCUS_19530 680452 679826 gene locus_tag LOCUS_19540 680452 679826 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449652.1 protein_id gnl|my_center|LOCUS_19540 681629 680730 gene locus_tag LOCUS_19550 681629 680730 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_19550 682029 681853 gene locus_tag LOCUS_19560 682029 681853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 682222 682815 gene locus_tag LOCUS_19570 682222 682815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 684557 683007 gene locus_tag LOCUS_19580 684557 683007 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011541218.1 protein_id gnl|my_center|LOCUS_19580 685765 684554 gene locus_tag LOCUS_19590 685765 684554 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085883.1 protein_id gnl|my_center|LOCUS_19590 688271 685836 gene locus_tag LOCUS_19600 688271 685836 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031533.1 protein_id gnl|my_center|LOCUS_19600 688421 690007 gene locus_tag LOCUS_19610 688421 690007 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_19610 690518 690057 gene locus_tag LOCUS_19620 690518 690057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 690417 690830 gene locus_tag LOCUS_19630 690417 690830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 691927 690728 gene locus_tag LOCUS_19640 691927 690728 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_19640 693173 692004 gene locus_tag LOCUS_19650 693173 692004 CDS product DMATS family aromatic prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031680.1 protein_id gnl|my_center|LOCUS_19650 693635 701143 gene locus_tag LOCUS_19660 693635 701143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 701175 701405 gene locus_tag LOCUS_19670 701175 701405 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975599.1 protein_id gnl|my_center|LOCUS_19670 701402 702610 gene locus_tag LOCUS_19680 701402 702610 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285235.1 protein_id gnl|my_center|LOCUS_19680 703689 702673 gene locus_tag LOCUS_19690 703689 702673 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_19690 705145 703811 gene locus_tag LOCUS_19700 705145 703811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 706341 705337 gene locus_tag LOCUS_19710 706341 705337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 707977 706490 gene locus_tag LOCUS_19720 707977 706490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 710623 707999 gene locus_tag LOCUS_19730 710623 707999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 710978 710628 gene locus_tag LOCUS_19740 710978 710628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 711199 712179 gene locus_tag LOCUS_19750 711199 712179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 713504 712176 gene locus_tag LOCUS_19760 713504 712176 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227817.1 protein_id gnl|my_center|LOCUS_19760 713976 713608 gene locus_tag LOCUS_19770 713976 713608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 714137 714364 gene locus_tag LOCUS_19780 714137 714364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 714992 714591 gene locus_tag LOCUS_19790 714992 714591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 715825 715328 gene locus_tag LOCUS_19800 715825 715328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 716626 718740 gene locus_tag LOCUS_19810 gene pabB 716626 718740 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 protein_id gnl|my_center|LOCUS_19810 718974 719429 gene locus_tag LOCUS_19820 718974 719429 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_19820 719486 722380 gene locus_tag LOCUS_19830 719486 722380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 723150 722449 gene locus_tag LOCUS_19840 723150 722449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 723195 723455 gene locus_tag LOCUS_19850 723195 723455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 723452 724819 gene locus_tag LOCUS_19860 723452 724819 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007460623.1 protein_id gnl|my_center|LOCUS_19860 724816 725367 gene locus_tag LOCUS_19870 724816 725367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 725364 725930 gene locus_tag LOCUS_19880 725364 725930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 726074 727075 gene locus_tag LOCUS_19890 726074 727075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 727110 727826 gene locus_tag LOCUS_19900 gene fabG1 727110 727826 CDS product 3-oxoacyl-ACP reductase FabG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057861.1 protein_id gnl|my_center|LOCUS_19900 730074 728602 gene locus_tag LOCUS_19910 730074 728602 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167861.1 protein_id gnl|my_center|LOCUS_19910 730713 730129 gene locus_tag LOCUS_19920 730713 730129 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237178.1 protein_id gnl|my_center|LOCUS_19920 732812 731475 gene locus_tag LOCUS_19930 732812 731475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 733677 733369 gene locus_tag LOCUS_19940 733677 733369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 733676 734551 gene locus_tag LOCUS_19950 733676 734551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 735067 734663 gene locus_tag LOCUS_19960 735067 734663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 735579 735430 gene locus_tag LOCUS_19970 735579 735430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 736029 735835 gene locus_tag LOCUS_19980 736029 735835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 736306 737208 gene locus_tag LOCUS_19990 736306 737208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 738557 737361 gene locus_tag LOCUS_20000 738557 737361 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212045.1 protein_id gnl|my_center|LOCUS_20000 739511 740617 gene locus_tag LOCUS_20010 739511 740617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 741272 742264 gene locus_tag LOCUS_20020 gene dhaK 741272 742264 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972071.1 protein_id gnl|my_center|LOCUS_20020 743684 742281 gene locus_tag LOCUS_20030 743684 742281 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027651.1 protein_id gnl|my_center|LOCUS_20030 745337 743886 gene locus_tag LOCUS_20040 745337 743886 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132388.1 protein_id gnl|my_center|LOCUS_20040 746402 745911 gene locus_tag LOCUS_20050 746402 745911 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977815.1 protein_id gnl|my_center|LOCUS_20050 747138 746551 gene locus_tag LOCUS_20060 747138 746551 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977812.1 protein_id gnl|my_center|LOCUS_20060 748026 747229 gene locus_tag LOCUS_20070 748026 747229 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873288.1 protein_id gnl|my_center|LOCUS_20070 748085 749254 gene locus_tag LOCUS_20080 748085 749254 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484591.1 protein_id gnl|my_center|LOCUS_20080 750542 749274 gene locus_tag LOCUS_20090 750542 749274 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027524.1 protein_id gnl|my_center|LOCUS_20090 750710 751243 gene locus_tag LOCUS_20100 750710 751243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977808.1 protein_id gnl|my_center|LOCUS_20100 751309 752145 gene locus_tag LOCUS_20110 751309 752145 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027526.1 protein_id gnl|my_center|LOCUS_20110 752330 753001 gene locus_tag LOCUS_20120 752330 753001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027527.1 protein_id gnl|my_center|LOCUS_20120 753145 755517 gene locus_tag LOCUS_20130 753145 755517 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666873.1 protein_id gnl|my_center|LOCUS_20130 755657 756505 gene locus_tag LOCUS_20140 755657 756505 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977803.1 protein_id gnl|my_center|LOCUS_20140 757620 756511 gene locus_tag LOCUS_20150 757620 756511 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977801.1 protein_id gnl|my_center|LOCUS_20150 757757 758095 gene locus_tag LOCUS_20160 757757 758095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 758463 758269 gene locus_tag LOCUS_20170 758463 758269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 758383 758892 gene locus_tag LOCUS_20180 758383 758892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 760024 758921 gene locus_tag LOCUS_20190 760024 758921 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027535.1 protein_id gnl|my_center|LOCUS_20190 759917 760171 gene locus_tag LOCUS_20200 759917 760171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 760159 761409 gene locus_tag LOCUS_20210 760159 761409 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027555.1 protein_id gnl|my_center|LOCUS_20210 761449 762342 gene locus_tag LOCUS_20220 761449 762342 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628631.1 protein_id gnl|my_center|LOCUS_20220 763633 762422 gene locus_tag LOCUS_20230 763633 762422 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977757.1 protein_id gnl|my_center|LOCUS_20230 763796 765184 gene locus_tag LOCUS_20240 763796 765184 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977756.1 protein_id gnl|my_center|LOCUS_20240 765655 765242 gene locus_tag LOCUS_20250 765655 765242 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030828.1 protein_id gnl|my_center|LOCUS_20250 766977 765652 gene locus_tag LOCUS_20260 766977 765652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 767238 768836 gene locus_tag LOCUS_20270 767238 768836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_20270 768833 769360 gene locus_tag LOCUS_20280 768833 769360 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030831.1 protein_id gnl|my_center|LOCUS_20280 769357 770298 gene locus_tag LOCUS_20290 769357 770298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 771547 770510 gene locus_tag LOCUS_20300 771547 770510 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977755.1 protein_id gnl|my_center|LOCUS_20300 772766 771765 gene locus_tag LOCUS_20310 772766 771765 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_20310 773099 774139 gene locus_tag LOCUS_20320 773099 774139 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977752.1 protein_id gnl|my_center|LOCUS_20320 775508 774222 gene locus_tag LOCUS_20330 775508 774222 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_20330 776056 775628 gene locus_tag LOCUS_20340 776056 775628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 776080 777330 gene locus_tag LOCUS_20350 776080 777330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 778372 777410 gene locus_tag LOCUS_20360 778372 777410 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_20360 779200 778418 gene locus_tag LOCUS_20370 779200 778418 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_20370 779902 779396 gene locus_tag LOCUS_20380 779902 779396 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977747.1 protein_id gnl|my_center|LOCUS_20380 780303 779962 gene locus_tag LOCUS_20390 780303 779962 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977746.1 protein_id gnl|my_center|LOCUS_20390 780575 781291 gene locus_tag LOCUS_20400 780575 781291 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977745.1 protein_id gnl|my_center|LOCUS_20400 782460 781369 gene locus_tag LOCUS_20410 782460 781369 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 protein_id gnl|my_center|LOCUS_20410 783233 782439 gene locus_tag LOCUS_20420 783233 782439 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325632.1 protein_id gnl|my_center|LOCUS_20420 784627 783230 gene locus_tag LOCUS_20430 784627 783230 CDS product DUF6421 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977741.1 protein_id gnl|my_center|LOCUS_20430 785448 784897 gene locus_tag LOCUS_20440 785448 784897 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027568.1 protein_id gnl|my_center|LOCUS_20440 785509 785919 gene locus_tag LOCUS_20450 785509 785919 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977738.1 protein_id gnl|my_center|LOCUS_20450 786107 786697 gene locus_tag LOCUS_20460 786107 786697 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027575.1 protein_id gnl|my_center|LOCUS_20460 786827 787765 gene locus_tag LOCUS_20470 786827 787765 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027576.1 protein_id gnl|my_center|LOCUS_20470 788165 787800 gene locus_tag LOCUS_20480 788165 787800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 788372 788995 gene locus_tag LOCUS_20490 788372 788995 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229333.1 protein_id gnl|my_center|LOCUS_20490 790689 788956 gene locus_tag LOCUS_20500 790689 788956 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229334.1 protein_id gnl|my_center|LOCUS_20500 791018 791374 gene locus_tag LOCUS_20510 791018 791374 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225525.1 protein_id gnl|my_center|LOCUS_20510 792677 791529 gene locus_tag LOCUS_20520 792677 791529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230190.1 protein_id gnl|my_center|LOCUS_20520 793513 792803 gene locus_tag LOCUS_20530 793513 792803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230191.1 protein_id gnl|my_center|LOCUS_20530 794691 793510 gene locus_tag LOCUS_20540 794691 793510 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191306837.1 protein_id gnl|my_center|LOCUS_20540 795356 794778 gene locus_tag LOCUS_20550 795356 794778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 795807 796043 gene locus_tag LOCUS_20560 795807 796043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 797096 795966 gene locus_tag LOCUS_20570 797096 795966 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729758.1 protein_id gnl|my_center|LOCUS_20570 797757 797467 gene locus_tag LOCUS_20580 797757 797467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 797970 800819 gene locus_tag LOCUS_20590 797970 800819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 802322 801777 gene locus_tag LOCUS_20600 802322 801777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 803623 802337 gene locus_tag LOCUS_20610 803623 802337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028595.1 protein_id gnl|my_center|LOCUS_20610 803818 804165 gene locus_tag LOCUS_20620 803818 804165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 804162 804422 gene locus_tag LOCUS_20630 804162 804422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 804419 804706 gene locus_tag LOCUS_20640 804419 804706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 804972 805733 gene locus_tag LOCUS_20650 804972 805733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 805744 806877 gene locus_tag LOCUS_20660 805744 806877 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_20660 807276 808145 gene locus_tag LOCUS_20670 807276 808145 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027413.1 protein_id gnl|my_center|LOCUS_20670 808452 808189 gene locus_tag LOCUS_20680 808452 808189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 808488 808799 gene locus_tag LOCUS_20690 808488 808799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 808780 810222 gene locus_tag LOCUS_20700 808780 810222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255956.1 protein_id gnl|my_center|LOCUS_20700 810805 810257 gene locus_tag LOCUS_20710 810805 810257 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973532.1 protein_id gnl|my_center|LOCUS_20710 811765 810938 gene locus_tag LOCUS_20720 811765 810938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 812646 811762 gene locus_tag LOCUS_20730 812646 811762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 813852 812863 gene locus_tag LOCUS_20740 gene meaB 813852 812863 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_20740 816058 813857 gene locus_tag LOCUS_20750 gene scpA 816058 813857 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_20750 817938 816058 gene locus_tag LOCUS_20760 817938 816058 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742071.1 protein_id gnl|my_center|LOCUS_20760 819052 818021 gene locus_tag LOCUS_20770 819052 818021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 821194 819176 gene locus_tag LOCUS_20780 821194 819176 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_20780 821344 822777 gene locus_tag LOCUS_20790 821344 822777 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893142.1 protein_id gnl|my_center|LOCUS_20790 824448 822943 gene locus_tag LOCUS_20800 824448 822943 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031044.1 protein_id gnl|my_center|LOCUS_20800 824498 825520 gene locus_tag LOCUS_20810 824498 825520 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869314.1 protein_id gnl|my_center|LOCUS_20810 825517 826491 gene locus_tag LOCUS_20820 825517 826491 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971796.1 protein_id gnl|my_center|LOCUS_20820 827468 826563 gene locus_tag LOCUS_20830 827468 826563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20830 827501 828511 gene locus_tag LOCUS_20840 827501 828511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 831373 828584 gene locus_tag LOCUS_20850 831373 828584 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031112.1 protein_id gnl|my_center|LOCUS_20850 831760 833268 gene locus_tag LOCUS_20860 831760 833268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977196.1 protein_id gnl|my_center|LOCUS_20860 833273 833683 gene locus_tag LOCUS_20870 833273 833683 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977197.1 protein_id gnl|my_center|LOCUS_20870 833680 834054 gene locus_tag LOCUS_20880 833680 834054 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977198.1 protein_id gnl|my_center|LOCUS_20880 834035 834658 gene locus_tag LOCUS_20890 834035 834658 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977199.1 protein_id gnl|my_center|LOCUS_20890 834655 836091 gene locus_tag LOCUS_20900 834655 836091 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027891.1 protein_id gnl|my_center|LOCUS_20900 837204 836182 gene locus_tag LOCUS_20910 837204 836182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 838143 837316 gene locus_tag LOCUS_20920 838143 837316 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_20920 838642 840183 gene locus_tag LOCUS_20930 gene lnt 838642 840183 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027728.1 protein_id gnl|my_center|LOCUS_20930 841349 840123 gene locus_tag LOCUS_20940 841349 840123 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027730.1 protein_id gnl|my_center|LOCUS_20940 841430 842035 gene locus_tag LOCUS_20950 841430 842035 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977488.1 protein_id gnl|my_center|LOCUS_20950 842076 842591 gene locus_tag LOCUS_20960 842076 842591 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977487.1 protein_id gnl|my_center|LOCUS_20960 842675 843379 gene locus_tag LOCUS_20970 842675 843379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 844130 843444 gene locus_tag LOCUS_20980 gene ung 844130 843444 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977484.1 protein_id gnl|my_center|LOCUS_20980 845082 844276 gene locus_tag LOCUS_20990 845082 844276 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027733.1 protein_id gnl|my_center|LOCUS_20990 845962 845201 gene locus_tag LOCUS_21000 gene fabG 845962 845201 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_21000 846599 846138 gene locus_tag LOCUS_21010 846599 846138 CDS product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_21010 847423 846596 gene locus_tag LOCUS_21020 847423 846596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_21020 847546 848148 gene locus_tag LOCUS_21030 847546 848148 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977470.1 protein_id gnl|my_center|LOCUS_21030 848812 848135 gene locus_tag LOCUS_21040 848812 848135 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104261.1 protein_id gnl|my_center|LOCUS_21040 848953 849420 gene locus_tag LOCUS_21050 848953 849420 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484772.1 protein_id gnl|my_center|LOCUS_21050 850439 849525 gene locus_tag LOCUS_21060 850439 849525 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027744.1 protein_id gnl|my_center|LOCUS_21060 850515 851558 gene locus_tag LOCUS_21070 850515 851558 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226734.1 protein_id gnl|my_center|LOCUS_21070 852814 851549 gene locus_tag LOCUS_21080 852814 851549 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_21080 852916 853644 gene locus_tag LOCUS_21090 852916 853644 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_21090 854740 853631 gene locus_tag LOCUS_21100 854740 853631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 855609 855082 gene locus_tag LOCUS_21110 855609 855082 CDS product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977462.1 protein_id gnl|my_center|LOCUS_21110 858155 855735 gene locus_tag LOCUS_21120 858155 855735 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_21120 858870 858253 gene locus_tag LOCUS_21130 858870 858253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 859587 858979 gene locus_tag LOCUS_21140 859587 858979 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230929.1 protein_id gnl|my_center|LOCUS_21140 859673 860140 gene locus_tag LOCUS_21150 859673 860140 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229515.1 protein_id gnl|my_center|LOCUS_21150 860137 861021 gene locus_tag LOCUS_21160 860137 861021 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229514.1 protein_id gnl|my_center|LOCUS_21160 861407 862240 gene locus_tag LOCUS_21170 861407 862240 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027752.1 protein_id gnl|my_center|LOCUS_21170 863086 862259 gene locus_tag LOCUS_21180 863086 862259 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_21180 864716 863211 gene locus_tag LOCUS_21190 864716 863211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 protein_id gnl|my_center|LOCUS_21190 865200 865787 gene locus_tag LOCUS_21200 865200 865787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325749.1 protein_id gnl|my_center|LOCUS_21200 866159 866365 gene locus_tag LOCUS_21210 866159 866365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 869360 866475 gene locus_tag LOCUS_21220 gene gcvP 869360 866475 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027754.1 protein_id gnl|my_center|LOCUS_21220 871564 870074 gene locus_tag LOCUS_21230 871564 870074 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027755.1 protein_id gnl|my_center|LOCUS_21230 872296 871724 gene locus_tag LOCUS_21240 872296 871724 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079363.1 protein_id gnl|my_center|LOCUS_21240 872968 872513 gene locus_tag LOCUS_21250 872968 872513 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_21250 873817 873038 gene locus_tag LOCUS_21260 873817 873038 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066949941.1 protein_id gnl|my_center|LOCUS_21260 874644 873859 gene locus_tag LOCUS_21270 874644 873859 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027757.1 protein_id gnl|my_center|LOCUS_21270 875842 874835 gene locus_tag LOCUS_21280 875842 874835 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027758.1 protein_id gnl|my_center|LOCUS_21280 876180 875848 gene locus_tag LOCUS_21290 876180 875848 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_21290 876998 876177 gene locus_tag LOCUS_21300 876998 876177 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977439.1 protein_id gnl|my_center|LOCUS_21300 879692 877197 gene locus_tag LOCUS_21310 879692 877197 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027759.1 protein_id gnl|my_center|LOCUS_21310 880410 879820 gene locus_tag LOCUS_21320 880410 879820 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221514425.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence03 1989 304 gene locus_tag LOCUS_21330 1989 304 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973282.1 protein_id gnl|my_center|LOCUS_21330 3028 2129 gene locus_tag LOCUS_21340 gene dapA 3028 2129 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030431.1 protein_id gnl|my_center|LOCUS_21340 2961 3284 gene locus_tag LOCUS_21350 2961 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3985 3245 gene locus_tag LOCUS_21360 gene thyX 3985 3245 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030430.1 protein_id gnl|my_center|LOCUS_21360 4230 4472 gene locus_tag LOCUS_21370 4230 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973285.1 protein_id gnl|my_center|LOCUS_21370 4549 5172 gene locus_tag LOCUS_21380 4549 5172 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030429.1 protein_id gnl|my_center|LOCUS_21380 5725 5264 gene locus_tag LOCUS_21390 5725 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973287.1 protein_id gnl|my_center|LOCUS_21390 6483 5731 gene locus_tag LOCUS_21400 gene dapB 6483 5731 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030428.1 protein_id gnl|my_center|LOCUS_21400 7916 6537 gene locus_tag LOCUS_21410 7916 6537 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973289.1 protein_id gnl|my_center|LOCUS_21410 10132 7913 gene locus_tag LOCUS_21420 10132 7913 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973290.1 protein_id gnl|my_center|LOCUS_21420 10676 10389 gene locus_tag LOCUS_21430 gene rpsO 10676 10389 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973291.1 protein_id gnl|my_center|LOCUS_21430 12335 10893 gene locus_tag LOCUS_21440 gene eccD 12335 10893 CDS product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270242.1 protein_id gnl|my_center|LOCUS_21440 12531 16511 gene locus_tag LOCUS_21450 12531 16511 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_21450 16841 16575 gene locus_tag LOCUS_21460 16841 16575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 17258 16944 gene locus_tag LOCUS_21470 17258 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 17510 17773 gene locus_tag LOCUS_21480 17510 17773 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030415.1 protein_id gnl|my_center|LOCUS_21480 19296 17818 gene locus_tag LOCUS_21490 19296 17818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 21036 19348 gene locus_tag LOCUS_21500 21036 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21500 22488 21136 gene locus_tag LOCUS_21510 gene mycP 22488 21136 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030414.1 protein_id gnl|my_center|LOCUS_21510 24060 22498 gene locus_tag LOCUS_21520 gene eccB 24060 22498 CDS product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030413.1 protein_id gnl|my_center|LOCUS_21520 24254 25570 gene locus_tag LOCUS_21530 gene eccE 24254 25570 CDS product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487445.1 protein_id gnl|my_center|LOCUS_21530 25570 26346 gene locus_tag LOCUS_21540 25570 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030411.1 protein_id gnl|my_center|LOCUS_21540 26622 29402 gene locus_tag LOCUS_21550 26622 29402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21550 30442 29477 gene locus_tag LOCUS_21560 30442 29477 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_21560 35537 30495 gene locus_tag LOCUS_21570 35537 30495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 36683 35781 gene locus_tag LOCUS_21580 gene truB 36683 35781 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030403.1 protein_id gnl|my_center|LOCUS_21580 37147 36683 gene locus_tag LOCUS_21590 gene rbfA 37147 36683 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973318.1 protein_id gnl|my_center|LOCUS_21590 37546 37202 gene locus_tag LOCUS_21600 37546 37202 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973319.1 protein_id gnl|my_center|LOCUS_21600 40702 37637 gene locus_tag LOCUS_21610 40702 37637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 41136 40828 gene locus_tag LOCUS_21620 41136 40828 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973321.1 protein_id gnl|my_center|LOCUS_21620 42340 41348 gene locus_tag LOCUS_21630 gene nusA 42340 41348 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030401.1 protein_id gnl|my_center|LOCUS_21630 42882 42343 gene locus_tag LOCUS_21640 gene rimP 42882 42343 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973323.1 protein_id gnl|my_center|LOCUS_21640 43125 43685 gene locus_tag LOCUS_21650 43125 43685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 43682 44137 gene locus_tag LOCUS_21660 43682 44137 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030399.1 protein_id gnl|my_center|LOCUS_21660 44208 45146 gene locus_tag LOCUS_21670 44208 45146 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030398.1 protein_id gnl|my_center|LOCUS_21670 45801 45268 gene locus_tag LOCUS_21680 45801 45268 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973328.1 protein_id gnl|my_center|LOCUS_21680 46691 45837 gene locus_tag LOCUS_21690 46691 45837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873433.1 protein_id gnl|my_center|LOCUS_21690 47972 46836 gene locus_tag LOCUS_21700 gene ispG 47972 46836 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973330.1 protein_id gnl|my_center|LOCUS_21700 49420 48119 gene locus_tag LOCUS_21710 49420 48119 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030397.1 protein_id gnl|my_center|LOCUS_21710 50691 49417 gene locus_tag LOCUS_21720 gene dxr 50691 49417 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973332.1 protein_id gnl|my_center|LOCUS_21720 52702 50768 gene locus_tag LOCUS_21730 52702 50768 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030396.1 protein_id gnl|my_center|LOCUS_21730 54312 52867 gene locus_tag LOCUS_21740 54312 52867 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030384.1 protein_id gnl|my_center|LOCUS_21740 56040 54439 gene locus_tag LOCUS_21750 56040 54439 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030383.1 protein_id gnl|my_center|LOCUS_21750 58239 56143 gene locus_tag LOCUS_21760 58239 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 58572 59924 gene locus_tag LOCUS_21770 gene gabT 58572 59924 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973349.1 protein_id gnl|my_center|LOCUS_21770 60284 60859 gene locus_tag LOCUS_21780 60284 60859 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247811.1 protein_id gnl|my_center|LOCUS_21780 62302 60893 gene locus_tag LOCUS_21790 62302 60893 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030377.1 protein_id gnl|my_center|LOCUS_21790 63114 62308 gene locus_tag LOCUS_21800 63114 62308 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 protein_id gnl|my_center|LOCUS_21800 64043 63114 gene locus_tag LOCUS_21810 64043 63114 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030376.1 protein_id gnl|my_center|LOCUS_21810 65230 64046 gene locus_tag LOCUS_21820 65230 64046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973357.1 protein_id gnl|my_center|LOCUS_21820 65589 66206 gene locus_tag LOCUS_21830 65589 66206 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_21830 67009 66149 gene locus_tag LOCUS_21840 67009 66149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 67138 68160 gene locus_tag LOCUS_21850 67138 68160 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030372.1 protein_id gnl|my_center|LOCUS_21850 68189 68911 gene locus_tag LOCUS_21860 68189 68911 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973364.1 protein_id gnl|my_center|LOCUS_21860 70104 68932 gene locus_tag LOCUS_21870 70104 68932 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030369.1 protein_id gnl|my_center|LOCUS_21870 71677 70226 gene locus_tag LOCUS_21880 71677 70226 CDS product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 protein_id gnl|my_center|LOCUS_21880 71844 72347 gene locus_tag LOCUS_21890 71844 72347 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_21890 72332 73711 gene locus_tag LOCUS_21900 72332 73711 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973370.1 protein_id gnl|my_center|LOCUS_21900 73934 74671 gene locus_tag LOCUS_21910 73934 74671 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973371.1 protein_id gnl|my_center|LOCUS_21910 74653 75864 gene locus_tag LOCUS_21920 74653 75864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 75967 76887 gene locus_tag LOCUS_21930 75967 76887 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111078.1 protein_id gnl|my_center|LOCUS_21930 77997 76963 gene locus_tag LOCUS_21940 77997 76963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_21940 79742 77997 gene locus_tag LOCUS_21950 79742 77997 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_21950 80809 79718 gene locus_tag LOCUS_21960 80809 79718 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_21960 82079 80973 gene locus_tag LOCUS_21970 gene rlmN 82079 80973 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973380.1 protein_id gnl|my_center|LOCUS_21970 83297 82188 gene locus_tag LOCUS_21980 83297 82188 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973382.1 protein_id gnl|my_center|LOCUS_21980 83854 83297 gene locus_tag LOCUS_21990 gene frr 83854 83297 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973383.1 protein_id gnl|my_center|LOCUS_21990 84819 84040 gene locus_tag LOCUS_22000 gene pyrH 84819 84040 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973384.1 protein_id gnl|my_center|LOCUS_22000 85818 84982 gene locus_tag LOCUS_22010 gene tsf 85818 84982 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973385.1 protein_id gnl|my_center|LOCUS_22010 86834 85992 gene locus_tag LOCUS_22020 gene rpsB 86834 85992 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106517497.1 protein_id gnl|my_center|LOCUS_22020 88288 87731 gene locus_tag LOCUS_22030 88288 87731 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973388.1 protein_id gnl|my_center|LOCUS_22030 89199 88363 gene locus_tag LOCUS_22040 gene whiG 89199 88363 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_22040 90628 89447 gene locus_tag LOCUS_22050 gene dprA 90628 89447 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487183.1 protein_id gnl|my_center|LOCUS_22050 92232 90625 gene locus_tag LOCUS_22060 92232 90625 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030329.1 protein_id gnl|my_center|LOCUS_22060 92591 92232 gene locus_tag LOCUS_22070 92591 92232 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872622.1 protein_id gnl|my_center|LOCUS_22070 93033 92725 gene locus_tag LOCUS_22080 93033 92725 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003965949.1 protein_id gnl|my_center|LOCUS_22080 93600 93073 gene locus_tag LOCUS_22090 93600 93073 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327363.1 protein_id gnl|my_center|LOCUS_22090 94336 93593 gene locus_tag LOCUS_22100 94336 93593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 95515 94448 gene locus_tag LOCUS_22110 gene lepB 95515 94448 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973395.1 protein_id gnl|my_center|LOCUS_22110 96494 95445 gene locus_tag LOCUS_22120 96494 95445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22120 97305 96487 gene locus_tag LOCUS_22130 gene lepB 97305 96487 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030325.1 protein_id gnl|my_center|LOCUS_22130 97701 97351 gene locus_tag LOCUS_22140 gene rplS 97701 97351 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973398.1 protein_id gnl|my_center|LOCUS_22140 98647 97832 gene locus_tag LOCUS_22150 gene trmD 98647 97832 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973399.1 protein_id gnl|my_center|LOCUS_22150 99204 98647 gene locus_tag LOCUS_22160 gene rimM 99204 98647 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973400.1 protein_id gnl|my_center|LOCUS_22160 99534 99295 gene locus_tag LOCUS_22170 99534 99295 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973401.1 protein_id gnl|my_center|LOCUS_22170 99974 99537 gene locus_tag LOCUS_22180 gene rpsP 99974 99537 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444852.1 protein_id gnl|my_center|LOCUS_22180 100829 100149 gene locus_tag LOCUS_22190 100829 100149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973403.1 protein_id gnl|my_center|LOCUS_22190 102423 101008 gene locus_tag LOCUS_22200 gene proS 102423 101008 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_22200 102742 103569 gene locus_tag LOCUS_22210 102742 103569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030324.1 protein_id gnl|my_center|LOCUS_22210 105177 103633 gene locus_tag LOCUS_22220 gene ffh 105177 103633 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327355.1 protein_id gnl|my_center|LOCUS_22220 107686 105254 gene locus_tag LOCUS_22230 107686 105254 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487177.1 protein_id gnl|my_center|LOCUS_22230 108058 107720 gene locus_tag LOCUS_22240 108058 107720 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_22240 109344 108055 gene locus_tag LOCUS_22250 109344 108055 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030319.1 protein_id gnl|my_center|LOCUS_22250 111189 109672 gene locus_tag LOCUS_22260 111189 109672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030318.1 protein_id gnl|my_center|LOCUS_22260 111661 112329 gene locus_tag LOCUS_22270 111661 112329 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030317.1 protein_id gnl|my_center|LOCUS_22270 113707 112460 gene locus_tag LOCUS_22280 gene ftsY 113707 112460 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164278219.1 protein_id gnl|my_center|LOCUS_22280 113918 115414 gene locus_tag LOCUS_22290 113918 115414 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973415.1 protein_id gnl|my_center|LOCUS_22290 117306 115888 gene locus_tag LOCUS_22300 117306 115888 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971990.1 protein_id gnl|my_center|LOCUS_22300 121100 117522 gene locus_tag LOCUS_22310 gene smc 121100 117522 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030315.1 protein_id gnl|my_center|LOCUS_22310 121569 121363 gene locus_tag LOCUS_22320 121569 121363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 122212 121973 gene locus_tag LOCUS_22330 122212 121973 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973419.1 protein_id gnl|my_center|LOCUS_22330 122483 123643 gene locus_tag LOCUS_22340 122483 123643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22340 124382 123798 gene locus_tag LOCUS_22350 124382 123798 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895563.1 protein_id gnl|my_center|LOCUS_22350 124494 124880 gene locus_tag LOCUS_22360 124494 124880 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973421.1 protein_id gnl|my_center|LOCUS_22360 125817 124939 gene locus_tag LOCUS_22370 gene mutM 125817 124939 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_22370 126693 125899 gene locus_tag LOCUS_22380 gene rnc 126693 125899 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_22380 126886 126713 gene locus_tag LOCUS_22390 gene rpmF 126886 126713 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006139588.1 protein_id gnl|my_center|LOCUS_22390 127599 126889 gene locus_tag LOCUS_22400 127599 126889 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_22400 128824 127676 gene locus_tag LOCUS_22410 128824 127676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030311.1 protein_id gnl|my_center|LOCUS_22410 129421 128930 gene locus_tag LOCUS_22420 gene coaD 129421 128930 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973426.1 protein_id gnl|my_center|LOCUS_22420 130050 129448 gene locus_tag LOCUS_22430 gene rsmD 130050 129448 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_22430 132390 130183 gene locus_tag LOCUS_22440 gene recG 132390 130183 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973428.1 protein_id gnl|my_center|LOCUS_22440 134125 132458 gene locus_tag LOCUS_22450 134125 132458 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_22450 134377 134562 gene locus_tag LOCUS_22460 gene rpmB 134377 134562 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_22460 135588 134797 gene locus_tag LOCUS_22470 gene thiD 135588 134797 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973431.1 protein_id gnl|my_center|LOCUS_22470 136589 135612 gene locus_tag LOCUS_22480 136589 135612 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973432.1 protein_id gnl|my_center|LOCUS_22480 136736 136969 gene locus_tag LOCUS_22490 136736 136969 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_22490 136990 137496 gene locus_tag LOCUS_22500 136990 137496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 138667 137519 gene locus_tag LOCUS_22510 138667 137519 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973434.1 protein_id gnl|my_center|LOCUS_22510 139703 138702 gene locus_tag LOCUS_22520 139703 138702 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030308.1 protein_id gnl|my_center|LOCUS_22520 140467 139700 gene locus_tag LOCUS_22530 140467 139700 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_22530 140670 141329 gene locus_tag LOCUS_22540 gene cofC 140670 141329 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973437.1 protein_id gnl|my_center|LOCUS_22540 141340 141567 gene locus_tag LOCUS_22550 141340 141567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030307.1 protein_id gnl|my_center|LOCUS_22550 142336 141641 gene locus_tag LOCUS_22560 142336 141641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 142705 142460 gene locus_tag LOCUS_22570 142705 142460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973440.1 protein_id gnl|my_center|LOCUS_22570 143468 142875 gene locus_tag LOCUS_22580 gene leuD 143468 142875 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030306.1 protein_id gnl|my_center|LOCUS_22580 144908 143472 gene locus_tag LOCUS_22590 gene leuC 144908 143472 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973442.1 protein_id gnl|my_center|LOCUS_22590 145007 145735 gene locus_tag LOCUS_22600 gene ndgR 145007 145735 CDS product IclR family transcriptional regulator NdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_22600 146864 145896 gene locus_tag LOCUS_22610 146864 145896 CDS product MEDS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086847606.1 protein_id gnl|my_center|LOCUS_22610 147732 146851 gene locus_tag LOCUS_22620 147732 146851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 147850 147777 gene locus_tag LOCUS_t00160 147850 147777 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 147938 147866 gene locus_tag LOCUS_t00170 147938 147866 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 148027 147954 gene locus_tag LOCUS_t00180 148027 147954 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 148139 148066 gene locus_tag LOCUS_t00190 148139 148066 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 148252 148179 gene locus_tag LOCUS_t00200 148252 148179 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 148415 148341 gene locus_tag LOCUS_t00210 148415 148341 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 150113 148638 gene locus_tag LOCUS_22630 gene gltX 150113 148638 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973448.1 protein_id gnl|my_center|LOCUS_22630 150906 150106 gene locus_tag LOCUS_22640 150906 150106 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973449.1 protein_id gnl|my_center|LOCUS_22640 151226 151023 gene locus_tag LOCUS_22650 151226 151023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327338.1 protein_id gnl|my_center|LOCUS_22650 151724 155206 gene locus_tag LOCUS_22660 151724 155206 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030302.1 protein_id gnl|my_center|LOCUS_22660 155207 155629 gene locus_tag LOCUS_22670 155207 155629 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_22670 155733 156143 gene locus_tag LOCUS_22680 155733 156143 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973454.1 protein_id gnl|my_center|LOCUS_22680 156124 156705 gene locus_tag LOCUS_22690 156124 156705 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_22690 157128 160157 gene locus_tag LOCUS_22700 157128 160157 CDS product nitrate- and nitrite sensing domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030300.1 protein_id gnl|my_center|LOCUS_22700 160159 160581 gene locus_tag LOCUS_22710 160159 160581 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078643930.1 protein_id gnl|my_center|LOCUS_22710 160666 161190 gene locus_tag LOCUS_22720 160666 161190 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973458.1 protein_id gnl|my_center|LOCUS_22720 161171 161752 gene locus_tag LOCUS_22730 161171 161752 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009314218.1 protein_id gnl|my_center|LOCUS_22730 162082 161888 gene locus_tag LOCUS_22740 162082 161888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 163699 162116 gene locus_tag LOCUS_22750 163699 162116 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973461.1 protein_id gnl|my_center|LOCUS_22750 166354 163871 gene locus_tag LOCUS_22760 166354 163871 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_22760 166486 167109 gene locus_tag LOCUS_22770 166486 167109 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973463.1 protein_id gnl|my_center|LOCUS_22770 168636 167122 gene locus_tag LOCUS_22780 168636 167122 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225551.1 protein_id gnl|my_center|LOCUS_22780 168719 169354 gene locus_tag LOCUS_22790 168719 169354 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974777.1 protein_id gnl|my_center|LOCUS_22790 171062 169428 gene locus_tag LOCUS_22800 gene cimA 171062 169428 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030295.1 protein_id gnl|my_center|LOCUS_22800 172674 171343 gene locus_tag LOCUS_22810 172674 171343 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097074.1 protein_id gnl|my_center|LOCUS_22810 173888 172782 gene locus_tag LOCUS_22820 173888 172782 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030291.1 protein_id gnl|my_center|LOCUS_22820 175136 174081 gene locus_tag LOCUS_22830 175136 174081 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030290.1 protein_id gnl|my_center|LOCUS_22830 175267 176931 gene locus_tag LOCUS_22840 175267 176931 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110463.1 protein_id gnl|my_center|LOCUS_22840 177107 176955 gene locus_tag LOCUS_22850 177107 176955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 179048 177417 gene locus_tag LOCUS_22860 gene pruA 179048 177417 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_22860 180019 179093 gene locus_tag LOCUS_22870 180019 179093 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973477.1 protein_id gnl|my_center|LOCUS_22870 180199 181449 gene locus_tag LOCUS_22880 180199 181449 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973478.1 protein_id gnl|my_center|LOCUS_22880 181637 181446 gene locus_tag LOCUS_22890 181637 181446 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027347.1 protein_id gnl|my_center|LOCUS_22890 182898 181681 gene locus_tag LOCUS_22900 182898 181681 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027348.1 protein_id gnl|my_center|LOCUS_22900 183590 183000 gene locus_tag LOCUS_22910 183590 183000 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222865.1 protein_id gnl|my_center|LOCUS_22910 183687 185225 gene locus_tag LOCUS_22920 183687 185225 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870095.1 protein_id gnl|my_center|LOCUS_22920 186052 185228 gene locus_tag LOCUS_22930 186052 185228 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 protein_id gnl|my_center|LOCUS_22930 187826 186219 gene locus_tag LOCUS_22940 gene serA 187826 186219 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973481.1 protein_id gnl|my_center|LOCUS_22940 189089 188088 gene locus_tag LOCUS_22950 gene ilvC 189089 188088 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973482.1 protein_id gnl|my_center|LOCUS_22950 189704 189180 gene locus_tag LOCUS_22960 gene ilvN 189704 189180 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_22960 191688 189805 gene locus_tag LOCUS_22970 191688 189805 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973484.1 protein_id gnl|my_center|LOCUS_22970 194826 191905 gene locus_tag LOCUS_22980 194826 191905 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030287.1 protein_id gnl|my_center|LOCUS_22980 196061 195099 gene locus_tag LOCUS_22990 196061 195099 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030286.1 protein_id gnl|my_center|LOCUS_22990 196135 197145 gene locus_tag LOCUS_23000 196135 197145 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870088.1 protein_id gnl|my_center|LOCUS_23000 197200 198405 gene locus_tag LOCUS_23010 197200 198405 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486947.1 protein_id gnl|my_center|LOCUS_23010 198437 198601 gene locus_tag LOCUS_23020 198437 198601 CDS product DUF6191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973490.1 protein_id gnl|my_center|LOCUS_23020 201250 198953 gene locus_tag LOCUS_23030 201250 198953 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_23030 201992 201471 gene locus_tag LOCUS_23040 201992 201471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803693.1 protein_id gnl|my_center|LOCUS_23040 201877 202155 gene locus_tag LOCUS_23050 201877 202155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 203790 202282 gene locus_tag LOCUS_23060 gene gatB 203790 202282 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030281.1 protein_id gnl|my_center|LOCUS_23060 204076 203816 gene locus_tag LOCUS_23070 204076 203816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444751.1 protein_id gnl|my_center|LOCUS_23070 205569 204073 gene locus_tag LOCUS_23080 gene gatA 205569 204073 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973499.1 protein_id gnl|my_center|LOCUS_23080 205872 205576 gene locus_tag LOCUS_23090 gene gatC 205872 205576 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973500.1 protein_id gnl|my_center|LOCUS_23090 208296 206197 gene locus_tag LOCUS_23100 gene rmdB 208296 206197 CDS product cyclic Di-GMP phosphodiesterase RmdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030279.1 protein_id gnl|my_center|LOCUS_23100 210737 208470 gene locus_tag LOCUS_23110 gene ligA 210737 208470 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030278.1 protein_id gnl|my_center|LOCUS_23110 211756 210734 gene locus_tag LOCUS_23120 211756 210734 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_23120 212501 211803 gene locus_tag LOCUS_23130 212501 211803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870060.1 protein_id gnl|my_center|LOCUS_23130 212895 212653 gene locus_tag LOCUS_23140 212895 212653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 212780 213205 gene locus_tag LOCUS_23150 212780 213205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 213665 213369 gene locus_tag LOCUS_23160 213665 213369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 213664 213951 gene locus_tag LOCUS_23170 213664 213951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 215149 213998 gene locus_tag LOCUS_23180 gene mnmA 215149 213998 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973510.1 protein_id gnl|my_center|LOCUS_23180 216451 215282 gene locus_tag LOCUS_23190 216451 215282 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030274.1 protein_id gnl|my_center|LOCUS_23190 217475 216465 gene locus_tag LOCUS_23200 217475 216465 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223035.1 protein_id gnl|my_center|LOCUS_23200 217594 218166 gene locus_tag LOCUS_23210 217594 218166 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226057.1 protein_id gnl|my_center|LOCUS_23210 218911 218231 gene locus_tag LOCUS_23220 218911 218231 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973517.1 protein_id gnl|my_center|LOCUS_23220 220465 219008 gene locus_tag LOCUS_23230 220465 219008 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174854953.1 protein_id gnl|my_center|LOCUS_23230 221640 220591 gene locus_tag LOCUS_23240 221640 220591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 222767 221652 gene locus_tag LOCUS_23250 222767 221652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973519.1 protein_id gnl|my_center|LOCUS_23250 223762 222764 gene locus_tag LOCUS_23260 223762 222764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_23260 225692 223914 gene locus_tag LOCUS_23270 225692 223914 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973521.1 protein_id gnl|my_center|LOCUS_23270 226761 225763 gene locus_tag LOCUS_23280 226761 225763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_23280 227986 227183 gene locus_tag LOCUS_23290 227986 227183 CDS product enhanced serine sensitivity protein SseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030271.1 protein_id gnl|my_center|LOCUS_23290 228793 228059 gene locus_tag LOCUS_23300 228793 228059 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973524.1 protein_id gnl|my_center|LOCUS_23300 229523 228903 gene locus_tag LOCUS_23310 229523 228903 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030270.1 protein_id gnl|my_center|LOCUS_23310 229914 231029 gene locus_tag LOCUS_23320 gene gcvT 229914 231029 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 protein_id gnl|my_center|LOCUS_23320 231097 231474 gene locus_tag LOCUS_23330 gene gcvH 231097 231474 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 protein_id gnl|my_center|LOCUS_23330 231508 232770 gene locus_tag LOCUS_23340 231508 232770 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973528.1 protein_id gnl|my_center|LOCUS_23340 233004 234386 gene locus_tag LOCUS_23350 233004 234386 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030269.1 protein_id gnl|my_center|LOCUS_23350 235537 234464 gene locus_tag LOCUS_23360 235537 234464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 235723 235974 gene locus_tag LOCUS_23370 235723 235974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 238053 235981 gene locus_tag LOCUS_23380 238053 235981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 238775 238233 gene locus_tag LOCUS_23390 238775 238233 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 protein_id gnl|my_center|LOCUS_23390 239746 238808 gene locus_tag LOCUS_23400 239746 238808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 240579 239749 gene locus_tag LOCUS_23410 240579 239749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 240748 242013 gene locus_tag LOCUS_23420 240748 242013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 242099 243466 gene locus_tag LOCUS_23430 242099 243466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 243559 244884 gene locus_tag LOCUS_23440 243559 244884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 244931 245602 gene locus_tag LOCUS_23450 244931 245602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 245636 247732 gene locus_tag LOCUS_23460 245636 247732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 247734 248741 gene locus_tag LOCUS_23470 247734 248741 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_23470 252119 248742 gene locus_tag LOCUS_23480 252119 248742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 253371 252424 gene locus_tag LOCUS_23490 253371 252424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224152.1 protein_id gnl|my_center|LOCUS_23490 253828 253388 gene locus_tag LOCUS_23500 253828 253388 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_23500 259893 253825 gene locus_tag LOCUS_23510 259893 253825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 260867 259890 gene locus_tag LOCUS_23520 260867 259890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228636.1 protein_id gnl|my_center|LOCUS_23520 262822 260891 gene locus_tag LOCUS_23530 262822 260891 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228637.1 protein_id gnl|my_center|LOCUS_23530 263852 262866 gene locus_tag LOCUS_23540 263852 262866 CDS product DUF1702 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228639.1 protein_id gnl|my_center|LOCUS_23540 264792 264028 gene locus_tag LOCUS_23550 264792 264028 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896974.1 protein_id gnl|my_center|LOCUS_23550 265586 264870 gene locus_tag LOCUS_23560 265586 264870 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227762.1 protein_id gnl|my_center|LOCUS_23560 265727 266770 gene locus_tag LOCUS_23570 265727 266770 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092054.1 protein_id gnl|my_center|LOCUS_23570 266803 268209 gene locus_tag LOCUS_23580 266803 268209 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 protein_id gnl|my_center|LOCUS_23580 268206 269651 gene locus_tag LOCUS_23590 268206 269651 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031804.1 protein_id gnl|my_center|LOCUS_23590 269662 270909 gene locus_tag LOCUS_23600 269662 270909 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_23600 271909 270887 gene locus_tag LOCUS_23610 271909 270887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 272880 271906 gene locus_tag LOCUS_23620 272880 271906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 273034 273471 gene locus_tag LOCUS_23630 273034 273471 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 protein_id gnl|my_center|LOCUS_23630 273468 273932 gene locus_tag LOCUS_23640 273468 273932 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_23640 273911 275086 gene locus_tag LOCUS_23650 273911 275086 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110170.1 protein_id gnl|my_center|LOCUS_23650 275248 276519 gene locus_tag LOCUS_23660 275248 276519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 276973 276593 gene locus_tag LOCUS_23670 276973 276593 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233803.1 protein_id gnl|my_center|LOCUS_23670 278622 277024 gene locus_tag LOCUS_23680 278622 277024 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_23680 279072 278665 gene locus_tag LOCUS_23690 279072 278665 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 protein_id gnl|my_center|LOCUS_23690 279575 279069 gene locus_tag LOCUS_23700 279575 279069 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030981.1 protein_id gnl|my_center|LOCUS_23700 281226 279628 gene locus_tag LOCUS_23710 281226 279628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272601.1 protein_id gnl|my_center|LOCUS_23710 281174 281356 gene locus_tag LOCUS_23720 281174 281356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 281661 281320 gene locus_tag LOCUS_23730 281661 281320 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_23730 281728 282039 gene locus_tag LOCUS_23740 281728 282039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 282270 282058 gene locus_tag LOCUS_23750 282270 282058 CDS product EF-hand domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973534.1 protein_id gnl|my_center|LOCUS_23750 282799 282308 gene locus_tag LOCUS_23760 282799 282308 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977659.1 protein_id gnl|my_center|LOCUS_23760 283626 283111 gene locus_tag LOCUS_23770 283626 283111 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_079178808.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23770 284612 283905 gene locus_tag LOCUS_23780 284612 283905 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_23780 285897 284758 gene locus_tag LOCUS_23790 285897 284758 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486965.1 protein_id gnl|my_center|LOCUS_23790 287482 286277 gene locus_tag LOCUS_23800 287482 286277 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030260.1 protein_id gnl|my_center|LOCUS_23800 287792 290050 gene locus_tag LOCUS_23810 gene glgX 287792 290050 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486968.1 protein_id gnl|my_center|LOCUS_23810 290085 291905 gene locus_tag LOCUS_23820 290085 291905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 protein_id gnl|my_center|LOCUS_23820 291902 293755 gene locus_tag LOCUS_23830 291902 293755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030254.1 protein_id gnl|my_center|LOCUS_23830 294019 296310 gene locus_tag LOCUS_23840 294019 296310 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973551.1 protein_id gnl|my_center|LOCUS_23840 299158 296555 gene locus_tag LOCUS_23850 299158 296555 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486976.1 protein_id gnl|my_center|LOCUS_23850 299735 301723 gene locus_tag LOCUS_23860 299735 301723 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030248.1 protein_id gnl|my_center|LOCUS_23860 301720 303426 gene locus_tag LOCUS_23870 gene treS 301720 303426 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_23870 303788 305161 gene locus_tag LOCUS_23880 303788 305161 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973557.1 protein_id gnl|my_center|LOCUS_23880 305214 307517 gene locus_tag LOCUS_23890 gene glgB 305214 307517 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486244.1 protein_id gnl|my_center|LOCUS_23890 308285 307521 gene locus_tag LOCUS_23900 308285 307521 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974575.1 protein_id gnl|my_center|LOCUS_23900 308512 309183 gene locus_tag LOCUS_23910 308512 309183 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029635.1 protein_id gnl|my_center|LOCUS_23910 309215 310285 gene locus_tag LOCUS_23920 309215 310285 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225511.1 protein_id gnl|my_center|LOCUS_23920 310349 311584 gene locus_tag LOCUS_23930 310349 311584 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_23930 311640 312452 gene locus_tag LOCUS_23940 311640 312452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 312775 313002 gene locus_tag LOCUS_23950 312775 313002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 314560 313190 gene locus_tag LOCUS_23960 314560 313190 CDS product C4-dicarboxylate transporter DctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973562.1 protein_id gnl|my_center|LOCUS_23960 314696 316342 gene locus_tag LOCUS_23970 314696 316342 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 protein_id gnl|my_center|LOCUS_23970 316339 317070 gene locus_tag LOCUS_23980 316339 317070 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030245.1 protein_id gnl|my_center|LOCUS_23980 317149 318513 gene locus_tag LOCUS_23990 317149 318513 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486252.1 protein_id gnl|my_center|LOCUS_23990 318510 319376 gene locus_tag LOCUS_24000 318510 319376 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030240.1 protein_id gnl|my_center|LOCUS_24000 319926 319459 gene locus_tag LOCUS_24010 319926 319459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 320786 319995 gene locus_tag LOCUS_24020 320786 319995 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031127.1 protein_id gnl|my_center|LOCUS_24020 321052 321501 gene locus_tag LOCUS_24030 gene hrp1 321052 321501 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_24030 321521 321943 gene locus_tag LOCUS_24040 gene hrp1 321521 321943 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_24040 322431 322027 gene locus_tag LOCUS_24050 322431 322027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 322370 322786 gene locus_tag LOCUS_24060 322370 322786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 322887 323720 gene locus_tag LOCUS_24070 322887 323720 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973570.1 protein_id gnl|my_center|LOCUS_24070 323899 324684 gene locus_tag LOCUS_24080 323899 324684 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_24080 324719 327256 gene locus_tag LOCUS_24090 324719 327256 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_24090 328532 327507 gene locus_tag LOCUS_24100 328532 327507 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973572.1 protein_id gnl|my_center|LOCUS_24100 328743 330839 gene locus_tag LOCUS_24110 gene pta 328743 330839 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030239.1 protein_id gnl|my_center|LOCUS_24110 330927 332138 gene locus_tag LOCUS_24120 330927 332138 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030238.1 protein_id gnl|my_center|LOCUS_24120 332222 333649 gene locus_tag LOCUS_24130 gene pyk 332222 333649 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973575.1 protein_id gnl|my_center|LOCUS_24130 335025 333742 gene locus_tag LOCUS_24140 335025 333742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283916.1 protein_id gnl|my_center|LOCUS_24140 335473 335015 gene locus_tag LOCUS_24150 335473 335015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 336232 335633 gene locus_tag LOCUS_24160 336232 335633 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_24160 337821 336889 gene locus_tag LOCUS_24170 337821 336889 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973580.1 protein_id gnl|my_center|LOCUS_24170 338046 338675 gene locus_tag LOCUS_24180 338046 338675 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030233.1 protein_id gnl|my_center|LOCUS_24180 340385 338685 gene locus_tag LOCUS_24190 340385 338685 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030230.1 protein_id gnl|my_center|LOCUS_24190 340852 340514 gene locus_tag LOCUS_24200 340852 340514 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666291.1 protein_id gnl|my_center|LOCUS_24200 341452 340901 gene locus_tag LOCUS_24210 341452 340901 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973586.1 protein_id gnl|my_center|LOCUS_24210 341877 341527 gene locus_tag LOCUS_24220 341877 341527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030669.1 protein_id gnl|my_center|LOCUS_24220 343514 341904 gene locus_tag LOCUS_24230 343514 341904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 343830 343534 gene locus_tag LOCUS_24240 343830 343534 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_24240 344171 343827 gene locus_tag LOCUS_24250 344171 343827 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030226.1 protein_id gnl|my_center|LOCUS_24250 344342 344980 gene locus_tag LOCUS_24260 344342 344980 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189739317.1 protein_id gnl|my_center|LOCUS_24260 344980 345630 gene locus_tag LOCUS_24270 344980 345630 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033475.1 protein_id gnl|my_center|LOCUS_24270 345627 346394 gene locus_tag LOCUS_24280 345627 346394 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973591.1 protein_id gnl|my_center|LOCUS_24280 346502 346975 gene locus_tag LOCUS_24290 346502 346975 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973592.1 protein_id gnl|my_center|LOCUS_24290 348041 347079 gene locus_tag LOCUS_24300 gene meaB 348041 347079 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_24300 349297 348080 gene locus_tag LOCUS_24310 349297 348080 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030221.1 protein_id gnl|my_center|LOCUS_24310 349438 349878 gene locus_tag LOCUS_24320 gene mce 349438 349878 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973598.1 protein_id gnl|my_center|LOCUS_24320 350052 355124 gene locus_tag LOCUS_24330 gene scy 350052 355124 CDS product polarized growth protein Scy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030220.1 protein_id gnl|my_center|LOCUS_24330 355249 356187 gene locus_tag LOCUS_24340 355249 356187 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_24340 356355 357344 gene locus_tag LOCUS_24350 356355 357344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973601.1 protein_id gnl|my_center|LOCUS_24350 357348 358118 gene locus_tag LOCUS_24360 357348 358118 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973602.1 protein_id gnl|my_center|LOCUS_24360 358388 359272 gene locus_tag LOCUS_24370 358388 359272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977751.1 protein_id gnl|my_center|LOCUS_24370 359405 360685 gene locus_tag LOCUS_24380 359405 360685 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030218.1 protein_id gnl|my_center|LOCUS_24380 360682 361734 gene locus_tag LOCUS_24390 360682 361734 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973604.1 protein_id gnl|my_center|LOCUS_24390 362088 361756 gene locus_tag LOCUS_24400 362088 361756 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973605.1 protein_id gnl|my_center|LOCUS_24400 362292 363329 gene locus_tag LOCUS_24410 362292 363329 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030217.1 protein_id gnl|my_center|LOCUS_24410 363806 363414 gene locus_tag LOCUS_24420 363806 363414 CDS product SCO5389 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973607.1 protein_id gnl|my_center|LOCUS_24420 364016 364687 gene locus_tag LOCUS_24430 gene nucS 364016 364687 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007387684.1 protein_id gnl|my_center|LOCUS_24430 367413 364768 gene locus_tag LOCUS_24440 367413 364768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030216.1 protein_id gnl|my_center|LOCUS_24440 368007 367639 gene locus_tag LOCUS_24450 368007 367639 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973611.1 protein_id gnl|my_center|LOCUS_24450 368996 368148 gene locus_tag LOCUS_24460 368996 368148 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030215.1 protein_id gnl|my_center|LOCUS_24460 369842 369189 gene locus_tag LOCUS_24470 369842 369189 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973613.1 protein_id gnl|my_center|LOCUS_24470 369939 370739 gene locus_tag LOCUS_24480 369939 370739 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973614.1 protein_id gnl|my_center|LOCUS_24480 370760 371515 gene locus_tag LOCUS_24490 370760 371515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973615.1 protein_id gnl|my_center|LOCUS_24490 371529 372101 gene locus_tag LOCUS_24500 371529 372101 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973616.1 protein_id gnl|my_center|LOCUS_24500 374198 372204 gene locus_tag LOCUS_24510 374198 372204 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226876.1 protein_id gnl|my_center|LOCUS_24510 375043 374348 gene locus_tag LOCUS_24520 375043 374348 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973620.1 protein_id gnl|my_center|LOCUS_24520 376239 375040 gene locus_tag LOCUS_24530 376239 375040 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030212.1 protein_id gnl|my_center|LOCUS_24530 376399 376944 gene locus_tag LOCUS_24540 376399 376944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030213.1 protein_id gnl|my_center|LOCUS_24540 377395 376946 gene locus_tag LOCUS_24550 377395 376946 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973622.1 protein_id gnl|my_center|LOCUS_24550 377893 377519 gene locus_tag LOCUS_24560 377893 377519 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973623.1 protein_id gnl|my_center|LOCUS_24560 379466 378024 gene locus_tag LOCUS_24570 gene atpD 379466 378024 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973624.1 protein_id gnl|my_center|LOCUS_24570 380387 379467 gene locus_tag LOCUS_24580 380387 379467 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973625.1 protein_id gnl|my_center|LOCUS_24580 381961 380390 gene locus_tag LOCUS_24590 gene atpA 381961 380390 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973626.1 protein_id gnl|my_center|LOCUS_24590 382922 382107 gene locus_tag LOCUS_24600 382922 382107 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327277.1 protein_id gnl|my_center|LOCUS_24600 383482 382919 gene locus_tag LOCUS_24610 383482 382919 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_24610 383765 383523 gene locus_tag LOCUS_24620 gene atpE 383765 383523 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973629.1 protein_id gnl|my_center|LOCUS_24620 384662 383850 gene locus_tag LOCUS_24630 gene atpB 384662 383850 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030208.1 protein_id gnl|my_center|LOCUS_24630 385364 384927 gene locus_tag LOCUS_24640 385364 384927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973631.1 protein_id gnl|my_center|LOCUS_24640 386935 385628 gene locus_tag LOCUS_24650 386935 385628 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030207.1 protein_id gnl|my_center|LOCUS_24650 388423 387107 gene locus_tag LOCUS_24660 388423 387107 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973633.1 protein_id gnl|my_center|LOCUS_24660 388308 388649 gene locus_tag LOCUS_24670 388308 388649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 389200 388547 gene locus_tag LOCUS_24680 389200 388547 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068381.1 protein_id gnl|my_center|LOCUS_24680 389844 389197 gene locus_tag LOCUS_24690 389844 389197 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973635.1 protein_id gnl|my_center|LOCUS_24690 390755 389910 gene locus_tag LOCUS_24700 gene prmC 390755 389910 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973636.1 protein_id gnl|my_center|LOCUS_24700 391895 390816 gene locus_tag LOCUS_24710 gene prfA 391895 390816 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973637.1 protein_id gnl|my_center|LOCUS_24710 392221 392000 gene locus_tag LOCUS_24720 gene rpmE 392221 392000 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973638.1 protein_id gnl|my_center|LOCUS_24720 393489 392377 gene locus_tag LOCUS_24730 393489 392377 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973639.1 protein_id gnl|my_center|LOCUS_24730 395828 393807 gene locus_tag LOCUS_24740 395828 393807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 397182 396268 gene locus_tag LOCUS_24750 gene thrB 397182 396268 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030204.1 protein_id gnl|my_center|LOCUS_24750 398593 397502 gene locus_tag LOCUS_24760 gene thrC 398593 397502 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973642.1 protein_id gnl|my_center|LOCUS_24760 399925 398633 gene locus_tag LOCUS_24770 399925 398633 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283905.1 protein_id gnl|my_center|LOCUS_24770 401445 400054 gene locus_tag LOCUS_24780 gene lysA 401445 400054 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030202.1 protein_id gnl|my_center|LOCUS_24780 402287 401463 gene locus_tag LOCUS_24790 402287 401463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 402820 402332 gene locus_tag LOCUS_24800 402820 402332 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030200.1 protein_id gnl|my_center|LOCUS_24800 402943 403015 gene locus_tag LOCUS_t00220 402943 403015 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 403097 403444 gene locus_tag LOCUS_24810 403097 403444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 403441 403701 gene locus_tag LOCUS_24820 403441 403701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 404572 403748 gene locus_tag LOCUS_24830 404572 403748 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191849049.1 protein_id gnl|my_center|LOCUS_24830 405850 404756 gene locus_tag LOCUS_24840 405850 404756 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_24840 406089 407027 gene locus_tag LOCUS_24850 406089 407027 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030161.1 protein_id gnl|my_center|LOCUS_24850 407231 407953 gene locus_tag LOCUS_24860 407231 407953 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030160.1 protein_id gnl|my_center|LOCUS_24860 408012 408767 gene locus_tag LOCUS_24870 408012 408767 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091945.1 protein_id gnl|my_center|LOCUS_24870 408815 409084 gene locus_tag LOCUS_24880 408815 409084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030159.1 protein_id gnl|my_center|LOCUS_24880 409239 410360 gene locus_tag LOCUS_24890 409239 410360 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030158.1 protein_id gnl|my_center|LOCUS_24890 411505 410318 gene locus_tag LOCUS_24900 411505 410318 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973676.1 protein_id gnl|my_center|LOCUS_24900 412269 411565 gene locus_tag LOCUS_24910 412269 411565 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973677.1 protein_id gnl|my_center|LOCUS_24910 412684 412250 gene locus_tag LOCUS_24920 412684 412250 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973678.1 protein_id gnl|my_center|LOCUS_24920 413199 412681 gene locus_tag LOCUS_24930 413199 412681 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327267.1 protein_id gnl|my_center|LOCUS_24930 416027 413196 gene locus_tag LOCUS_24940 416027 413196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 416252 416968 gene locus_tag LOCUS_24950 416252 416968 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030154.1 protein_id gnl|my_center|LOCUS_24950 417711 417187 gene locus_tag LOCUS_24960 417711 417187 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973682.1 protein_id gnl|my_center|LOCUS_24960 418001 418813 gene locus_tag LOCUS_24970 418001 418813 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027227.1 protein_id gnl|my_center|LOCUS_24970 421692 418945 gene locus_tag LOCUS_24980 421692 418945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 421840 422160 gene locus_tag LOCUS_24990 421840 422160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 423421 422519 gene locus_tag LOCUS_25000 423421 422519 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731455.1 protein_id gnl|my_center|LOCUS_25000 423501 423929 gene locus_tag LOCUS_25010 423501 423929 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_25010 426388 423977 gene locus_tag LOCUS_25020 gene lon 426388 423977 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030152.1 protein_id gnl|my_center|LOCUS_25020 427351 426533 gene locus_tag LOCUS_25030 427351 426533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 427527 428207 gene locus_tag LOCUS_25040 427527 428207 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_25040 428298 429035 gene locus_tag LOCUS_25050 428298 429035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973686.1 protein_id gnl|my_center|LOCUS_25050 429076 430185 gene locus_tag LOCUS_25060 429076 430185 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973687.1 protein_id gnl|my_center|LOCUS_25060 430428 434270 gene locus_tag LOCUS_25070 430428 434270 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030150.1 protein_id gnl|my_center|LOCUS_25070 434437 434616 gene locus_tag LOCUS_25080 434437 434616 CDS product DUF6104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_25080 435491 434670 gene locus_tag LOCUS_25090 435491 434670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973703.1 protein_id gnl|my_center|LOCUS_25090 435627 436481 gene locus_tag LOCUS_25100 435627 436481 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486398.1 protein_id gnl|my_center|LOCUS_25100 436481 437479 gene locus_tag LOCUS_25110 436481 437479 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973705.1 protein_id gnl|my_center|LOCUS_25110 440280 437608 gene locus_tag LOCUS_25120 440280 437608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 443182 440522 gene locus_tag LOCUS_25130 443182 440522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 444766 443318 gene locus_tag LOCUS_25140 444766 443318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 445736 444774 gene locus_tag LOCUS_25150 445736 444774 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973708.1 protein_id gnl|my_center|LOCUS_25150 445915 447258 gene locus_tag LOCUS_25160 445915 447258 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950374.1 protein_id gnl|my_center|LOCUS_25160 448543 447329 gene locus_tag LOCUS_25170 448543 447329 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_25170 449178 450101 gene locus_tag LOCUS_25180 449178 450101 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973710.1 protein_id gnl|my_center|LOCUS_25180 450161 451360 gene locus_tag LOCUS_25190 450161 451360 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973711.1 protein_id gnl|my_center|LOCUS_25190 451357 452118 gene locus_tag LOCUS_25200 451357 452118 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 protein_id gnl|my_center|LOCUS_25200 452288 452929 gene locus_tag LOCUS_25210 452288 452929 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973714.1 protein_id gnl|my_center|LOCUS_25210 453285 452821 gene locus_tag LOCUS_25220 gene sodX 453285 452821 CDS product nickel-type superoxide dismutase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868025.1 protein_id gnl|my_center|LOCUS_25220 453429 453824 gene locus_tag LOCUS_25230 gene sodN 453429 453824 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_25230 454660 453896 gene locus_tag LOCUS_25240 454660 453896 CDS product TylF/MycF family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296730.1 protein_id gnl|my_center|LOCUS_25240 455844 454687 gene locus_tag LOCUS_25250 455844 454687 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227228.1 protein_id gnl|my_center|LOCUS_25250 456991 455873 gene locus_tag LOCUS_25260 gene iroB 456991 455873 CDS product salmochelin biosynthesis C-glycosyltransferase IroB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221113.1 protein_id gnl|my_center|LOCUS_25260 458114 456993 gene locus_tag LOCUS_25270 458114 456993 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227228.1 protein_id gnl|my_center|LOCUS_25270 458971 458135 gene locus_tag LOCUS_25280 458971 458135 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115127.1 protein_id gnl|my_center|LOCUS_25280 460014 458968 gene locus_tag LOCUS_25290 460014 458968 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_25290 460469 460011 gene locus_tag LOCUS_25300 460469 460011 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973657.1 protein_id gnl|my_center|LOCUS_25300 460714 460469 gene locus_tag LOCUS_25310 460714 460469 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973889.1 protein_id gnl|my_center|LOCUS_25310 461982 460762 gene locus_tag LOCUS_25320 461982 460762 CDS product ketosynthase chain-length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030048.1 protein_id gnl|my_center|LOCUS_25320 463250 461979 gene locus_tag LOCUS_25330 463250 461979 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973891.1 protein_id gnl|my_center|LOCUS_25330 463678 463247 gene locus_tag LOCUS_25340 463678 463247 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227256.1 protein_id gnl|my_center|LOCUS_25340 464011 463691 gene locus_tag LOCUS_25350 464011 463691 CDS product TcmI family type II polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030169.1 protein_id gnl|my_center|LOCUS_25350 464345 464013 gene locus_tag LOCUS_25360 464345 464013 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891546.1 protein_id gnl|my_center|LOCUS_25360 465998 464358 gene locus_tag LOCUS_25370 465998 464358 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227261.1 protein_id gnl|my_center|LOCUS_25370 467741 466599 gene locus_tag LOCUS_25380 467741 466599 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230064.1 protein_id gnl|my_center|LOCUS_25380 469394 467871 gene locus_tag LOCUS_25390 469394 467871 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_25390 470310 469723 gene locus_tag LOCUS_25400 470310 469723 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727714.1 protein_id gnl|my_center|LOCUS_25400 471209 470331 gene locus_tag LOCUS_25410 gene rfbA 471209 470331 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726901.1 protein_id gnl|my_center|LOCUS_25410 471380 472369 gene locus_tag LOCUS_25420 gene rfbB 471380 472369 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222917.1 protein_id gnl|my_center|LOCUS_25420 472366 473289 gene locus_tag LOCUS_25430 gene rfbD 472366 473289 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_25430 473382 474077 gene locus_tag LOCUS_25440 473382 474077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028915.1 protein_id gnl|my_center|LOCUS_25440 474159 474785 gene locus_tag LOCUS_25450 474159 474785 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975463.1 protein_id gnl|my_center|LOCUS_25450 475070 474810 gene locus_tag LOCUS_25460 475070 474810 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971884.1 protein_id gnl|my_center|LOCUS_25460 475221 475628 gene locus_tag LOCUS_25470 475221 475628 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804405.1 protein_id gnl|my_center|LOCUS_25470 475612 478239 gene locus_tag LOCUS_25480 gene mgtA 475612 478239 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704210.1 protein_id gnl|my_center|LOCUS_25480 479634 478258 gene locus_tag LOCUS_25490 479634 478258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973466.1 protein_id gnl|my_center|LOCUS_25490 481194 479752 gene locus_tag LOCUS_25500 481194 479752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 481396 481602 gene locus_tag LOCUS_25510 481396 481602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 481699 483054 gene locus_tag LOCUS_25520 gene phoA 481699 483054 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224636.1 protein_id gnl|my_center|LOCUS_25520 483227 484165 gene locus_tag LOCUS_25530 483227 484165 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031009.1 protein_id gnl|my_center|LOCUS_25530 484465 484181 gene locus_tag LOCUS_25540 484465 484181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 485383 484472 gene locus_tag LOCUS_25550 485383 484472 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972095.1 protein_id gnl|my_center|LOCUS_25550 485447 486364 gene locus_tag LOCUS_25560 485447 486364 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030134.1 protein_id gnl|my_center|LOCUS_25560 487977 486370 gene locus_tag LOCUS_25570 487977 486370 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973724.1 protein_id gnl|my_center|LOCUS_25570 488049 488291 gene locus_tag LOCUS_25580 488049 488291 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973725.1 protein_id gnl|my_center|LOCUS_25580 488304 488828 gene locus_tag LOCUS_25590 488304 488828 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918290.1 protein_id gnl|my_center|LOCUS_25590 489015 489443 gene locus_tag LOCUS_25600 489015 489443 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_25600 489801 489472 gene locus_tag LOCUS_25610 489801 489472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 489736 490452 gene locus_tag LOCUS_25620 489736 490452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 490962 490477 gene locus_tag LOCUS_25630 490962 490477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 491045 492013 gene locus_tag LOCUS_25640 491045 492013 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030131.1 protein_id gnl|my_center|LOCUS_25640 492338 492595 gene locus_tag LOCUS_25650 492338 492595 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973730.1 protein_id gnl|my_center|LOCUS_25650 494208 492730 gene locus_tag LOCUS_25660 494208 492730 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_25660 494669 495454 gene locus_tag LOCUS_25670 gene nagB 494669 495454 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030128.1 protein_id gnl|my_center|LOCUS_25670 497058 495535 gene locus_tag LOCUS_25680 497058 495535 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031132272.1 protein_id gnl|my_center|LOCUS_25680 497908 497069 gene locus_tag LOCUS_25690 497908 497069 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973737.1 protein_id gnl|my_center|LOCUS_25690 498885 497905 gene locus_tag LOCUS_25700 498885 497905 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973738.1 protein_id gnl|my_center|LOCUS_25700 500258 498987 gene locus_tag LOCUS_25710 gene dasA 500258 498987 CDS product N,N'-diacetylchitobiose ABC transporter substrate-binding protein DasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973739.1 protein_id gnl|my_center|LOCUS_25710 500583 500371 gene locus_tag LOCUS_25720 500583 500371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 500513 501283 gene locus_tag LOCUS_25730 500513 501283 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973740.1 protein_id gnl|my_center|LOCUS_25730 501424 501651 gene locus_tag LOCUS_25740 501424 501651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 501648 502151 gene locus_tag LOCUS_25750 501648 502151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 503818 502169 gene locus_tag LOCUS_25760 503818 502169 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028087.1 protein_id gnl|my_center|LOCUS_25760 505793 503895 gene locus_tag LOCUS_25770 505793 503895 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028738.1 protein_id gnl|my_center|LOCUS_25770 507481 505907 gene locus_tag LOCUS_25780 gene fusH 507481 505907 CDS product fusidic acid esterase FusH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030656.1 protein_id gnl|my_center|LOCUS_25780 508030 507515 gene locus_tag LOCUS_25790 508030 507515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972387.1 protein_id gnl|my_center|LOCUS_25790 508640 511753 gene locus_tag LOCUS_25800 508640 511753 CDS product ALF repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030734.1 protein_id gnl|my_center|LOCUS_25800 511766 512047 gene locus_tag LOCUS_25810 511766 512047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 512086 513045 gene locus_tag LOCUS_25820 512086 513045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 514602 513109 gene locus_tag LOCUS_25830 514602 513109 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_25830 515265 514672 gene locus_tag LOCUS_25840 515265 514672 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972866.1 protein_id gnl|my_center|LOCUS_25840 515699 516028 gene locus_tag LOCUS_25850 515699 516028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 516025 517656 gene locus_tag LOCUS_25860 516025 517656 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973742.1 protein_id gnl|my_center|LOCUS_25860 517723 517636 gene locus_tag LOCUS_t00230 517723 517636 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 518122 520524 gene locus_tag LOCUS_25870 518122 520524 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 protein_id gnl|my_center|LOCUS_25870 520524 521546 gene locus_tag LOCUS_25880 520524 521546 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 protein_id gnl|my_center|LOCUS_25880 522318 521677 gene locus_tag LOCUS_25890 gene def 522318 521677 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973751.1 protein_id gnl|my_center|LOCUS_25890 523402 522410 gene locus_tag LOCUS_25900 523402 522410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973752.1 protein_id gnl|my_center|LOCUS_25900 525304 523628 gene locus_tag LOCUS_25910 525304 523628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 526647 525301 gene locus_tag LOCUS_25920 526647 525301 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030117.1 protein_id gnl|my_center|LOCUS_25920 527136 526813 gene locus_tag LOCUS_25930 gene rsrA 527136 526813 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973755.1 protein_id gnl|my_center|LOCUS_25930 527978 527133 gene locus_tag LOCUS_25940 gene sigR 527978 527133 CDS product RNA polymerase sigma factor SigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973756.1 protein_id gnl|my_center|LOCUS_25940 528765 528124 gene locus_tag LOCUS_25950 528765 528124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_25950 529643 528813 gene locus_tag LOCUS_25960 529643 528813 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_25960 529685 530401 gene locus_tag LOCUS_25970 529685 530401 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_25970 530429 531799 gene locus_tag LOCUS_25980 gene aroA 530429 531799 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973760.1 protein_id gnl|my_center|LOCUS_25980 531817 532824 gene locus_tag LOCUS_25990 gene rsgA 531817 532824 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973761.1 protein_id gnl|my_center|LOCUS_25990 532912 533271 gene locus_tag LOCUS_26000 532912 533271 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973762.1 protein_id gnl|my_center|LOCUS_26000 533898 533299 gene locus_tag LOCUS_26010 533898 533299 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030115.1 protein_id gnl|my_center|LOCUS_26010 534057 534863 gene locus_tag LOCUS_26020 gene hisN 534057 534863 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973764.1 protein_id gnl|my_center|LOCUS_26020 535065 535469 gene locus_tag LOCUS_26030 535065 535469 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486342.1 protein_id gnl|my_center|LOCUS_26030 537061 535586 gene locus_tag LOCUS_26040 537061 535586 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972723.1 protein_id gnl|my_center|LOCUS_26040 537223 537639 gene locus_tag LOCUS_26050 537223 537639 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 protein_id gnl|my_center|LOCUS_26050 537754 537680 gene locus_tag LOCUS_t00240 537754 537680 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 539701 537845 gene locus_tag LOCUS_26060 539701 537845 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030113.1 protein_id gnl|my_center|LOCUS_26060 540140 540066 gene locus_tag LOCUS_t00250 540140 540066 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 542998 540185 gene locus_tag LOCUS_26070 542998 540185 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973771.1 protein_id gnl|my_center|LOCUS_26070 543276 543860 gene locus_tag LOCUS_26080 543276 543860 CDS product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167526720.1 protein_id gnl|my_center|LOCUS_26080 545022 543955 gene locus_tag LOCUS_26090 545022 543955 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973773.1 protein_id gnl|my_center|LOCUS_26090 545303 545130 gene locus_tag LOCUS_26100 545303 545130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 545994 545503 gene locus_tag LOCUS_26110 545994 545503 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_26110 547251 546184 gene locus_tag LOCUS_26120 547251 546184 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973776.1 protein_id gnl|my_center|LOCUS_26120 547555 549018 gene locus_tag LOCUS_26130 547555 549018 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973777.1 protein_id gnl|my_center|LOCUS_26130 549015 549536 gene locus_tag LOCUS_26140 549015 549536 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973778.1 protein_id gnl|my_center|LOCUS_26140 550370 549612 gene locus_tag LOCUS_26150 550370 549612 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030111.1 protein_id gnl|my_center|LOCUS_26150 551097 550390 gene locus_tag LOCUS_26160 551097 550390 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973780.1 protein_id gnl|my_center|LOCUS_26160 552896 551109 gene locus_tag LOCUS_26170 552896 551109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26170 553597 553001 gene locus_tag LOCUS_26180 553597 553001 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867997.1 protein_id gnl|my_center|LOCUS_26180 553683 555026 gene locus_tag LOCUS_26190 553683 555026 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486346.1 protein_id gnl|my_center|LOCUS_26190 555019 556383 gene locus_tag LOCUS_26200 555019 556383 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_26200 557062 556742 gene locus_tag LOCUS_26210 557062 556742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973785.1 protein_id gnl|my_center|LOCUS_26210 557421 557059 gene locus_tag LOCUS_26220 557421 557059 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973786.1 protein_id gnl|my_center|LOCUS_26220 557857 557555 gene locus_tag LOCUS_26230 557857 557555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973787.1 protein_id gnl|my_center|LOCUS_26230 560213 558003 gene locus_tag LOCUS_26240 560213 558003 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668762.1 protein_id gnl|my_center|LOCUS_26240 560380 560622 gene locus_tag LOCUS_26250 560380 560622 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973789.1 protein_id gnl|my_center|LOCUS_26250 561612 560659 gene locus_tag LOCUS_26260 gene nudC 561612 560659 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_26260 563099 561666 gene locus_tag LOCUS_26270 563099 561666 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973791.1 protein_id gnl|my_center|LOCUS_26270 566551 563147 gene locus_tag LOCUS_26280 566551 563147 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486348.1 protein_id gnl|my_center|LOCUS_26280 569876 566559 gene locus_tag LOCUS_26290 569876 566559 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030103.1 protein_id gnl|my_center|LOCUS_26290 570434 570090 gene locus_tag LOCUS_26300 570434 570090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 570624 573326 gene locus_tag LOCUS_26310 570624 573326 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030101.1 protein_id gnl|my_center|LOCUS_26310 573482 573886 gene locus_tag LOCUS_26320 573482 573886 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975235.1 protein_id gnl|my_center|LOCUS_26320 573899 574663 gene locus_tag LOCUS_26330 gene modA 573899 574663 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110929.1 protein_id gnl|my_center|LOCUS_26330 574660 576642 gene locus_tag LOCUS_26340 574660 576642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 576746 578266 gene locus_tag LOCUS_26350 576746 578266 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_26350 578390 579460 gene locus_tag LOCUS_26360 578390 579460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 579525 581114 gene locus_tag LOCUS_26370 579525 581114 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030100.1 protein_id gnl|my_center|LOCUS_26370 582376 581198 gene locus_tag LOCUS_26380 gene moeZ 582376 581198 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_26380 583255 582461 gene locus_tag LOCUS_26390 583255 582461 CDS product spherulation-specific family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973799.1 protein_id gnl|my_center|LOCUS_26390 584157 583243 gene locus_tag LOCUS_26400 584157 583243 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134112038.1 protein_id gnl|my_center|LOCUS_26400 585237 584254 gene locus_tag LOCUS_26410 585237 584254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867977.1 protein_id gnl|my_center|LOCUS_26410 586859 585315 gene locus_tag LOCUS_26420 586859 585315 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030096.1 protein_id gnl|my_center|LOCUS_26420 588640 587009 gene locus_tag LOCUS_26430 588640 587009 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969966.1 protein_id gnl|my_center|LOCUS_26430 589626 588637 gene locus_tag LOCUS_26440 589626 588637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973520.1 protein_id gnl|my_center|LOCUS_26440 590648 589623 gene locus_tag LOCUS_26450 590648 589623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973522.1 protein_id gnl|my_center|LOCUS_26450 592369 590645 gene locus_tag LOCUS_26460 592369 590645 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994617.1 protein_id gnl|my_center|LOCUS_26460 594055 592691 gene locus_tag LOCUS_26470 594055 592691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26470 594947 594048 gene locus_tag LOCUS_26480 594947 594048 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030094.1 protein_id gnl|my_center|LOCUS_26480 594928 595125 gene locus_tag LOCUS_26490 594928 595125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 595194 595421 gene locus_tag LOCUS_26500 595194 595421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 595592 596236 gene locus_tag LOCUS_26510 595592 596236 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_26510 596429 596656 gene locus_tag LOCUS_26520 596429 596656 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221492514.1 protein_id gnl|my_center|LOCUS_26520 596872 597150 gene locus_tag LOCUS_26530 596872 597150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973810.1 protein_id gnl|my_center|LOCUS_26530 597949 597215 gene locus_tag LOCUS_26540 597949 597215 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_26540 598254 601151 gene locus_tag LOCUS_26550 598254 601151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26550 601318 602193 gene locus_tag LOCUS_26560 601318 602193 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_26560 602969 602190 gene locus_tag LOCUS_26570 602969 602190 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_26570 603204 603356 gene locus_tag LOCUS_26580 603204 603356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444413.1 protein_id gnl|my_center|LOCUS_26580 604039 603434 gene locus_tag LOCUS_26590 604039 603434 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973815.1 protein_id gnl|my_center|LOCUS_26590 605108 604245 gene locus_tag LOCUS_26600 605108 604245 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_26600 605831 605190 gene locus_tag LOCUS_26610 605831 605190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_26610 606539 605940 gene locus_tag LOCUS_26620 606539 605940 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030091.1 protein_id gnl|my_center|LOCUS_26620 607037 608152 gene locus_tag LOCUS_26630 607037 608152 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030090.1 protein_id gnl|my_center|LOCUS_26630 609142 608156 gene locus_tag LOCUS_26640 609142 608156 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_26640 609184 609678 gene locus_tag LOCUS_26650 609184 609678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973821.1 protein_id gnl|my_center|LOCUS_26650 610525 609701 gene locus_tag LOCUS_26660 610525 609701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973822.1 protein_id gnl|my_center|LOCUS_26660 610711 611997 gene locus_tag LOCUS_26670 610711 611997 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_26670 611994 612608 gene locus_tag LOCUS_26680 611994 612608 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469672.1 protein_id gnl|my_center|LOCUS_26680 612652 613812 gene locus_tag LOCUS_26690 612652 613812 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973825.1 protein_id gnl|my_center|LOCUS_26690 614067 613876 gene locus_tag LOCUS_26700 614067 613876 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672132.1 protein_id gnl|my_center|LOCUS_26700 614863 614171 gene locus_tag LOCUS_26710 614863 614171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327210.1 protein_id gnl|my_center|LOCUS_26710 615428 614982 gene locus_tag LOCUS_26720 615428 614982 CDS product sec-independent translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030086.1 protein_id gnl|my_center|LOCUS_26720 617379 615619 gene locus_tag LOCUS_26730 617379 615619 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456948.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26730 618297 617512 gene locus_tag LOCUS_26740 618297 617512 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030084.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26740 618959 618294 gene locus_tag LOCUS_26750 gene sigE 618959 618294 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_26750 619331 619933 gene locus_tag LOCUS_26760 619331 619933 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469700.1 protein_id gnl|my_center|LOCUS_26760 620303 620136 gene locus_tag LOCUS_26770 620303 620136 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966491.1 protein_id gnl|my_center|LOCUS_26770 620618 621418 gene locus_tag LOCUS_26780 620618 621418 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030081.1 protein_id gnl|my_center|LOCUS_26780 622024 621428 gene locus_tag LOCUS_26790 622024 621428 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_26790 622455 622021 gene locus_tag LOCUS_26800 622455 622021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 622572 623432 gene locus_tag LOCUS_26810 gene folP 622572 623432 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327205.1 protein_id gnl|my_center|LOCUS_26810 624192 623443 gene locus_tag LOCUS_26820 624192 623443 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973837.1 protein_id gnl|my_center|LOCUS_26820 625398 624295 gene locus_tag LOCUS_26830 gene dapE 625398 624295 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_26830 625463 626383 gene locus_tag LOCUS_26840 625463 626383 CDS product heavy metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486364.1 protein_id gnl|my_center|LOCUS_26840 626673 627071 gene locus_tag LOCUS_26850 626673 627071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973840.1 protein_id gnl|my_center|LOCUS_26850 628272 627175 gene locus_tag LOCUS_26860 628272 627175 CDS product bifunctional succinyldiaminopimelate transaminase/glutamate-prephenate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030077.1 protein_id gnl|my_center|LOCUS_26860 628723 628391 gene locus_tag LOCUS_26870 628723 628391 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973842.1 protein_id gnl|my_center|LOCUS_26870 628838 629842 gene locus_tag LOCUS_26880 628838 629842 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030076.1 protein_id gnl|my_center|LOCUS_26880 630052 630768 gene locus_tag LOCUS_26890 630052 630768 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030075.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26890 631432 630860 gene locus_tag LOCUS_26900 631432 630860 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030074.1 protein_id gnl|my_center|LOCUS_26900 632723 631506 gene locus_tag LOCUS_26910 632723 631506 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030073.1 protein_id gnl|my_center|LOCUS_26910 633511 632771 gene locus_tag LOCUS_26920 633511 632771 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973847.1 protein_id gnl|my_center|LOCUS_26920 634461 633508 gene locus_tag LOCUS_26930 634461 633508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973848.1 protein_id gnl|my_center|LOCUS_26930 637659 634615 gene locus_tag LOCUS_26940 637659 634615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 637616 637756 gene locus_tag LOCUS_26950 637616 637756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 638423 638034 gene locus_tag LOCUS_26960 638423 638034 CDS product DUF6113 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030071.1 protein_id gnl|my_center|LOCUS_26960 639319 638423 gene locus_tag LOCUS_26970 gene mshB 639319 638423 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030070.1 protein_id gnl|my_center|LOCUS_26970 639318 639509 gene locus_tag LOCUS_26980 639318 639509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 639619 639425 gene locus_tag LOCUS_26990 639619 639425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973854.1 protein_id gnl|my_center|LOCUS_26990 639843 641966 gene locus_tag LOCUS_27000 639843 641966 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030068.1 protein_id gnl|my_center|LOCUS_27000 642179 643213 gene locus_tag LOCUS_27010 642179 643213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973865.1 protein_id gnl|my_center|LOCUS_27010 643340 645094 gene locus_tag LOCUS_27020 643340 645094 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973864.1 protein_id gnl|my_center|LOCUS_27020 645099 646076 gene locus_tag LOCUS_27030 645099 646076 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973863.1 protein_id gnl|my_center|LOCUS_27030 646186 647205 gene locus_tag LOCUS_27040 646186 647205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973862.1 protein_id gnl|my_center|LOCUS_27040 647217 648257 gene locus_tag LOCUS_27050 647217 648257 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973861.1 protein_id gnl|my_center|LOCUS_27050 648374 648550 gene locus_tag LOCUS_27060 648374 648550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 648658 649983 gene locus_tag LOCUS_27070 648658 649983 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038035.1 protein_id gnl|my_center|LOCUS_27070 651164 650133 gene locus_tag LOCUS_27080 651164 650133 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_27080 652140 651154 gene locus_tag LOCUS_27090 652140 651154 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_27090 653180 652152 gene locus_tag LOCUS_27100 653180 652152 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_27100 654096 653173 gene locus_tag LOCUS_27110 654096 653173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_27110 655748 654126 gene locus_tag LOCUS_27120 655748 654126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_27120 655931 656797 gene locus_tag LOCUS_27130 655931 656797 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_27130 656855 657337 gene locus_tag LOCUS_27140 656855 657337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 657334 660105 gene locus_tag LOCUS_27150 657334 660105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 660102 660335 gene locus_tag LOCUS_27160 660102 660335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 660460 660819 gene locus_tag LOCUS_27170 660460 660819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 660859 662274 gene locus_tag LOCUS_27180 660859 662274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 662284 663198 gene locus_tag LOCUS_27190 662284 663198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 663305 663808 gene locus_tag LOCUS_27200 663305 663808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 665039 663897 gene locus_tag LOCUS_27210 665039 663897 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030067.1 protein_id gnl|my_center|LOCUS_27210 666090 665032 gene locus_tag LOCUS_27220 666090 665032 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030066.1 protein_id gnl|my_center|LOCUS_27220 667070 666102 gene locus_tag LOCUS_27230 667070 666102 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973858.1 protein_id gnl|my_center|LOCUS_27230 667992 667063 gene locus_tag LOCUS_27240 667992 667063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973859.1 protein_id gnl|my_center|LOCUS_27240 669798 668155 gene locus_tag LOCUS_27250 669798 668155 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973860.1 protein_id gnl|my_center|LOCUS_27250 670845 670141 gene locus_tag LOCUS_27260 670845 670141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27260 671868 670867 gene locus_tag LOCUS_27270 671868 670867 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_27270 673486 671879 gene locus_tag LOCUS_27280 673486 671879 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086928.1 protein_id gnl|my_center|LOCUS_27280 674776 673553 gene locus_tag LOCUS_27290 674776 673553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 676007 674778 gene locus_tag LOCUS_27300 676007 674778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 676963 676004 gene locus_tag LOCUS_27310 676963 676004 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975025.1 protein_id gnl|my_center|LOCUS_27310 677809 676967 gene locus_tag LOCUS_27320 677809 676967 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266331.1 protein_id gnl|my_center|LOCUS_27320 679016 677820 gene locus_tag LOCUS_27330 gene hemT 679016 677820 CDS product 5-aminolevulinic acid synthase HemT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338981.1 protein_id gnl|my_center|LOCUS_27330 679240 679079 gene locus_tag LOCUS_27340 679240 679079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 679378 680379 gene locus_tag LOCUS_27350 679378 680379 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485134.1 protein_id gnl|my_center|LOCUS_27350 682344 680440 gene locus_tag LOCUS_27360 gene typA 682344 680440 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_27360 684740 682566 gene locus_tag LOCUS_27370 684740 682566 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030064.1 protein_id gnl|my_center|LOCUS_27370 684919 685338 gene locus_tag LOCUS_27380 684919 685338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 685390 686229 gene locus_tag LOCUS_27390 685390 686229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_27390 686289 688217 gene locus_tag LOCUS_27400 686289 688217 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030061.1 protein_id gnl|my_center|LOCUS_27400 688214 688981 gene locus_tag LOCUS_27410 688214 688981 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973872.1 protein_id gnl|my_center|LOCUS_27410 689217 691106 gene locus_tag LOCUS_27420 689217 691106 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110219.1 protein_id gnl|my_center|LOCUS_27420 693738 691213 gene locus_tag LOCUS_27430 693738 691213 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030059.1 protein_id gnl|my_center|LOCUS_27430 694337 693927 gene locus_tag LOCUS_27440 694337 693927 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030058.1 protein_id gnl|my_center|LOCUS_27440 694929 694522 gene locus_tag LOCUS_27450 694929 694522 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973876.1 protein_id gnl|my_center|LOCUS_27450 695183 695004 gene locus_tag LOCUS_27460 695183 695004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973877.1 protein_id gnl|my_center|LOCUS_27460 696991 695348 gene locus_tag LOCUS_27470 696991 695348 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246447.1 protein_id gnl|my_center|LOCUS_27470 698012 697260 gene locus_tag LOCUS_27480 698012 697260 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973878.1 protein_id gnl|my_center|LOCUS_27480 698280 700874 gene locus_tag LOCUS_27490 698280 700874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 701141 701410 gene locus_tag LOCUS_27500 701141 701410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 701403 701666 gene locus_tag LOCUS_27510 701403 701666 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_27510 702888 701800 gene locus_tag LOCUS_27520 gene ychF 702888 701800 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_27520 703076 703675 gene locus_tag LOCUS_27530 703076 703675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 704336 703572 gene locus_tag LOCUS_27540 704336 703572 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973919.1 protein_id gnl|my_center|LOCUS_27540 705356 704367 gene locus_tag LOCUS_27550 705356 704367 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973920.1 protein_id gnl|my_center|LOCUS_27550 705424 706779 gene locus_tag LOCUS_27560 705424 706779 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973921.1 protein_id gnl|my_center|LOCUS_27560 707091 708350 gene locus_tag LOCUS_27570 gene xseA 707091 708350 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030027.1 protein_id gnl|my_center|LOCUS_27570 708361 708609 gene locus_tag LOCUS_27580 708361 708609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 708778 709368 gene locus_tag LOCUS_27590 708778 709368 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973928.1 protein_id gnl|my_center|LOCUS_27590 710012 709458 gene locus_tag LOCUS_27600 710012 709458 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973929.1 protein_id gnl|my_center|LOCUS_27600 710224 711255 gene locus_tag LOCUS_27610 gene glpX 710224 711255 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_27610 711703 711347 gene locus_tag LOCUS_27620 711703 711347 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030021.1 protein_id gnl|my_center|LOCUS_27620 712625 711915 gene locus_tag LOCUS_27630 712625 711915 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030020.1 protein_id gnl|my_center|LOCUS_27630 712741 714405 gene locus_tag LOCUS_27640 712741 714405 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327174.1 protein_id gnl|my_center|LOCUS_27640 716003 714468 gene locus_tag LOCUS_27650 716003 714468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 716109 717536 gene locus_tag LOCUS_27660 716109 717536 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030018.1 protein_id gnl|my_center|LOCUS_27660 717624 718394 gene locus_tag LOCUS_27670 717624 718394 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030017.1 protein_id gnl|my_center|LOCUS_27670 718638 719312 gene locus_tag LOCUS_27680 718638 719312 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970812.1 protein_id gnl|my_center|LOCUS_27680 719373 721901 gene locus_tag LOCUS_27690 719373 721901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 722030 723493 gene locus_tag LOCUS_27700 722030 723493 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 protein_id gnl|my_center|LOCUS_27700 725827 723560 gene locus_tag LOCUS_27710 725827 723560 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973938.1 protein_id gnl|my_center|LOCUS_27710 726068 726994 gene locus_tag LOCUS_27720 726068 726994 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_27720 726991 727227 gene locus_tag LOCUS_27730 726991 727227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 727437 727961 gene locus_tag LOCUS_27740 727437 727961 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_27740 727958 728653 gene locus_tag LOCUS_27750 727958 728653 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_27750 728640 731084 gene locus_tag LOCUS_27760 728640 731084 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327169.1 protein_id gnl|my_center|LOCUS_27760 732188 731199 gene locus_tag LOCUS_27770 732188 731199 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973944.1 protein_id gnl|my_center|LOCUS_27770 732324 732878 gene locus_tag LOCUS_27780 732324 732878 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973945.1 protein_id gnl|my_center|LOCUS_27780 732890 733423 gene locus_tag LOCUS_27790 732890 733423 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973946.1 protein_id gnl|my_center|LOCUS_27790 734908 733496 gene locus_tag LOCUS_27800 734908 733496 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030013.1 protein_id gnl|my_center|LOCUS_27800 735746 735033 gene locus_tag LOCUS_27810 735746 735033 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973948.1 protein_id gnl|my_center|LOCUS_27810 737467 736145 gene locus_tag LOCUS_27820 737467 736145 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_27820 738628 737873 gene locus_tag LOCUS_27830 738628 737873 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167441465.1 protein_id gnl|my_center|LOCUS_27830 738739 739788 gene locus_tag LOCUS_27840 gene mgrA 738739 739788 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_27840 741426 740233 gene locus_tag LOCUS_27850 741426 740233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106206.1 protein_id gnl|my_center|LOCUS_27850 742129 741548 gene locus_tag LOCUS_27860 742129 741548 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226768.1 protein_id gnl|my_center|LOCUS_27860 743812 742181 gene locus_tag LOCUS_27870 743812 742181 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071802696.1 protein_id gnl|my_center|LOCUS_27870 744255 743809 gene locus_tag LOCUS_27880 744255 743809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 744590 744252 gene locus_tag LOCUS_27890 744590 744252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 744701 745432 gene locus_tag LOCUS_27900 744701 745432 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231033.1 protein_id gnl|my_center|LOCUS_27900 745529 745906 gene locus_tag LOCUS_27910 745529 745906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978001.1 protein_id gnl|my_center|LOCUS_27910 746512 745994 gene locus_tag LOCUS_27920 746512 745994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 746793 747152 gene locus_tag LOCUS_27930 746793 747152 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487141.1 protein_id gnl|my_center|LOCUS_27930 747281 748297 gene locus_tag LOCUS_27940 747281 748297 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227260.1 protein_id gnl|my_center|LOCUS_27940 749640 748354 gene locus_tag LOCUS_27950 749640 748354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029277.1 protein_id gnl|my_center|LOCUS_27950 749792 750064 gene locus_tag LOCUS_27960 749792 750064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 750656 750132 gene locus_tag LOCUS_27970 750656 750132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029992.1 protein_id gnl|my_center|LOCUS_27970 750943 751794 gene locus_tag LOCUS_27980 750943 751794 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 protein_id gnl|my_center|LOCUS_27980 751806 751997 gene locus_tag LOCUS_27990 751806 751997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973980.1 protein_id gnl|my_center|LOCUS_27990 752011 752286 gene locus_tag LOCUS_28000 752011 752286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 752606 752812 gene locus_tag LOCUS_28010 752606 752812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 752963 753820 gene locus_tag LOCUS_28020 752963 753820 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082846.1 protein_id gnl|my_center|LOCUS_28020 754475 753840 gene locus_tag LOCUS_28030 754475 753840 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030005.1 protein_id gnl|my_center|LOCUS_28030 755044 754472 gene locus_tag LOCUS_28040 755044 754472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030004.1 protein_id gnl|my_center|LOCUS_28040 755680 755081 gene locus_tag LOCUS_28050 755680 755081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 755925 755746 gene locus_tag LOCUS_28060 755925 755746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 757120 756233 gene locus_tag LOCUS_28070 757120 756233 CDS product DUF5936 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030001.1 protein_id gnl|my_center|LOCUS_28070 758129 757182 gene locus_tag LOCUS_28080 758129 757182 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030000.1 protein_id gnl|my_center|LOCUS_28080 759607 758144 gene locus_tag LOCUS_28090 759607 758144 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973968.1 protein_id gnl|my_center|LOCUS_28090 760050 759604 gene locus_tag LOCUS_28100 760050 759604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 761778 760054 gene locus_tag LOCUS_28110 761778 760054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 762550 761831 gene locus_tag LOCUS_28120 gene cpaB 762550 761831 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973972.1 protein_id gnl|my_center|LOCUS_28120 763643 762675 gene locus_tag LOCUS_28130 763643 762675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029997.1 protein_id gnl|my_center|LOCUS_28130 764049 765692 gene locus_tag LOCUS_28140 764049 765692 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029996.1 protein_id gnl|my_center|LOCUS_28140 766638 765751 gene locus_tag LOCUS_28150 766638 765751 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029986.1 protein_id gnl|my_center|LOCUS_28150 766864 768270 gene locus_tag LOCUS_28160 766864 768270 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230482.1 protein_id gnl|my_center|LOCUS_28160 768744 768328 gene locus_tag LOCUS_28170 768744 768328 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973987.1 protein_id gnl|my_center|LOCUS_28170 769520 768741 gene locus_tag LOCUS_28180 769520 768741 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973988.1 protein_id gnl|my_center|LOCUS_28180 770566 769517 gene locus_tag LOCUS_28190 770566 769517 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029988.1 protein_id gnl|my_center|LOCUS_28190 770695 772023 gene locus_tag LOCUS_28200 770695 772023 CDS product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973990.1 protein_id gnl|my_center|LOCUS_28200 772185 773801 gene locus_tag LOCUS_28210 772185 773801 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029987.1 protein_id gnl|my_center|LOCUS_28210 773862 775100 gene locus_tag LOCUS_28220 773862 775100 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973993.1 protein_id gnl|my_center|LOCUS_28220 775184 775582 gene locus_tag LOCUS_28230 775184 775582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973994.1 protein_id gnl|my_center|LOCUS_28230 776054 775566 gene locus_tag LOCUS_28240 776054 775566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 776360 776136 gene locus_tag LOCUS_28250 776360 776136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 776439 776618 gene locus_tag LOCUS_28260 776439 776618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 777716 776886 gene locus_tag LOCUS_28270 777716 776886 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_28270 778234 777713 gene locus_tag LOCUS_28280 778234 777713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_28280 779486 778224 gene locus_tag LOCUS_28290 779486 778224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 780497 779649 gene locus_tag LOCUS_28300 780497 779649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 780826 780554 gene locus_tag LOCUS_28310 780826 780554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 782672 780852 gene locus_tag LOCUS_28320 782672 780852 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_28320 783065 783727 gene locus_tag LOCUS_28330 783065 783727 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_28330 783913 783701 gene locus_tag LOCUS_28340 783913 783701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 784049 784690 gene locus_tag LOCUS_28350 784049 784690 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 protein_id gnl|my_center|LOCUS_28350 786792 784765 gene locus_tag LOCUS_28360 786792 784765 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974002.1 protein_id gnl|my_center|LOCUS_28360 787148 786948 gene locus_tag LOCUS_28370 787148 786948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 788004 787153 gene locus_tag LOCUS_28380 gene mca 788004 787153 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007444314.1 protein_id gnl|my_center|LOCUS_28380 788145 788555 gene locus_tag LOCUS_28390 788145 788555 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974010.1 protein_id gnl|my_center|LOCUS_28390 788775 789272 gene locus_tag LOCUS_28400 gene greA 788775 789272 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974011.1 protein_id gnl|my_center|LOCUS_28400 790209 789346 gene locus_tag LOCUS_28410 790209 789346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974012.1 protein_id gnl|my_center|LOCUS_28410 791234 790206 gene locus_tag LOCUS_28420 791234 790206 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_28420 792590 791373 gene locus_tag LOCUS_28430 gene ilvA 792590 791373 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_28430 792807 793310 gene locus_tag LOCUS_28440 792807 793310 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666375.1 protein_id gnl|my_center|LOCUS_28440 793363 793791 gene locus_tag LOCUS_28450 793363 793791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28450 793788 794042 gene locus_tag LOCUS_28460 793788 794042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 795288 794143 gene locus_tag LOCUS_28470 795288 794143 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870223.1 protein_id gnl|my_center|LOCUS_28470 795445 796530 gene locus_tag LOCUS_28480 795445 796530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_28480 796640 798328 gene locus_tag LOCUS_28490 796640 798328 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230595.1 protein_id gnl|my_center|LOCUS_28490 798388 799506 gene locus_tag LOCUS_28500 798388 799506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974019.1 protein_id gnl|my_center|LOCUS_28500 799506 800171 gene locus_tag LOCUS_28510 gene msrA 799506 800171 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338316.1 protein_id gnl|my_center|LOCUS_28510 801229 800168 gene locus_tag LOCUS_28520 801229 800168 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815985.1 protein_id gnl|my_center|LOCUS_28520 802170 801370 gene locus_tag LOCUS_28530 802170 801370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 803687 802353 gene locus_tag LOCUS_28540 803687 802353 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028368.1 protein_id gnl|my_center|LOCUS_28540 804424 803684 gene locus_tag LOCUS_28550 804424 803684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485073.1 protein_id gnl|my_center|LOCUS_28550 804567 805493 gene locus_tag LOCUS_28560 804567 805493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 806167 805553 gene locus_tag LOCUS_28570 806167 805553 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181390343.1 protein_id gnl|my_center|LOCUS_28570 806223 807014 gene locus_tag LOCUS_28580 806223 807014 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229990.1 protein_id gnl|my_center|LOCUS_28580 808379 807165 gene locus_tag LOCUS_28590 808379 807165 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028973.1 protein_id gnl|my_center|LOCUS_28590 809594 808611 gene locus_tag LOCUS_28600 809594 808611 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804257.1 protein_id gnl|my_center|LOCUS_28600 810994 809720 gene locus_tag LOCUS_28610 810994 809720 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 protein_id gnl|my_center|LOCUS_28610 811316 811585 gene locus_tag LOCUS_28620 811316 811585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 813126 811597 gene locus_tag LOCUS_28630 gene hutH 813126 811597 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974041.1 protein_id gnl|my_center|LOCUS_28630 814495 813257 gene locus_tag LOCUS_28640 814495 813257 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870180.1 protein_id gnl|my_center|LOCUS_28640 815388 814528 gene locus_tag LOCUS_28650 815388 814528 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029956.1 protein_id gnl|my_center|LOCUS_28650 816650 815487 gene locus_tag LOCUS_28660 816650 815487 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029954.1 protein_id gnl|my_center|LOCUS_28660 817647 816781 gene locus_tag LOCUS_28670 817647 816781 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029953.1 protein_id gnl|my_center|LOCUS_28670 817847 819445 gene locus_tag LOCUS_28680 817847 819445 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_28680 819489 819695 gene locus_tag LOCUS_28690 819489 819695 CDS product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974048.1 protein_id gnl|my_center|LOCUS_28690 819769 819897 gene locus_tag LOCUS_28700 819769 819897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 819984 821435 gene locus_tag LOCUS_28710 819984 821435 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_28710 821489 822100 gene locus_tag LOCUS_28720 821489 822100 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974050.1 protein_id gnl|my_center|LOCUS_28720 822741 822148 gene locus_tag LOCUS_28730 822741 822148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 822939 823694 gene locus_tag LOCUS_28740 822939 823694 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031782.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence04 1300 98 gene locus_tag LOCUS_28750 1300 98 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869456.1 protein_id gnl|my_center|LOCUS_28750 1410 1625 gene locus_tag LOCUS_28760 1410 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976644.1 protein_id gnl|my_center|LOCUS_28760 2417 1695 gene locus_tag LOCUS_28770 2417 1695 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028174.1 protein_id gnl|my_center|LOCUS_28770 3079 2477 gene locus_tag LOCUS_28780 3079 2477 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28780 3348 4142 gene locus_tag LOCUS_28790 3348 4142 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739112.1 protein_id gnl|my_center|LOCUS_28790 4188 4466 gene locus_tag LOCUS_28800 4188 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_28800 4610 5920 gene locus_tag LOCUS_28810 4610 5920 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976650.1 protein_id gnl|my_center|LOCUS_28810 5917 6603 gene locus_tag LOCUS_28820 5917 6603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976651.1 protein_id gnl|my_center|LOCUS_28820 6708 7763 gene locus_tag LOCUS_28830 gene cobT 6708 7763 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028178.1 protein_id gnl|my_center|LOCUS_28830 7858 9618 gene locus_tag LOCUS_28840 7858 9618 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030881.1 protein_id gnl|my_center|LOCUS_28840 9615 10373 gene locus_tag LOCUS_28850 9615 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030880.1 protein_id gnl|my_center|LOCUS_28850 11070 10333 gene locus_tag LOCUS_28860 11070 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028179.1 protein_id gnl|my_center|LOCUS_28860 11144 11968 gene locus_tag LOCUS_28870 11144 11968 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028180.1 protein_id gnl|my_center|LOCUS_28870 12102 13634 gene locus_tag LOCUS_28880 12102 13634 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028182.1 protein_id gnl|my_center|LOCUS_28880 13958 15346 gene locus_tag LOCUS_28890 gene lpdA 13958 15346 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873385.1 protein_id gnl|my_center|LOCUS_28890 15396 17120 gene locus_tag LOCUS_28900 gene sucB 15396 17120 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028184.1 protein_id gnl|my_center|LOCUS_28900 17256 17879 gene locus_tag LOCUS_28910 17256 17879 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976633.1 protein_id gnl|my_center|LOCUS_28910 18131 19024 gene locus_tag LOCUS_28920 18131 19024 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033272919.1 protein_id gnl|my_center|LOCUS_28920 20341 19412 gene locus_tag LOCUS_28930 20341 19412 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973098.1 protein_id gnl|my_center|LOCUS_28930 20535 21053 gene locus_tag LOCUS_28940 20535 21053 CDS product DUF4240 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870944.1 protein_id gnl|my_center|LOCUS_28940 21056 21949 gene locus_tag LOCUS_28950 21056 21949 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870932.1 protein_id gnl|my_center|LOCUS_28950 22126 23448 gene locus_tag LOCUS_28960 22126 23448 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028190.1 protein_id gnl|my_center|LOCUS_28960 24416 23526 gene locus_tag LOCUS_28970 24416 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28970 24524 24850 gene locus_tag LOCUS_28980 24524 24850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 24865 25302 gene locus_tag LOCUS_28990 24865 25302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 25193 26095 gene locus_tag LOCUS_29000 gene lipB 25193 26095 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976622.1 protein_id gnl|my_center|LOCUS_29000 26257 27222 gene locus_tag LOCUS_29010 gene lipA 26257 27222 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976621.1 protein_id gnl|my_center|LOCUS_29010 27451 27711 gene locus_tag LOCUS_29020 27451 27711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028192.1 protein_id gnl|my_center|LOCUS_29020 27722 28408 gene locus_tag LOCUS_29030 27722 28408 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_29030 29012 28521 gene locus_tag LOCUS_29040 29012 28521 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_29040 29231 30640 gene locus_tag LOCUS_29050 gene glnA 29231 30640 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976617.1 protein_id gnl|my_center|LOCUS_29050 30798 31595 gene locus_tag LOCUS_29060 30798 31595 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974027.1 protein_id gnl|my_center|LOCUS_29060 31622 31987 gene locus_tag LOCUS_29070 31622 31987 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223911.1 protein_id gnl|my_center|LOCUS_29070 32816 32055 gene locus_tag LOCUS_29080 32816 32055 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224827.1 protein_id gnl|my_center|LOCUS_29080 32944 34389 gene locus_tag LOCUS_29090 32944 34389 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972427.1 protein_id gnl|my_center|LOCUS_29090 34484 35461 gene locus_tag LOCUS_29100 gene sph 34484 35461 CDS product sphingomyelin phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193577588.1 protein_id gnl|my_center|LOCUS_29100 35854 36507 gene locus_tag LOCUS_29110 35854 36507 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028201.1 protein_id gnl|my_center|LOCUS_29110 36650 37909 gene locus_tag LOCUS_29120 36650 37909 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028203.1 protein_id gnl|my_center|LOCUS_29120 37944 38417 gene locus_tag LOCUS_29130 37944 38417 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_29130 38408 39055 gene locus_tag LOCUS_29140 38408 39055 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028204.1 protein_id gnl|my_center|LOCUS_29140 39060 39686 gene locus_tag LOCUS_29150 39060 39686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 39738 40544 gene locus_tag LOCUS_29160 39738 40544 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386997.1 protein_id gnl|my_center|LOCUS_29160 40593 42581 gene locus_tag LOCUS_29170 40593 42581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028207.1 protein_id gnl|my_center|LOCUS_29170 40929 40835 gene locus_tag LOCUS_t00260 40929 40835 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42637 43365 gene locus_tag LOCUS_29180 42637 43365 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976592.1 protein_id gnl|my_center|LOCUS_29180 45907 43346 gene locus_tag LOCUS_29190 45907 43346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 47060 46065 gene locus_tag LOCUS_29200 47060 46065 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028214.1 protein_id gnl|my_center|LOCUS_29200 48203 47178 gene locus_tag LOCUS_29210 48203 47178 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976582.1 protein_id gnl|my_center|LOCUS_29210 49899 48229 gene locus_tag LOCUS_29220 49899 48229 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028213.1 protein_id gnl|my_center|LOCUS_29220 50824 49976 gene locus_tag LOCUS_29230 50824 49976 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_29230 51765 50821 gene locus_tag LOCUS_29240 51765 50821 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976584.1 protein_id gnl|my_center|LOCUS_29240 53074 51773 gene locus_tag LOCUS_29250 53074 51773 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_29250 53384 54808 gene locus_tag LOCUS_29260 53384 54808 CDS product carbohydrate-binding module family 20 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486988.1 protein_id gnl|my_center|LOCUS_29260 55177 54830 gene locus_tag LOCUS_29270 55177 54830 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975921.1 protein_id gnl|my_center|LOCUS_29270 58332 55219 gene locus_tag LOCUS_29280 58332 55219 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028215.1 protein_id gnl|my_center|LOCUS_29280 59752 58391 gene locus_tag LOCUS_29290 gene glnA 59752 58391 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_29290 59973 60554 gene locus_tag LOCUS_29300 59973 60554 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028486.1 protein_id gnl|my_center|LOCUS_29300 61482 60577 gene locus_tag LOCUS_29310 61482 60577 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078880017.1 protein_id gnl|my_center|LOCUS_29310 63039 61552 gene locus_tag LOCUS_29320 63039 61552 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225750.1 protein_id gnl|my_center|LOCUS_29320 63229 63684 gene locus_tag LOCUS_29330 63229 63684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 63771 65381 gene locus_tag LOCUS_29340 gene mmcO 63771 65381 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_29340 66278 65454 gene locus_tag LOCUS_29350 66278 65454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 66461 68215 gene locus_tag LOCUS_29360 66461 68215 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208946.1 protein_id gnl|my_center|LOCUS_29360 68507 68235 gene locus_tag LOCUS_29370 68507 68235 CDS product DUF2277 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028299.1 protein_id gnl|my_center|LOCUS_29370 69684 68455 gene locus_tag LOCUS_29380 69684 68455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028228.1 protein_id gnl|my_center|LOCUS_29380 70794 69760 gene locus_tag LOCUS_29390 gene vanJ 70794 69760 CDS product teicoplanin resistance protein VanJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029107.1 protein_id gnl|my_center|LOCUS_29390 71672 71007 gene locus_tag LOCUS_29400 71672 71007 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892887.1 protein_id gnl|my_center|LOCUS_29400 73324 71684 gene locus_tag LOCUS_29410 73324 71684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030040.1 protein_id gnl|my_center|LOCUS_29410 73558 74427 gene locus_tag LOCUS_29420 gene panB 73558 74427 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976556.1 protein_id gnl|my_center|LOCUS_29420 74592 75641 gene locus_tag LOCUS_29430 74592 75641 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976555.1 protein_id gnl|my_center|LOCUS_29430 75638 76462 gene locus_tag LOCUS_29440 75638 76462 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976554.1 protein_id gnl|my_center|LOCUS_29440 79993 76541 gene locus_tag LOCUS_29450 79993 76541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 80137 80913 gene locus_tag LOCUS_29460 80137 80913 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976552.1 protein_id gnl|my_center|LOCUS_29460 81124 80936 gene locus_tag LOCUS_29470 81124 80936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 81923 81246 gene locus_tag LOCUS_29480 gene npdG 81923 81246 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_29480 82053 82688 gene locus_tag LOCUS_29490 82053 82688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028233.1 protein_id gnl|my_center|LOCUS_29490 82761 84143 gene locus_tag LOCUS_29500 82761 84143 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028234.1 protein_id gnl|my_center|LOCUS_29500 84498 84289 gene locus_tag LOCUS_29510 84498 84289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976547.1 protein_id gnl|my_center|LOCUS_29510 84740 84498 gene locus_tag LOCUS_29520 84740 84498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 84625 85401 gene locus_tag LOCUS_29530 gene map 84625 85401 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976546.1 protein_id gnl|my_center|LOCUS_29530 85557 86219 gene locus_tag LOCUS_29540 85557 86219 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028236.1 protein_id gnl|my_center|LOCUS_29540 87924 86386 gene locus_tag LOCUS_29550 87924 86386 CDS product HtaA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028239.1 protein_id gnl|my_center|LOCUS_29550 89441 87921 gene locus_tag LOCUS_29560 89441 87921 CDS product HtaA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028240.1 protein_id gnl|my_center|LOCUS_29560 89578 90603 gene locus_tag LOCUS_29570 89578 90603 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486763.1 protein_id gnl|my_center|LOCUS_29570 90605 91681 gene locus_tag LOCUS_29580 90605 91681 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028242.1 protein_id gnl|my_center|LOCUS_29580 91797 92660 gene locus_tag LOCUS_29590 91797 92660 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_29590 92799 93932 gene locus_tag LOCUS_29600 gene efeO 92799 93932 CDS product iron uptake system protein EfeO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028244.1 protein_id gnl|my_center|LOCUS_29600 93948 95423 gene locus_tag LOCUS_29610 gene efeB 93948 95423 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028245.1 protein_id gnl|my_center|LOCUS_29610 95455 96438 gene locus_tag LOCUS_29620 95455 96438 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976536.1 protein_id gnl|my_center|LOCUS_29620 96347 97282 gene locus_tag LOCUS_29630 96347 97282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270025.1 protein_id gnl|my_center|LOCUS_29630 98138 97404 gene locus_tag LOCUS_29640 98138 97404 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976534.1 protein_id gnl|my_center|LOCUS_29640 98403 98588 gene locus_tag LOCUS_29650 98403 98588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 98620 99522 gene locus_tag LOCUS_29660 98620 99522 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222475.1 protein_id gnl|my_center|LOCUS_29660 100596 99562 gene locus_tag LOCUS_29670 100596 99562 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028248.1 protein_id gnl|my_center|LOCUS_29670 101899 100607 gene locus_tag LOCUS_29680 101899 100607 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028249.1 protein_id gnl|my_center|LOCUS_29680 102036 102908 gene locus_tag LOCUS_29690 102036 102908 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_29690 103007 103654 gene locus_tag LOCUS_29700 103007 103654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 103871 105886 gene locus_tag LOCUS_29710 103871 105886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 106138 106626 gene locus_tag LOCUS_29720 106138 106626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972387.1 protein_id gnl|my_center|LOCUS_29720 106743 108356 gene locus_tag LOCUS_29730 106743 108356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 108450 110009 gene locus_tag LOCUS_29740 108450 110009 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053131211.1 protein_id gnl|my_center|LOCUS_29740 110095 112080 gene locus_tag LOCUS_29750 110095 112080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 112597 112157 gene locus_tag LOCUS_29760 112597 112157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 116127 112597 gene locus_tag LOCUS_29770 116127 112597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 116653 117141 gene locus_tag LOCUS_29780 116653 117141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972728.1 protein_id gnl|my_center|LOCUS_29780 117262 118932 gene locus_tag LOCUS_29790 117262 118932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 119045 120640 gene locus_tag LOCUS_29800 119045 120640 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030657.1 protein_id gnl|my_center|LOCUS_29800 120732 122273 gene locus_tag LOCUS_29810 120732 122273 CDS product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030657.1 protein_id gnl|my_center|LOCUS_29810 124393 122345 gene locus_tag LOCUS_29820 124393 122345 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030601.1 protein_id gnl|my_center|LOCUS_29820 127302 124405 gene locus_tag LOCUS_29830 127302 124405 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028443.1 protein_id gnl|my_center|LOCUS_29830 128419 127349 gene locus_tag LOCUS_29840 128419 127349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 128834 130756 gene locus_tag LOCUS_29850 128834 130756 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976207.1 protein_id gnl|my_center|LOCUS_29850 131318 130767 gene locus_tag LOCUS_29860 131318 130767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 131472 132554 gene locus_tag LOCUS_29870 131472 132554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 135308 132576 gene locus_tag LOCUS_29880 135308 132576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 135636 135986 gene locus_tag LOCUS_29890 135636 135986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 135983 136285 gene locus_tag LOCUS_29900 135983 136285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 136905 137705 gene locus_tag LOCUS_29910 gene yaaA 136905 137705 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976516.1 protein_id gnl|my_center|LOCUS_29910 137771 138397 gene locus_tag LOCUS_29920 gene eda 137771 138397 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_29920 139417 138479 gene locus_tag LOCUS_29930 139417 138479 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028937.1 protein_id gnl|my_center|LOCUS_29930 139528 139875 gene locus_tag LOCUS_29940 139528 139875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 139975 140286 gene locus_tag LOCUS_29950 139975 140286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 140795 140346 gene locus_tag LOCUS_29960 140795 140346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 140931 141554 gene locus_tag LOCUS_29970 140931 141554 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_29970 142835 141663 gene locus_tag LOCUS_29980 142835 141663 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223079.1 protein_id gnl|my_center|LOCUS_29980 143313 142843 gene locus_tag LOCUS_29990 143313 142843 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028262.1 protein_id gnl|my_center|LOCUS_29990 143281 143610 gene locus_tag LOCUS_30000 143281 143610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 144440 143601 gene locus_tag LOCUS_30010 144440 143601 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_30010 145563 144517 gene locus_tag LOCUS_30020 145563 144517 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015613.1 protein_id gnl|my_center|LOCUS_30020 145747 146922 gene locus_tag LOCUS_30030 145747 146922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028264.1 protein_id gnl|my_center|LOCUS_30030 147173 147346 gene locus_tag LOCUS_30040 147173 147346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 148368 147439 gene locus_tag LOCUS_30050 148368 147439 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224297.1 protein_id gnl|my_center|LOCUS_30050 149444 148368 gene locus_tag LOCUS_30060 149444 148368 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027929.1 protein_id gnl|my_center|LOCUS_30060 150372 149488 gene locus_tag LOCUS_30070 150372 149488 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871467.1 protein_id gnl|my_center|LOCUS_30070 150576 151754 gene locus_tag LOCUS_30080 150576 151754 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028268.1 protein_id gnl|my_center|LOCUS_30080 151751 152368 gene locus_tag LOCUS_30090 151751 152368 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046247814.1 protein_id gnl|my_center|LOCUS_30090 152493 153137 gene locus_tag LOCUS_30100 152493 153137 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976501.1 protein_id gnl|my_center|LOCUS_30100 153161 154108 gene locus_tag LOCUS_30110 153161 154108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 154270 155172 gene locus_tag LOCUS_30120 154270 155172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 155308 156324 gene locus_tag LOCUS_30130 155308 156324 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 protein_id gnl|my_center|LOCUS_30130 157762 156335 gene locus_tag LOCUS_30140 157762 156335 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029546.1 protein_id gnl|my_center|LOCUS_30140 158564 157776 gene locus_tag LOCUS_30150 158564 157776 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030363.1 protein_id gnl|my_center|LOCUS_30150 159189 158623 gene locus_tag LOCUS_30160 159189 158623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 160431 159349 gene locus_tag LOCUS_30170 160431 159349 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_30170 161192 160428 gene locus_tag LOCUS_30180 161192 160428 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976496.1 protein_id gnl|my_center|LOCUS_30180 162636 161278 gene locus_tag LOCUS_30190 162636 161278 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_30190 162916 163536 gene locus_tag LOCUS_30200 162916 163536 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_30200 166069 164216 gene locus_tag LOCUS_30210 166069 164216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031102.1 protein_id gnl|my_center|LOCUS_30210 167835 166126 gene locus_tag LOCUS_30220 167835 166126 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031101.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30220 168212 168090 gene locus_tag LOCUS_30230 168212 168090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 170939 168261 gene locus_tag LOCUS_30240 gene lanKC 170939 168261 CDS product class III lanthionine synthetase LanKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495285.1 protein_id gnl|my_center|LOCUS_30240 171404 171156 gene locus_tag LOCUS_30250 171404 171156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 172866 171397 gene locus_tag LOCUS_30260 172866 171397 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079861.1 protein_id gnl|my_center|LOCUS_30260 174698 172992 gene locus_tag LOCUS_30270 174698 172992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 174968 176242 gene locus_tag LOCUS_30280 174968 176242 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976492.1 protein_id gnl|my_center|LOCUS_30280 176239 176910 gene locus_tag LOCUS_30290 176239 176910 CDS product SCO2322 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028279.1 protein_id gnl|my_center|LOCUS_30290 176907 178331 gene locus_tag LOCUS_30300 176907 178331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 178328 179938 gene locus_tag LOCUS_30310 178328 179938 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028281.1 protein_id gnl|my_center|LOCUS_30310 179935 180801 gene locus_tag LOCUS_30320 179935 180801 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028282.1 protein_id gnl|my_center|LOCUS_30320 181438 182874 gene locus_tag LOCUS_30330 181438 182874 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095203.1 protein_id gnl|my_center|LOCUS_30330 183035 183499 gene locus_tag LOCUS_30340 183035 183499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 184718 183549 gene locus_tag LOCUS_30350 184718 183549 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085491.1 protein_id gnl|my_center|LOCUS_30350 184983 186218 gene locus_tag LOCUS_30360 184983 186218 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020115335.1 protein_id gnl|my_center|LOCUS_30360 186421 187044 gene locus_tag LOCUS_30370 186421 187044 CDS product DUF6230 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030235.1 protein_id gnl|my_center|LOCUS_30370 187046 187438 gene locus_tag LOCUS_30380 187046 187438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 187600 188277 gene locus_tag LOCUS_30390 187600 188277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 190387 188318 gene locus_tag LOCUS_30400 190387 188318 CDS product bifunctional glycosyltransferase 87/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270029.1 protein_id gnl|my_center|LOCUS_30400 190546 191229 gene locus_tag LOCUS_30410 190546 191229 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029222.1 protein_id gnl|my_center|LOCUS_30410 191257 191607 gene locus_tag LOCUS_30420 gene mhuD 191257 191607 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065009.1 protein_id gnl|my_center|LOCUS_30420 191730 192215 gene locus_tag LOCUS_30430 191730 192215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976461.1 protein_id gnl|my_center|LOCUS_30430 194324 192240 gene locus_tag LOCUS_30440 194324 192240 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028294.1 protein_id gnl|my_center|LOCUS_30440 194624 195280 gene locus_tag LOCUS_30450 194624 195280 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028296.1 protein_id gnl|my_center|LOCUS_30450 195324 195929 gene locus_tag LOCUS_30460 195324 195929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975445.1 protein_id gnl|my_center|LOCUS_30460 195973 196308 gene locus_tag LOCUS_30470 195973 196308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 196415 196720 gene locus_tag LOCUS_30480 196415 196720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 196734 197384 gene locus_tag LOCUS_30490 196734 197384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 197978 197397 gene locus_tag LOCUS_30500 197978 197397 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028297.1 protein_id gnl|my_center|LOCUS_30500 198979 198185 gene locus_tag LOCUS_30510 198979 198185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 199222 199863 gene locus_tag LOCUS_30520 199222 199863 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976456.1 protein_id gnl|my_center|LOCUS_30520 200072 200557 gene locus_tag LOCUS_30530 200072 200557 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976454.1 protein_id gnl|my_center|LOCUS_30530 200784 201425 gene locus_tag LOCUS_30540 200784 201425 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976453.1 protein_id gnl|my_center|LOCUS_30540 202190 201519 gene locus_tag LOCUS_30550 gene snpA 202190 201519 CDS product snapalysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971712.1 protein_id gnl|my_center|LOCUS_30550 202637 202380 gene locus_tag LOCUS_30560 202637 202380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 202518 203417 gene locus_tag LOCUS_30570 202518 203417 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031660.1 protein_id gnl|my_center|LOCUS_30570 203688 203434 gene locus_tag LOCUS_30580 203688 203434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 203842 204426 gene locus_tag LOCUS_30590 203842 204426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 204426 204653 gene locus_tag LOCUS_30600 204426 204653 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295139.1 protein_id gnl|my_center|LOCUS_30600 205168 206010 gene locus_tag LOCUS_30610 205168 206010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 206489 207400 gene locus_tag LOCUS_30620 206489 207400 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270195.1 protein_id gnl|my_center|LOCUS_30620 207564 208124 gene locus_tag LOCUS_30630 207564 208124 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137208463.1 protein_id gnl|my_center|LOCUS_30630 208582 208112 gene locus_tag LOCUS_30640 208582 208112 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030185.1 protein_id gnl|my_center|LOCUS_30640 209436 208618 gene locus_tag LOCUS_30650 209436 208618 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030186.1 protein_id gnl|my_center|LOCUS_30650 209505 209849 gene locus_tag LOCUS_30660 209505 209849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028865.1 protein_id gnl|my_center|LOCUS_30660 209855 211210 gene locus_tag LOCUS_30670 209855 211210 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193449360.1 protein_id gnl|my_center|LOCUS_30670 211306 211497 gene locus_tag LOCUS_30680 211306 211497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 211644 211835 gene locus_tag LOCUS_30690 211644 211835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 211841 212050 gene locus_tag LOCUS_30700 211841 212050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 212047 212229 gene locus_tag LOCUS_30710 212047 212229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 212310 212993 gene locus_tag LOCUS_30720 212310 212993 CDS product DUF2637 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030190.1 protein_id gnl|my_center|LOCUS_30720 213017 213205 gene locus_tag LOCUS_30730 213017 213205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 213232 213417 gene locus_tag LOCUS_30740 213232 213417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030192.1 protein_id gnl|my_center|LOCUS_30740 213445 213768 gene locus_tag LOCUS_30750 213445 213768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028861.1 protein_id gnl|my_center|LOCUS_30750 214042 214185 gene locus_tag LOCUS_30760 214042 214185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 214182 214361 gene locus_tag LOCUS_30770 214182 214361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 214354 214665 gene locus_tag LOCUS_30780 214354 214665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 214665 215087 gene locus_tag LOCUS_30790 214665 215087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189749536.1 protein_id gnl|my_center|LOCUS_30790 215080 216465 gene locus_tag LOCUS_30800 gene repSA 215080 216465 CDS product replication initiator protein RepSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030196.1 protein_id gnl|my_center|LOCUS_30800 216462 216650 gene locus_tag LOCUS_30810 216462 216650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 216650 217795 gene locus_tag LOCUS_30820 216650 217795 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_30820 219311 218052 gene locus_tag LOCUS_30830 219311 218052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 219546 219301 gene locus_tag LOCUS_30840 219546 219301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 220081 219707 gene locus_tag LOCUS_30850 220081 219707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 220345 220647 gene locus_tag LOCUS_30860 220345 220647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 220655 220855 gene locus_tag LOCUS_30870 220655 220855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 220939 221298 gene locus_tag LOCUS_30880 220939 221298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 221295 221849 gene locus_tag LOCUS_30890 221295 221849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 221849 222241 gene locus_tag LOCUS_30900 221849 222241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 222238 222498 gene locus_tag LOCUS_30910 222238 222498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 222752 223036 gene locus_tag LOCUS_30920 222752 223036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 223033 223269 gene locus_tag LOCUS_30930 223033 223269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 223266 224096 gene locus_tag LOCUS_30940 223266 224096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 224096 225100 gene locus_tag LOCUS_30950 224096 225100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 225090 225563 gene locus_tag LOCUS_30960 225090 225563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 225703 226248 gene locus_tag LOCUS_30970 225703 226248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 226245 226703 gene locus_tag LOCUS_30980 226245 226703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 226808 227131 gene locus_tag LOCUS_30990 226808 227131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 227165 227240 gene locus_tag LOCUS_t00270 227165 227240 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 227281 227697 gene locus_tag LOCUS_31000 227281 227697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 227694 228437 gene locus_tag LOCUS_31010 227694 228437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 228471 229154 gene locus_tag LOCUS_31020 228471 229154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 229154 229345 gene locus_tag LOCUS_31030 229154 229345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 229563 229369 gene locus_tag LOCUS_31040 229563 229369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 229726 230631 gene locus_tag LOCUS_31050 229726 230631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 230621 231352 gene locus_tag LOCUS_31060 230621 231352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 231349 231900 gene locus_tag LOCUS_31070 231349 231900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484326.1 protein_id gnl|my_center|LOCUS_31070 231897 232073 gene locus_tag LOCUS_31080 231897 232073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 232070 232267 gene locus_tag LOCUS_31090 232070 232267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 232289 232492 gene locus_tag LOCUS_31100 232289 232492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 232489 232656 gene locus_tag LOCUS_31110 232489 232656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 232653 232898 gene locus_tag LOCUS_31120 232653 232898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 232898 233296 gene locus_tag LOCUS_31130 232898 233296 CDS product DUF4326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076534005.1 protein_id gnl|my_center|LOCUS_31130 233348 233803 gene locus_tag LOCUS_31140 233348 233803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 233907 234353 gene locus_tag LOCUS_31150 233907 234353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 234350 235450 gene locus_tag LOCUS_31160 234350 235450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 235440 235745 gene locus_tag LOCUS_31170 235440 235745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 235748 235996 gene locus_tag LOCUS_31180 235748 235996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 236328 236074 gene locus_tag LOCUS_31190 236328 236074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 236447 236821 gene locus_tag LOCUS_31200 236447 236821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 236888 237772 gene locus_tag LOCUS_31210 236888 237772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 237845 238039 gene locus_tag LOCUS_31220 237845 238039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 238042 238305 gene locus_tag LOCUS_31230 238042 238305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 238356 238826 gene locus_tag LOCUS_31240 238356 238826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 238823 239050 gene locus_tag LOCUS_31250 238823 239050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 239072 239470 gene locus_tag LOCUS_31260 239072 239470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 239486 239659 gene locus_tag LOCUS_31270 239486 239659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 239941 239717 gene locus_tag LOCUS_31280 239941 239717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 240720 240238 gene locus_tag LOCUS_31290 240720 240238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 241105 240797 gene locus_tag LOCUS_31300 241105 240797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 241312 241470 gene locus_tag LOCUS_31310 241312 241470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 241467 241664 gene locus_tag LOCUS_31320 241467 241664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 241778 242842 gene locus_tag LOCUS_31330 241778 242842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 242844 243011 gene locus_tag LOCUS_31340 242844 243011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 243176 243580 gene locus_tag LOCUS_31350 243176 243580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 243577 244083 gene locus_tag LOCUS_31360 243577 244083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 244080 244823 gene locus_tag LOCUS_31370 244080 244823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 244820 245077 gene locus_tag LOCUS_31380 244820 245077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 245164 245763 gene locus_tag LOCUS_31390 245164 245763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 245760 246002 gene locus_tag LOCUS_31400 245760 246002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 246099 246332 gene locus_tag LOCUS_31410 246099 246332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 246406 246912 gene locus_tag LOCUS_31420 246406 246912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 246989 247846 gene locus_tag LOCUS_31430 246989 247846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 247865 248206 gene locus_tag LOCUS_31440 247865 248206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 248275 248625 gene locus_tag LOCUS_31450 248275 248625 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145905.1 protein_id gnl|my_center|LOCUS_31450 248829 249293 gene locus_tag LOCUS_31460 248829 249293 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900701.1 protein_id gnl|my_center|LOCUS_31460 249256 250980 gene locus_tag LOCUS_31470 249256 250980 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938795.1 protein_id gnl|my_center|LOCUS_31470 251204 250977 gene locus_tag LOCUS_31480 251204 250977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 251241 251465 gene locus_tag LOCUS_31490 251241 251465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 251465 253396 gene locus_tag LOCUS_31500 251465 253396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 253399 254256 gene locus_tag LOCUS_31510 253399 254256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 254263 255546 gene locus_tag LOCUS_31520 254263 255546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 255556 255771 gene locus_tag LOCUS_31530 255556 255771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 255865 256095 gene locus_tag LOCUS_31540 255865 256095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 256085 256636 gene locus_tag LOCUS_31550 256085 256636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 256636 256983 gene locus_tag LOCUS_31560 256636 256983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 256999 257283 gene locus_tag LOCUS_31570 256999 257283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 257280 257699 gene locus_tag LOCUS_31580 257280 257699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 257760 258281 gene locus_tag LOCUS_31590 257760 258281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 258373 258708 gene locus_tag LOCUS_31600 258373 258708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 258594 259112 gene locus_tag LOCUS_31610 258594 259112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 259135 262506 gene locus_tag LOCUS_31620 259135 262506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 262509 264746 gene locus_tag LOCUS_31630 262509 264746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 264750 265841 gene locus_tag LOCUS_31640 264750 265841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 265838 266452 gene locus_tag LOCUS_31650 265838 266452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 266463 267125 gene locus_tag LOCUS_31660 266463 267125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 267139 268092 gene locus_tag LOCUS_31670 267139 268092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 268150 268377 gene locus_tag LOCUS_31680 268150 268377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 268380 268628 gene locus_tag LOCUS_31690 268380 268628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 268902 269786 gene locus_tag LOCUS_31700 268902 269786 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872665.1 protein_id gnl|my_center|LOCUS_31700 269937 270455 gene locus_tag LOCUS_31710 269937 270455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 270576 271034 gene locus_tag LOCUS_31720 270576 271034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 271118 272404 gene locus_tag LOCUS_31730 271118 272404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 272495 273229 gene locus_tag LOCUS_31740 272495 273229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 273443 273931 gene locus_tag LOCUS_31750 273443 273931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 273928 274107 gene locus_tag LOCUS_31760 273928 274107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 274606 274274 gene locus_tag LOCUS_31770 274606 274274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 274745 274673 gene locus_tag LOCUS_t00280 274745 274673 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 274942 275715 gene locus_tag LOCUS_31780 274942 275715 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976449.1 protein_id gnl|my_center|LOCUS_31780 275790 277157 gene locus_tag LOCUS_31790 275790 277157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028302.1 protein_id gnl|my_center|LOCUS_31790 277172 277390 gene locus_tag LOCUS_31800 277172 277390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 278071 277406 gene locus_tag LOCUS_31810 278071 277406 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_31810 278922 278116 gene locus_tag LOCUS_31820 278922 278116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_31820 281480 278919 gene locus_tag LOCUS_31830 281480 278919 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028307.1 protein_id gnl|my_center|LOCUS_31830 282640 281477 gene locus_tag LOCUS_31840 282640 281477 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_31840 282884 283792 gene locus_tag LOCUS_31850 282884 283792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 284584 283841 gene locus_tag LOCUS_31860 284584 283841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976439.1 protein_id gnl|my_center|LOCUS_31860 285827 284682 gene locus_tag LOCUS_31870 285827 284682 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028309.1 protein_id gnl|my_center|LOCUS_31870 286451 285876 gene locus_tag LOCUS_31880 286451 285876 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976437.1 protein_id gnl|my_center|LOCUS_31880 287172 286597 gene locus_tag LOCUS_31890 287172 286597 CDS product calcium homeostasis/redox stress adaptation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976436.1 protein_id gnl|my_center|LOCUS_31890 287812 287354 gene locus_tag LOCUS_31900 287812 287354 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_31900 288430 287984 gene locus_tag LOCUS_31910 288430 287984 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202437260.1 protein_id gnl|my_center|LOCUS_31910 288911 291643 gene locus_tag LOCUS_31920 gene aceE 288911 291643 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976432.1 protein_id gnl|my_center|LOCUS_31920 292155 291727 gene locus_tag LOCUS_31930 292155 291727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 293797 292193 gene locus_tag LOCUS_31940 293797 292193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027641.1 protein_id gnl|my_center|LOCUS_31940 293910 294548 gene locus_tag LOCUS_31950 293910 294548 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028311.1 protein_id gnl|my_center|LOCUS_31950 294647 295891 gene locus_tag LOCUS_31960 294647 295891 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028312.1 protein_id gnl|my_center|LOCUS_31960 295957 296817 gene locus_tag LOCUS_31970 295957 296817 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976427.1 protein_id gnl|my_center|LOCUS_31970 296919 298211 gene locus_tag LOCUS_31980 296919 298211 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009688.1 protein_id gnl|my_center|LOCUS_31980 298208 298885 gene locus_tag LOCUS_31990 298208 298885 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975186.1 protein_id gnl|my_center|LOCUS_31990 299937 299212 gene locus_tag LOCUS_32000 299937 299212 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066628.1 protein_id gnl|my_center|LOCUS_32000 301264 299945 gene locus_tag LOCUS_32010 301264 299945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976412.1 protein_id gnl|my_center|LOCUS_32010 301445 302140 gene locus_tag LOCUS_32020 301445 302140 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062896.1 protein_id gnl|my_center|LOCUS_32020 302267 302440 gene locus_tag LOCUS_32030 302267 302440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 303306 302401 gene locus_tag LOCUS_32040 303306 302401 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976414.1 protein_id gnl|my_center|LOCUS_32040 303664 304134 gene locus_tag LOCUS_32050 303664 304134 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_32050 304185 305063 gene locus_tag LOCUS_32060 304185 305063 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027435.1 protein_id gnl|my_center|LOCUS_32060 306474 305212 gene locus_tag LOCUS_32070 306474 305212 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028323.1 protein_id gnl|my_center|LOCUS_32070 306793 306542 gene locus_tag LOCUS_32080 306793 306542 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976417.1 protein_id gnl|my_center|LOCUS_32080 307875 306871 gene locus_tag LOCUS_32090 307875 306871 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976418.1 protein_id gnl|my_center|LOCUS_32090 308843 307872 gene locus_tag LOCUS_32100 308843 307872 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_32100 310117 308942 gene locus_tag LOCUS_32110 gene fasR 310117 308942 CDS product fatty acid biosynthesis transcriptional regulator FasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028321.1 protein_id gnl|my_center|LOCUS_32110 310082 310873 gene locus_tag LOCUS_32120 310082 310873 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028320.1 protein_id gnl|my_center|LOCUS_32120 311746 310928 gene locus_tag LOCUS_32130 311746 310928 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028315.1 protein_id gnl|my_center|LOCUS_32130 311910 312341 gene locus_tag LOCUS_32140 311910 312341 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326123.1 protein_id gnl|my_center|LOCUS_32140 312348 313367 gene locus_tag LOCUS_32150 312348 313367 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028313.1 protein_id gnl|my_center|LOCUS_32150 314162 313368 gene locus_tag LOCUS_32160 314162 313368 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028326.1 protein_id gnl|my_center|LOCUS_32160 315241 314216 gene locus_tag LOCUS_32170 315241 314216 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976409.1 protein_id gnl|my_center|LOCUS_32170 315332 315793 gene locus_tag LOCUS_32180 315332 315793 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_32180 316381 315866 gene locus_tag LOCUS_32190 316381 315866 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978113.1 protein_id gnl|my_center|LOCUS_32190 316566 317162 gene locus_tag LOCUS_32200 316566 317162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976365.1 protein_id gnl|my_center|LOCUS_32200 317322 317128 gene locus_tag LOCUS_32210 317322 317128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 317321 317848 gene locus_tag LOCUS_32220 317321 317848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 318285 317860 gene locus_tag LOCUS_32230 318285 317860 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972448.1 protein_id gnl|my_center|LOCUS_32230 318967 318365 gene locus_tag LOCUS_32240 318967 318365 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972709.1 protein_id gnl|my_center|LOCUS_32240 319358 318960 gene locus_tag LOCUS_32250 gene trxA 319358 318960 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_32250 319650 319576 gene locus_tag LOCUS_t00290 319650 319576 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 319913 319838 gene locus_tag LOCUS_t00300 319913 319838 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 319991 319918 gene locus_tag LOCUS_t00310 319991 319918 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 320183 320473 gene locus_tag LOCUS_32260 320183 320473 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326153.1 protein_id gnl|my_center|LOCUS_32260 320538 321977 gene locus_tag LOCUS_32270 320538 321977 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976342.1 protein_id gnl|my_center|LOCUS_32270 323082 322018 gene locus_tag LOCUS_32280 323082 322018 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976339.1 protein_id gnl|my_center|LOCUS_32280 325293 323392 gene locus_tag LOCUS_32290 gene dnaG 325293 323392 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976336.1 protein_id gnl|my_center|LOCUS_32290 326601 325339 gene locus_tag LOCUS_32300 326601 325339 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976335.1 protein_id gnl|my_center|LOCUS_32300 328101 326791 gene locus_tag LOCUS_32310 328101 326791 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028369.1 protein_id gnl|my_center|LOCUS_32310 328245 328949 gene locus_tag LOCUS_32320 328245 328949 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_32320 330014 328971 gene locus_tag LOCUS_32330 330014 328971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 331032 330148 gene locus_tag LOCUS_32340 331032 330148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 331172 332155 gene locus_tag LOCUS_32350 331172 332155 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976313.1 protein_id gnl|my_center|LOCUS_32350 332862 332293 gene locus_tag LOCUS_32360 332862 332293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 333107 334978 gene locus_tag LOCUS_32370 333107 334978 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093091.1 protein_id gnl|my_center|LOCUS_32370 335088 336350 gene locus_tag LOCUS_32380 335088 336350 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230134.1 protein_id gnl|my_center|LOCUS_32380 336352 337257 gene locus_tag LOCUS_32390 336352 337257 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230135.1 protein_id gnl|my_center|LOCUS_32390 337260 338105 gene locus_tag LOCUS_32400 337260 338105 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230136.1 protein_id gnl|my_center|LOCUS_32400 339205 338141 gene locus_tag LOCUS_32410 339205 338141 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 protein_id gnl|my_center|LOCUS_32410 342414 339694 gene locus_tag LOCUS_32420 gene ppdK 342414 339694 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976309.1 protein_id gnl|my_center|LOCUS_32420 343995 342808 gene locus_tag LOCUS_32430 gene dusB 343995 342808 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028387.1 protein_id gnl|my_center|LOCUS_32430 344916 344002 gene locus_tag LOCUS_32440 344916 344002 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976301.1 protein_id gnl|my_center|LOCUS_32440 345027 346484 gene locus_tag LOCUS_32450 345027 346484 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028390.1 protein_id gnl|my_center|LOCUS_32450 346594 347598 gene locus_tag LOCUS_32460 346594 347598 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 protein_id gnl|my_center|LOCUS_32460 347751 348332 gene locus_tag LOCUS_32470 347751 348332 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173393.1 protein_id gnl|my_center|LOCUS_32470 348978 348343 gene locus_tag LOCUS_32480 348978 348343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029801.1 protein_id gnl|my_center|LOCUS_32480 350216 348975 gene locus_tag LOCUS_32490 350216 348975 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_32490 351787 350405 gene locus_tag LOCUS_32500 351787 350405 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976298.1 protein_id gnl|my_center|LOCUS_32500 351963 352979 gene locus_tag LOCUS_32510 351963 352979 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_32510 353039 353806 gene locus_tag LOCUS_32520 353039 353806 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028392.1 protein_id gnl|my_center|LOCUS_32520 353806 354696 gene locus_tag LOCUS_32530 353806 354696 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_32530 354790 355206 gene locus_tag LOCUS_32540 354790 355206 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_32540 355816 355283 gene locus_tag LOCUS_32550 355816 355283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 356645 355809 gene locus_tag LOCUS_32560 356645 355809 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976293.1 protein_id gnl|my_center|LOCUS_32560 357423 356677 gene locus_tag LOCUS_32570 gene recO 357423 356677 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863758.1 protein_id gnl|my_center|LOCUS_32570 357617 358873 gene locus_tag LOCUS_32580 357617 358873 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_32580 358812 359033 gene locus_tag LOCUS_32590 358812 359033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 359030 359962 gene locus_tag LOCUS_32600 359030 359962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 360692 359967 gene locus_tag LOCUS_32610 360692 359967 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028407.1 protein_id gnl|my_center|LOCUS_32610 362651 360882 gene locus_tag LOCUS_32620 gene leuA 362651 360882 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976275.1 protein_id gnl|my_center|LOCUS_32620 362986 364044 gene locus_tag LOCUS_32630 362986 364044 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_32630 364115 364387 gene locus_tag LOCUS_32640 364115 364387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976273.1 protein_id gnl|my_center|LOCUS_32640 365467 364526 gene locus_tag LOCUS_32650 gene era 365467 364526 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326176.1 protein_id gnl|my_center|LOCUS_32650 365883 365524 gene locus_tag LOCUS_32660 365883 365524 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456125.1 protein_id gnl|my_center|LOCUS_32660 366827 365949 gene locus_tag LOCUS_32670 366827 365949 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485043.1 protein_id gnl|my_center|LOCUS_32670 366909 368345 gene locus_tag LOCUS_32680 366909 368345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976267.1 protein_id gnl|my_center|LOCUS_32680 368927 368532 gene locus_tag LOCUS_32690 368927 368532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 370171 368987 gene locus_tag LOCUS_32700 370171 368987 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085002.1 protein_id gnl|my_center|LOCUS_32700 370809 370312 gene locus_tag LOCUS_32710 gene ybeY 370809 370312 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976270.1 protein_id gnl|my_center|LOCUS_32710 371816 370824 gene locus_tag LOCUS_32720 371816 370824 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976271.1 protein_id gnl|my_center|LOCUS_32720 373086 371953 gene locus_tag LOCUS_32730 373086 371953 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485041.1 protein_id gnl|my_center|LOCUS_32730 373166 374491 gene locus_tag LOCUS_32740 373166 374491 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031093.1 protein_id gnl|my_center|LOCUS_32740 374672 375148 gene locus_tag LOCUS_32750 374672 375148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_32750 375213 376058 gene locus_tag LOCUS_32760 375213 376058 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_32760 376141 377079 gene locus_tag LOCUS_32770 376141 377079 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029634.1 protein_id gnl|my_center|LOCUS_32770 377076 377864 gene locus_tag LOCUS_32780 377076 377864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974578.1 protein_id gnl|my_center|LOCUS_32780 379003 377972 gene locus_tag LOCUS_32790 379003 377972 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027326.1 protein_id gnl|my_center|LOCUS_32790 379215 380015 gene locus_tag LOCUS_32800 379215 380015 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028026.1 protein_id gnl|my_center|LOCUS_32800 380872 380042 gene locus_tag LOCUS_32810 380872 380042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 381017 381472 gene locus_tag LOCUS_32820 381017 381472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 382412 381504 gene locus_tag LOCUS_32830 382412 381504 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028422.1 protein_id gnl|my_center|LOCUS_32830 382773 382417 gene locus_tag LOCUS_32840 382773 382417 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_32840 383414 382854 gene locus_tag LOCUS_32850 383414 382854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 383649 384905 gene locus_tag LOCUS_32860 383649 384905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 384902 386530 gene locus_tag LOCUS_32870 384902 386530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 386567 389026 gene locus_tag LOCUS_32880 386567 389026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 389136 389702 gene locus_tag LOCUS_32890 389136 389702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 389728 390255 gene locus_tag LOCUS_32900 389728 390255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 390716 390288 gene locus_tag LOCUS_32910 390716 390288 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230403.1 protein_id gnl|my_center|LOCUS_32910 390807 391172 gene locus_tag LOCUS_32920 390807 391172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 391735 391169 gene locus_tag LOCUS_32930 391735 391169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 391842 392570 gene locus_tag LOCUS_32940 391842 392570 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 protein_id gnl|my_center|LOCUS_32940 392656 393195 gene locus_tag LOCUS_32950 392656 393195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 393880 393266 gene locus_tag LOCUS_32960 393880 393266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 394028 394879 gene locus_tag LOCUS_32970 394028 394879 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 protein_id gnl|my_center|LOCUS_32970 394890 395159 gene locus_tag LOCUS_32980 394890 395159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 395709 395134 gene locus_tag LOCUS_32990 395709 395134 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906986.1 protein_id gnl|my_center|LOCUS_32990 396934 395729 gene locus_tag LOCUS_33000 396934 395729 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817233.1 protein_id gnl|my_center|LOCUS_33000 397026 397463 gene locus_tag LOCUS_33010 397026 397463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926470.1 protein_id gnl|my_center|LOCUS_33010 397580 398014 gene locus_tag LOCUS_33020 397580 398014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 398834 398031 gene locus_tag LOCUS_33030 398834 398031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 399711 398911 gene locus_tag LOCUS_33040 399711 398911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 400772 400002 gene locus_tag LOCUS_33050 400772 400002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 401561 400812 gene locus_tag LOCUS_33060 401561 400812 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976252.1 protein_id gnl|my_center|LOCUS_33060 402693 401620 gene locus_tag LOCUS_33070 402693 401620 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976251.1 protein_id gnl|my_center|LOCUS_33070 404001 402862 gene locus_tag LOCUS_33080 gene dnaJ 404001 402862 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976250.1 protein_id gnl|my_center|LOCUS_33080 405018 404002 gene locus_tag LOCUS_33090 gene hrcA 405018 404002 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976249.1 protein_id gnl|my_center|LOCUS_33090 405250 405993 gene locus_tag LOCUS_33100 405250 405993 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028425.1 protein_id gnl|my_center|LOCUS_33100 406018 406857 gene locus_tag LOCUS_33110 406018 406857 CDS product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976247.1 protein_id gnl|my_center|LOCUS_33110 408163 406961 gene locus_tag LOCUS_33120 gene hemW 408163 406961 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326185.1 protein_id gnl|my_center|LOCUS_33120 409939 408221 gene locus_tag LOCUS_33130 409939 408221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 409905 410147 gene locus_tag LOCUS_33140 409905 410147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 412138 410249 gene locus_tag LOCUS_33150 412138 410249 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_33150 414232 412364 gene locus_tag LOCUS_33160 gene lepA 414232 412364 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976242.1 protein_id gnl|my_center|LOCUS_33160 414404 414733 gene locus_tag LOCUS_33170 gene rpsT 414404 414733 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_33170 415949 414963 gene locus_tag LOCUS_33180 gene holA 415949 414963 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485035.1 protein_id gnl|my_center|LOCUS_33180 416022 416300 gene locus_tag LOCUS_33190 416022 416300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666679.1 protein_id gnl|my_center|LOCUS_33190 416981 416334 gene locus_tag LOCUS_33200 416981 416334 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467786.1 protein_id gnl|my_center|LOCUS_33200 419740 416888 gene locus_tag LOCUS_33210 419740 416888 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028431.1 protein_id gnl|my_center|LOCUS_33210 420627 419737 gene locus_tag LOCUS_33220 420627 419737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 421573 420728 gene locus_tag LOCUS_33230 421573 420728 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_33230 422355 421660 gene locus_tag LOCUS_33240 422355 421660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028433.1 protein_id gnl|my_center|LOCUS_33240 425380 422531 gene locus_tag LOCUS_33250 gene leuS 425380 422531 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976232.1 protein_id gnl|my_center|LOCUS_33250 427657 425678 gene locus_tag LOCUS_33260 427657 425678 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_33260 427922 428626 gene locus_tag LOCUS_33270 427922 428626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33270 428623 430131 gene locus_tag LOCUS_33280 428623 430131 CDS product NADH-quinone oxidoreductase subunit NuoF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326195.1 protein_id gnl|my_center|LOCUS_33280 430291 430218 gene locus_tag LOCUS_t00320 430291 430218 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 430653 430420 gene locus_tag LOCUS_33290 430653 430420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976229.1 protein_id gnl|my_center|LOCUS_33290 430849 430776 gene locus_tag LOCUS_t00330 430849 430776 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 431570 430953 gene locus_tag LOCUS_33300 431570 430953 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_33300 432043 431603 gene locus_tag LOCUS_33310 gene rsfS 432043 431603 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976226.1 protein_id gnl|my_center|LOCUS_33310 433816 432152 gene locus_tag LOCUS_33320 gene pdtA 433816 432152 CDS product polydiglycosylphosphate transferase PdtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976225.1 protein_id gnl|my_center|LOCUS_33320 434474 433863 gene locus_tag LOCUS_33330 gene nadD 434474 433863 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485033.1 protein_id gnl|my_center|LOCUS_33330 434691 434530 gene locus_tag LOCUS_33340 434691 434530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976223.1 protein_id gnl|my_center|LOCUS_33340 435015 434851 gene locus_tag LOCUS_33350 435015 434851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 435109 436197 gene locus_tag LOCUS_33360 435109 436197 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028434.1 protein_id gnl|my_center|LOCUS_33360 437302 436220 gene locus_tag LOCUS_33370 437302 436220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028435.1 protein_id gnl|my_center|LOCUS_33370 438089 437478 gene locus_tag LOCUS_33380 438089 437478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326198.1 protein_id gnl|my_center|LOCUS_33380 439525 438227 gene locus_tag LOCUS_33390 439525 438227 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976218.1 protein_id gnl|my_center|LOCUS_33390 440101 439637 gene locus_tag LOCUS_33400 440101 439637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028437.1 protein_id gnl|my_center|LOCUS_33400 441506 440352 gene locus_tag LOCUS_33410 gene proB 441506 440352 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_33410 441755 443809 gene locus_tag LOCUS_33420 441755 443809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032946.1 protein_id gnl|my_center|LOCUS_33420 445335 443896 gene locus_tag LOCUS_33430 gene obgE 445335 443896 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976206.1 protein_id gnl|my_center|LOCUS_33430 445723 445469 gene locus_tag LOCUS_33440 gene rpmA 445723 445469 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976205.1 protein_id gnl|my_center|LOCUS_33440 446121 445738 gene locus_tag LOCUS_33450 gene rplU 446121 445738 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976204.1 protein_id gnl|my_center|LOCUS_33450 450615 446305 gene locus_tag LOCUS_33460 450615 446305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33460 451617 450835 gene locus_tag LOCUS_33470 451617 450835 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_33470 453695 451770 gene locus_tag LOCUS_33480 453695 451770 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976193.1 protein_id gnl|my_center|LOCUS_33480 455365 453794 gene locus_tag LOCUS_33490 455365 453794 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978319.1 protein_id gnl|my_center|LOCUS_33490 456617 455418 gene locus_tag LOCUS_33500 gene rodA 456617 455418 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_33500 458848 456614 gene locus_tag LOCUS_33510 gene mrdA 458848 456614 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028453.1 protein_id gnl|my_center|LOCUS_33510 459650 458937 gene locus_tag LOCUS_33520 gene mreD 459650 458937 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976190.1 protein_id gnl|my_center|LOCUS_33520 460587 459655 gene locus_tag LOCUS_33530 gene mreC 460587 459655 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_33530 461679 460648 gene locus_tag LOCUS_33540 461679 460648 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_33540 462373 461960 gene locus_tag LOCUS_33550 gene ndk 462373 461960 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976187.1 protein_id gnl|my_center|LOCUS_33550 462886 462515 gene locus_tag LOCUS_33560 462886 462515 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976186.1 protein_id gnl|my_center|LOCUS_33560 464435 462888 gene locus_tag LOCUS_33570 464435 462888 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485025.1 protein_id gnl|my_center|LOCUS_33570 464578 465744 gene locus_tag LOCUS_33580 464578 465744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33580 465741 466427 gene locus_tag LOCUS_33590 465741 466427 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 protein_id gnl|my_center|LOCUS_33590 466583 467710 gene locus_tag LOCUS_33600 gene wecB 466583 467710 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229162.1 protein_id gnl|my_center|LOCUS_33600 467797 469161 gene locus_tag LOCUS_33610 467797 469161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33610 469300 470520 gene locus_tag LOCUS_33620 469300 470520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 473218 470597 gene locus_tag LOCUS_33630 473218 470597 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028455.1 protein_id gnl|my_center|LOCUS_33630 473354 474325 gene locus_tag LOCUS_33640 473354 474325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 474752 475717 gene locus_tag LOCUS_33650 474752 475717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 475880 476782 gene locus_tag LOCUS_33660 475880 476782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029723.1 protein_id gnl|my_center|LOCUS_33660 478142 476856 gene locus_tag LOCUS_33670 gene clpX 478142 476856 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_33670 478970 478317 gene locus_tag LOCUS_33680 478970 478317 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668811.1 protein_id gnl|my_center|LOCUS_33680 479655 479038 gene locus_tag LOCUS_33690 479655 479038 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030186848.1 protein_id gnl|my_center|LOCUS_33690 481421 480051 gene locus_tag LOCUS_33700 gene tig 481421 480051 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976179.1 protein_id gnl|my_center|LOCUS_33700 481643 481567 gene locus_tag LOCUS_t00340 481643 481567 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 481830 481903 gene locus_tag LOCUS_t00350 481830 481903 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 482172 481978 gene locus_tag LOCUS_33710 482172 481978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976178.1 protein_id gnl|my_center|LOCUS_33710 483823 482387 gene locus_tag LOCUS_33720 483823 482387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 487848 483820 gene locus_tag LOCUS_33730 487848 483820 CDS product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030426.1 protein_id gnl|my_center|LOCUS_33730 489130 487997 gene locus_tag LOCUS_33740 489130 487997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 490605 489163 gene locus_tag LOCUS_33750 490605 489163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 491002 490619 gene locus_tag LOCUS_33760 491002 490619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 491688 491092 gene locus_tag LOCUS_33770 491688 491092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 491999 491805 gene locus_tag LOCUS_33780 491999 491805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 493080 492310 gene locus_tag LOCUS_33790 493080 492310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 495979 493118 gene locus_tag LOCUS_33800 495979 493118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 496374 495976 gene locus_tag LOCUS_33810 496374 495976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 496743 496429 gene locus_tag LOCUS_33820 496743 496429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 497119 496763 gene locus_tag LOCUS_33830 497119 496763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 497708 497289 gene locus_tag LOCUS_33840 497708 497289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 497899 497705 gene locus_tag LOCUS_33850 497899 497705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 498083 498319 gene locus_tag LOCUS_33860 498083 498319 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055540536.1 protein_id gnl|my_center|LOCUS_33860 498875 498333 gene locus_tag LOCUS_33870 498875 498333 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230767.1 protein_id gnl|my_center|LOCUS_33870 499353 498919 gene locus_tag LOCUS_33880 499353 498919 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028365.1 protein_id gnl|my_center|LOCUS_33880 499805 499383 gene locus_tag LOCUS_33890 499805 499383 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 protein_id gnl|my_center|LOCUS_33890 500016 501476 gene locus_tag LOCUS_33900 500016 501476 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728620.1 protein_id gnl|my_center|LOCUS_33900 501823 503004 gene locus_tag LOCUS_33910 501823 503004 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_33910 503015 503866 gene locus_tag LOCUS_33920 503015 503866 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972642.1 protein_id gnl|my_center|LOCUS_33920 506505 503932 gene locus_tag LOCUS_33930 506505 503932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 506810 507298 gene locus_tag LOCUS_33940 506810 507298 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892388.1 protein_id gnl|my_center|LOCUS_33940 508218 507328 gene locus_tag LOCUS_33950 508218 507328 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972637.1 protein_id gnl|my_center|LOCUS_33950 509502 508297 gene locus_tag LOCUS_33960 509502 508297 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976175.1 protein_id gnl|my_center|LOCUS_33960 509651 510907 gene locus_tag LOCUS_33970 509651 510907 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028461.1 protein_id gnl|my_center|LOCUS_33970 511753 510929 gene locus_tag LOCUS_33980 511753 510929 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_33980 512346 511858 gene locus_tag LOCUS_33990 512346 511858 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_33990 512527 513972 gene locus_tag LOCUS_34000 512527 513972 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869905.1 protein_id gnl|my_center|LOCUS_34000 514645 514046 gene locus_tag LOCUS_34010 514645 514046 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_34010 514955 516361 gene locus_tag LOCUS_34020 514955 516361 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976169.1 protein_id gnl|my_center|LOCUS_34020 516511 517917 gene locus_tag LOCUS_34030 516511 517917 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976169.1 protein_id gnl|my_center|LOCUS_34030 518083 518724 gene locus_tag LOCUS_34040 518083 518724 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976168.1 protein_id gnl|my_center|LOCUS_34040 519475 518843 gene locus_tag LOCUS_34050 519475 518843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 520191 519550 gene locus_tag LOCUS_34060 520191 519550 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326218.1 protein_id gnl|my_center|LOCUS_34060 520305 522914 gene locus_tag LOCUS_34070 gene pepN 520305 522914 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 protein_id gnl|my_center|LOCUS_34070 523027 524073 gene locus_tag LOCUS_34080 523027 524073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270042.1 protein_id gnl|my_center|LOCUS_34080 525859 524108 gene locus_tag LOCUS_34090 525859 524108 CDS product TIGR03767 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230137.1 protein_id gnl|my_center|LOCUS_34090 526370 529690 gene locus_tag LOCUS_34100 526370 529690 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028469.1 protein_id gnl|my_center|LOCUS_34100 529862 530890 gene locus_tag LOCUS_34110 529862 530890 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028472.1 protein_id gnl|my_center|LOCUS_34110 531030 533603 gene locus_tag LOCUS_34120 gene pepN 531030 533603 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_34120 534693 533704 gene locus_tag LOCUS_34130 534693 533704 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031130.1 protein_id gnl|my_center|LOCUS_34130 535096 534827 gene locus_tag LOCUS_34140 535096 534827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 537207 535144 gene locus_tag LOCUS_34150 gene malQ 537207 535144 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028481.1 protein_id gnl|my_center|LOCUS_34150 537441 540506 gene locus_tag LOCUS_34160 537441 540506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 541109 540573 gene locus_tag LOCUS_34170 541109 540573 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028487.1 protein_id gnl|my_center|LOCUS_34170 541379 542461 gene locus_tag LOCUS_34180 541379 542461 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283001.1 protein_id gnl|my_center|LOCUS_34180 543042 542539 gene locus_tag LOCUS_34190 543042 542539 CDS product FBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978065.1 protein_id gnl|my_center|LOCUS_34190 543226 544425 gene locus_tag LOCUS_34200 543226 544425 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136208195.1 protein_id gnl|my_center|LOCUS_34200 544526 545875 gene locus_tag LOCUS_34210 544526 545875 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028490.1 protein_id gnl|my_center|LOCUS_34210 545920 546879 gene locus_tag LOCUS_34220 545920 546879 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976142.1 protein_id gnl|my_center|LOCUS_34220 546897 547727 gene locus_tag LOCUS_34230 546897 547727 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028491.1 protein_id gnl|my_center|LOCUS_34230 547724 548977 gene locus_tag LOCUS_34240 547724 548977 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028492.1 protein_id gnl|my_center|LOCUS_34240 548968 549972 gene locus_tag LOCUS_34250 548968 549972 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866323.1 protein_id gnl|my_center|LOCUS_34250 550408 550815 gene locus_tag LOCUS_34260 550408 550815 CDS product tyrosinase cofactor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191290802.1 protein_id gnl|my_center|LOCUS_34260 550884 551705 gene locus_tag LOCUS_34270 550884 551705 CDS product tyrosinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976100.1 protein_id gnl|my_center|LOCUS_34270 551977 553362 gene locus_tag LOCUS_34280 551977 553362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976138.1 protein_id gnl|my_center|LOCUS_34280 553380 554345 gene locus_tag LOCUS_34290 553380 554345 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028495.1 protein_id gnl|my_center|LOCUS_34290 554415 555737 gene locus_tag LOCUS_34300 554415 555737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028496.1 protein_id gnl|my_center|LOCUS_34300 556133 555768 gene locus_tag LOCUS_34310 556133 555768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 556027 558444 gene locus_tag LOCUS_34320 556027 558444 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028497.1 protein_id gnl|my_center|LOCUS_34320 558448 559608 gene locus_tag LOCUS_34330 558448 559608 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028498.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34330 559730 561061 gene locus_tag LOCUS_34340 559730 561061 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484988.1 protein_id gnl|my_center|LOCUS_34340 561099 562097 gene locus_tag LOCUS_34350 561099 562097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 562157 562561 gene locus_tag LOCUS_34360 562157 562561 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_34360 563377 562640 gene locus_tag LOCUS_34370 563377 562640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866307.1 protein_id gnl|my_center|LOCUS_34370 563802 563374 gene locus_tag LOCUS_34380 563802 563374 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028505.1 protein_id gnl|my_center|LOCUS_34380 565469 563805 gene locus_tag LOCUS_34390 gene ettA 565469 563805 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976122.1 protein_id gnl|my_center|LOCUS_34390 567073 565637 gene locus_tag LOCUS_34400 567073 565637 CDS product TQXA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028511.1 protein_id gnl|my_center|LOCUS_34400 567881 567312 gene locus_tag LOCUS_34410 567881 567312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 569756 567900 gene locus_tag LOCUS_34420 569756 567900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34420 571504 569861 gene locus_tag LOCUS_34430 571504 569861 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028513.1 protein_id gnl|my_center|LOCUS_34430 571801 571874 gene locus_tag LOCUS_t00360 571801 571874 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 572111 572596 gene locus_tag LOCUS_34440 572111 572596 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223894.1 protein_id gnl|my_center|LOCUS_34440 572589 573827 gene locus_tag LOCUS_34450 572589 573827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 575054 573804 gene locus_tag LOCUS_34460 575054 573804 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400620.1 protein_id gnl|my_center|LOCUS_34460 577326 575146 gene locus_tag LOCUS_34470 577326 575146 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227877.1 protein_id gnl|my_center|LOCUS_34470 577507 578043 gene locus_tag LOCUS_34480 577507 578043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34480 578145 579302 gene locus_tag LOCUS_34490 578145 579302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34490 581487 579397 gene locus_tag LOCUS_34500 581487 579397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 581884 581645 gene locus_tag LOCUS_34510 gene chpF 581884 581645 CDS product chaplin ChpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028524.1 protein_id gnl|my_center|LOCUS_34510 582289 582014 gene locus_tag LOCUS_34520 582289 582014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 582555 583223 gene locus_tag LOCUS_34530 582555 583223 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_34530 584164 583259 gene locus_tag LOCUS_34540 584164 583259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 584504 585766 gene locus_tag LOCUS_34550 584504 585766 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227089.1 protein_id gnl|my_center|LOCUS_34550 585776 586249 gene locus_tag LOCUS_34560 gene crcB 585776 586249 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031398.1 protein_id gnl|my_center|LOCUS_34560 586246 586596 gene locus_tag LOCUS_34570 586246 586596 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972099.1 protein_id gnl|my_center|LOCUS_34570 586593 586949 gene locus_tag LOCUS_34580 gene crcB 586593 586949 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_34580 587864 586962 gene locus_tag LOCUS_34590 587864 586962 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_34590 587952 588659 gene locus_tag LOCUS_34600 587952 588659 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325539.1 protein_id gnl|my_center|LOCUS_34600 588661 590607 gene locus_tag LOCUS_34610 588661 590607 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977936.1 protein_id gnl|my_center|LOCUS_34610 590604 591359 gene locus_tag LOCUS_34620 590604 591359 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027448.1 protein_id gnl|my_center|LOCUS_34620 591722 591414 gene locus_tag LOCUS_34630 591722 591414 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_34630 592144 591719 gene locus_tag LOCUS_34640 592144 591719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 592336 592953 gene locus_tag LOCUS_34650 592336 592953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 593254 592994 gene locus_tag LOCUS_34660 593254 592994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976994.1 protein_id gnl|my_center|LOCUS_34660 595224 593413 gene locus_tag LOCUS_34670 595224 593413 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978119.1 protein_id gnl|my_center|LOCUS_34670 595646 595230 gene locus_tag LOCUS_34680 595646 595230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 595909 595643 gene locus_tag LOCUS_34690 595909 595643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 597770 595929 gene locus_tag LOCUS_34700 597770 595929 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_34700 598102 597950 gene locus_tag LOCUS_34710 598102 597950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 600087 598393 gene locus_tag LOCUS_34720 600087 598393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 601804 600200 gene locus_tag LOCUS_34730 601804 600200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 601874 602470 gene locus_tag LOCUS_34740 601874 602470 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_34740 604592 602502 gene locus_tag LOCUS_34750 604592 602502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 606217 604724 gene locus_tag LOCUS_34760 gene mmsA 606217 604724 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028544.1 protein_id gnl|my_center|LOCUS_34760 608143 606254 gene locus_tag LOCUS_34770 gene iolD 608143 606254 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 protein_id gnl|my_center|LOCUS_34770 609015 608140 gene locus_tag LOCUS_34780 gene iolB 609015 608140 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031348.1 protein_id gnl|my_center|LOCUS_34780 610087 609209 gene locus_tag LOCUS_34790 610087 609209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031349.1 protein_id gnl|my_center|LOCUS_34790 611118 610084 gene locus_tag LOCUS_34800 gene iolC 611118 610084 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972167.1 protein_id gnl|my_center|LOCUS_34800 611280 612233 gene locus_tag LOCUS_34810 611280 612233 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031353.1 protein_id gnl|my_center|LOCUS_34810 612230 613366 gene locus_tag LOCUS_34820 612230 613366 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031545.1 protein_id gnl|my_center|LOCUS_34820 613363 614376 gene locus_tag LOCUS_34830 613363 614376 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972671.1 protein_id gnl|my_center|LOCUS_34830 614627 614833 gene locus_tag LOCUS_34840 614627 614833 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326277.1 protein_id gnl|my_center|LOCUS_34840 614930 615145 gene locus_tag LOCUS_34850 614930 615145 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113056.1 protein_id gnl|my_center|LOCUS_34850 615295 615597 gene locus_tag LOCUS_34860 615295 615597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 616895 615594 gene locus_tag LOCUS_34870 616895 615594 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976064.1 protein_id gnl|my_center|LOCUS_34870 619281 617053 gene locus_tag LOCUS_34880 619281 617053 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028552.1 protein_id gnl|my_center|LOCUS_34880 620227 619571 gene locus_tag LOCUS_34890 620227 619571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 621302 620328 gene locus_tag LOCUS_34900 621302 620328 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976044.1 protein_id gnl|my_center|LOCUS_34900 621396 622301 gene locus_tag LOCUS_34910 621396 622301 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028565.1 protein_id gnl|my_center|LOCUS_34910 622348 622989 gene locus_tag LOCUS_34920 622348 622989 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227830.1 protein_id gnl|my_center|LOCUS_34920 623290 623958 gene locus_tag LOCUS_34930 623290 623958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 625411 623981 gene locus_tag LOCUS_34940 625411 623981 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028568.1 protein_id gnl|my_center|LOCUS_34940 629291 625539 gene locus_tag LOCUS_34950 629291 625539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028569.1 protein_id gnl|my_center|LOCUS_34950 631528 629420 gene locus_tag LOCUS_34960 gene kdpB 631528 629420 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029187.1 protein_id gnl|my_center|LOCUS_34960 632705 631734 gene locus_tag LOCUS_34970 gene speB 632705 631734 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895813.1 protein_id gnl|my_center|LOCUS_34970 632891 633679 gene locus_tag LOCUS_34980 632891 633679 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976029.1 protein_id gnl|my_center|LOCUS_34980 634311 633676 gene locus_tag LOCUS_34990 634311 633676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 634419 635147 gene locus_tag LOCUS_35000 634419 635147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 635209 636642 gene locus_tag LOCUS_35010 635209 636642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 636922 636680 gene locus_tag LOCUS_35020 636922 636680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 637890 636985 gene locus_tag LOCUS_35030 637890 636985 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028576.1 protein_id gnl|my_center|LOCUS_35030 639092 637935 gene locus_tag LOCUS_35040 639092 637935 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028577.1 protein_id gnl|my_center|LOCUS_35040 639841 639233 gene locus_tag LOCUS_35050 639841 639233 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028578.1 protein_id gnl|my_center|LOCUS_35050 639943 641574 gene locus_tag LOCUS_35060 639943 641574 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028579.1 protein_id gnl|my_center|LOCUS_35060 641583 643661 gene locus_tag LOCUS_35070 641583 643661 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028580.1 protein_id gnl|my_center|LOCUS_35070 643658 644596 gene locus_tag LOCUS_35080 643658 644596 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028581.1 protein_id gnl|my_center|LOCUS_35080 644600 645769 gene locus_tag LOCUS_35090 644600 645769 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976021.1 protein_id gnl|my_center|LOCUS_35090 645856 646773 gene locus_tag LOCUS_35100 645856 646773 CDS product DUF4429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976013.1 protein_id gnl|my_center|LOCUS_35100 646860 647135 gene locus_tag LOCUS_35110 646860 647135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976012.1 protein_id gnl|my_center|LOCUS_35110 647257 649077 gene locus_tag LOCUS_35120 gene glmS 647257 649077 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976011.1 protein_id gnl|my_center|LOCUS_35120 649936 649415 gene locus_tag LOCUS_35130 649936 649415 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976010.1 protein_id gnl|my_center|LOCUS_35130 650273 650605 gene locus_tag LOCUS_35140 650273 650605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 650974 652299 gene locus_tag LOCUS_35150 650974 652299 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028588.1 protein_id gnl|my_center|LOCUS_35150 652317 652910 gene locus_tag LOCUS_35160 gene orn 652317 652910 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976007.1 protein_id gnl|my_center|LOCUS_35160 653018 653091 gene locus_tag LOCUS_t00370 653018 653091 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 653239 653448 gene locus_tag LOCUS_35170 653239 653448 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_35170 653445 654770 gene locus_tag LOCUS_35180 653445 654770 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_35180 654781 655758 gene locus_tag LOCUS_35190 654781 655758 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028590.1 protein_id gnl|my_center|LOCUS_35190 655768 656616 gene locus_tag LOCUS_35200 655768 656616 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028591.1 protein_id gnl|my_center|LOCUS_35200 656657 658045 gene locus_tag LOCUS_35210 656657 658045 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976002.1 protein_id gnl|my_center|LOCUS_35210 658952 658083 gene locus_tag LOCUS_35220 658952 658083 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028594.1 protein_id gnl|my_center|LOCUS_35220 659457 658996 gene locus_tag LOCUS_35230 659457 658996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975996.1 protein_id gnl|my_center|LOCUS_35230 659738 661114 gene locus_tag LOCUS_35240 659738 661114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028595.1 protein_id gnl|my_center|LOCUS_35240 661880 661287 gene locus_tag LOCUS_35250 661880 661287 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028596.1 protein_id gnl|my_center|LOCUS_35250 662169 663143 gene locus_tag LOCUS_35260 662169 663143 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028597.1 protein_id gnl|my_center|LOCUS_35260 663064 664278 gene locus_tag LOCUS_35270 663064 664278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485125.1 protein_id gnl|my_center|LOCUS_35270 663457 663555 gene locus_tag LOCUS_t00380 663457 663555 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 664382 665977 gene locus_tag LOCUS_35280 664382 665977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484926.1 protein_id gnl|my_center|LOCUS_35280 665974 667326 gene locus_tag LOCUS_35290 665974 667326 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975990.1 protein_id gnl|my_center|LOCUS_35290 667499 667867 gene locus_tag LOCUS_35300 667499 667867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975980.1 protein_id gnl|my_center|LOCUS_35300 668013 668642 gene locus_tag LOCUS_35310 668013 668642 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028603.1 protein_id gnl|my_center|LOCUS_35310 668699 668773 gene locus_tag LOCUS_t00390 668699 668773 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 670105 668855 gene locus_tag LOCUS_35320 670105 668855 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028602.1 protein_id gnl|my_center|LOCUS_35320 670503 672446 gene locus_tag LOCUS_35330 670503 672446 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975983.1 protein_id gnl|my_center|LOCUS_35330 673717 672608 gene locus_tag LOCUS_35340 673717 672608 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028601.1 protein_id gnl|my_center|LOCUS_35340 673940 674728 gene locus_tag LOCUS_35350 673940 674728 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866451.1 protein_id gnl|my_center|LOCUS_35350 674802 674876 gene locus_tag LOCUS_t00400 674802 674876 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 675033 675434 gene locus_tag LOCUS_35360 675033 675434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 675510 676274 gene locus_tag LOCUS_35370 675510 676274 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030586.1 protein_id gnl|my_center|LOCUS_35370 676271 677128 gene locus_tag LOCUS_35380 676271 677128 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030587.1 protein_id gnl|my_center|LOCUS_35380 677770 677180 gene locus_tag LOCUS_35390 677770 677180 CDS product lytic polysaccharide monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975967.1 protein_id gnl|my_center|LOCUS_35390 678687 677887 gene locus_tag LOCUS_35400 678687 677887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 678860 678934 gene locus_tag LOCUS_t00410 678860 678934 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 679278 681125 gene locus_tag LOCUS_35410 679278 681125 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028608.1 protein_id gnl|my_center|LOCUS_35410 681122 683149 gene locus_tag LOCUS_35420 681122 683149 CDS product kelch motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028609.1 protein_id gnl|my_center|LOCUS_35420 684209 683154 gene locus_tag LOCUS_35430 684209 683154 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715516.1 protein_id gnl|my_center|LOCUS_35430 685074 684385 gene locus_tag LOCUS_35440 685074 684385 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028613.1 protein_id gnl|my_center|LOCUS_35440 685732 685100 gene locus_tag LOCUS_35450 685732 685100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 686681 685902 gene locus_tag LOCUS_35460 686681 685902 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_35460 687854 686805 gene locus_tag LOCUS_35470 687854 686805 CDS product 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533035.1 protein_id gnl|my_center|LOCUS_35470 688689 687883 gene locus_tag LOCUS_35480 688689 687883 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533032.1 protein_id gnl|my_center|LOCUS_35480 689605 688676 gene locus_tag LOCUS_35490 689605 688676 CDS product 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533033.1 protein_id gnl|my_center|LOCUS_35490 690650 689598 gene locus_tag LOCUS_35500 690650 689598 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533034.1 protein_id gnl|my_center|LOCUS_35500 691381 690647 gene locus_tag LOCUS_35510 691381 690647 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084718.1 protein_id gnl|my_center|LOCUS_35510 692481 691387 gene locus_tag LOCUS_35520 692481 691387 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876725.1 protein_id gnl|my_center|LOCUS_35520 693405 692620 gene locus_tag LOCUS_35530 693405 692620 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224434.1 protein_id gnl|my_center|LOCUS_35530 694276 693461 gene locus_tag LOCUS_35540 694276 693461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 695715 694624 gene locus_tag LOCUS_35550 695715 694624 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975954.1 protein_id gnl|my_center|LOCUS_35550 695764 696864 gene locus_tag LOCUS_35560 695764 696864 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975953.1 protein_id gnl|my_center|LOCUS_35560 697782 696856 gene locus_tag LOCUS_35570 697782 696856 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229477.1 protein_id gnl|my_center|LOCUS_35570 697851 698549 gene locus_tag LOCUS_35580 697851 698549 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 protein_id gnl|my_center|LOCUS_35580 698668 699594 gene locus_tag LOCUS_35590 gene bla 698668 699594 CDS product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387981.1 protein_id gnl|my_center|LOCUS_35590 700570 699614 gene locus_tag LOCUS_35600 700570 699614 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974569.1 protein_id gnl|my_center|LOCUS_35600 700658 701590 gene locus_tag LOCUS_35610 700658 701590 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_35610 702129 701596 gene locus_tag LOCUS_35620 702129 701596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 703582 702191 gene locus_tag LOCUS_35630 703582 702191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 704660 703788 gene locus_tag LOCUS_35640 704660 703788 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028618.1 protein_id gnl|my_center|LOCUS_35640 705527 704748 gene locus_tag LOCUS_35650 705527 704748 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028619.1 protein_id gnl|my_center|LOCUS_35650 705982 705668 gene locus_tag LOCUS_35660 705982 705668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 707598 706051 gene locus_tag LOCUS_35670 707598 706051 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125939.1 protein_id gnl|my_center|LOCUS_35670 707795 707595 gene locus_tag LOCUS_35680 707795 707595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 709138 707855 gene locus_tag LOCUS_35690 709138 707855 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_35690 709343 710665 gene locus_tag LOCUS_35700 709343 710665 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_35700 711342 710680 gene locus_tag LOCUS_35710 711342 710680 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028650.1 protein_id gnl|my_center|LOCUS_35710 712379 711411 gene locus_tag LOCUS_35720 712379 711411 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_35720 713230 712376 gene locus_tag LOCUS_35730 713230 712376 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028652.1 protein_id gnl|my_center|LOCUS_35730 714023 713223 gene locus_tag LOCUS_35740 714023 713223 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_35740 714348 716657 gene locus_tag LOCUS_35750 714348 716657 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943963.1 protein_id gnl|my_center|LOCUS_35750 716998 716678 gene locus_tag LOCUS_35760 716998 716678 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975912.1 protein_id gnl|my_center|LOCUS_35760 717434 717093 gene locus_tag LOCUS_35770 717434 717093 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975911.1 protein_id gnl|my_center|LOCUS_35770 717864 717505 gene locus_tag LOCUS_35780 717864 717505 CDS product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028653.1 protein_id gnl|my_center|LOCUS_35780 718014 718481 gene locus_tag LOCUS_35790 gene bcp 718014 718481 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 protein_id gnl|my_center|LOCUS_35790 719754 718462 gene locus_tag LOCUS_35800 719754 718462 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_35800 720317 719754 gene locus_tag LOCUS_35810 720317 719754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 720482 720566 gene locus_tag LOCUS_t00420 720482 720566 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 721231 720629 gene locus_tag LOCUS_35820 gene rdgB 721231 720629 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028655.1 protein_id gnl|my_center|LOCUS_35820 722015 721284 gene locus_tag LOCUS_35830 gene rph 722015 721284 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975906.1 protein_id gnl|my_center|LOCUS_35830 722340 722107 gene locus_tag LOCUS_35840 722340 722107 CDS product PTS glucose/sucrose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975905.1 protein_id gnl|my_center|LOCUS_35840 722533 723843 gene locus_tag LOCUS_35850 722533 723843 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028656.1 protein_id gnl|my_center|LOCUS_35850 724053 725387 gene locus_tag LOCUS_35860 724053 725387 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028657.1 protein_id gnl|my_center|LOCUS_35860 726217 725465 gene locus_tag LOCUS_35870 726217 725465 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_35870 726688 726479 gene locus_tag LOCUS_35880 726688 726479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 727779 726856 gene locus_tag LOCUS_35890 727779 726856 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975900.1 protein_id gnl|my_center|LOCUS_35890 728105 727824 gene locus_tag LOCUS_35900 728105 727824 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975899.1 protein_id gnl|my_center|LOCUS_35900 728683 728243 gene locus_tag LOCUS_35910 728683 728243 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028660.1 protein_id gnl|my_center|LOCUS_35910 730190 728742 gene locus_tag LOCUS_35920 730190 728742 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028661.1 protein_id gnl|my_center|LOCUS_35920 731106 730513 gene locus_tag LOCUS_35930 731106 730513 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_35930 731417 731106 gene locus_tag LOCUS_35940 gene clpS 731417 731106 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180153.1 protein_id gnl|my_center|LOCUS_35940 731625 732878 gene locus_tag LOCUS_35950 731625 732878 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028662.1 protein_id gnl|my_center|LOCUS_35950 732987 733580 gene locus_tag LOCUS_35960 732987 733580 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975893.1 protein_id gnl|my_center|LOCUS_35960 733971 733636 gene locus_tag LOCUS_35970 733971 733636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975892.1 protein_id gnl|my_center|LOCUS_35970 736493 734073 gene locus_tag LOCUS_35980 736493 734073 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028663.1 protein_id gnl|my_center|LOCUS_35980 736858 737130 gene locus_tag LOCUS_35990 736858 737130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 737790 737116 gene locus_tag LOCUS_36000 737790 737116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 739230 737848 gene locus_tag LOCUS_36010 739230 737848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 739482 739898 gene locus_tag LOCUS_36020 739482 739898 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975886.1 protein_id gnl|my_center|LOCUS_36020 741424 740000 gene locus_tag LOCUS_36030 741424 740000 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975885.1 protein_id gnl|my_center|LOCUS_36030 742696 741554 gene locus_tag LOCUS_36040 gene hppD 742696 741554 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975883.1 protein_id gnl|my_center|LOCUS_36040 742821 743285 gene locus_tag LOCUS_36050 742821 743285 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028667.1 protein_id gnl|my_center|LOCUS_36050 744184 743393 gene locus_tag LOCUS_36060 744184 743393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028670.1 protein_id gnl|my_center|LOCUS_36060 745054 744413 gene locus_tag LOCUS_36070 745054 744413 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975875.1 protein_id gnl|my_center|LOCUS_36070 745340 746326 gene locus_tag LOCUS_36080 745340 746326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 748180 746393 gene locus_tag LOCUS_36090 748180 746393 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_36090 749779 748370 gene locus_tag LOCUS_36100 749779 748370 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 protein_id gnl|my_center|LOCUS_36100 750018 750611 gene locus_tag LOCUS_36110 750018 750611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 751704 750649 gene locus_tag LOCUS_36120 751704 750649 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929959.1 protein_id gnl|my_center|LOCUS_36120 752267 751704 gene locus_tag LOCUS_36130 752267 751704 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926066.1 protein_id gnl|my_center|LOCUS_36130 753282 752377 gene locus_tag LOCUS_36140 753282 752377 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_36140 753371 754234 gene locus_tag LOCUS_36150 753371 754234 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224885.1 protein_id gnl|my_center|LOCUS_36150 754366 754438 gene locus_tag LOCUS_t00430 754366 754438 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 755741 754485 gene locus_tag LOCUS_36160 755741 754485 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227817.1 protein_id gnl|my_center|LOCUS_36160 756158 755826 gene locus_tag LOCUS_36170 756158 755826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 756401 756763 gene locus_tag LOCUS_36180 756401 756763 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978039.1 protein_id gnl|my_center|LOCUS_36180 757155 756775 gene locus_tag LOCUS_36190 757155 756775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 758136 757159 gene locus_tag LOCUS_36200 758136 757159 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026837.1 protein_id gnl|my_center|LOCUS_36200 758587 758171 gene locus_tag LOCUS_36210 758587 758171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 763398 758605 gene locus_tag LOCUS_36220 763398 758605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 764005 763418 gene locus_tag LOCUS_36230 764005 763418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 764469 764002 gene locus_tag LOCUS_36240 764469 764002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 764736 765203 gene locus_tag LOCUS_36250 764736 765203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 765217 766536 gene locus_tag LOCUS_36260 765217 766536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 766566 767060 gene locus_tag LOCUS_36270 766566 767060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 767057 767548 gene locus_tag LOCUS_36280 767057 767548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 768704 767688 gene locus_tag LOCUS_36290 768704 767688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 770515 768911 gene locus_tag LOCUS_36300 770515 768911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030424.1 protein_id gnl|my_center|LOCUS_36300 770973 770515 gene locus_tag LOCUS_36310 770973 770515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 773424 771052 gene locus_tag LOCUS_36320 773424 771052 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028673.1 protein_id gnl|my_center|LOCUS_36320 775193 773421 gene locus_tag LOCUS_36330 775193 773421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 776134 775190 gene locus_tag LOCUS_36340 776134 775190 CDS product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865474.1 protein_id gnl|my_center|LOCUS_36340 776022 776351 gene locus_tag LOCUS_36350 776022 776351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 778103 776442 gene locus_tag LOCUS_36360 778103 776442 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_36360 778963 778112 gene locus_tag LOCUS_36370 778963 778112 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028676.1 protein_id gnl|my_center|LOCUS_36370 779865 778960 gene locus_tag LOCUS_36380 779865 778960 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270062.1 protein_id gnl|my_center|LOCUS_36380 781160 779877 gene locus_tag LOCUS_36390 781160 779877 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975864.1 protein_id gnl|my_center|LOCUS_36390 781687 781397 gene locus_tag LOCUS_36400 781687 781397 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030402030.1 protein_id gnl|my_center|LOCUS_36400 782368 781718 gene locus_tag LOCUS_36410 782368 781718 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865482.1 protein_id gnl|my_center|LOCUS_36410 782686 784026 gene locus_tag LOCUS_36420 gene murA 782686 784026 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975861.1 protein_id gnl|my_center|LOCUS_36420 784695 784414 gene locus_tag LOCUS_36430 784695 784414 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003950507.1 protein_id gnl|my_center|LOCUS_36430 >Feature sequence05 <1 801 gene locus_tag LOCUS_36440 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029950.1:biotin carboxylase N-terminal domain-containing protein 981 1568 gene locus_tag LOCUS_36450 981 1568 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_36450 2613 1633 gene locus_tag LOCUS_36460 2613 1633 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029949.1 protein_id gnl|my_center|LOCUS_36460 4245 2797 gene locus_tag LOCUS_36470 4245 2797 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872192.1 protein_id gnl|my_center|LOCUS_36470 4422 4859 gene locus_tag LOCUS_36480 4422 4859 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974055.1 protein_id gnl|my_center|LOCUS_36480 4982 5803 gene locus_tag LOCUS_36490 4982 5803 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974056.1 protein_id gnl|my_center|LOCUS_36490 6158 7843 gene locus_tag LOCUS_36500 6158 7843 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495362.1 protein_id gnl|my_center|LOCUS_36500 8810 8184 gene locus_tag LOCUS_36510 8810 8184 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029946.1 protein_id gnl|my_center|LOCUS_36510 9204 9279 gene locus_tag LOCUS_t00440 9204 9279 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11066 9597 gene locus_tag LOCUS_36520 11066 9597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 11404 12345 gene locus_tag LOCUS_36530 gene deoC 11404 12345 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_36530 12348 13778 gene locus_tag LOCUS_36540 12348 13778 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029944.1 protein_id gnl|my_center|LOCUS_36540 13771 14655 gene locus_tag LOCUS_36550 13771 14655 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_36550 15097 14729 gene locus_tag LOCUS_36560 15097 14729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 15250 15903 gene locus_tag LOCUS_36570 15250 15903 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189397579.1 protein_id gnl|my_center|LOCUS_36570 16700 16083 gene locus_tag LOCUS_36580 16700 16083 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327117.1 protein_id gnl|my_center|LOCUS_36580 17057 17734 gene locus_tag LOCUS_36590 gene afsQ1 17057 17734 CDS product two-component system response regulator AfsQ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974066.1 protein_id gnl|my_center|LOCUS_36590 17805 19361 gene locus_tag LOCUS_36600 gene afsQ2 17805 19361 CDS product two-component system sensor histidine kinase AfsQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974067.1 protein_id gnl|my_center|LOCUS_36600 19358 19969 gene locus_tag LOCUS_36610 19358 19969 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974068.1 protein_id gnl|my_center|LOCUS_36610 20015 20578 gene locus_tag LOCUS_36620 20015 20578 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029938.1 protein_id gnl|my_center|LOCUS_36620 20688 20900 gene locus_tag LOCUS_36630 20688 20900 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974070.1 protein_id gnl|my_center|LOCUS_36630 21443 20976 gene locus_tag LOCUS_36640 21443 20976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 22795 21635 gene locus_tag LOCUS_36650 22795 21635 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_36650 22915 23712 gene locus_tag LOCUS_36660 22915 23712 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029936.1 protein_id gnl|my_center|LOCUS_36660 24725 23721 gene locus_tag LOCUS_36670 24725 23721 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_36670 24789 26111 gene locus_tag LOCUS_36680 24789 26111 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029933.1 protein_id gnl|my_center|LOCUS_36680 27705 26821 gene locus_tag LOCUS_36690 27705 26821 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727064.1 protein_id gnl|my_center|LOCUS_36690 27827 28744 gene locus_tag LOCUS_36700 27827 28744 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225603.1 protein_id gnl|my_center|LOCUS_36700 29274 28684 gene locus_tag LOCUS_36710 29274 28684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 29608 30432 gene locus_tag LOCUS_36720 29608 30432 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_36720 31057 30437 gene locus_tag LOCUS_36730 31057 30437 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227463.1 protein_id gnl|my_center|LOCUS_36730 32232 31147 gene locus_tag LOCUS_36740 32232 31147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 33732 32455 gene locus_tag LOCUS_36750 33732 32455 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872150.1 protein_id gnl|my_center|LOCUS_36750 34229 33834 gene locus_tag LOCUS_36760 34229 33834 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_36760 35518 34226 gene locus_tag LOCUS_36770 35518 34226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_36770 36621 35515 gene locus_tag LOCUS_36780 36621 35515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029927.1 protein_id gnl|my_center|LOCUS_36780 38315 36618 gene locus_tag LOCUS_36790 38315 36618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_36790 39666 38623 gene locus_tag LOCUS_36800 39666 38623 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029926.1 protein_id gnl|my_center|LOCUS_36800 41022 39784 gene locus_tag LOCUS_36810 41022 39784 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029925.1 protein_id gnl|my_center|LOCUS_36810 42346 41129 gene locus_tag LOCUS_36820 42346 41129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974090.1 protein_id gnl|my_center|LOCUS_36820 43307 42357 gene locus_tag LOCUS_36830 43307 42357 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974091.1 protein_id gnl|my_center|LOCUS_36830 44668 43346 gene locus_tag LOCUS_36840 44668 43346 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_36840 45990 44686 gene locus_tag LOCUS_36850 45990 44686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029923.1 protein_id gnl|my_center|LOCUS_36850 46208 47200 gene locus_tag LOCUS_36860 46208 47200 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974094.1 protein_id gnl|my_center|LOCUS_36860 47200 48570 gene locus_tag LOCUS_36870 47200 48570 CDS product alpha-2,8-polysialyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029922.1 protein_id gnl|my_center|LOCUS_36870 48567 49694 gene locus_tag LOCUS_36880 48567 49694 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 protein_id gnl|my_center|LOCUS_36880 50291 49680 gene locus_tag LOCUS_36890 50291 49680 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974101.1 protein_id gnl|my_center|LOCUS_36890 50404 51894 gene locus_tag LOCUS_36900 50404 51894 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029917.1 protein_id gnl|my_center|LOCUS_36900 53445 51967 gene locus_tag LOCUS_36910 53445 51967 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028399.1 protein_id gnl|my_center|LOCUS_36910 54028 53531 gene locus_tag LOCUS_36920 54028 53531 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029961.1 protein_id gnl|my_center|LOCUS_36920 54337 54143 gene locus_tag LOCUS_36930 54337 54143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 55149 54334 gene locus_tag LOCUS_36940 55149 54334 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974794.1 protein_id gnl|my_center|LOCUS_36940 55267 55623 gene locus_tag LOCUS_36950 55267 55623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 57233 55833 gene locus_tag LOCUS_36960 57233 55833 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223067.1 protein_id gnl|my_center|LOCUS_36960 57770 57279 gene locus_tag LOCUS_36970 57770 57279 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977146.1 protein_id gnl|my_center|LOCUS_36970 57910 58623 gene locus_tag LOCUS_36980 57910 58623 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027913.1 protein_id gnl|my_center|LOCUS_36980 60126 58708 gene locus_tag LOCUS_36990 60126 58708 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222347.1 protein_id gnl|my_center|LOCUS_36990 60255 60536 gene locus_tag LOCUS_37000 60255 60536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 60693 62963 gene locus_tag LOCUS_37010 60693 62963 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973559.1 protein_id gnl|my_center|LOCUS_37010 63256 64728 gene locus_tag LOCUS_37020 63256 64728 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028399.1 protein_id gnl|my_center|LOCUS_37020 65189 64725 gene locus_tag LOCUS_37030 65189 64725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 65450 65232 gene locus_tag LOCUS_37040 65450 65232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 67073 65481 gene locus_tag LOCUS_37050 67073 65481 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031217.1 protein_id gnl|my_center|LOCUS_37050 68497 67283 gene locus_tag LOCUS_37060 68497 67283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 69153 68497 gene locus_tag LOCUS_37070 69153 68497 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974105.1 protein_id gnl|my_center|LOCUS_37070 70165 69188 gene locus_tag LOCUS_37080 70165 69188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 72065 70467 gene locus_tag LOCUS_37090 72065 70467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 72482 72862 gene locus_tag LOCUS_37100 gene sdhC 72482 72862 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974113.1 protein_id gnl|my_center|LOCUS_37100 72871 73344 gene locus_tag LOCUS_37110 72871 73344 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029907.1 protein_id gnl|my_center|LOCUS_37110 73365 75119 gene locus_tag LOCUS_37120 gene sdhA 73365 75119 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974115.1 protein_id gnl|my_center|LOCUS_37120 75119 75877 gene locus_tag LOCUS_37130 75119 75877 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974116.1 protein_id gnl|my_center|LOCUS_37130 76285 75941 gene locus_tag LOCUS_37140 76285 75941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 76313 77128 gene locus_tag LOCUS_37150 76313 77128 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228494.1 protein_id gnl|my_center|LOCUS_37150 77381 77154 gene locus_tag LOCUS_37160 77381 77154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 78257 77436 gene locus_tag LOCUS_37170 78257 77436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 80004 78418 gene locus_tag LOCUS_37180 80004 78418 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973111.1 protein_id gnl|my_center|LOCUS_37180 80366 80088 gene locus_tag LOCUS_37190 80366 80088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974124.1 protein_id gnl|my_center|LOCUS_37190 80269 81867 gene locus_tag LOCUS_37200 80269 81867 CDS product DUF5136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486558.1 protein_id gnl|my_center|LOCUS_37200 82741 81836 gene locus_tag LOCUS_37210 82741 81836 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974125.1 protein_id gnl|my_center|LOCUS_37210 83346 82714 gene locus_tag LOCUS_37220 83346 82714 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029900.1 protein_id gnl|my_center|LOCUS_37220 84536 83523 gene locus_tag LOCUS_37230 gene trpS 84536 83523 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974132.1 protein_id gnl|my_center|LOCUS_37230 84681 85889 gene locus_tag LOCUS_37240 gene rocD 84681 85889 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977608.1 protein_id gnl|my_center|LOCUS_37240 86871 85828 gene locus_tag LOCUS_37250 86871 85828 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125308321.1 protein_id gnl|my_center|LOCUS_37250 86268 86361 gene locus_tag LOCUS_t00450 86268 86361 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 86821 87762 gene locus_tag LOCUS_37260 86821 87762 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892028.1 protein_id gnl|my_center|LOCUS_37260 88972 87767 gene locus_tag LOCUS_37270 88972 87767 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112824.1 protein_id gnl|my_center|LOCUS_37270 89260 88982 gene locus_tag LOCUS_37280 89260 88982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 90150 89389 gene locus_tag LOCUS_37290 90150 89389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 90199 91035 gene locus_tag LOCUS_37300 90199 91035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030873.1 protein_id gnl|my_center|LOCUS_37300 91647 91201 gene locus_tag LOCUS_37310 91647 91201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 91646 92323 gene locus_tag LOCUS_37320 91646 92323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37320 92320 92631 gene locus_tag LOCUS_37330 92320 92631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 92873 92640 gene locus_tag LOCUS_37340 92873 92640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 93667 92825 gene locus_tag LOCUS_37350 93667 92825 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028316.1 protein_id gnl|my_center|LOCUS_37350 93791 94117 gene locus_tag LOCUS_37360 93791 94117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 94270 95139 gene locus_tag LOCUS_37370 94270 95139 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029807.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37370 95146 96069 gene locus_tag LOCUS_37380 95146 96069 CDS product DUF1963 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227205.1 protein_id gnl|my_center|LOCUS_37380 97624 96098 gene locus_tag LOCUS_37390 97624 96098 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029898.1 protein_id gnl|my_center|LOCUS_37390 97717 98154 gene locus_tag LOCUS_37400 97717 98154 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029897.1 protein_id gnl|my_center|LOCUS_37400 98249 98632 gene locus_tag LOCUS_37410 98249 98632 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_37410 98722 99462 gene locus_tag LOCUS_37420 98722 99462 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223482.1 protein_id gnl|my_center|LOCUS_37420 100449 99478 gene locus_tag LOCUS_37430 100449 99478 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_37430 102406 100451 gene locus_tag LOCUS_37440 102406 100451 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029894.1 protein_id gnl|my_center|LOCUS_37440 103587 102403 gene locus_tag LOCUS_37450 103587 102403 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_37450 105116 103584 gene locus_tag LOCUS_37460 105116 103584 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974143.1 protein_id gnl|my_center|LOCUS_37460 106677 105169 gene locus_tag LOCUS_37470 106677 105169 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029892.1 protein_id gnl|my_center|LOCUS_37470 107715 106852 gene locus_tag LOCUS_37480 107715 106852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 108310 107729 gene locus_tag LOCUS_37490 108310 107729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 109977 108307 gene locus_tag LOCUS_37500 109977 108307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 111149 110160 gene locus_tag LOCUS_37510 111149 110160 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974145.1 protein_id gnl|my_center|LOCUS_37510 112642 111521 gene locus_tag LOCUS_37520 112642 111521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 113930 113040 gene locus_tag LOCUS_37530 113930 113040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 114727 113927 gene locus_tag LOCUS_37540 114727 113927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 115101 115499 gene locus_tag LOCUS_37550 115101 115499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 116797 115574 gene locus_tag LOCUS_37560 116797 115574 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037385982.1 protein_id gnl|my_center|LOCUS_37560 117371 116901 gene locus_tag LOCUS_37570 117371 116901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 118242 117361 gene locus_tag LOCUS_37580 118242 117361 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974148.1 protein_id gnl|my_center|LOCUS_37580 118402 119061 gene locus_tag LOCUS_37590 118402 119061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37590 120683 119115 gene locus_tag LOCUS_37600 gene purH 120683 119115 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029883.1 protein_id gnl|my_center|LOCUS_37600 121306 120680 gene locus_tag LOCUS_37610 gene purN 121306 120680 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974158.1 protein_id gnl|my_center|LOCUS_37610 121587 122342 gene locus_tag LOCUS_37620 121587 122342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029882.1 protein_id gnl|my_center|LOCUS_37620 124426 122561 gene locus_tag LOCUS_37630 124426 122561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 125509 124625 gene locus_tag LOCUS_37640 gene sucD 125509 124625 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974163.1 protein_id gnl|my_center|LOCUS_37640 126728 125532 gene locus_tag LOCUS_37650 gene sucC 126728 125532 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974164.1 protein_id gnl|my_center|LOCUS_37650 128196 127027 gene locus_tag LOCUS_37660 128196 127027 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495359.1 protein_id gnl|my_center|LOCUS_37660 130685 128193 gene locus_tag LOCUS_37670 130685 128193 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_37670 131782 130682 gene locus_tag LOCUS_37680 131782 130682 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029875.1 protein_id gnl|my_center|LOCUS_37680 131911 133266 gene locus_tag LOCUS_37690 131911 133266 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055512687.1 protein_id gnl|my_center|LOCUS_37690 133299 134921 gene locus_tag LOCUS_37700 133299 134921 CDS product DUF5691 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029873.1 protein_id gnl|my_center|LOCUS_37700 135319 134909 gene locus_tag LOCUS_37710 135319 134909 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974171.1 protein_id gnl|my_center|LOCUS_37710 135725 136618 gene locus_tag LOCUS_37720 135725 136618 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029872.1 protein_id gnl|my_center|LOCUS_37720 136790 138409 gene locus_tag LOCUS_37730 136790 138409 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029871.1 protein_id gnl|my_center|LOCUS_37730 140963 138480 gene locus_tag LOCUS_37740 gene pcrA 140963 138480 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_37740 141424 141071 gene locus_tag LOCUS_37750 141424 141071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327076.1 protein_id gnl|my_center|LOCUS_37750 141642 141436 gene locus_tag LOCUS_37760 141642 141436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 141701 142777 gene locus_tag LOCUS_37770 141701 142777 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029867.1 protein_id gnl|my_center|LOCUS_37770 143914 142799 gene locus_tag LOCUS_37780 143914 142799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 144725 144030 gene locus_tag LOCUS_37790 144725 144030 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029866.1 protein_id gnl|my_center|LOCUS_37790 145996 144722 gene locus_tag LOCUS_37800 145996 144722 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974180.1 protein_id gnl|my_center|LOCUS_37800 147827 146103 gene locus_tag LOCUS_37810 147827 146103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 147960 149459 gene locus_tag LOCUS_37820 147960 149459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 149446 149682 gene locus_tag LOCUS_37830 149446 149682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 150181 149645 gene locus_tag LOCUS_37840 150181 149645 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897578.1 protein_id gnl|my_center|LOCUS_37840 151391 150363 gene locus_tag LOCUS_37850 151391 150363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 152407 151595 gene locus_tag LOCUS_37860 152407 151595 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974185.1 protein_id gnl|my_center|LOCUS_37860 153078 152494 gene locus_tag LOCUS_37870 153078 152494 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_37870 153739 153185 gene locus_tag LOCUS_37880 153739 153185 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226688.1 protein_id gnl|my_center|LOCUS_37880 155476 153872 gene locus_tag LOCUS_37890 gene guaA 155476 153872 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974187.1 protein_id gnl|my_center|LOCUS_37890 155802 156116 gene locus_tag LOCUS_37900 155802 156116 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486583.1 protein_id gnl|my_center|LOCUS_37900 158486 156702 gene locus_tag LOCUS_37910 158486 156702 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029860.1 protein_id gnl|my_center|LOCUS_37910 160202 158496 gene locus_tag LOCUS_37920 160202 158496 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_37920 161826 160234 gene locus_tag LOCUS_37930 161826 160234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 162426 163316 gene locus_tag LOCUS_37940 162426 163316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 163423 163496 gene locus_tag LOCUS_t00460 163423 163496 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 163964 163461 gene locus_tag LOCUS_37950 163964 163461 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486148.1 protein_id gnl|my_center|LOCUS_37950 164060 165226 gene locus_tag LOCUS_37960 164060 165226 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028195.1 protein_id gnl|my_center|LOCUS_37960 165731 165300 gene locus_tag LOCUS_37970 165731 165300 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 protein_id gnl|my_center|LOCUS_37970 167220 165760 gene locus_tag LOCUS_37980 167220 165760 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_37980 167354 168052 gene locus_tag LOCUS_37990 167354 168052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 169391 168063 gene locus_tag LOCUS_38000 169391 168063 CDS product M64 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031040.1 protein_id gnl|my_center|LOCUS_38000 170810 169548 gene locus_tag LOCUS_38010 170810 169548 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027368.1 protein_id gnl|my_center|LOCUS_38010 170809 170955 gene locus_tag LOCUS_38020 170809 170955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 170997 172385 gene locus_tag LOCUS_38030 170997 172385 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975159.1 protein_id gnl|my_center|LOCUS_38030 172658 173368 gene locus_tag LOCUS_38040 172658 173368 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230063.1 protein_id gnl|my_center|LOCUS_38040 173365 174516 gene locus_tag LOCUS_38050 173365 174516 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742171.1 protein_id gnl|my_center|LOCUS_38050 175012 174620 gene locus_tag LOCUS_38060 175012 174620 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974572.1 protein_id gnl|my_center|LOCUS_38060 175428 175958 gene locus_tag LOCUS_38070 175428 175958 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974573.1 protein_id gnl|my_center|LOCUS_38070 175997 177205 gene locus_tag LOCUS_38080 175997 177205 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029636.1 protein_id gnl|my_center|LOCUS_38080 178176 177313 gene locus_tag LOCUS_38090 gene purU 178176 177313 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974579.1 protein_id gnl|my_center|LOCUS_38090 178702 178259 gene locus_tag LOCUS_38100 178702 178259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974580.1 protein_id gnl|my_center|LOCUS_38100 180589 178808 gene locus_tag LOCUS_38110 180589 178808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867240.1 protein_id gnl|my_center|LOCUS_38110 179035 179131 gene locus_tag LOCUS_t00470 179035 179131 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 182146 180758 gene locus_tag LOCUS_38120 182146 180758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029632.1 protein_id gnl|my_center|LOCUS_38120 182572 183183 gene locus_tag LOCUS_38130 182572 183183 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974584.1 protein_id gnl|my_center|LOCUS_38130 183374 184180 gene locus_tag LOCUS_38140 183374 184180 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_38140 184177 185841 gene locus_tag LOCUS_38150 184177 185841 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029630.1 protein_id gnl|my_center|LOCUS_38150 187021 185921 gene locus_tag LOCUS_38160 187021 185921 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029624.1 protein_id gnl|my_center|LOCUS_38160 187524 187282 gene locus_tag LOCUS_38170 187524 187282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 187507 188265 gene locus_tag LOCUS_38180 gene pdxH 187507 188265 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029623.1 protein_id gnl|my_center|LOCUS_38180 188730 188464 gene locus_tag LOCUS_38190 188730 188464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 188668 190038 gene locus_tag LOCUS_38200 188668 190038 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051815090.1 protein_id gnl|my_center|LOCUS_38200 190840 190082 gene locus_tag LOCUS_38210 190840 190082 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_38210 191088 191780 gene locus_tag LOCUS_38220 191088 191780 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_38220 192255 193190 gene locus_tag LOCUS_38230 192255 193190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326902.1 protein_id gnl|my_center|LOCUS_38230 193307 194728 gene locus_tag LOCUS_38240 193307 194728 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227506.1 protein_id gnl|my_center|LOCUS_38240 195612 194809 gene locus_tag LOCUS_38250 195612 194809 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978600.1 protein_id gnl|my_center|LOCUS_38250 196183 195752 gene locus_tag LOCUS_38260 196183 195752 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928468.1 protein_id gnl|my_center|LOCUS_38260 196277 196987 gene locus_tag LOCUS_38270 196277 196987 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762731.1 protein_id gnl|my_center|LOCUS_38270 197043 198095 gene locus_tag LOCUS_38280 197043 198095 CDS product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114660815.1 protein_id gnl|my_center|LOCUS_38280 199307 198186 gene locus_tag LOCUS_38290 gene serC 199307 198186 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_38290 199429 202338 gene locus_tag LOCUS_38300 199429 202338 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029608.1 protein_id gnl|my_center|LOCUS_38300 202354 204159 gene locus_tag LOCUS_38310 202354 204159 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029617.1 protein_id gnl|my_center|LOCUS_38310 204156 205760 gene locus_tag LOCUS_38320 204156 205760 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974603.1 protein_id gnl|my_center|LOCUS_38320 205813 207714 gene locus_tag LOCUS_38330 205813 207714 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029618.1 protein_id gnl|my_center|LOCUS_38330 207711 208871 gene locus_tag LOCUS_38340 207711 208871 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029619.1 protein_id gnl|my_center|LOCUS_38340 208883 209653 gene locus_tag LOCUS_38350 208883 209653 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974599.1 protein_id gnl|my_center|LOCUS_38350 209641 210315 gene locus_tag LOCUS_38360 209641 210315 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867225.1 protein_id gnl|my_center|LOCUS_38360 210451 210843 gene locus_tag LOCUS_38370 210451 210843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 212422 210989 gene locus_tag LOCUS_38380 212422 210989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 212715 213299 gene locus_tag LOCUS_38390 212715 213299 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972778.1 protein_id gnl|my_center|LOCUS_38390 213299 214159 gene locus_tag LOCUS_38400 213299 214159 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229849.1 protein_id gnl|my_center|LOCUS_38400 215133 214156 gene locus_tag LOCUS_38410 215133 214156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 215711 215130 gene locus_tag LOCUS_38420 215711 215130 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228158.1 protein_id gnl|my_center|LOCUS_38420 215932 215708 gene locus_tag LOCUS_38430 215932 215708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 216560 215985 gene locus_tag LOCUS_38440 216560 215985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 216835 217059 gene locus_tag LOCUS_38450 216835 217059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028633.1 protein_id gnl|my_center|LOCUS_38450 217040 217555 gene locus_tag LOCUS_38460 217040 217555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030180053.1 protein_id gnl|my_center|LOCUS_38460 217645 218412 gene locus_tag LOCUS_38470 217645 218412 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028635.1 protein_id gnl|my_center|LOCUS_38470 218687 218424 gene locus_tag LOCUS_38480 218687 218424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 218815 219000 gene locus_tag LOCUS_38490 218815 219000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 219003 219242 gene locus_tag LOCUS_38500 219003 219242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 219369 220181 gene locus_tag LOCUS_38510 219369 220181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229069.1 protein_id gnl|my_center|LOCUS_38510 220695 220153 gene locus_tag LOCUS_38520 220695 220153 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872890.1 protein_id gnl|my_center|LOCUS_38520 220803 222854 gene locus_tag LOCUS_38530 220803 222854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 222934 223929 gene locus_tag LOCUS_38540 222934 223929 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974629.1 protein_id gnl|my_center|LOCUS_38540 225077 223950 gene locus_tag LOCUS_38550 225077 223950 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_38550 225240 225785 gene locus_tag LOCUS_38560 225240 225785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 226545 225979 gene locus_tag LOCUS_38570 gene thpR 226545 225979 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029587.1 protein_id gnl|my_center|LOCUS_38570 226480 226701 gene locus_tag LOCUS_38580 226480 226701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 228196 226781 gene locus_tag LOCUS_38590 228196 226781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_38590 228688 228224 gene locus_tag LOCUS_38600 228688 228224 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974639.1 protein_id gnl|my_center|LOCUS_38600 228860 229519 gene locus_tag LOCUS_38610 228860 229519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 231089 229620 gene locus_tag LOCUS_38620 231089 229620 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029586.1 protein_id gnl|my_center|LOCUS_38620 231330 231605 gene locus_tag LOCUS_38630 231330 231605 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029585.1 protein_id gnl|my_center|LOCUS_38630 231662 234109 gene locus_tag LOCUS_38640 231662 234109 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029584.1 protein_id gnl|my_center|LOCUS_38640 234197 234123 gene locus_tag LOCUS_t00480 234197 234123 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 234275 234784 gene locus_tag LOCUS_38650 234275 234784 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708322.1 protein_id gnl|my_center|LOCUS_38650 234932 236119 gene locus_tag LOCUS_38660 234932 236119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 236116 236592 gene locus_tag LOCUS_38670 236116 236592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 237287 236622 gene locus_tag LOCUS_38680 237287 236622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 238344 237844 gene locus_tag LOCUS_38690 238344 237844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 238697 238503 gene locus_tag LOCUS_38700 238697 238503 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814443.1 protein_id gnl|my_center|LOCUS_38700 238977 239171 gene locus_tag LOCUS_38710 238977 239171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 240968 239229 gene locus_tag LOCUS_38720 240968 239229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 241860 241030 gene locus_tag LOCUS_38730 241860 241030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 245222 241953 gene locus_tag LOCUS_38740 245222 241953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029583.1 protein_id gnl|my_center|LOCUS_38740 246271 245372 gene locus_tag LOCUS_38750 246271 245372 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_38750 246641 248017 gene locus_tag LOCUS_38760 246641 248017 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029582.1 protein_id gnl|my_center|LOCUS_38760 248044 248559 gene locus_tag LOCUS_38770 248044 248559 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668749.1 protein_id gnl|my_center|LOCUS_38770 248571 249359 gene locus_tag LOCUS_38780 248571 249359 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_38780 249361 250221 gene locus_tag LOCUS_38790 249361 250221 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_38790 250618 250235 gene locus_tag LOCUS_38800 250618 250235 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_38800 250849 251097 gene locus_tag LOCUS_38810 250849 251097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974651.1 protein_id gnl|my_center|LOCUS_38810 251786 251094 gene locus_tag LOCUS_38820 251786 251094 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029580.1 protein_id gnl|my_center|LOCUS_38820 251924 252955 gene locus_tag LOCUS_38830 251924 252955 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082397.1 protein_id gnl|my_center|LOCUS_38830 252952 254016 gene locus_tag LOCUS_38840 252952 254016 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455028.1 protein_id gnl|my_center|LOCUS_38840 254013 254822 gene locus_tag LOCUS_38850 254013 254822 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 protein_id gnl|my_center|LOCUS_38850 255927 254956 gene locus_tag LOCUS_38860 255927 254956 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029579.1 protein_id gnl|my_center|LOCUS_38860 256071 258524 gene locus_tag LOCUS_38870 256071 258524 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029578.1 protein_id gnl|my_center|LOCUS_38870 259905 258487 gene locus_tag LOCUS_38880 259905 258487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 260882 259938 gene locus_tag LOCUS_38890 gene murQ 260882 259938 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029570.1 protein_id gnl|my_center|LOCUS_38890 261839 260910 gene locus_tag LOCUS_38900 261839 260910 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974666.1 protein_id gnl|my_center|LOCUS_38900 261903 262307 gene locus_tag LOCUS_38910 261903 262307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_38910 262323 262595 gene locus_tag LOCUS_38920 262323 262595 CDS product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974664.1 protein_id gnl|my_center|LOCUS_38920 263235 262585 gene locus_tag LOCUS_38930 263235 262585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974662.1 protein_id gnl|my_center|LOCUS_38930 263263 264015 gene locus_tag LOCUS_38940 263263 264015 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029574.1 protein_id gnl|my_center|LOCUS_38940 266291 264234 gene locus_tag LOCUS_38950 266291 264234 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029575.1 protein_id gnl|my_center|LOCUS_38950 266613 266759 gene locus_tag LOCUS_38960 266613 266759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 268421 266772 gene locus_tag LOCUS_38970 268421 266772 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063651.1 protein_id gnl|my_center|LOCUS_38970 271150 268517 gene locus_tag LOCUS_38980 271150 268517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 272786 271164 gene locus_tag LOCUS_38990 gene groL 272786 271164 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_38990 273341 273138 gene locus_tag LOCUS_39000 273341 273138 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004929928.1 protein_id gnl|my_center|LOCUS_39000 274103 273828 gene locus_tag LOCUS_39010 274103 273828 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974680.1 protein_id gnl|my_center|LOCUS_39010 275462 274167 gene locus_tag LOCUS_39020 gene thrC 275462 274167 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270150.1 protein_id gnl|my_center|LOCUS_39020 275800 276765 gene locus_tag LOCUS_39030 275800 276765 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974682.1 protein_id gnl|my_center|LOCUS_39030 276815 278386 gene locus_tag LOCUS_39040 276815 278386 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029560.1 protein_id gnl|my_center|LOCUS_39040 278672 279433 gene locus_tag LOCUS_39050 278672 279433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 280303 279446 gene locus_tag LOCUS_39060 gene otsB 280303 279446 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029558.1 protein_id gnl|my_center|LOCUS_39060 280637 280365 gene locus_tag LOCUS_39070 280637 280365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 281905 280652 gene locus_tag LOCUS_39080 281905 280652 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136207383.1 protein_id gnl|my_center|LOCUS_39080 282188 283072 gene locus_tag LOCUS_39090 282188 283072 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007446839.1 protein_id gnl|my_center|LOCUS_39090 283459 284424 gene locus_tag LOCUS_39100 283459 284424 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029555.1 protein_id gnl|my_center|LOCUS_39100 284421 285599 gene locus_tag LOCUS_39110 gene nagA 284421 285599 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_39110 285735 286655 gene locus_tag LOCUS_39120 285735 286655 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029553.1 protein_id gnl|my_center|LOCUS_39120 286726 287559 gene locus_tag LOCUS_39130 286726 287559 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030498.1 protein_id gnl|my_center|LOCUS_39130 287724 288212 gene locus_tag LOCUS_39140 287724 288212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 289814 288807 gene locus_tag LOCUS_39150 289814 288807 CDS product CBM35 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029552.1 protein_id gnl|my_center|LOCUS_39150 291756 289960 gene locus_tag LOCUS_39160 gene cdgB 291756 289960 CDS product diguanylate cyclase CdgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029551.1 protein_id gnl|my_center|LOCUS_39160 292122 292715 gene locus_tag LOCUS_39170 292122 292715 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109035270.1 protein_id gnl|my_center|LOCUS_39170 293160 292732 gene locus_tag LOCUS_39180 gene arfB 293160 292732 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974697.1 protein_id gnl|my_center|LOCUS_39180 293369 293944 gene locus_tag LOCUS_39190 293369 293944 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974698.1 protein_id gnl|my_center|LOCUS_39190 294763 294041 gene locus_tag LOCUS_39200 294763 294041 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816000.1 protein_id gnl|my_center|LOCUS_39200 295683 294793 gene locus_tag LOCUS_39210 295683 294793 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223267.1 protein_id gnl|my_center|LOCUS_39210 295828 296256 gene locus_tag LOCUS_39220 295828 296256 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742221.1 protein_id gnl|my_center|LOCUS_39220 297050 296286 gene locus_tag LOCUS_39230 297050 296286 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918580.1 protein_id gnl|my_center|LOCUS_39230 297200 297388 gene locus_tag LOCUS_39240 297200 297388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 297998 297408 gene locus_tag LOCUS_39250 297998 297408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 298224 299846 gene locus_tag LOCUS_39260 298224 299846 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030250.1 protein_id gnl|my_center|LOCUS_39260 299989 300483 gene locus_tag LOCUS_39270 299989 300483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974706.1 protein_id gnl|my_center|LOCUS_39270 300565 301578 gene locus_tag LOCUS_39280 300565 301578 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974709.1 protein_id gnl|my_center|LOCUS_39280 301761 303293 gene locus_tag LOCUS_39290 301761 303293 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029543.1 protein_id gnl|my_center|LOCUS_39290 304428 303322 gene locus_tag LOCUS_39300 304428 303322 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030634.1 protein_id gnl|my_center|LOCUS_39300 304680 306842 gene locus_tag LOCUS_39310 304680 306842 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030524.1 protein_id gnl|my_center|LOCUS_39310 306093 306021 gene locus_tag LOCUS_t00490 306093 306021 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 306993 308153 gene locus_tag LOCUS_39320 306993 308153 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928656.1 protein_id gnl|my_center|LOCUS_39320 308159 308857 gene locus_tag LOCUS_39330 308159 308857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 310112 309816 gene locus_tag LOCUS_39340 310112 309816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 310039 310245 gene locus_tag LOCUS_39350 310039 310245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39350 310389 310314 gene locus_tag LOCUS_t00500 310389 310314 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 310552 311664 gene locus_tag LOCUS_39360 gene msiK 310552 311664 CDS product diacetylchitobiose ABC transporter ATP-binding protein MsiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_39360 311863 312273 gene locus_tag LOCUS_39370 311863 312273 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029526.1 protein_id gnl|my_center|LOCUS_39370 312340 313071 gene locus_tag LOCUS_39380 312340 313071 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974737.1 protein_id gnl|my_center|LOCUS_39380 314796 313243 gene locus_tag LOCUS_39390 314796 313243 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063739108.1 protein_id gnl|my_center|LOCUS_39390 315984 315034 gene locus_tag LOCUS_39400 gene rlmB 315984 315034 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029524.1 protein_id gnl|my_center|LOCUS_39400 317510 316116 gene locus_tag LOCUS_39410 gene cysS 317510 316116 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868385.1 protein_id gnl|my_center|LOCUS_39410 317761 318897 gene locus_tag LOCUS_39420 317761 318897 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39420 319117 320292 gene locus_tag LOCUS_39430 319117 320292 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028897.1 protein_id gnl|my_center|LOCUS_39430 320753 320346 gene locus_tag LOCUS_39440 320753 320346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 321370 320873 gene locus_tag LOCUS_39450 gene ispF 321370 320873 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029522.1 protein_id gnl|my_center|LOCUS_39450 322136 321360 gene locus_tag LOCUS_39460 gene ispD 322136 321360 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029521.1 protein_id gnl|my_center|LOCUS_39460 322938 322456 gene locus_tag LOCUS_39470 322938 322456 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_39470 323521 324207 gene locus_tag LOCUS_39480 323521 324207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 324954 324274 gene locus_tag LOCUS_39490 324954 324274 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_39490 326296 325046 gene locus_tag LOCUS_39500 326296 325046 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_39500 326547 327185 gene locus_tag LOCUS_39510 gene phoU 326547 327185 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974747.1 protein_id gnl|my_center|LOCUS_39510 328323 327499 gene locus_tag LOCUS_39520 328323 327499 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974762.1 protein_id gnl|my_center|LOCUS_39520 328489 328343 gene locus_tag LOCUS_39530 328489 328343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 328494 329678 gene locus_tag LOCUS_39540 328494 329678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_39540 330213 329698 gene locus_tag LOCUS_39550 330213 329698 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974766.1 protein_id gnl|my_center|LOCUS_39550 330435 331769 gene locus_tag LOCUS_39560 330435 331769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976304.1 protein_id gnl|my_center|LOCUS_39560 333153 331792 gene locus_tag LOCUS_39570 gene mshA 333153 331792 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326818.1 protein_id gnl|my_center|LOCUS_39570 334469 333285 gene locus_tag LOCUS_39580 334469 333285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877490.1 protein_id gnl|my_center|LOCUS_39580 334554 335273 gene locus_tag LOCUS_39590 334554 335273 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977010.1 protein_id gnl|my_center|LOCUS_39590 335266 336066 gene locus_tag LOCUS_39600 335266 336066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_39600 336622 336209 gene locus_tag LOCUS_39610 336622 336209 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029461.1 protein_id gnl|my_center|LOCUS_39610 337665 336622 gene locus_tag LOCUS_39620 337665 336622 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487611.1 protein_id gnl|my_center|LOCUS_39620 340081 337721 gene locus_tag LOCUS_39630 340081 337721 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270140.1 protein_id gnl|my_center|LOCUS_39630 341086 340157 gene locus_tag LOCUS_39640 gene mshD 341086 340157 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974818.1 protein_id gnl|my_center|LOCUS_39640 341701 341117 gene locus_tag LOCUS_39650 341701 341117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 342048 343880 gene locus_tag LOCUS_39660 342048 343880 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029468.1 protein_id gnl|my_center|LOCUS_39660 344020 344232 gene locus_tag LOCUS_39670 344020 344232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 344345 344815 gene locus_tag LOCUS_39680 344345 344815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 345048 344890 gene locus_tag LOCUS_39690 345048 344890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 345665 345048 gene locus_tag LOCUS_39700 345665 345048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 345868 346917 gene locus_tag LOCUS_39710 345868 346917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 347195 346968 gene locus_tag LOCUS_39720 347195 346968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 348277 347381 gene locus_tag LOCUS_39730 348277 347381 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 protein_id gnl|my_center|LOCUS_39730 348455 348943 gene locus_tag LOCUS_39740 348455 348943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 349619 348972 gene locus_tag LOCUS_39750 349619 348972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 349960 351231 gene locus_tag LOCUS_39760 349960 351231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 352745 351342 gene locus_tag LOCUS_39770 352745 351342 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029471.1 protein_id gnl|my_center|LOCUS_39770 353479 352742 gene locus_tag LOCUS_39780 353479 352742 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 protein_id gnl|my_center|LOCUS_39780 354546 353554 gene locus_tag LOCUS_39790 354546 353554 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009689.1 protein_id gnl|my_center|LOCUS_39790 355716 354670 gene locus_tag LOCUS_39800 355716 354670 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974813.1 protein_id gnl|my_center|LOCUS_39800 356535 355717 gene locus_tag LOCUS_39810 gene glnR 356535 355717 CDS product two-component system response regulator GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029474.1 protein_id gnl|my_center|LOCUS_39810 359083 357014 gene locus_tag LOCUS_39820 359083 357014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976340.1 protein_id gnl|my_center|LOCUS_39820 360786 359080 gene locus_tag LOCUS_39830 360786 359080 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067016493.1 protein_id gnl|my_center|LOCUS_39830 360926 361252 gene locus_tag LOCUS_39840 360926 361252 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974810.1 protein_id gnl|my_center|LOCUS_39840 361263 362465 gene locus_tag LOCUS_39850 361263 362465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029476.1 protein_id gnl|my_center|LOCUS_39850 362645 363439 gene locus_tag LOCUS_39860 362645 363439 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974808.1 protein_id gnl|my_center|LOCUS_39860 363866 364690 gene locus_tag LOCUS_39870 363866 364690 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_39870 364720 365010 gene locus_tag LOCUS_39880 364720 365010 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_39880 365081 365410 gene locus_tag LOCUS_39890 365081 365410 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326801.1 protein_id gnl|my_center|LOCUS_39890 365793 365422 gene locus_tag LOCUS_39900 365793 365422 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974797.1 protein_id gnl|my_center|LOCUS_39900 366052 366651 gene locus_tag LOCUS_39910 366052 366651 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974791.1 protein_id gnl|my_center|LOCUS_39910 366904 367977 gene locus_tag LOCUS_39920 366904 367977 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_39920 367977 368750 gene locus_tag LOCUS_39930 367977 368750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_39930 368758 369801 gene locus_tag LOCUS_39940 368758 369801 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031519.1 protein_id gnl|my_center|LOCUS_39940 369824 370258 gene locus_tag LOCUS_39950 369824 370258 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_39950 370269 371255 gene locus_tag LOCUS_39960 370269 371255 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_39960 372662 371433 gene locus_tag LOCUS_39970 372662 371433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084375.1 protein_id gnl|my_center|LOCUS_39970 372773 373123 gene locus_tag LOCUS_39980 372773 373123 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267489.1 protein_id gnl|my_center|LOCUS_39980 376266 373012 gene locus_tag LOCUS_39990 376266 373012 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230443.1 protein_id gnl|my_center|LOCUS_39990 376372 377181 gene locus_tag LOCUS_40000 376372 377181 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532931.1 protein_id gnl|my_center|LOCUS_40000 377810 377217 gene locus_tag LOCUS_40010 377810 377217 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224876.1 protein_id gnl|my_center|LOCUS_40010 379205 377952 gene locus_tag LOCUS_40020 379205 377952 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974785.1 protein_id gnl|my_center|LOCUS_40020 380341 379352 gene locus_tag LOCUS_40030 380341 379352 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_40030 381160 380453 gene locus_tag LOCUS_40040 381160 380453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 381244 381678 gene locus_tag LOCUS_40050 gene dtd 381244 381678 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029487.1 protein_id gnl|my_center|LOCUS_40050 382365 381697 gene locus_tag LOCUS_40060 382365 381697 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039544.1 protein_id gnl|my_center|LOCUS_40060 383239 382451 gene locus_tag LOCUS_40070 383239 382451 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122195341.1 protein_id gnl|my_center|LOCUS_40070 383747 383295 gene locus_tag LOCUS_40080 383747 383295 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 protein_id gnl|my_center|LOCUS_40080 384171 383767 gene locus_tag LOCUS_40090 384171 383767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 385044 384202 gene locus_tag LOCUS_40100 385044 384202 CDS product putative protein N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031408.1 protein_id gnl|my_center|LOCUS_40100 386158 385247 gene locus_tag LOCUS_40110 gene cynR 386158 385247 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112831.1 protein_id gnl|my_center|LOCUS_40110 386297 386902 gene locus_tag LOCUS_40120 gene cynT 386297 386902 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107081.1 protein_id gnl|my_center|LOCUS_40120 386973 387443 gene locus_tag LOCUS_40130 gene cynS 386973 387443 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005072180.1 protein_id gnl|my_center|LOCUS_40130 387516 388004 gene locus_tag LOCUS_40140 387516 388004 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112830.1 protein_id gnl|my_center|LOCUS_40140 388082 388522 gene locus_tag LOCUS_40150 388082 388522 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029496.1 protein_id gnl|my_center|LOCUS_40150 388540 389133 gene locus_tag LOCUS_40160 388540 389133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 389233 389583 gene locus_tag LOCUS_40170 389233 389583 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868443.1 protein_id gnl|my_center|LOCUS_40170 390855 389626 gene locus_tag LOCUS_40180 390855 389626 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487464.1 protein_id gnl|my_center|LOCUS_40180 392225 391146 gene locus_tag LOCUS_40190 392225 391146 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029498.1 protein_id gnl|my_center|LOCUS_40190 392568 393701 gene locus_tag LOCUS_40200 gene pstS 392568 393701 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974827.1 protein_id gnl|my_center|LOCUS_40200 394138 393638 gene locus_tag LOCUS_40210 394138 393638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 394020 394865 gene locus_tag LOCUS_40220 gene pstC 394020 394865 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029460.1 protein_id gnl|my_center|LOCUS_40220 394862 395944 gene locus_tag LOCUS_40230 gene pstA 394862 395944 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974829.1 protein_id gnl|my_center|LOCUS_40230 395980 396759 gene locus_tag LOCUS_40240 gene pstB 395980 396759 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974830.1 protein_id gnl|my_center|LOCUS_40240 397951 396953 gene locus_tag LOCUS_40250 gene pitH 397951 396953 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029459.1 protein_id gnl|my_center|LOCUS_40250 398578 397958 gene locus_tag LOCUS_40260 398578 397958 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_40260 398679 399221 gene locus_tag LOCUS_40270 398679 399221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 399428 399207 gene locus_tag LOCUS_40280 399428 399207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 400726 399572 gene locus_tag LOCUS_40290 400726 399572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 400753 400977 gene locus_tag LOCUS_40300 400753 400977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 401796 401080 gene locus_tag LOCUS_40310 401796 401080 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974837.1 protein_id gnl|my_center|LOCUS_40310 403108 402083 gene locus_tag LOCUS_40320 gene tgdA 403108 402083 CDS product transglycosylase TgdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029455.1 protein_id gnl|my_center|LOCUS_40320 404965 403184 gene locus_tag LOCUS_40330 404965 403184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 405196 404984 gene locus_tag LOCUS_40340 405196 404984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 405598 406581 gene locus_tag LOCUS_40350 405598 406581 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973979.1 protein_id gnl|my_center|LOCUS_40350 406590 406781 gene locus_tag LOCUS_40360 406590 406781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 406991 407452 gene locus_tag LOCUS_40370 406991 407452 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230140.1 protein_id gnl|my_center|LOCUS_40370 407590 407994 gene locus_tag LOCUS_40380 407590 407994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 408142 409281 gene locus_tag LOCUS_40390 408142 409281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 409236 409445 gene locus_tag LOCUS_40400 409236 409445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 411066 409555 gene locus_tag LOCUS_40410 411066 409555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 411407 411709 gene locus_tag LOCUS_40420 411407 411709 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974839.1 protein_id gnl|my_center|LOCUS_40420 411926 412792 gene locus_tag LOCUS_40430 411926 412792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029454.1 protein_id gnl|my_center|LOCUS_40430 412782 414200 gene locus_tag LOCUS_40440 412782 414200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668748.1 protein_id gnl|my_center|LOCUS_40440 414197 415756 gene locus_tag LOCUS_40450 414197 415756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326782.1 protein_id gnl|my_center|LOCUS_40450 415767 417200 gene locus_tag LOCUS_40460 415767 417200 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974843.1 protein_id gnl|my_center|LOCUS_40460 417202 418842 gene locus_tag LOCUS_40470 417202 418842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 418909 420333 gene locus_tag LOCUS_40480 418909 420333 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_40480 420373 421359 gene locus_tag LOCUS_40490 420373 421359 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_40490 >Feature sequence06 256 83 gene locus_tag LOCUS_40500 256 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 597 370 gene locus_tag LOCUS_40510 597 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 479 1366 gene locus_tag LOCUS_40520 479 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 1537 2025 gene locus_tag LOCUS_40530 1537 2025 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027944.1 protein_id gnl|my_center|LOCUS_40530 1928 3559 gene locus_tag LOCUS_40540 1928 3559 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_40540 3652 5529 gene locus_tag LOCUS_40550 gene asnB 3652 5529 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223784.1 protein_id gnl|my_center|LOCUS_40550 5601 5975 gene locus_tag LOCUS_40560 5601 5975 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_40560 6145 6561 gene locus_tag LOCUS_40570 6145 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 6940 6572 gene locus_tag LOCUS_40580 6940 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 7439 7044 gene locus_tag LOCUS_40590 7439 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 10859 7530 gene locus_tag LOCUS_40600 10859 7530 CDS product ALF repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030734.1 protein_id gnl|my_center|LOCUS_40600 12292 11162 gene locus_tag LOCUS_40610 12292 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 12424 13791 gene locus_tag LOCUS_40620 12424 13791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 13859 14116 gene locus_tag LOCUS_40630 13859 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 14116 14742 gene locus_tag LOCUS_40640 14116 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 14783 15421 gene locus_tag LOCUS_40650 14783 15421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 19106 15450 gene locus_tag LOCUS_40660 19106 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 19956 19099 gene locus_tag LOCUS_40670 19956 19099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 21086 19953 gene locus_tag LOCUS_40680 21086 19953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 21904 21083 gene locus_tag LOCUS_40690 21904 21083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 23343 22276 gene locus_tag LOCUS_40700 23343 22276 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878505.1 protein_id gnl|my_center|LOCUS_40700 23881 23408 gene locus_tag LOCUS_40710 23881 23408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 24183 24986 gene locus_tag LOCUS_40720 24183 24986 CDS product SGNH family lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977101.1 protein_id gnl|my_center|LOCUS_40720 26688 25027 gene locus_tag LOCUS_40730 26688 25027 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027941.1 protein_id gnl|my_center|LOCUS_40730 26961 27218 gene locus_tag LOCUS_40740 26961 27218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977105.1 protein_id gnl|my_center|LOCUS_40740 28108 27362 gene locus_tag LOCUS_40750 28108 27362 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977110.1 protein_id gnl|my_center|LOCUS_40750 29471 28137 gene locus_tag LOCUS_40760 gene hmgA 29471 28137 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977111.1 protein_id gnl|my_center|LOCUS_40760 30239 29697 gene locus_tag LOCUS_40770 30239 29697 CDS product DUF2165 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974551.1 protein_id gnl|my_center|LOCUS_40770 30416 31048 gene locus_tag LOCUS_40780 30416 31048 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977126.1 protein_id gnl|my_center|LOCUS_40780 31075 31539 gene locus_tag LOCUS_40790 gene soxR 31075 31539 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 protein_id gnl|my_center|LOCUS_40790 32197 31616 gene locus_tag LOCUS_40800 32197 31616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977130.1 protein_id gnl|my_center|LOCUS_40800 33765 32407 gene locus_tag LOCUS_40810 33765 32407 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729636.1 protein_id gnl|my_center|LOCUS_40810 34002 34613 gene locus_tag LOCUS_40820 34002 34613 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 protein_id gnl|my_center|LOCUS_40820 35894 34680 gene locus_tag LOCUS_40830 35894 34680 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027921.1 protein_id gnl|my_center|LOCUS_40830 36928 35900 gene locus_tag LOCUS_40840 36928 35900 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027920.1 protein_id gnl|my_center|LOCUS_40840 37997 37050 gene locus_tag LOCUS_40850 37997 37050 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222332.1 protein_id gnl|my_center|LOCUS_40850 38534 38094 gene locus_tag LOCUS_40860 38534 38094 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028328.1 protein_id gnl|my_center|LOCUS_40860 38685 40184 gene locus_tag LOCUS_40870 38685 40184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728948.1 protein_id gnl|my_center|LOCUS_40870 40217 41140 gene locus_tag LOCUS_40880 40217 41140 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228428.1 protein_id gnl|my_center|LOCUS_40880 41723 41148 gene locus_tag LOCUS_40890 41723 41148 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485846.1 protein_id gnl|my_center|LOCUS_40890 42673 41777 gene locus_tag LOCUS_40900 42673 41777 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977140.1 protein_id gnl|my_center|LOCUS_40900 42986 43975 gene locus_tag LOCUS_40910 42986 43975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977141.1 protein_id gnl|my_center|LOCUS_40910 44068 45597 gene locus_tag LOCUS_40920 44068 45597 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027916.1 protein_id gnl|my_center|LOCUS_40920 46014 45613 gene locus_tag LOCUS_40930 46014 45613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004993226.1 protein_id gnl|my_center|LOCUS_40930 46186 46099 gene locus_tag LOCUS_t00510 46186 46099 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 46381 47715 gene locus_tag LOCUS_40940 46381 47715 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_40940 47873 48106 gene locus_tag LOCUS_40950 gene chpH 47873 48106 CDS product chaplin ChpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977150.1 protein_id gnl|my_center|LOCUS_40950 48264 49148 gene locus_tag LOCUS_40960 gene chpC 48264 49148 CDS product LAXTG-anchored chaplin ChpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027911.1 protein_id gnl|my_center|LOCUS_40960 49416 49228 gene locus_tag LOCUS_40970 49416 49228 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977152.1 protein_id gnl|my_center|LOCUS_40970 49464 50258 gene locus_tag LOCUS_40980 49464 50258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 52651 50348 gene locus_tag LOCUS_40990 52651 50348 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027909.1 protein_id gnl|my_center|LOCUS_40990 53631 52648 gene locus_tag LOCUS_41000 53631 52648 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_41000 53771 54829 gene locus_tag LOCUS_41010 53771 54829 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_41010 55047 55835 gene locus_tag LOCUS_41020 55047 55835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027907.1 protein_id gnl|my_center|LOCUS_41020 56924 55932 gene locus_tag LOCUS_41030 gene corA 56924 55932 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027906.1 protein_id gnl|my_center|LOCUS_41030 56989 57684 gene locus_tag LOCUS_41040 56989 57684 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977159.1 protein_id gnl|my_center|LOCUS_41040 57793 58383 gene locus_tag LOCUS_41050 57793 58383 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_41050 58380 59168 gene locus_tag LOCUS_41060 58380 59168 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270002.1 protein_id gnl|my_center|LOCUS_41060 59212 60528 gene locus_tag LOCUS_41070 gene mshC 59212 60528 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977162.1 protein_id gnl|my_center|LOCUS_41070 60713 62950 gene locus_tag LOCUS_41080 60713 62950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 63104 63766 gene locus_tag LOCUS_41090 63104 63766 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742119.1 protein_id gnl|my_center|LOCUS_41090 63782 64468 gene locus_tag LOCUS_41100 63782 64468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223836.1 protein_id gnl|my_center|LOCUS_41100 64478 65899 gene locus_tag LOCUS_41110 64478 65899 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223835.1 protein_id gnl|my_center|LOCUS_41110 66439 66122 gene locus_tag LOCUS_41120 66439 66122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_41120 66459 67619 gene locus_tag LOCUS_41130 66459 67619 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028668.1 protein_id gnl|my_center|LOCUS_41130 68813 67683 gene locus_tag LOCUS_41140 68813 67683 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029609.1 protein_id gnl|my_center|LOCUS_41140 72405 68899 gene locus_tag LOCUS_41150 gene metH 72405 68899 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027904.1 protein_id gnl|my_center|LOCUS_41150 72708 73472 gene locus_tag LOCUS_41160 72708 73472 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977167.1 protein_id gnl|my_center|LOCUS_41160 73832 74614 gene locus_tag LOCUS_41170 73832 74614 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977166.1 protein_id gnl|my_center|LOCUS_41170 74659 76194 gene locus_tag LOCUS_41180 gene glpK 74659 76194 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977165.1 protein_id gnl|my_center|LOCUS_41180 76197 77804 gene locus_tag LOCUS_41190 76197 77804 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977164.1 protein_id gnl|my_center|LOCUS_41190 77938 79014 gene locus_tag LOCUS_41200 77938 79014 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030060.1 protein_id gnl|my_center|LOCUS_41200 79159 80190 gene locus_tag LOCUS_41210 gene parJ 79159 80190 CDS product filament polymerization regulator ParJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_41210 80381 81070 gene locus_tag LOCUS_41220 80381 81070 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977169.1 protein_id gnl|my_center|LOCUS_41220 81459 83054 gene locus_tag LOCUS_41230 81459 83054 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977170.1 protein_id gnl|my_center|LOCUS_41230 83324 84793 gene locus_tag LOCUS_41240 83324 84793 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325733.1 protein_id gnl|my_center|LOCUS_41240 85553 84882 gene locus_tag LOCUS_41250 85553 84882 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_41250 86507 85569 gene locus_tag LOCUS_41260 86507 85569 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485830.1 protein_id gnl|my_center|LOCUS_41260 86633 87862 gene locus_tag LOCUS_41270 86633 87862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41270 87888 88814 gene locus_tag LOCUS_41280 87888 88814 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_41280 88990 89589 gene locus_tag LOCUS_41290 88990 89589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977175.1 protein_id gnl|my_center|LOCUS_41290 89901 89614 gene locus_tag LOCUS_41300 89901 89614 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977176.1 protein_id gnl|my_center|LOCUS_41300 90144 91910 gene locus_tag LOCUS_41310 gene arc 90144 91910 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_41310 92236 93747 gene locus_tag LOCUS_41320 gene dop 92236 93747 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_41320 93909 94127 gene locus_tag LOCUS_41330 93909 94127 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027899.1 protein_id gnl|my_center|LOCUS_41330 94230 95072 gene locus_tag LOCUS_41340 gene prcB 94230 95072 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_41340 95135 95884 gene locus_tag LOCUS_41350 gene prcA 95135 95884 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027897.1 protein_id gnl|my_center|LOCUS_41350 97080 95986 gene locus_tag LOCUS_41360 97080 95986 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977184.1 protein_id gnl|my_center|LOCUS_41360 97225 98493 gene locus_tag LOCUS_41370 97225 98493 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870809.1 protein_id gnl|my_center|LOCUS_41370 98503 99864 gene locus_tag LOCUS_41380 gene pafA 98503 99864 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977186.1 protein_id gnl|my_center|LOCUS_41380 100012 100992 gene locus_tag LOCUS_41390 100012 100992 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805214.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41390 101056 101430 gene locus_tag LOCUS_41400 101056 101430 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_41400 101547 102536 gene locus_tag LOCUS_41410 101547 102536 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027895.1 protein_id gnl|my_center|LOCUS_41410 102558 103520 gene locus_tag LOCUS_41420 102558 103520 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027894.1 protein_id gnl|my_center|LOCUS_41420 103559 103813 gene locus_tag LOCUS_41430 103559 103813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 103894 104100 gene locus_tag LOCUS_41440 103894 104100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 104316 104600 gene locus_tag LOCUS_41450 gene tatA 104316 104600 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 protein_id gnl|my_center|LOCUS_41450 104663 105580 gene locus_tag LOCUS_41460 gene tatC 104663 105580 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977194.1 protein_id gnl|my_center|LOCUS_41460 105713 108538 gene locus_tag LOCUS_41470 105713 108538 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027893.1 protein_id gnl|my_center|LOCUS_41470 109766 108600 gene locus_tag LOCUS_41480 109766 108600 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225076.1 protein_id gnl|my_center|LOCUS_41480 110590 109901 gene locus_tag LOCUS_41490 110590 109901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 111489 110629 gene locus_tag LOCUS_41500 111489 110629 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977203.1 protein_id gnl|my_center|LOCUS_41500 112503 111583 gene locus_tag LOCUS_41510 112503 111583 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027889.1 protein_id gnl|my_center|LOCUS_41510 112673 113788 gene locus_tag LOCUS_41520 112673 113788 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977205.1 protein_id gnl|my_center|LOCUS_41520 113781 115592 gene locus_tag LOCUS_41530 113781 115592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 115676 116428 gene locus_tag LOCUS_41540 115676 116428 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223098.1 protein_id gnl|my_center|LOCUS_41540 117470 116355 gene locus_tag LOCUS_41550 117470 116355 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 protein_id gnl|my_center|LOCUS_41550 117541 118476 gene locus_tag LOCUS_41560 117541 118476 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977210.1 protein_id gnl|my_center|LOCUS_41560 118739 118587 gene locus_tag LOCUS_41570 118739 118587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 119442 118729 gene locus_tag LOCUS_41580 119442 118729 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027885.1 protein_id gnl|my_center|LOCUS_41580 120893 119469 gene locus_tag LOCUS_41590 gene eat 120893 119469 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727732.1 protein_id gnl|my_center|LOCUS_41590 121758 121012 gene locus_tag LOCUS_41600 121758 121012 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027884.1 protein_id gnl|my_center|LOCUS_41600 121830 123206 gene locus_tag LOCUS_41610 gene glnA4 121830 123206 CDS product gamma-glutamylethanolamide synthetase GlnA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027883.1 protein_id gnl|my_center|LOCUS_41610 123333 124721 gene locus_tag LOCUS_41620 123333 124721 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495124.1 protein_id gnl|my_center|LOCUS_41620 124718 125503 gene locus_tag LOCUS_41630 124718 125503 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977216.1 protein_id gnl|my_center|LOCUS_41630 125631 126905 gene locus_tag LOCUS_41640 125631 126905 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112017.1 protein_id gnl|my_center|LOCUS_41640 127050 128099 gene locus_tag LOCUS_41650 127050 128099 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_41650 129768 128395 gene locus_tag LOCUS_41660 129768 128395 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027880.1 protein_id gnl|my_center|LOCUS_41660 129761 130618 gene locus_tag LOCUS_41670 129761 130618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283992.1 protein_id gnl|my_center|LOCUS_41670 130615 131799 gene locus_tag LOCUS_41680 gene mycP 130615 131799 CDS product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977220.1 protein_id gnl|my_center|LOCUS_41680 131893 132633 gene locus_tag LOCUS_41690 131893 132633 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027875.1 protein_id gnl|my_center|LOCUS_41690 132729 133553 gene locus_tag LOCUS_41700 gene aqpZ 132729 133553 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089853.1 protein_id gnl|my_center|LOCUS_41700 133956 133576 gene locus_tag LOCUS_41710 133956 133576 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977223.1 protein_id gnl|my_center|LOCUS_41710 134157 134939 gene locus_tag LOCUS_41720 134157 134939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 135068 135262 gene locus_tag LOCUS_41730 gene rpmI 135068 135262 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977225.1 protein_id gnl|my_center|LOCUS_41730 135355 135741 gene locus_tag LOCUS_41740 gene rplT 135355 135741 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977226.1 protein_id gnl|my_center|LOCUS_41740 135883 136716 gene locus_tag LOCUS_41750 135883 136716 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_41750 136757 137887 gene locus_tag LOCUS_41760 136757 137887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_41760 138026 139171 gene locus_tag LOCUS_41770 gene pheS 138026 139171 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977229.1 protein_id gnl|my_center|LOCUS_41770 139171 141681 gene locus_tag LOCUS_41780 gene pheT 139171 141681 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027870.1 protein_id gnl|my_center|LOCUS_41780 141955 143139 gene locus_tag LOCUS_41790 141955 143139 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225630519.1 protein_id gnl|my_center|LOCUS_41790 143225 144562 gene locus_tag LOCUS_41800 143225 144562 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027869.1 protein_id gnl|my_center|LOCUS_41800 144620 145150 gene locus_tag LOCUS_41810 144620 145150 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977232.1 protein_id gnl|my_center|LOCUS_41810 145537 145274 gene locus_tag LOCUS_41820 145537 145274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 146543 145686 gene locus_tag LOCUS_41830 146543 145686 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977233.1 protein_id gnl|my_center|LOCUS_41830 146719 147978 gene locus_tag LOCUS_41840 146719 147978 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027868.1 protein_id gnl|my_center|LOCUS_41840 148224 147985 gene locus_tag LOCUS_41850 148224 147985 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977235.1 protein_id gnl|my_center|LOCUS_41850 149182 148268 gene locus_tag LOCUS_41860 149182 148268 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818970.1 protein_id gnl|my_center|LOCUS_41860 150494 149274 gene locus_tag LOCUS_41870 150494 149274 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223986.1 protein_id gnl|my_center|LOCUS_41870 151219 150647 gene locus_tag LOCUS_41880 151219 150647 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971492.1 protein_id gnl|my_center|LOCUS_41880 151253 151849 gene locus_tag LOCUS_41890 151253 151849 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209080.1 protein_id gnl|my_center|LOCUS_41890 151941 152972 gene locus_tag LOCUS_41900 gene argC 151941 152972 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977244.1 protein_id gnl|my_center|LOCUS_41900 152969 153106 gene locus_tag LOCUS_41910 152969 153106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 153103 154254 gene locus_tag LOCUS_41920 gene argJ 153103 154254 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027859.1 protein_id gnl|my_center|LOCUS_41920 154251 155255 gene locus_tag LOCUS_41930 gene argB 154251 155255 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977246.1 protein_id gnl|my_center|LOCUS_41930 155252 156460 gene locus_tag LOCUS_41940 155252 156460 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977247.1 protein_id gnl|my_center|LOCUS_41940 156469 157011 gene locus_tag LOCUS_41950 156469 157011 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_41950 157234 159207 gene locus_tag LOCUS_41960 157234 159207 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083709.1 protein_id gnl|my_center|LOCUS_41960 159246 159172 gene locus_tag LOCUS_t00520 159246 159172 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 159885 159343 gene locus_tag LOCUS_41970 159885 159343 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326184.1 protein_id gnl|my_center|LOCUS_41970 160070 161263 gene locus_tag LOCUS_41980 160070 161263 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776176.1 protein_id gnl|my_center|LOCUS_41980 161303 162736 gene locus_tag LOCUS_41990 gene argH 161303 162736 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027854.1 protein_id gnl|my_center|LOCUS_41990 162872 163351 gene locus_tag LOCUS_42000 162872 163351 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 protein_id gnl|my_center|LOCUS_42000 163348 164901 gene locus_tag LOCUS_42010 163348 164901 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 protein_id gnl|my_center|LOCUS_42010 165122 165946 gene locus_tag LOCUS_42020 165122 165946 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222909.1 protein_id gnl|my_center|LOCUS_42020 166641 165973 gene locus_tag LOCUS_42030 166641 165973 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007447704.1 protein_id gnl|my_center|LOCUS_42030 166864 168042 gene locus_tag LOCUS_42040 166864 168042 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027852.1 protein_id gnl|my_center|LOCUS_42040 168120 168620 gene locus_tag LOCUS_42050 168120 168620 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027851.1 protein_id gnl|my_center|LOCUS_42050 168670 169182 gene locus_tag LOCUS_42060 168670 169182 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977261.1 protein_id gnl|my_center|LOCUS_42060 169663 169202 gene locus_tag LOCUS_42070 169663 169202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977262.1 protein_id gnl|my_center|LOCUS_42070 170024 169665 gene locus_tag LOCUS_42080 170024 169665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977263.1 protein_id gnl|my_center|LOCUS_42080 170494 171543 gene locus_tag LOCUS_42090 170494 171543 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325822.1 protein_id gnl|my_center|LOCUS_42090 171540 172316 gene locus_tag LOCUS_42100 171540 172316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027847.1 protein_id gnl|my_center|LOCUS_42100 172412 173284 gene locus_tag LOCUS_42110 172412 173284 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977267.1 protein_id gnl|my_center|LOCUS_42110 173450 174157 gene locus_tag LOCUS_42120 173450 174157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269997.1 protein_id gnl|my_center|LOCUS_42120 174287 175528 gene locus_tag LOCUS_42130 gene cbiE 174287 175528 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977269.1 protein_id gnl|my_center|LOCUS_42130 175777 180951 gene locus_tag LOCUS_42140 175777 180951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 181055 182290 gene locus_tag LOCUS_42150 gene cobA 181055 182290 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_42150 182350 183168 gene locus_tag LOCUS_42160 182350 183168 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977273.1 protein_id gnl|my_center|LOCUS_42160 184414 183143 gene locus_tag LOCUS_42170 184414 183143 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715246.1 protein_id gnl|my_center|LOCUS_42170 185010 185216 gene locus_tag LOCUS_42180 185010 185216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 185513 185441 gene locus_tag LOCUS_t00530 185513 185441 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 185607 185533 gene locus_tag LOCUS_t00540 185607 185533 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 185700 185628 gene locus_tag LOCUS_t00550 185700 185628 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 185794 185720 gene locus_tag LOCUS_t00560 185794 185720 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 185869 185796 gene locus_tag LOCUS_t00570 185869 185796 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 185977 185904 gene locus_tag LOCUS_t00580 185977 185904 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 186178 187251 gene locus_tag LOCUS_42190 186178 187251 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027841.1 protein_id gnl|my_center|LOCUS_42190 187251 188069 gene locus_tag LOCUS_42200 187251 188069 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_42200 188129 188950 gene locus_tag LOCUS_42210 188129 188950 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485797.1 protein_id gnl|my_center|LOCUS_42210 189534 189028 gene locus_tag LOCUS_42220 189534 189028 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325815.1 protein_id gnl|my_center|LOCUS_42220 189702 190139 gene locus_tag LOCUS_42230 189702 190139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977282.1 protein_id gnl|my_center|LOCUS_42230 190183 190359 gene locus_tag LOCUS_42240 190183 190359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 190914 190381 gene locus_tag LOCUS_42250 190914 190381 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977284.1 protein_id gnl|my_center|LOCUS_42250 191535 191122 gene locus_tag LOCUS_42260 191535 191122 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004002642.1 protein_id gnl|my_center|LOCUS_42260 191727 192158 gene locus_tag LOCUS_42270 191727 192158 CDS product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027839.1 protein_id gnl|my_center|LOCUS_42270 192234 192306 gene locus_tag LOCUS_t00590 192234 192306 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 192339 192857 gene locus_tag LOCUS_42280 192339 192857 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_42280 192919 192991 gene locus_tag LOCUS_t00600 192919 192991 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 193808 193083 gene locus_tag LOCUS_42290 193808 193083 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977293.1 protein_id gnl|my_center|LOCUS_42290 194017 194583 gene locus_tag LOCUS_42300 194017 194583 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977294.1 protein_id gnl|my_center|LOCUS_42300 194583 195749 gene locus_tag LOCUS_42310 194583 195749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027834.1 protein_id gnl|my_center|LOCUS_42310 195852 197831 gene locus_tag LOCUS_42320 gene thrS 195852 197831 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977296.1 protein_id gnl|my_center|LOCUS_42320 197932 198450 gene locus_tag LOCUS_42330 197932 198450 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027833.1 protein_id gnl|my_center|LOCUS_42330 198735 202118 gene locus_tag LOCUS_42340 198735 202118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42340 202115 202453 gene locus_tag LOCUS_42350 202115 202453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 202598 203410 gene locus_tag LOCUS_42360 202598 203410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42360 203659 204696 gene locus_tag LOCUS_42370 203659 204696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225442.1 protein_id gnl|my_center|LOCUS_42370 206435 204768 gene locus_tag LOCUS_42380 206435 204768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027832.1 protein_id gnl|my_center|LOCUS_42380 208814 206607 gene locus_tag LOCUS_42390 208814 206607 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027831.1 protein_id gnl|my_center|LOCUS_42390 209058 209720 gene locus_tag LOCUS_42400 209058 209720 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027830.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42400 209717 210646 gene locus_tag LOCUS_42410 209717 210646 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_42410 210643 211803 gene locus_tag LOCUS_42420 210643 211803 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_42420 212778 212080 gene locus_tag LOCUS_42430 212778 212080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 213010 212828 gene locus_tag LOCUS_42440 213010 212828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 212970 213512 gene locus_tag LOCUS_42450 212970 213512 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_42450 213598 214506 gene locus_tag LOCUS_42460 gene pdxS 213598 214506 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977304.1 protein_id gnl|my_center|LOCUS_42460 214638 215240 gene locus_tag LOCUS_42470 gene pdxT 214638 215240 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_42470 215301 216053 gene locus_tag LOCUS_42480 215301 216053 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977306.1 protein_id gnl|my_center|LOCUS_42480 216184 216735 gene locus_tag LOCUS_42490 gene ruvC 216184 216735 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977307.1 protein_id gnl|my_center|LOCUS_42490 216732 217346 gene locus_tag LOCUS_42500 gene ruvA 216732 217346 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_42500 217378 218541 gene locus_tag LOCUS_42510 gene ruvB 217378 218541 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977309.1 protein_id gnl|my_center|LOCUS_42510 218705 219208 gene locus_tag LOCUS_42520 gene yajC 218705 219208 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027824.1 protein_id gnl|my_center|LOCUS_42520 219357 221186 gene locus_tag LOCUS_42530 gene secD 219357 221186 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027823.1 protein_id gnl|my_center|LOCUS_42530 221188 222312 gene locus_tag LOCUS_42540 gene secF 221188 222312 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977312.1 protein_id gnl|my_center|LOCUS_42540 222309 222857 gene locus_tag LOCUS_42550 222309 222857 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325803.1 protein_id gnl|my_center|LOCUS_42550 223025 225586 gene locus_tag LOCUS_42560 gene relA 223025 225586 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977314.1 protein_id gnl|my_center|LOCUS_42560 226887 225658 gene locus_tag LOCUS_42570 226887 225658 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325802.1 protein_id gnl|my_center|LOCUS_42570 227908 227102 gene locus_tag LOCUS_42580 227908 227102 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977316.1 protein_id gnl|my_center|LOCUS_42580 228097 228804 gene locus_tag LOCUS_42590 228097 228804 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_42590 228816 230078 gene locus_tag LOCUS_42600 gene hisS 228816 230078 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325801.1 protein_id gnl|my_center|LOCUS_42600 230139 230789 gene locus_tag LOCUS_42610 230139 230789 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030871078.1 protein_id gnl|my_center|LOCUS_42610 230875 232224 gene locus_tag LOCUS_42620 230875 232224 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977320.1 protein_id gnl|my_center|LOCUS_42620 232984 232322 gene locus_tag LOCUS_42630 232984 232322 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027363.1 protein_id gnl|my_center|LOCUS_42630 233240 233854 gene locus_tag LOCUS_42640 gene rpsD 233240 233854 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977321.1 protein_id gnl|my_center|LOCUS_42640 234074 234517 gene locus_tag LOCUS_42650 234074 234517 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977323.1 protein_id gnl|my_center|LOCUS_42650 234527 234856 gene locus_tag LOCUS_42660 234527 234856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977324.1 protein_id gnl|my_center|LOCUS_42660 234856 237525 gene locus_tag LOCUS_42670 gene alaS 234856 237525 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977325.1 protein_id gnl|my_center|LOCUS_42670 237527 237991 gene locus_tag LOCUS_42680 gene ruvX 237527 237991 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042825781.1 protein_id gnl|my_center|LOCUS_42680 238116 239882 gene locus_tag LOCUS_42690 gene mltG 238116 239882 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977327.1 protein_id gnl|my_center|LOCUS_42690 239879 240727 gene locus_tag LOCUS_42700 239879 240727 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027816.1 protein_id gnl|my_center|LOCUS_42700 240907 242091 gene locus_tag LOCUS_42710 gene aroC 240907 242091 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977330.1 protein_id gnl|my_center|LOCUS_42710 242088 242624 gene locus_tag LOCUS_42720 242088 242624 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027814.1 protein_id gnl|my_center|LOCUS_42720 242632 243723 gene locus_tag LOCUS_42730 gene aroB 242632 243723 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027813.1 protein_id gnl|my_center|LOCUS_42730 243720 244172 gene locus_tag LOCUS_42740 gene aroQ 243720 244172 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224605.1 protein_id gnl|my_center|LOCUS_42740 244393 245016 gene locus_tag LOCUS_42750 244393 245016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42750 245086 246204 gene locus_tag LOCUS_42760 245086 246204 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977334.1 protein_id gnl|my_center|LOCUS_42760 246255 246821 gene locus_tag LOCUS_42770 gene efp 246255 246821 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977335.1 protein_id gnl|my_center|LOCUS_42770 246824 247258 gene locus_tag LOCUS_42780 gene nusB 246824 247258 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_42780 247836 247336 gene locus_tag LOCUS_42790 gene bldD 247836 247336 CDS product transcriptional regulator BldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977337.1 protein_id gnl|my_center|LOCUS_42790 248060 248629 gene locus_tag LOCUS_42800 gene pyrR 248060 248629 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977338.1 protein_id gnl|my_center|LOCUS_42800 248720 249706 gene locus_tag LOCUS_42810 248720 249706 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027811.1 protein_id gnl|my_center|LOCUS_42810 249709 250995 gene locus_tag LOCUS_42820 249709 250995 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977340.1 protein_id gnl|my_center|LOCUS_42820 250992 251555 gene locus_tag LOCUS_42830 250992 251555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977341.1 protein_id gnl|my_center|LOCUS_42830 251552 252691 gene locus_tag LOCUS_42840 gene carA 251552 252691 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027810.1 protein_id gnl|my_center|LOCUS_42840 252684 255992 gene locus_tag LOCUS_42850 gene carB 252684 255992 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977343.1 protein_id gnl|my_center|LOCUS_42850 256085 257188 gene locus_tag LOCUS_42860 256085 257188 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977344.1 protein_id gnl|my_center|LOCUS_42860 257279 258127 gene locus_tag LOCUS_42870 gene pyrF 257279 258127 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485777.1 protein_id gnl|my_center|LOCUS_42870 258406 258729 gene locus_tag LOCUS_42880 258406 258729 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_42880 258826 259416 gene locus_tag LOCUS_42890 gene gmk 258826 259416 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977347.1 protein_id gnl|my_center|LOCUS_42890 259451 259723 gene locus_tag LOCUS_42900 gene rpoZ 259451 259723 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977348.1 protein_id gnl|my_center|LOCUS_42900 259845 261053 gene locus_tag LOCUS_42910 gene coaBC 259845 261053 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485775.1 protein_id gnl|my_center|LOCUS_42910 261240 262448 gene locus_tag LOCUS_42920 gene metK 261240 262448 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977350.1 protein_id gnl|my_center|LOCUS_42920 263654 262527 gene locus_tag LOCUS_42930 263654 262527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 265653 263698 gene locus_tag LOCUS_42940 265653 263698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 266396 265650 gene locus_tag LOCUS_42950 266396 265650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 267719 266409 gene locus_tag LOCUS_42960 267719 266409 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223469.1 protein_id gnl|my_center|LOCUS_42960 267904 270054 gene locus_tag LOCUS_42970 267904 270054 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027807.1 protein_id gnl|my_center|LOCUS_42970 270875 270285 gene locus_tag LOCUS_42980 270875 270285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027806.1 protein_id gnl|my_center|LOCUS_42980 271026 271961 gene locus_tag LOCUS_42990 gene fmt 271026 271961 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027805.1 protein_id gnl|my_center|LOCUS_42990 272023 273459 gene locus_tag LOCUS_43000 272023 273459 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977354.1 protein_id gnl|my_center|LOCUS_43000 273646 274332 gene locus_tag LOCUS_43010 gene rpe 273646 274332 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977361.1 protein_id gnl|my_center|LOCUS_43010 274552 275541 gene locus_tag LOCUS_43020 274552 275541 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977362.1 protein_id gnl|my_center|LOCUS_43020 275752 277206 gene locus_tag LOCUS_43030 275752 277206 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164279790.1 protein_id gnl|my_center|LOCUS_43030 277541 279223 gene locus_tag LOCUS_43040 277541 279223 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027796.1 protein_id gnl|my_center|LOCUS_43040 279348 279914 gene locus_tag LOCUS_43050 279348 279914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 280011 280466 gene locus_tag LOCUS_43060 280011 280466 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977367.1 protein_id gnl|my_center|LOCUS_43060 281753 280614 gene locus_tag LOCUS_43070 281753 280614 CDS product questin oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484207.1 protein_id gnl|my_center|LOCUS_43070 281806 282297 gene locus_tag LOCUS_43080 281806 282297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 282481 283281 gene locus_tag LOCUS_43090 282481 283281 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027793.1 protein_id gnl|my_center|LOCUS_43090 283340 285046 gene locus_tag LOCUS_43100 283340 285046 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027792.1 protein_id gnl|my_center|LOCUS_43100 285797 285111 gene locus_tag LOCUS_43110 285797 285111 CDS product DUF5995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977373.1 protein_id gnl|my_center|LOCUS_43110 287301 285883 gene locus_tag LOCUS_43120 287301 285883 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977375.1 protein_id gnl|my_center|LOCUS_43120 287537 288262 gene locus_tag LOCUS_43130 287537 288262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 289579 288362 gene locus_tag LOCUS_43140 289579 288362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977377.1 protein_id gnl|my_center|LOCUS_43140 292008 289624 gene locus_tag LOCUS_43150 292008 289624 CDS product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027789.1 protein_id gnl|my_center|LOCUS_43150 292647 293780 gene locus_tag LOCUS_43160 gene ribD 292647 293780 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976111.1 protein_id gnl|my_center|LOCUS_43160 293783 294409 gene locus_tag LOCUS_43170 293783 294409 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_43170 294406 295068 gene locus_tag LOCUS_43180 294406 295068 CDS product nicotinamide mononucleotide transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977383.1 protein_id gnl|my_center|LOCUS_43180 295065 296345 gene locus_tag LOCUS_43190 295065 296345 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977384.1 protein_id gnl|my_center|LOCUS_43190 296375 296860 gene locus_tag LOCUS_43200 gene ribH 296375 296860 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977385.1 protein_id gnl|my_center|LOCUS_43200 296894 297163 gene locus_tag LOCUS_43210 296894 297163 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027788.1 protein_id gnl|my_center|LOCUS_43210 297228 298076 gene locus_tag LOCUS_43220 gene hisG 297228 298076 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977387.1 protein_id gnl|my_center|LOCUS_43220 298136 298600 gene locus_tag LOCUS_43230 298136 298600 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977388.1 protein_id gnl|my_center|LOCUS_43230 298827 300182 gene locus_tag LOCUS_43240 298827 300182 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977389.1 protein_id gnl|my_center|LOCUS_43240 300179 301258 gene locus_tag LOCUS_43250 300179 301258 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977390.1 protein_id gnl|my_center|LOCUS_43250 303328 301421 gene locus_tag LOCUS_43260 303328 301421 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027787.1 protein_id gnl|my_center|LOCUS_43260 304454 303861 gene locus_tag LOCUS_43270 304454 303861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 304642 306009 gene locus_tag LOCUS_43280 304642 306009 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495115.1 protein_id gnl|my_center|LOCUS_43280 306487 306215 gene locus_tag LOCUS_43290 306487 306215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 306390 306614 gene locus_tag LOCUS_43300 306390 306614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 306635 308887 gene locus_tag LOCUS_43310 gene rmdA 306635 308887 CDS product cyclic Di-GMP phosphodiesterase RmdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027451.1 protein_id gnl|my_center|LOCUS_43310 309354 308926 gene locus_tag LOCUS_43320 309354 308926 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027643.1 protein_id gnl|my_center|LOCUS_43320 311929 309497 gene locus_tag LOCUS_43330 311929 309497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43330 312903 312154 gene locus_tag LOCUS_43340 312903 312154 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028613.1 protein_id gnl|my_center|LOCUS_43340 313624 312923 gene locus_tag LOCUS_43350 313624 312923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 314806 316416 gene locus_tag LOCUS_43360 314806 316416 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031038.1 protein_id gnl|my_center|LOCUS_43360 317441 316485 gene locus_tag LOCUS_43370 317441 316485 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727741.1 protein_id gnl|my_center|LOCUS_43370 317566 318168 gene locus_tag LOCUS_43380 317566 318168 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947468.1 protein_id gnl|my_center|LOCUS_43380 318866 318441 gene locus_tag LOCUS_43390 318866 318441 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977188.1 protein_id gnl|my_center|LOCUS_43390 320385 319135 gene locus_tag LOCUS_43400 320385 319135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 322090 320567 gene locus_tag LOCUS_43410 322090 320567 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027628.1 protein_id gnl|my_center|LOCUS_43410 323421 322159 gene locus_tag LOCUS_43420 323421 322159 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027627.1 protein_id gnl|my_center|LOCUS_43420 323645 323911 gene locus_tag LOCUS_43430 323645 323911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 324217 324981 gene locus_tag LOCUS_43440 324217 324981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027403.1 protein_id gnl|my_center|LOCUS_43440 325105 325431 gene locus_tag LOCUS_43450 325105 325431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 325424 326023 gene locus_tag LOCUS_43460 325424 326023 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027402.1 protein_id gnl|my_center|LOCUS_43460 326609 326106 gene locus_tag LOCUS_43470 326609 326106 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978000.1 protein_id gnl|my_center|LOCUS_43470 328948 326606 gene locus_tag LOCUS_43480 328948 326606 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027397.1 protein_id gnl|my_center|LOCUS_43480 329163 328948 gene locus_tag LOCUS_43490 329163 328948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 329394 330710 gene locus_tag LOCUS_43500 329394 330710 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_43500 330707 331660 gene locus_tag LOCUS_43510 gene pvcA 330707 331660 CDS product paerucumarin biosynthesis protein PvcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113733.1 protein_id gnl|my_center|LOCUS_43510 331737 332198 gene locus_tag LOCUS_43520 331737 332198 CDS product spore-associated protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978456.1 protein_id gnl|my_center|LOCUS_43520 333258 332266 gene locus_tag LOCUS_43530 333258 332266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 334274 333477 gene locus_tag LOCUS_43540 334274 333477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851039.1 protein_id gnl|my_center|LOCUS_43540 335344 334271 gene locus_tag LOCUS_43550 335344 334271 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031517.1 protein_id gnl|my_center|LOCUS_43550 336388 335345 gene locus_tag LOCUS_43560 336388 335345 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_43560 336552 337295 gene locus_tag LOCUS_43570 336552 337295 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_43570 338485 337304 gene locus_tag LOCUS_43580 338485 337304 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030542.1 protein_id gnl|my_center|LOCUS_43580 339669 338575 gene locus_tag LOCUS_43590 339669 338575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 341385 339748 gene locus_tag LOCUS_43600 341385 339748 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728731.1 protein_id gnl|my_center|LOCUS_43600 341578 342771 gene locus_tag LOCUS_43610 341578 342771 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228776.1 protein_id gnl|my_center|LOCUS_43610 342959 344182 gene locus_tag LOCUS_43620 342959 344182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 344850 344260 gene locus_tag LOCUS_43630 344850 344260 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 protein_id gnl|my_center|LOCUS_43630 346315 344873 gene locus_tag LOCUS_43640 346315 344873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 347573 346335 gene locus_tag LOCUS_43650 347573 346335 CDS product alanine-phosphoribitol ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973676.1 protein_id gnl|my_center|LOCUS_43650 347995 347570 gene locus_tag LOCUS_43660 347995 347570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 348315 347995 gene locus_tag LOCUS_43670 348315 347995 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103070.1 protein_id gnl|my_center|LOCUS_43670 349064 348372 gene locus_tag LOCUS_43680 349064 348372 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_43680 350206 349070 gene locus_tag LOCUS_43690 350206 349070 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_43690 350662 350285 gene locus_tag LOCUS_43700 350662 350285 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403190.1 protein_id gnl|my_center|LOCUS_43700 350918 350649 gene locus_tag LOCUS_43710 350918 350649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 352415 350925 gene locus_tag LOCUS_43720 352415 350925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 352837 352412 gene locus_tag LOCUS_43730 352837 352412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 353271 354104 gene locus_tag LOCUS_43740 353271 354104 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728730.1 protein_id gnl|my_center|LOCUS_43740 355421 354174 gene locus_tag LOCUS_43750 355421 354174 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027783.1 protein_id gnl|my_center|LOCUS_43750 355719 356891 gene locus_tag LOCUS_43760 355719 356891 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027782.1 protein_id gnl|my_center|LOCUS_43760 358174 356972 gene locus_tag LOCUS_43770 358174 356972 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065102.1 protein_id gnl|my_center|LOCUS_43770 358682 358260 gene locus_tag LOCUS_43780 358682 358260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 358828 359271 gene locus_tag LOCUS_43790 358828 359271 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019983923.1 protein_id gnl|my_center|LOCUS_43790 359327 360955 gene locus_tag LOCUS_43800 359327 360955 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866976.1 protein_id gnl|my_center|LOCUS_43800 361456 363105 gene locus_tag LOCUS_43810 gene lnt 361456 363105 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027519.1 protein_id gnl|my_center|LOCUS_43810 363114 363890 gene locus_tag LOCUS_43820 363114 363890 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_43820 363970 364560 gene locus_tag LOCUS_43830 363970 364560 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977403.1 protein_id gnl|my_center|LOCUS_43830 365103 364729 gene locus_tag LOCUS_43840 365103 364729 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977404.1 protein_id gnl|my_center|LOCUS_43840 366065 365361 gene locus_tag LOCUS_43850 366065 365361 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_43850 366168 367673 gene locus_tag LOCUS_43860 366168 367673 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977408.1 protein_id gnl|my_center|LOCUS_43860 369219 367693 gene locus_tag LOCUS_43870 369219 367693 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027776.1 protein_id gnl|my_center|LOCUS_43870 369432 369238 gene locus_tag LOCUS_43880 369432 369238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977410.1 protein_id gnl|my_center|LOCUS_43880 369537 369953 gene locus_tag LOCUS_43890 369537 369953 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325767.1 protein_id gnl|my_center|LOCUS_43890 371581 370052 gene locus_tag LOCUS_43900 371581 370052 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027650.1 protein_id gnl|my_center|LOCUS_43900 373018 371618 gene locus_tag LOCUS_43910 373018 371618 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189283896.1 protein_id gnl|my_center|LOCUS_43910 374451 373066 gene locus_tag LOCUS_43920 374451 373066 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973593.1 protein_id gnl|my_center|LOCUS_43920 375157 374480 gene locus_tag LOCUS_43930 375157 374480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230358.1 protein_id gnl|my_center|LOCUS_43930 375328 375741 gene locus_tag LOCUS_43940 375328 375741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 377304 375883 gene locus_tag LOCUS_43950 377304 375883 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_43950 379023 377479 gene locus_tag LOCUS_43960 gene mdlC 379023 377479 CDS product benzoylformate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099962.1 protein_id gnl|my_center|LOCUS_43960 379248 379487 gene locus_tag LOCUS_43970 379248 379487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 380036 379551 gene locus_tag LOCUS_43980 380036 379551 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_43980 380192 380335 gene locus_tag LOCUS_43990 380192 380335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 380398 381621 gene locus_tag LOCUS_44000 380398 381621 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742121.1 protein_id gnl|my_center|LOCUS_44000 382555 381692 gene locus_tag LOCUS_44010 382555 381692 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046421936.1 protein_id gnl|my_center|LOCUS_44010 383202 382552 gene locus_tag LOCUS_44020 383202 382552 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027119.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44020 383957 383199 gene locus_tag LOCUS_44030 383957 383199 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027118.1 protein_id gnl|my_center|LOCUS_44030 384607 383954 gene locus_tag LOCUS_44040 384607 383954 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230108.1 protein_id gnl|my_center|LOCUS_44040 384775 385473 gene locus_tag LOCUS_44050 384775 385473 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027117.1 protein_id gnl|my_center|LOCUS_44050 385470 386438 gene locus_tag LOCUS_44060 385470 386438 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978427.1 protein_id gnl|my_center|LOCUS_44060 386557 388122 gene locus_tag LOCUS_44070 386557 388122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977417.1 protein_id gnl|my_center|LOCUS_44070 388409 389302 gene locus_tag LOCUS_44080 388409 389302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027772.1 protein_id gnl|my_center|LOCUS_44080 388504 388426 gene locus_tag LOCUS_t00610 388504 388426 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 389357 394039 gene locus_tag LOCUS_44090 389357 394039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224660.1 protein_id gnl|my_center|LOCUS_44090 394458 394075 gene locus_tag LOCUS_44100 394458 394075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44100 394734 396992 gene locus_tag LOCUS_44110 394734 396992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 396989 397450 gene locus_tag LOCUS_44120 396989 397450 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977425.1 protein_id gnl|my_center|LOCUS_44120 397459 397989 gene locus_tag LOCUS_44130 397459 397989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 398133 398741 gene locus_tag LOCUS_44140 398133 398741 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977427.1 protein_id gnl|my_center|LOCUS_44140 399534 398749 gene locus_tag LOCUS_44150 399534 398749 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 protein_id gnl|my_center|LOCUS_44150 401960 399636 gene locus_tag LOCUS_44160 401960 399636 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027761.1 protein_id gnl|my_center|LOCUS_44160 402208 404214 gene locus_tag LOCUS_44170 402208 404214 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027760.1 protein_id gnl|my_center|LOCUS_44170 404293 405171 gene locus_tag LOCUS_44180 404293 405171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977433.1 protein_id gnl|my_center|LOCUS_44180 406913 405243 gene locus_tag LOCUS_44190 gene ptsP 406913 405243 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977434.1 protein_id gnl|my_center|LOCUS_44190 407468 407019 gene locus_tag LOCUS_44200 407468 407019 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977435.1 protein_id gnl|my_center|LOCUS_44200 >Feature sequence07 939 319 gene locus_tag LOCUS_44210 939 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975789.1 protein_id gnl|my_center|LOCUS_44210 2484 1030 gene locus_tag LOCUS_44220 gene ahcY 2484 1030 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_44220 2858 4954 gene locus_tag LOCUS_44230 2858 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44230 6153 5209 gene locus_tag LOCUS_44240 6153 5209 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 protein_id gnl|my_center|LOCUS_44240 7469 6258 gene locus_tag LOCUS_44250 gene manA 7469 6258 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_44250 8744 7572 gene locus_tag LOCUS_44260 8744 7572 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975785.1 protein_id gnl|my_center|LOCUS_44260 9034 8849 gene locus_tag LOCUS_44270 9034 8849 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975784.1 protein_id gnl|my_center|LOCUS_44270 10518 9160 gene locus_tag LOCUS_44280 10518 9160 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_44280 11055 10615 gene locus_tag LOCUS_44290 11055 10615 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975781.1 protein_id gnl|my_center|LOCUS_44290 11422 11823 gene locus_tag LOCUS_44300 11422 11823 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063628643.1 protein_id gnl|my_center|LOCUS_44300 13427 11838 gene locus_tag LOCUS_44310 13427 11838 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028724.1 protein_id gnl|my_center|LOCUS_44310 17095 13424 gene locus_tag LOCUS_44320 17095 13424 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028725.1 protein_id gnl|my_center|LOCUS_44320 17641 17378 gene locus_tag LOCUS_44330 17641 17378 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975777.1 protein_id gnl|my_center|LOCUS_44330 18380 18886 gene locus_tag LOCUS_44340 18380 18886 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028726.1 protein_id gnl|my_center|LOCUS_44340 18945 19916 gene locus_tag LOCUS_44350 gene cofD 18945 19916 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975775.1 protein_id gnl|my_center|LOCUS_44350 19913 21232 gene locus_tag LOCUS_44360 19913 21232 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028727.1 protein_id gnl|my_center|LOCUS_44360 22294 21386 gene locus_tag LOCUS_44370 22294 21386 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028728.1 protein_id gnl|my_center|LOCUS_44370 23416 22334 gene locus_tag LOCUS_44380 23416 22334 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_44380 25041 23500 gene locus_tag LOCUS_44390 25041 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44390 25181 25933 gene locus_tag LOCUS_44400 25181 25933 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975771.1 protein_id gnl|my_center|LOCUS_44400 26087 27493 gene locus_tag LOCUS_44410 26087 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 27784 29547 gene locus_tag LOCUS_44420 27784 29547 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518416.1 protein_id gnl|my_center|LOCUS_44420 29645 31384 gene locus_tag LOCUS_44430 29645 31384 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486662.1 protein_id gnl|my_center|LOCUS_44430 32390 31422 gene locus_tag LOCUS_44440 32390 31422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 32364 32669 gene locus_tag LOCUS_44450 32364 32669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 32666 34162 gene locus_tag LOCUS_44460 32666 34162 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326400.1 protein_id gnl|my_center|LOCUS_44460 34791 34177 gene locus_tag LOCUS_44470 34791 34177 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873063.1 protein_id gnl|my_center|LOCUS_44470 34867 36168 gene locus_tag LOCUS_44480 34867 36168 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284299.1 protein_id gnl|my_center|LOCUS_44480 36978 36184 gene locus_tag LOCUS_44490 36978 36184 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403012.1 protein_id gnl|my_center|LOCUS_44490 38275 37118 gene locus_tag LOCUS_44500 38275 37118 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975760.1 protein_id gnl|my_center|LOCUS_44500 38493 39833 gene locus_tag LOCUS_44510 38493 39833 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975759.1 protein_id gnl|my_center|LOCUS_44510 41071 39884 gene locus_tag LOCUS_44520 41071 39884 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_44520 41609 41076 gene locus_tag LOCUS_44530 gene purE 41609 41076 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975752.1 protein_id gnl|my_center|LOCUS_44530 42745 41606 gene locus_tag LOCUS_44540 42745 41606 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975751.1 protein_id gnl|my_center|LOCUS_44540 42914 43441 gene locus_tag LOCUS_44550 42914 43441 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028743.1 protein_id gnl|my_center|LOCUS_44550 44711 43467 gene locus_tag LOCUS_44560 gene draK 44711 43467 CDS product two-component system sensor histidine kinase DraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028744.1 protein_id gnl|my_center|LOCUS_44560 45402 44722 gene locus_tag LOCUS_44570 45402 44722 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975748.1 protein_id gnl|my_center|LOCUS_44570 45873 47408 gene locus_tag LOCUS_44580 45873 47408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975747.1 protein_id gnl|my_center|LOCUS_44580 48496 47492 gene locus_tag LOCUS_44590 48496 47492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 49359 48493 gene locus_tag LOCUS_44600 49359 48493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 49337 49525 gene locus_tag LOCUS_44610 49337 49525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 50408 49497 gene locus_tag LOCUS_44620 50408 49497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 51025 50531 gene locus_tag LOCUS_44630 51025 50531 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028746.1 protein_id gnl|my_center|LOCUS_44630 51531 51163 gene locus_tag LOCUS_44640 51531 51163 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975744.1 protein_id gnl|my_center|LOCUS_44640 51790 52734 gene locus_tag LOCUS_44650 51790 52734 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975743.1 protein_id gnl|my_center|LOCUS_44650 52977 53342 gene locus_tag LOCUS_44660 52977 53342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 54397 53780 gene locus_tag LOCUS_44670 54397 53780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 55658 54492 gene locus_tag LOCUS_44680 gene hutI 55658 54492 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028748.1 protein_id gnl|my_center|LOCUS_44680 57013 55679 gene locus_tag LOCUS_44690 57013 55679 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_44690 58248 57004 gene locus_tag LOCUS_44700 58248 57004 CDS product allantoate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028750.1 protein_id gnl|my_center|LOCUS_44700 59948 58371 gene locus_tag LOCUS_44710 59948 58371 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028751.1 protein_id gnl|my_center|LOCUS_44710 60210 61598 gene locus_tag LOCUS_44720 60210 61598 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 protein_id gnl|my_center|LOCUS_44720 62196 61582 gene locus_tag LOCUS_44730 62196 61582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 62429 63757 gene locus_tag LOCUS_44740 62429 63757 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029609.1 protein_id gnl|my_center|LOCUS_44740 64775 63924 gene locus_tag LOCUS_44750 64775 63924 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028753.1 protein_id gnl|my_center|LOCUS_44750 66214 64853 gene locus_tag LOCUS_44760 66214 64853 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730326.1 protein_id gnl|my_center|LOCUS_44760 66323 66853 gene locus_tag LOCUS_44770 66323 66853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469765.1 protein_id gnl|my_center|LOCUS_44770 68604 67207 gene locus_tag LOCUS_44780 68604 67207 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028755.1 protein_id gnl|my_center|LOCUS_44780 68819 69883 gene locus_tag LOCUS_44790 68819 69883 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975733.1 protein_id gnl|my_center|LOCUS_44790 69923 71143 gene locus_tag LOCUS_44800 69923 71143 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975732.1 protein_id gnl|my_center|LOCUS_44800 71495 72295 gene locus_tag LOCUS_44810 71495 72295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028756.1 protein_id gnl|my_center|LOCUS_44810 72734 72417 gene locus_tag LOCUS_44820 72734 72417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975730.1 protein_id gnl|my_center|LOCUS_44820 72842 73072 gene locus_tag LOCUS_44830 72842 73072 CDS product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975729.1 protein_id gnl|my_center|LOCUS_44830 74051 73161 gene locus_tag LOCUS_44840 74051 73161 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_44840 74353 74270 gene locus_tag LOCUS_t00620 74353 74270 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 74781 75566 gene locus_tag LOCUS_44850 74781 75566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_44850 75603 78122 gene locus_tag LOCUS_44860 75603 78122 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_44860 79512 78199 gene locus_tag LOCUS_44870 79512 78199 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028761.1 protein_id gnl|my_center|LOCUS_44870 81070 79694 gene locus_tag LOCUS_44880 81070 79694 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486678.1 protein_id gnl|my_center|LOCUS_44880 81526 81843 gene locus_tag LOCUS_44890 81526 81843 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028253.1 protein_id gnl|my_center|LOCUS_44890 82157 81939 gene locus_tag LOCUS_44900 82157 81939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 83026 82154 gene locus_tag LOCUS_44910 83026 82154 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_44910 83251 83601 gene locus_tag LOCUS_44920 83251 83601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 84005 84157 gene locus_tag LOCUS_44930 84005 84157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 84154 85455 gene locus_tag LOCUS_44940 84154 85455 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222361.1 protein_id gnl|my_center|LOCUS_44940 86542 85391 gene locus_tag LOCUS_44950 86542 85391 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226073.1 protein_id gnl|my_center|LOCUS_44950 87589 86648 gene locus_tag LOCUS_44960 87589 86648 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_44960 88122 87586 gene locus_tag LOCUS_44970 88122 87586 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028762.1 protein_id gnl|my_center|LOCUS_44970 88639 88169 gene locus_tag LOCUS_44980 gene divIC 88639 88169 CDS product cell division protein DivIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975716.1 protein_id gnl|my_center|LOCUS_44980 90063 88783 gene locus_tag LOCUS_44990 gene eno 90063 88783 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975715.1 protein_id gnl|my_center|LOCUS_44990 91085 90336 gene locus_tag LOCUS_45000 gene rpfA 91085 90336 CDS product resuscitation-promoting factor protein RpfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028764.1 protein_id gnl|my_center|LOCUS_45000 92553 91534 gene locus_tag LOCUS_45010 gene rpfC 92553 91534 CDS product resuscitation-promoting factor protein RpfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028765.1 protein_id gnl|my_center|LOCUS_45010 93994 92723 gene locus_tag LOCUS_45020 93994 92723 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975712.1 protein_id gnl|my_center|LOCUS_45020 94527 94096 gene locus_tag LOCUS_45030 94527 94096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45030 95643 94603 gene locus_tag LOCUS_45040 95643 94603 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975711.1 protein_id gnl|my_center|LOCUS_45040 96347 95742 gene locus_tag LOCUS_45050 96347 95742 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975710.1 protein_id gnl|my_center|LOCUS_45050 96672 98126 gene locus_tag LOCUS_45060 96672 98126 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230373.1 protein_id gnl|my_center|LOCUS_45060 101750 98220 gene locus_tag LOCUS_45070 gene mfd 101750 98220 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028772.1 protein_id gnl|my_center|LOCUS_45070 104788 102218 gene locus_tag LOCUS_45080 104788 102218 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028773.1 protein_id gnl|my_center|LOCUS_45080 105573 104785 gene locus_tag LOCUS_45090 105573 104785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028774.1 protein_id gnl|my_center|LOCUS_45090 106034 107848 gene locus_tag LOCUS_45100 106034 107848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 108734 107910 gene locus_tag LOCUS_45110 108734 107910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028777.1 protein_id gnl|my_center|LOCUS_45110 111651 108985 gene locus_tag LOCUS_45120 111651 108985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45120 112637 111645 gene locus_tag LOCUS_45130 112637 111645 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028779.1 protein_id gnl|my_center|LOCUS_45130 112970 113500 gene locus_tag LOCUS_45140 112970 113500 CDS product YwqJ-related putative deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028780.1 protein_id gnl|my_center|LOCUS_45140 113510 114016 gene locus_tag LOCUS_45150 113510 114016 CDS product SUKH-3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975695.1 protein_id gnl|my_center|LOCUS_45150 115385 114075 gene locus_tag LOCUS_45160 115385 114075 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975694.1 protein_id gnl|my_center|LOCUS_45160 115598 116329 gene locus_tag LOCUS_45170 115598 116329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 116341 116413 gene locus_tag LOCUS_t00630 116341 116413 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 116522 117979 gene locus_tag LOCUS_45180 gene glmU 116522 117979 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_45180 118053 119030 gene locus_tag LOCUS_45190 118053 119030 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975691.1 protein_id gnl|my_center|LOCUS_45190 119250 119537 gene locus_tag LOCUS_45200 119250 119537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 119633 120229 gene locus_tag LOCUS_45210 gene pth 119633 120229 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975689.1 protein_id gnl|my_center|LOCUS_45210 123019 120293 gene locus_tag LOCUS_45220 gene ppc 123019 120293 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975687.1 protein_id gnl|my_center|LOCUS_45220 123222 124223 gene locus_tag LOCUS_45230 123222 124223 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_45230 124220 124915 gene locus_tag LOCUS_45240 124220 124915 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975684.1 protein_id gnl|my_center|LOCUS_45240 125924 125100 gene locus_tag LOCUS_45250 125924 125100 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028784.1 protein_id gnl|my_center|LOCUS_45250 125981 126478 gene locus_tag LOCUS_45260 gene tamR 125981 126478 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_45260 127225 126437 gene locus_tag LOCUS_45270 127225 126437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326434.1 protein_id gnl|my_center|LOCUS_45270 128824 127673 gene locus_tag LOCUS_45280 gene galK 128824 127673 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_45280 129807 128821 gene locus_tag LOCUS_45290 gene galE 129807 128821 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975676.1 protein_id gnl|my_center|LOCUS_45290 130850 129804 gene locus_tag LOCUS_45300 gene galT 130850 129804 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028787.1 protein_id gnl|my_center|LOCUS_45300 130947 132602 gene locus_tag LOCUS_45310 130947 132602 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_45310 132660 132899 gene locus_tag LOCUS_45320 132660 132899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 133587 132838 gene locus_tag LOCUS_45330 133587 132838 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028791.1 protein_id gnl|my_center|LOCUS_45330 135804 133825 gene locus_tag LOCUS_45340 135804 133825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 137790 135988 gene locus_tag LOCUS_45350 137790 135988 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_45350 139463 137877 gene locus_tag LOCUS_45360 139463 137877 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929101.1 protein_id gnl|my_center|LOCUS_45360 140415 139501 gene locus_tag LOCUS_45370 140415 139501 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028794.1 protein_id gnl|my_center|LOCUS_45370 141302 140412 gene locus_tag LOCUS_45380 gene rsmA 141302 140412 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_45380 143191 141299 gene locus_tag LOCUS_45390 143191 141299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 144193 143285 gene locus_tag LOCUS_45400 144193 143285 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_45400 144689 144243 gene locus_tag LOCUS_45410 144689 144243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028797.1 protein_id gnl|my_center|LOCUS_45410 145727 144876 gene locus_tag LOCUS_45420 gene rsmI 145727 144876 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975663.1 protein_id gnl|my_center|LOCUS_45420 146214 145762 gene locus_tag LOCUS_45430 146214 145762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 147158 146307 gene locus_tag LOCUS_45440 147158 146307 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028804.1 protein_id gnl|my_center|LOCUS_45440 148949 147303 gene locus_tag LOCUS_45450 148949 147303 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010985034.1 protein_id gnl|my_center|LOCUS_45450 150757 149105 gene locus_tag LOCUS_45460 150757 149105 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486701.1 protein_id gnl|my_center|LOCUS_45460 151796 150981 gene locus_tag LOCUS_45470 151796 150981 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_45470 151899 152879 gene locus_tag LOCUS_45480 151899 152879 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029244.1 protein_id gnl|my_center|LOCUS_45480 152881 153234 gene locus_tag LOCUS_45490 152881 153234 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222521.1 protein_id gnl|my_center|LOCUS_45490 154038 153172 gene locus_tag LOCUS_45500 154038 153172 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027324.1 protein_id gnl|my_center|LOCUS_45500 155224 154049 gene locus_tag LOCUS_45510 155224 154049 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 protein_id gnl|my_center|LOCUS_45510 156097 155321 gene locus_tag LOCUS_45520 156097 155321 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_45520 156858 156094 gene locus_tag LOCUS_45530 gene cbiQ 156858 156094 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_45530 157903 156860 gene locus_tag LOCUS_45540 157903 156860 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028801.1 protein_id gnl|my_center|LOCUS_45540 158211 159362 gene locus_tag LOCUS_45550 158211 159362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45550 160558 159359 gene locus_tag LOCUS_45560 160558 159359 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_45560 163058 160863 gene locus_tag LOCUS_45570 163058 160863 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028805.1 protein_id gnl|my_center|LOCUS_45570 163768 163169 gene locus_tag LOCUS_45580 163768 163169 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975649.1 protein_id gnl|my_center|LOCUS_45580 163918 167178 gene locus_tag LOCUS_45590 163918 167178 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486705.1 protein_id gnl|my_center|LOCUS_45590 167424 167236 gene locus_tag LOCUS_45600 167424 167236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 168423 167503 gene locus_tag LOCUS_45610 168423 167503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028807.1 protein_id gnl|my_center|LOCUS_45610 169940 168420 gene locus_tag LOCUS_45620 169940 168420 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_45620 170093 170803 gene locus_tag LOCUS_45630 170093 170803 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975643.1 protein_id gnl|my_center|LOCUS_45630 172037 171366 gene locus_tag LOCUS_45640 172037 171366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 172976 172182 gene locus_tag LOCUS_45650 172976 172182 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456342.1 protein_id gnl|my_center|LOCUS_45650 173043 173543 gene locus_tag LOCUS_45660 173043 173543 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975641.1 protein_id gnl|my_center|LOCUS_45660 174211 173711 gene locus_tag LOCUS_45670 174211 173711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 175514 174249 gene locus_tag LOCUS_45680 175514 174249 CDS product histidine kinase dimerization/phospho-acceptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030163.1 protein_id gnl|my_center|LOCUS_45680 176021 175554 gene locus_tag LOCUS_45690 176021 175554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 176368 178545 gene locus_tag LOCUS_45700 176368 178545 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202102.1 protein_id gnl|my_center|LOCUS_45700 180158 178695 gene locus_tag LOCUS_45710 180158 178695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 183701 180435 gene locus_tag LOCUS_45720 183701 180435 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221979.1 protein_id gnl|my_center|LOCUS_45720 183949 185553 gene locus_tag LOCUS_45730 183949 185553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030790.1 protein_id gnl|my_center|LOCUS_45730 185687 187000 gene locus_tag LOCUS_45740 185687 187000 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030788.1 protein_id gnl|my_center|LOCUS_45740 187051 187896 gene locus_tag LOCUS_45750 187051 187896 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 protein_id gnl|my_center|LOCUS_45750 187960 188727 gene locus_tag LOCUS_45760 187960 188727 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972643.1 protein_id gnl|my_center|LOCUS_45760 190415 188796 gene locus_tag LOCUS_45770 190415 188796 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030784.1 protein_id gnl|my_center|LOCUS_45770 190812 190738 gene locus_tag LOCUS_t00640 190812 190738 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 192009 190906 gene locus_tag LOCUS_45780 192009 190906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975639.1 protein_id gnl|my_center|LOCUS_45780 192806 192156 gene locus_tag LOCUS_45790 192806 192156 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_45790 193363 192803 gene locus_tag LOCUS_45800 193363 192803 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_45800 193854 193360 gene locus_tag LOCUS_45810 gene moaC 193854 193360 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 protein_id gnl|my_center|LOCUS_45810 195231 193909 gene locus_tag LOCUS_45820 195231 193909 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486735.1 protein_id gnl|my_center|LOCUS_45820 196138 195236 gene locus_tag LOCUS_45830 gene galU 196138 195236 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975635.1 protein_id gnl|my_center|LOCUS_45830 196219 196821 gene locus_tag LOCUS_45840 196219 196821 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028815.1 protein_id gnl|my_center|LOCUS_45840 199779 196831 gene locus_tag LOCUS_45850 199779 196831 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_45850 200119 201630 gene locus_tag LOCUS_45860 200119 201630 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_45860 201892 203172 gene locus_tag LOCUS_45870 201892 203172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975631.1 protein_id gnl|my_center|LOCUS_45870 203573 203394 gene locus_tag LOCUS_45880 203573 203394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 203647 204552 gene locus_tag LOCUS_45890 203647 204552 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_45890 204961 205449 gene locus_tag LOCUS_45900 gene mscL 204961 205449 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975627.1 protein_id gnl|my_center|LOCUS_45900 205726 205535 gene locus_tag LOCUS_45910 205726 205535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975626.1 protein_id gnl|my_center|LOCUS_45910 205894 207120 gene locus_tag LOCUS_45920 205894 207120 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326457.1 protein_id gnl|my_center|LOCUS_45920 207159 208286 gene locus_tag LOCUS_45930 207159 208286 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028819.1 protein_id gnl|my_center|LOCUS_45930 209874 208330 gene locus_tag LOCUS_45940 209874 208330 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_45940 209992 210960 gene locus_tag LOCUS_45950 209992 210960 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028824.1 protein_id gnl|my_center|LOCUS_45950 212074 211070 gene locus_tag LOCUS_45960 212074 211070 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975615.1 protein_id gnl|my_center|LOCUS_45960 212525 212959 gene locus_tag LOCUS_45970 212525 212959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 213081 214124 gene locus_tag LOCUS_45980 213081 214124 CDS product questin oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484207.1 protein_id gnl|my_center|LOCUS_45980 216178 214181 gene locus_tag LOCUS_45990 gene recQ 216178 214181 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029740.1 protein_id gnl|my_center|LOCUS_45990 218348 216297 gene locus_tag LOCUS_46000 218348 216297 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190850422.1 protein_id gnl|my_center|LOCUS_46000 219043 218459 gene locus_tag LOCUS_46010 219043 218459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 221239 219155 gene locus_tag LOCUS_46020 221239 219155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 223035 221353 gene locus_tag LOCUS_46030 223035 221353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46030 223919 223191 gene locus_tag LOCUS_46040 223919 223191 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978487.1 protein_id gnl|my_center|LOCUS_46040 224106 224033 gene locus_tag LOCUS_t00650 224106 224033 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 225537 224218 gene locus_tag LOCUS_46050 225537 224218 CDS product M6 family metalloprotease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975609.1 protein_id gnl|my_center|LOCUS_46050 225816 225607 gene locus_tag LOCUS_46060 225816 225607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 225809 226519 gene locus_tag LOCUS_46070 225809 226519 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227485.1 protein_id gnl|my_center|LOCUS_46070 226595 228100 gene locus_tag LOCUS_46080 226595 228100 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975611.1 protein_id gnl|my_center|LOCUS_46080 228726 228205 gene locus_tag LOCUS_46090 228726 228205 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_46090 228854 229639 gene locus_tag LOCUS_46100 228854 229639 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975613.1 protein_id gnl|my_center|LOCUS_46100 229742 230608 gene locus_tag LOCUS_46110 229742 230608 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868402.1 protein_id gnl|my_center|LOCUS_46110 231193 230612 gene locus_tag LOCUS_46120 231193 230612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46120 231336 231878 gene locus_tag LOCUS_46130 231336 231878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46130 232142 231912 gene locus_tag LOCUS_46140 232142 231912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 233008 232139 gene locus_tag LOCUS_46150 233008 232139 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224344.1 protein_id gnl|my_center|LOCUS_46150 233267 233491 gene locus_tag LOCUS_46160 233267 233491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46160 233488 233715 gene locus_tag LOCUS_46170 233488 233715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 234604 233750 gene locus_tag LOCUS_46180 234604 233750 CDS product class F sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976324.1 protein_id gnl|my_center|LOCUS_46180 235189 234626 gene locus_tag LOCUS_46190 235189 234626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028375.1 protein_id gnl|my_center|LOCUS_46190 237394 235466 gene locus_tag LOCUS_46200 237394 235466 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029653.1 protein_id gnl|my_center|LOCUS_46200 240058 237587 gene locus_tag LOCUS_46210 240058 237587 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284555.1 protein_id gnl|my_center|LOCUS_46210 240319 241101 gene locus_tag LOCUS_46220 240319 241101 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974541.1 protein_id gnl|my_center|LOCUS_46220 241516 242424 gene locus_tag LOCUS_46230 241516 242424 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029655.1 protein_id gnl|my_center|LOCUS_46230 242663 242866 gene locus_tag LOCUS_46240 242663 242866 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974539.1 protein_id gnl|my_center|LOCUS_46240 244162 243014 gene locus_tag LOCUS_46250 244162 243014 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974547.1 protein_id gnl|my_center|LOCUS_46250 245580 244339 gene locus_tag LOCUS_46260 245580 244339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 248318 245670 gene locus_tag LOCUS_46270 248318 245670 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029648.1 protein_id gnl|my_center|LOCUS_46270 249299 248442 gene locus_tag LOCUS_46280 249299 248442 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031039612.1 protein_id gnl|my_center|LOCUS_46280 249563 251089 gene locus_tag LOCUS_46290 249563 251089 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_46290 251246 251719 gene locus_tag LOCUS_46300 251246 251719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 253297 251744 gene locus_tag LOCUS_46310 253297 251744 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727782.1 protein_id gnl|my_center|LOCUS_46310 255313 253538 gene locus_tag LOCUS_46320 255313 253538 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_46320 256527 255388 gene locus_tag LOCUS_46330 256527 255388 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_46330 257628 256699 gene locus_tag LOCUS_46340 257628 256699 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_46340 257765 257953 gene locus_tag LOCUS_46350 257765 257953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 258095 261025 gene locus_tag LOCUS_46360 gene afsR 258095 261025 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_46360 261417 261680 gene locus_tag LOCUS_46370 261417 261680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46370 262050 261637 gene locus_tag LOCUS_46380 262050 261637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 262267 262728 gene locus_tag LOCUS_46390 262267 262728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 264875 262968 gene locus_tag LOCUS_46400 264875 262968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 265002 266153 gene locus_tag LOCUS_46410 265002 266153 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730955.1 protein_id gnl|my_center|LOCUS_46410 266160 266624 gene locus_tag LOCUS_46420 266160 266624 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812328.1 protein_id gnl|my_center|LOCUS_46420 266621 267388 gene locus_tag LOCUS_46430 266621 267388 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 protein_id gnl|my_center|LOCUS_46430 270000 267484 gene locus_tag LOCUS_46440 270000 267484 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029643.1 protein_id gnl|my_center|LOCUS_46440 270971 270222 gene locus_tag LOCUS_46450 270971 270222 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031563.1 protein_id gnl|my_center|LOCUS_46450 271339 271986 gene locus_tag LOCUS_46460 271339 271986 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974562.1 protein_id gnl|my_center|LOCUS_46460 272689 272204 gene locus_tag LOCUS_46470 272689 272204 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_46470 273954 272689 gene locus_tag LOCUS_46480 273954 272689 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 protein_id gnl|my_center|LOCUS_46480 274053 275225 gene locus_tag LOCUS_46490 274053 275225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930997.1 protein_id gnl|my_center|LOCUS_46490 275710 275243 gene locus_tag LOCUS_46500 275710 275243 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_46500 275834 278059 gene locus_tag LOCUS_46510 275834 278059 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086230.1 protein_id gnl|my_center|LOCUS_46510 278133 279008 gene locus_tag LOCUS_46520 gene paaG 278133 279008 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_46520 279094 279744 gene locus_tag LOCUS_46530 279094 279744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 280807 279776 gene locus_tag LOCUS_46540 280807 279776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46540 282044 280971 gene locus_tag LOCUS_46550 282044 280971 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727442.1 protein_id gnl|my_center|LOCUS_46550 283535 282072 gene locus_tag LOCUS_46560 283535 282072 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889386.1 protein_id gnl|my_center|LOCUS_46560 284719 283532 gene locus_tag LOCUS_46570 284719 283532 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225242.1 protein_id gnl|my_center|LOCUS_46570 285664 284753 gene locus_tag LOCUS_46580 285664 284753 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_46580 285787 286713 gene locus_tag LOCUS_46590 285787 286713 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_46590 287449 286970 gene locus_tag LOCUS_46600 287449 286970 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_46600 288916 287873 gene locus_tag LOCUS_46610 288916 287873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 290095 288926 gene locus_tag LOCUS_46620 290095 288926 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_46620 291330 290101 gene locus_tag LOCUS_46630 291330 290101 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_46630 291463 293058 gene locus_tag LOCUS_46640 291463 293058 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 protein_id gnl|my_center|LOCUS_46640 295739 293118 gene locus_tag LOCUS_46650 295739 293118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 297632 296067 gene locus_tag LOCUS_46660 297632 296067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 299646 297940 gene locus_tag LOCUS_46670 299646 297940 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974200.1 protein_id gnl|my_center|LOCUS_46670 299963 301240 gene locus_tag LOCUS_46680 299963 301240 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974201.1 protein_id gnl|my_center|LOCUS_46680 302377 301283 gene locus_tag LOCUS_46690 302377 301283 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_46690 303626 302499 gene locus_tag LOCUS_46700 303626 302499 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_46700 305250 303748 gene locus_tag LOCUS_46710 gene guaB 305250 303748 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974203.1 protein_id gnl|my_center|LOCUS_46710 306151 305384 gene locus_tag LOCUS_46720 306151 305384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 306961 306350 gene locus_tag LOCUS_46730 306961 306350 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948568.1 protein_id gnl|my_center|LOCUS_46730 307369 307695 gene locus_tag LOCUS_46740 307369 307695 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974205.1 protein_id gnl|my_center|LOCUS_46740 308743 307820 gene locus_tag LOCUS_46750 308743 307820 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029852.1 protein_id gnl|my_center|LOCUS_46750 308812 309600 gene locus_tag LOCUS_46760 308812 309600 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284363.1 protein_id gnl|my_center|LOCUS_46760 309597 310370 gene locus_tag LOCUS_46770 309597 310370 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_46770 312093 310471 gene locus_tag LOCUS_46780 gene groL 312093 310471 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974210.1 protein_id gnl|my_center|LOCUS_46780 312521 312213 gene locus_tag LOCUS_46790 gene groES 312521 312213 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974211.1 protein_id gnl|my_center|LOCUS_46790 313649 312774 gene locus_tag LOCUS_46800 313649 312774 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486593.1 protein_id gnl|my_center|LOCUS_46800 313746 314948 gene locus_tag LOCUS_46810 313746 314948 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_46810 316128 314971 gene locus_tag LOCUS_46820 gene tsaD 316128 314971 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029841.1 protein_id gnl|my_center|LOCUS_46820 316666 316112 gene locus_tag LOCUS_46830 gene rimI 316666 316112 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029840.1 protein_id gnl|my_center|LOCUS_46830 317331 316663 gene locus_tag LOCUS_46840 gene tsaB 317331 316663 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_46840 317580 318170 gene locus_tag LOCUS_46850 317580 318170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974224.1 protein_id gnl|my_center|LOCUS_46850 318391 318176 gene locus_tag LOCUS_46860 318391 318176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46860 319028 318492 gene locus_tag LOCUS_46870 gene tsaE 319028 318492 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029837.1 protein_id gnl|my_center|LOCUS_46870 320408 319146 gene locus_tag LOCUS_46880 320408 319146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327056.1 protein_id gnl|my_center|LOCUS_46880 321567 320380 gene locus_tag LOCUS_46890 gene alr 321567 320380 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029835.1 protein_id gnl|my_center|LOCUS_46890 321824 323245 gene locus_tag LOCUS_46900 321824 323245 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029833.1 protein_id gnl|my_center|LOCUS_46900 325829 323271 gene locus_tag LOCUS_46910 325829 323271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 326892 325939 gene locus_tag LOCUS_46920 326892 325939 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226103.1 protein_id gnl|my_center|LOCUS_46920 327020 327643 gene locus_tag LOCUS_46930 327020 327643 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971926.1 protein_id gnl|my_center|LOCUS_46930 328163 327795 gene locus_tag LOCUS_46940 328163 327795 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_46940 330013 328160 gene locus_tag LOCUS_46950 gene glmS 330013 328160 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974233.1 protein_id gnl|my_center|LOCUS_46950 330351 330052 gene locus_tag LOCUS_46960 330351 330052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 330604 331584 gene locus_tag LOCUS_46970 gene coaA 330604 331584 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974235.1 protein_id gnl|my_center|LOCUS_46970 333003 331645 gene locus_tag LOCUS_46980 gene glmM 333003 331645 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974237.1 protein_id gnl|my_center|LOCUS_46980 333749 333246 gene locus_tag LOCUS_46990 gene rpsI 333749 333246 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974238.1 protein_id gnl|my_center|LOCUS_46990 334236 333790 gene locus_tag LOCUS_47000 gene rplM 334236 333790 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974239.1 protein_id gnl|my_center|LOCUS_47000 336097 334487 gene locus_tag LOCUS_47010 336097 334487 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030975.1 protein_id gnl|my_center|LOCUS_47010 336348 337319 gene locus_tag LOCUS_47020 336348 337319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029828.1 protein_id gnl|my_center|LOCUS_47020 338123 337344 gene locus_tag LOCUS_47030 338123 337344 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029831.1 protein_id gnl|my_center|LOCUS_47030 338367 340469 gene locus_tag LOCUS_47040 338367 340469 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972899.1 protein_id gnl|my_center|LOCUS_47040 341459 340605 gene locus_tag LOCUS_47050 gene truA 341459 340605 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_47050 341998 341534 gene locus_tag LOCUS_47060 341998 341534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 343165 342143 gene locus_tag LOCUS_47070 343165 342143 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003966937.1 protein_id gnl|my_center|LOCUS_47070 343731 343327 gene locus_tag LOCUS_47080 gene rpsK 343731 343327 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_47080 344183 343803 gene locus_tag LOCUS_47090 gene rpsM 344183 343803 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974244.1 protein_id gnl|my_center|LOCUS_47090 344768 344547 gene locus_tag LOCUS_47100 gene infA 344768 344547 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_47100 345790 344954 gene locus_tag LOCUS_47110 gene map 345790 344954 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029827.1 protein_id gnl|my_center|LOCUS_47110 346566 345910 gene locus_tag LOCUS_47120 346566 345910 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029826.1 protein_id gnl|my_center|LOCUS_47120 347879 346566 gene locus_tag LOCUS_47130 gene secY 347879 346566 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974248.1 protein_id gnl|my_center|LOCUS_47130 348540 348085 gene locus_tag LOCUS_47140 gene rplO 348540 348085 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974249.1 protein_id gnl|my_center|LOCUS_47140 348724 348542 gene locus_tag LOCUS_47150 gene rpmD 348724 348542 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_47150 349326 348724 gene locus_tag LOCUS_47160 gene rpsE 349326 348724 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974251.1 protein_id gnl|my_center|LOCUS_47160 349756 349373 gene locus_tag LOCUS_47170 gene rplR 349756 349373 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_47170 350299 349760 gene locus_tag LOCUS_47180 gene rplF 350299 349760 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974253.1 protein_id gnl|my_center|LOCUS_47180 350719 350321 gene locus_tag LOCUS_47190 gene rpsH 350719 350321 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974254.1 protein_id gnl|my_center|LOCUS_47190 351124 350930 gene locus_tag LOCUS_47200 351124 350930 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948630.1 protein_id gnl|my_center|LOCUS_47200 351672 351121 gene locus_tag LOCUS_47210 gene rplE 351672 351121 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974255.1 protein_id gnl|my_center|LOCUS_47210 351983 351672 gene locus_tag LOCUS_47220 gene rplX 351983 351672 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974256.1 protein_id gnl|my_center|LOCUS_47220 352355 351987 gene locus_tag LOCUS_47230 gene rplN 352355 351987 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_47230 352740 352459 gene locus_tag LOCUS_47240 gene rpsQ 352740 352459 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_47240 352964 352740 gene locus_tag LOCUS_47250 gene rpmC 352964 352740 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974259.1 protein_id gnl|my_center|LOCUS_47250 353383 352964 gene locus_tag LOCUS_47260 gene rplP 353383 352964 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974260.1 protein_id gnl|my_center|LOCUS_47260 354207 353389 gene locus_tag LOCUS_47270 gene rpsC 354207 353389 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974261.1 protein_id gnl|my_center|LOCUS_47270 354554 354207 gene locus_tag LOCUS_47280 gene rplV 354554 354207 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_47280 354879 354598 gene locus_tag LOCUS_47290 gene rpsS 354879 354598 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974263.1 protein_id gnl|my_center|LOCUS_47290 355728 354892 gene locus_tag LOCUS_47300 gene rplB 355728 354892 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974264.1 protein_id gnl|my_center|LOCUS_47300 356091 355768 gene locus_tag LOCUS_47310 gene rplW 356091 355768 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974265.1 protein_id gnl|my_center|LOCUS_47310 356741 356091 gene locus_tag LOCUS_47320 gene rplD 356741 356091 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974266.1 protein_id gnl|my_center|LOCUS_47320 357406 356750 gene locus_tag LOCUS_47330 gene rplC 357406 356750 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974267.1 protein_id gnl|my_center|LOCUS_47330 357716 357408 gene locus_tag LOCUS_47340 gene rpsJ 357716 357408 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_47340 358313 360448 gene locus_tag LOCUS_47350 358313 360448 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030601.1 protein_id gnl|my_center|LOCUS_47350 360542 361546 gene locus_tag LOCUS_47360 360542 361546 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229227.1 protein_id gnl|my_center|LOCUS_47360 361564 362424 gene locus_tag LOCUS_47370 361564 362424 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_47370 <363314 362517 gene locus_tag LOCUS_47380 <363314 362517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029795.1:elongation factor Tu >Feature sequence08 1086 253 gene locus_tag LOCUS_47390 1086 253 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977030.1 protein_id gnl|my_center|LOCUS_47390 974 1756 gene locus_tag LOCUS_47400 974 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 2248 1820 gene locus_tag LOCUS_47410 2248 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47410 2670 2245 gene locus_tag LOCUS_47420 2670 2245 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194152.1 protein_id gnl|my_center|LOCUS_47420 2723 3337 gene locus_tag LOCUS_47430 2723 3337 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977028.1 protein_id gnl|my_center|LOCUS_47430 4413 3646 gene locus_tag LOCUS_47440 4413 3646 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943926.1 protein_id gnl|my_center|LOCUS_47440 5475 4528 gene locus_tag LOCUS_47450 5475 4528 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_47450 6038 5625 gene locus_tag LOCUS_47460 6038 5625 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977025.1 protein_id gnl|my_center|LOCUS_47460 6922 6113 gene locus_tag LOCUS_47470 6922 6113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977024.1 protein_id gnl|my_center|LOCUS_47470 7162 7821 gene locus_tag LOCUS_47480 7162 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027983.1 protein_id gnl|my_center|LOCUS_47480 8246 7899 gene locus_tag LOCUS_47490 8246 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 8693 8448 gene locus_tag LOCUS_47500 8693 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47500 9521 8871 gene locus_tag LOCUS_47510 9521 8871 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007388333.1 protein_id gnl|my_center|LOCUS_47510 10662 9514 gene locus_tag LOCUS_47520 10662 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 10819 11466 gene locus_tag LOCUS_47530 10819 11466 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_47530 11841 12551 gene locus_tag LOCUS_47540 11841 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 15117 12631 gene locus_tag LOCUS_47550 15117 12631 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_47550 15413 17182 gene locus_tag LOCUS_47560 15413 17182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 17278 18510 gene locus_tag LOCUS_47570 gene serB 17278 18510 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977014.1 protein_id gnl|my_center|LOCUS_47570 19051 18533 gene locus_tag LOCUS_47580 19051 18533 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977013.1 protein_id gnl|my_center|LOCUS_47580 19380 19141 gene locus_tag LOCUS_47590 19380 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 19685 19563 gene locus_tag LOCUS_47600 19685 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47600 20040 19720 gene locus_tag LOCUS_47610 20040 19720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 21029 20268 gene locus_tag LOCUS_47620 gene fabI 21029 20268 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977009.1 protein_id gnl|my_center|LOCUS_47620 21739 21035 gene locus_tag LOCUS_47630 gene fabG 21739 21035 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977008.1 protein_id gnl|my_center|LOCUS_47630 22717 21878 gene locus_tag LOCUS_47640 22717 21878 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027366.1 protein_id gnl|my_center|LOCUS_47640 23046 22831 gene locus_tag LOCUS_47650 23046 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47650 23151 24077 gene locus_tag LOCUS_47660 23151 24077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 24214 25740 gene locus_tag LOCUS_47670 24214 25740 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110223.1 protein_id gnl|my_center|LOCUS_47670 25737 27140 gene locus_tag LOCUS_47680 25737 27140 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_47680 27206 28606 gene locus_tag LOCUS_47690 gene tyrS 27206 28606 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_47690 28982 28701 gene locus_tag LOCUS_47700 28982 28701 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977004.1 protein_id gnl|my_center|LOCUS_47700 29203 29586 gene locus_tag LOCUS_47710 29203 29586 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486044.1 protein_id gnl|my_center|LOCUS_47710 29795 30043 gene locus_tag LOCUS_47720 29795 30043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 31048 30059 gene locus_tag LOCUS_47730 gene moaA 31048 30059 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106977887.1 protein_id gnl|my_center|LOCUS_47730 32819 31170 gene locus_tag LOCUS_47740 32819 31170 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977000.1 protein_id gnl|my_center|LOCUS_47740 33205 32816 gene locus_tag LOCUS_47750 33205 32816 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976999.1 protein_id gnl|my_center|LOCUS_47750 33484 35034 gene locus_tag LOCUS_47760 33484 35034 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027994.1 protein_id gnl|my_center|LOCUS_47760 35741 34989 gene locus_tag LOCUS_47770 35741 34989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 36619 35738 gene locus_tag LOCUS_47780 36619 35738 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224651.1 protein_id gnl|my_center|LOCUS_47780 36849 39578 gene locus_tag LOCUS_47790 36849 39578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027393.1 protein_id gnl|my_center|LOCUS_47790 39640 40644 gene locus_tag LOCUS_47800 39640 40644 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027997.1 protein_id gnl|my_center|LOCUS_47800 40703 41527 gene locus_tag LOCUS_47810 40703 41527 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872966.1 protein_id gnl|my_center|LOCUS_47810 41558 43342 gene locus_tag LOCUS_47820 41558 43342 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027999.1 protein_id gnl|my_center|LOCUS_47820 43371 44102 gene locus_tag LOCUS_47830 43371 44102 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976991.1 protein_id gnl|my_center|LOCUS_47830 44407 44171 gene locus_tag LOCUS_47840 44407 44171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976975.1 protein_id gnl|my_center|LOCUS_47840 45678 44434 gene locus_tag LOCUS_47850 gene pitH 45678 44434 CDS product low-affinity phosphate transporter PitH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976976.1 protein_id gnl|my_center|LOCUS_47850 45791 46465 gene locus_tag LOCUS_47860 45791 46465 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028005.1 protein_id gnl|my_center|LOCUS_47860 46508 47659 gene locus_tag LOCUS_47870 46508 47659 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976978.1 protein_id gnl|my_center|LOCUS_47870 47761 49206 gene locus_tag LOCUS_47880 47761 49206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976980.1 protein_id gnl|my_center|LOCUS_47880 49745 49314 gene locus_tag LOCUS_47890 49745 49314 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872956.1 protein_id gnl|my_center|LOCUS_47890 50658 49768 gene locus_tag LOCUS_47900 50658 49768 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222195.1 protein_id gnl|my_center|LOCUS_47900 50896 52494 gene locus_tag LOCUS_47910 50896 52494 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_47910 52960 52532 gene locus_tag LOCUS_47920 52960 52532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 52863 53084 gene locus_tag LOCUS_47930 52863 53084 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976983.1 protein_id gnl|my_center|LOCUS_47930 53159 53992 gene locus_tag LOCUS_47940 53159 53992 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_47940 54117 54593 gene locus_tag LOCUS_47950 54117 54593 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976986.1 protein_id gnl|my_center|LOCUS_47950 54604 54804 gene locus_tag LOCUS_47960 54604 54804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976987.1 protein_id gnl|my_center|LOCUS_47960 54808 55164 gene locus_tag LOCUS_47970 54808 55164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976988.1 protein_id gnl|my_center|LOCUS_47970 55161 55778 gene locus_tag LOCUS_47980 55161 55778 CDS product DUF6286 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486046.1 protein_id gnl|my_center|LOCUS_47980 55843 56439 gene locus_tag LOCUS_47990 gene amaP 55843 56439 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028000.1 protein_id gnl|my_center|LOCUS_47990 56744 57706 gene locus_tag LOCUS_48000 56744 57706 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028006.1 protein_id gnl|my_center|LOCUS_48000 57703 59289 gene locus_tag LOCUS_48010 57703 59289 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028007.1 protein_id gnl|my_center|LOCUS_48010 59289 61418 gene locus_tag LOCUS_48020 59289 61418 CDS product putative cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976970.1 protein_id gnl|my_center|LOCUS_48020 61418 62017 gene locus_tag LOCUS_48030 gene cobO 61418 62017 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976969.1 protein_id gnl|my_center|LOCUS_48030 62014 63381 gene locus_tag LOCUS_48040 62014 63381 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028009.1 protein_id gnl|my_center|LOCUS_48040 63378 63758 gene locus_tag LOCUS_48050 63378 63758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48050 63850 64956 gene locus_tag LOCUS_48060 gene cobC 63850 64956 CDS product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897661.1 protein_id gnl|my_center|LOCUS_48060 65979 65005 gene locus_tag LOCUS_48070 65979 65005 CDS product SCO1860 family LAETG-anchored protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486091.1 protein_id gnl|my_center|LOCUS_48070 65885 66073 gene locus_tag LOCUS_48080 65885 66073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48080 67314 66214 gene locus_tag LOCUS_48090 67314 66214 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_48090 67372 68661 gene locus_tag LOCUS_48100 67372 68661 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224708.1 protein_id gnl|my_center|LOCUS_48100 68658 69326 gene locus_tag LOCUS_48110 68658 69326 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032008.1 protein_id gnl|my_center|LOCUS_48110 70638 69457 gene locus_tag LOCUS_48120 70638 69457 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229381.1 protein_id gnl|my_center|LOCUS_48120 70760 71938 gene locus_tag LOCUS_48130 70760 71938 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028040.1 protein_id gnl|my_center|LOCUS_48130 72959 71886 gene locus_tag LOCUS_48140 72959 71886 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027444.1 protein_id gnl|my_center|LOCUS_48140 74511 73033 gene locus_tag LOCUS_48150 74511 73033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976912.1 protein_id gnl|my_center|LOCUS_48150 74797 76626 gene locus_tag LOCUS_48160 74797 76626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 76724 77620 gene locus_tag LOCUS_48170 gene dapA 76724 77620 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943917.1 protein_id gnl|my_center|LOCUS_48170 78659 77670 gene locus_tag LOCUS_48180 gene dapD 78659 77670 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_48180 78877 80109 gene locus_tag LOCUS_48190 78877 80109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48190 80124 81149 gene locus_tag LOCUS_48200 80124 81149 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091679.1 protein_id gnl|my_center|LOCUS_48200 81555 81190 gene locus_tag LOCUS_48210 81555 81190 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057839.1 protein_id gnl|my_center|LOCUS_48210 82025 81552 gene locus_tag LOCUS_48220 82025 81552 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976899.1 protein_id gnl|my_center|LOCUS_48220 83297 82038 gene locus_tag LOCUS_48230 83297 82038 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_48230 84058 83294 gene locus_tag LOCUS_48240 gene sufC 84058 83294 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976897.1 protein_id gnl|my_center|LOCUS_48240 84386 84066 gene locus_tag LOCUS_48250 84386 84066 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_48250 85564 84383 gene locus_tag LOCUS_48260 gene sufD 85564 84383 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976895.1 protein_id gnl|my_center|LOCUS_48260 87045 85624 gene locus_tag LOCUS_48270 gene sufB 87045 85624 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_48270 87842 87042 gene locus_tag LOCUS_48280 87842 87042 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976893.1 protein_id gnl|my_center|LOCUS_48280 87980 88906 gene locus_tag LOCUS_48290 87980 88906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_48290 88903 89691 gene locus_tag LOCUS_48300 88903 89691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976890.1 protein_id gnl|my_center|LOCUS_48300 89756 90745 gene locus_tag LOCUS_48310 89756 90745 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897656.1 protein_id gnl|my_center|LOCUS_48310 91779 90718 gene locus_tag LOCUS_48320 91779 90718 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028051.1 protein_id gnl|my_center|LOCUS_48320 92216 91857 gene locus_tag LOCUS_48330 92216 91857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534985.1 protein_id gnl|my_center|LOCUS_48330 93250 92309 gene locus_tag LOCUS_48340 93250 92309 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976885.1 protein_id gnl|my_center|LOCUS_48340 93706 95787 gene locus_tag LOCUS_48350 gene tkt 93706 95787 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976883.1 protein_id gnl|my_center|LOCUS_48350 95825 96940 gene locus_tag LOCUS_48360 gene tal 95825 96940 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976882.1 protein_id gnl|my_center|LOCUS_48360 96942 98465 gene locus_tag LOCUS_48370 gene zwf 96942 98465 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976881.1 protein_id gnl|my_center|LOCUS_48370 98462 99517 gene locus_tag LOCUS_48380 gene opcA 98462 99517 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976880.1 protein_id gnl|my_center|LOCUS_48380 99514 100293 gene locus_tag LOCUS_48390 gene pgl 99514 100293 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976879.1 protein_id gnl|my_center|LOCUS_48390 102219 100558 gene locus_tag LOCUS_48400 gene pgi 102219 100558 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028056.1 protein_id gnl|my_center|LOCUS_48400 102685 102350 gene locus_tag LOCUS_48410 102685 102350 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976875.1 protein_id gnl|my_center|LOCUS_48410 103105 102869 gene locus_tag LOCUS_48420 gene secG 103105 102869 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_48420 104002 103226 gene locus_tag LOCUS_48430 gene tpiA 104002 103226 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976873.1 protein_id gnl|my_center|LOCUS_48430 105220 104009 gene locus_tag LOCUS_48440 105220 104009 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028057.1 protein_id gnl|my_center|LOCUS_48440 106350 105346 gene locus_tag LOCUS_48450 gene gap 106350 105346 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_48450 108841 106508 gene locus_tag LOCUS_48460 108841 106508 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028058.1 protein_id gnl|my_center|LOCUS_48460 109987 108980 gene locus_tag LOCUS_48470 gene whiA 109987 108980 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_48470 111030 109978 gene locus_tag LOCUS_48480 gene yvcK 111030 109978 CDS product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028061.1 protein_id gnl|my_center|LOCUS_48480 111959 111027 gene locus_tag LOCUS_48490 gene rapZ 111959 111027 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093455885.1 protein_id gnl|my_center|LOCUS_48490 114087 112102 gene locus_tag LOCUS_48500 gene uvrC 114087 112102 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831611.1 protein_id gnl|my_center|LOCUS_48500 115081 114224 gene locus_tag LOCUS_48510 115081 114224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 115746 115123 gene locus_tag LOCUS_48520 115746 115123 CDS product papain-like cysteine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226265.1 protein_id gnl|my_center|LOCUS_48520 116029 116988 gene locus_tag LOCUS_48530 116029 116988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976865.1 protein_id gnl|my_center|LOCUS_48530 117458 117018 gene locus_tag LOCUS_48540 117458 117018 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976864.1 protein_id gnl|my_center|LOCUS_48540 120673 117680 gene locus_tag LOCUS_48550 gene uvrA 120673 117680 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028066.1 protein_id gnl|my_center|LOCUS_48550 120884 121570 gene locus_tag LOCUS_48560 120884 121570 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028067.1 protein_id gnl|my_center|LOCUS_48560 121644 122237 gene locus_tag LOCUS_48570 121644 122237 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976859.1 protein_id gnl|my_center|LOCUS_48570 122383 123693 gene locus_tag LOCUS_48580 122383 123693 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194886.1 protein_id gnl|my_center|LOCUS_48580 124730 123723 gene locus_tag LOCUS_48590 124730 123723 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976856.1 protein_id gnl|my_center|LOCUS_48590 127051 124844 gene locus_tag LOCUS_48600 127051 124844 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028068.1 protein_id gnl|my_center|LOCUS_48600 127705 127127 gene locus_tag LOCUS_48610 127705 127127 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976854.1 protein_id gnl|my_center|LOCUS_48610 130049 127902 gene locus_tag LOCUS_48620 gene uvrB 130049 127902 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028069.1 protein_id gnl|my_center|LOCUS_48620 130296 131294 gene locus_tag LOCUS_48630 130296 131294 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_48630 131360 131932 gene locus_tag LOCUS_48640 131360 131932 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028072.1 protein_id gnl|my_center|LOCUS_48640 131975 132265 gene locus_tag LOCUS_48650 131975 132265 CDS product DUF6343 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325978.1 protein_id gnl|my_center|LOCUS_48650 132628 132305 gene locus_tag LOCUS_48660 132628 132305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48660 133405 132656 gene locus_tag LOCUS_48670 133405 132656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48670 133733 133413 gene locus_tag LOCUS_48680 133733 133413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 134394 133816 gene locus_tag LOCUS_48690 134394 133816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 135212 134604 gene locus_tag LOCUS_48700 gene coaE 135212 134604 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_48700 136181 135237 gene locus_tag LOCUS_48710 136181 135237 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976821.1 protein_id gnl|my_center|LOCUS_48710 137853 136360 gene locus_tag LOCUS_48720 gene rpsA 137853 136360 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976820.1 protein_id gnl|my_center|LOCUS_48720 138362 139168 gene locus_tag LOCUS_48730 138362 139168 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976818.1 protein_id gnl|my_center|LOCUS_48730 139284 141812 gene locus_tag LOCUS_48740 gene hrpB 139284 141812 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_48740 142086 141895 gene locus_tag LOCUS_48750 142086 141895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978144.1 protein_id gnl|my_center|LOCUS_48750 142975 142103 gene locus_tag LOCUS_48760 142975 142103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 143252 143118 gene locus_tag LOCUS_48770 143252 143118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 145997 143355 gene locus_tag LOCUS_48780 gene polA 145997 143355 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467407.1 protein_id gnl|my_center|LOCUS_48780 146240 148540 gene locus_tag LOCUS_48790 146240 148540 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_48790 148608 149069 gene locus_tag LOCUS_48800 148608 149069 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976812.1 protein_id gnl|my_center|LOCUS_48800 149391 150635 gene locus_tag LOCUS_48810 149391 150635 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976809.1 protein_id gnl|my_center|LOCUS_48810 150716 151648 gene locus_tag LOCUS_48820 150716 151648 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028093.1 protein_id gnl|my_center|LOCUS_48820 151654 153429 gene locus_tag LOCUS_48830 151654 153429 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028094.1 protein_id gnl|my_center|LOCUS_48830 153435 154292 gene locus_tag LOCUS_48840 153435 154292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976806.1 protein_id gnl|my_center|LOCUS_48840 154289 155005 gene locus_tag LOCUS_48850 154289 155005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028095.1 protein_id gnl|my_center|LOCUS_48850 155728 155078 gene locus_tag LOCUS_48860 155728 155078 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_48860 155817 155903 gene locus_tag LOCUS_t00660 155817 155903 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 156274 156777 gene locus_tag LOCUS_48870 156274 156777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 158217 156781 gene locus_tag LOCUS_48880 gene pyk 158217 156781 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028096.1 protein_id gnl|my_center|LOCUS_48880 159061 158372 gene locus_tag LOCUS_48890 159061 158372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 159210 161021 gene locus_tag LOCUS_48900 159210 161021 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028097.1 protein_id gnl|my_center|LOCUS_48900 162461 160977 gene locus_tag LOCUS_48910 162461 160977 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976800.1 protein_id gnl|my_center|LOCUS_48910 162707 163258 gene locus_tag LOCUS_48920 162707 163258 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_48920 163724 163413 gene locus_tag LOCUS_48930 163724 163413 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976797.1 protein_id gnl|my_center|LOCUS_48930 164625 163735 gene locus_tag LOCUS_48940 164625 163735 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803679.1 protein_id gnl|my_center|LOCUS_48940 164745 166583 gene locus_tag LOCUS_48950 164745 166583 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229240.1 protein_id gnl|my_center|LOCUS_48950 169708 166646 gene locus_tag LOCUS_48960 169708 166646 CDS product endo-alpha-N-acetylgalactosaminidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030847.1 protein_id gnl|my_center|LOCUS_48960 169822 170280 gene locus_tag LOCUS_48970 169822 170280 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224578.1 protein_id gnl|my_center|LOCUS_48970 170292 170693 gene locus_tag LOCUS_48980 170292 170693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48980 171277 170690 gene locus_tag LOCUS_48990 171277 170690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 171680 171447 gene locus_tag LOCUS_49000 171680 171447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 171834 172619 gene locus_tag LOCUS_49010 171834 172619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 172944 172720 gene locus_tag LOCUS_49020 172944 172720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 173027 173305 gene locus_tag LOCUS_49030 173027 173305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 173382 173576 gene locus_tag LOCUS_49040 173382 173576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 175393 173852 gene locus_tag LOCUS_49050 175393 173852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 176773 175508 gene locus_tag LOCUS_49060 176773 175508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49060 177273 176770 gene locus_tag LOCUS_49070 177273 176770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 179450 177588 gene locus_tag LOCUS_49080 179450 177588 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974635.1 protein_id gnl|my_center|LOCUS_49080 179723 180895 gene locus_tag LOCUS_49090 179723 180895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 181681 180956 gene locus_tag LOCUS_49100 181681 180956 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897698.1 protein_id gnl|my_center|LOCUS_49100 182939 181764 gene locus_tag LOCUS_49110 182939 181764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 183619 182936 gene locus_tag LOCUS_49120 183619 182936 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230978.1 protein_id gnl|my_center|LOCUS_49120 184652 183795 gene locus_tag LOCUS_49130 184652 183795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 185829 185044 gene locus_tag LOCUS_49140 185829 185044 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224432.1 protein_id gnl|my_center|LOCUS_49140 186068 186943 gene locus_tag LOCUS_49150 186068 186943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028100.1 protein_id gnl|my_center|LOCUS_49150 187898 186978 gene locus_tag LOCUS_49160 187898 186978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_49160 187867 188052 gene locus_tag LOCUS_49170 187867 188052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49170 189916 188066 gene locus_tag LOCUS_49180 189916 188066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 190287 190487 gene locus_tag LOCUS_49190 190287 190487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 190484 191734 gene locus_tag LOCUS_49200 190484 191734 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222669.1 protein_id gnl|my_center|LOCUS_49200 191799 192992 gene locus_tag LOCUS_49210 gene wecB 191799 192992 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_49210 192989 193657 gene locus_tag LOCUS_49220 192989 193657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 195213 193753 gene locus_tag LOCUS_49230 195213 193753 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_49230 199765 195206 gene locus_tag LOCUS_49240 gene gltB 199765 195206 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028104.1 protein_id gnl|my_center|LOCUS_49240 200810 200079 gene locus_tag LOCUS_49250 200810 200079 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_49250 202004 201024 gene locus_tag LOCUS_49260 gene lgt 202004 201024 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976782.1 protein_id gnl|my_center|LOCUS_49260 203092 202097 gene locus_tag LOCUS_49270 203092 202097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49270 204008 203160 gene locus_tag LOCUS_49280 204008 203160 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715374.1 protein_id gnl|my_center|LOCUS_49280 204829 204014 gene locus_tag LOCUS_49290 gene trpA 204829 204014 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976780.1 protein_id gnl|my_center|LOCUS_49290 206079 204829 gene locus_tag LOCUS_49300 gene trpB 206079 204829 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976779.1 protein_id gnl|my_center|LOCUS_49300 207230 206421 gene locus_tag LOCUS_49310 gene trpC 207230 206421 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028110.1 protein_id gnl|my_center|LOCUS_49310 207995 207585 gene locus_tag LOCUS_49320 207995 207585 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028111.1 protein_id gnl|my_center|LOCUS_49320 208329 208102 gene locus_tag LOCUS_49330 208329 208102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028112.1 protein_id gnl|my_center|LOCUS_49330 209063 208440 gene locus_tag LOCUS_49340 209063 208440 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 protein_id gnl|my_center|LOCUS_49340 210752 209193 gene locus_tag LOCUS_49350 210752 209193 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976773.1 protein_id gnl|my_center|LOCUS_49350 211184 210780 gene locus_tag LOCUS_49360 gene hisI 211184 210780 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976772.1 protein_id gnl|my_center|LOCUS_49360 211183 211815 gene locus_tag LOCUS_49370 211183 211815 CDS product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_49370 211918 212469 gene locus_tag LOCUS_49380 211918 212469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 213258 212503 gene locus_tag LOCUS_49390 gene hisF 213258 212503 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976768.1 protein_id gnl|my_center|LOCUS_49390 213659 213255 gene locus_tag LOCUS_49400 213659 213255 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 protein_id gnl|my_center|LOCUS_49400 214384 213656 gene locus_tag LOCUS_49410 gene priA 214384 213656 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976766.1 protein_id gnl|my_center|LOCUS_49410 215099 214458 gene locus_tag LOCUS_49420 gene hisH 215099 214458 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976765.1 protein_id gnl|my_center|LOCUS_49420 215263 215096 gene locus_tag LOCUS_49430 215263 215096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 215892 215266 gene locus_tag LOCUS_49440 gene hisB 215892 215266 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976763.1 protein_id gnl|my_center|LOCUS_49440 216995 215886 gene locus_tag LOCUS_49450 216995 215886 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_49450 218317 216992 gene locus_tag LOCUS_49460 gene hisD 218317 216992 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028117.1 protein_id gnl|my_center|LOCUS_49460 218547 220151 gene locus_tag LOCUS_49470 218547 220151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028118.1 protein_id gnl|my_center|LOCUS_49470 220239 220976 gene locus_tag LOCUS_49480 220239 220976 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_49480 220993 221496 gene locus_tag LOCUS_49490 gene ybaK 220993 221496 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976757.1 protein_id gnl|my_center|LOCUS_49490 222461 221745 gene locus_tag LOCUS_49500 222461 221745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028121.1 protein_id gnl|my_center|LOCUS_49500 223300 222458 gene locus_tag LOCUS_49510 223300 222458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109031846.1 protein_id gnl|my_center|LOCUS_49510 224297 223332 gene locus_tag LOCUS_49520 224297 223332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028123.1 protein_id gnl|my_center|LOCUS_49520 225753 224431 gene locus_tag LOCUS_49530 225753 224431 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028124.1 protein_id gnl|my_center|LOCUS_49530 225964 226197 gene locus_tag LOCUS_49540 225964 226197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 229808 226269 gene locus_tag LOCUS_49550 gene dnaE 229808 226269 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976751.1 protein_id gnl|my_center|LOCUS_49550 229966 231303 gene locus_tag LOCUS_49560 229966 231303 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_49560 231323 231982 gene locus_tag LOCUS_49570 231323 231982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976749.1 protein_id gnl|my_center|LOCUS_49570 232069 232899 gene locus_tag LOCUS_49580 232069 232899 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976748.1 protein_id gnl|my_center|LOCUS_49580 233018 233641 gene locus_tag LOCUS_49590 233018 233641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976749.1 protein_id gnl|my_center|LOCUS_49590 233687 234538 gene locus_tag LOCUS_49600 233687 234538 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976748.1 protein_id gnl|my_center|LOCUS_49600 234650 236302 gene locus_tag LOCUS_49610 234650 236302 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 protein_id gnl|my_center|LOCUS_49610 236942 236355 gene locus_tag LOCUS_49620 236942 236355 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976746.1 protein_id gnl|my_center|LOCUS_49620 237015 238127 gene locus_tag LOCUS_49630 237015 238127 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976745.1 protein_id gnl|my_center|LOCUS_49630 239729 238137 gene locus_tag LOCUS_49640 239729 238137 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028126.1 protein_id gnl|my_center|LOCUS_49640 240814 239873 gene locus_tag LOCUS_49650 240814 239873 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976742.1 protein_id gnl|my_center|LOCUS_49650 241429 240863 gene locus_tag LOCUS_49660 gene lspA 241429 240863 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028127.1 protein_id gnl|my_center|LOCUS_49660 242927 241494 gene locus_tag LOCUS_49670 242927 241494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 243369 246506 gene locus_tag LOCUS_49680 gene ileS 243369 246506 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976739.1 protein_id gnl|my_center|LOCUS_49680 247933 246719 gene locus_tag LOCUS_49690 247933 246719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 248279 247995 gene locus_tag LOCUS_49700 248279 247995 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976737.1 protein_id gnl|my_center|LOCUS_49700 248965 248351 gene locus_tag LOCUS_49710 gene sepF 248965 248351 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976736.1 protein_id gnl|my_center|LOCUS_49710 249812 249087 gene locus_tag LOCUS_49720 249812 249087 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_49720 250552 249809 gene locus_tag LOCUS_49730 gene pgeF 250552 249809 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028130.1 protein_id gnl|my_center|LOCUS_49730 251940 250693 gene locus_tag LOCUS_49740 gene ftsZ 251940 250693 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_49740 253077 252181 gene locus_tag LOCUS_49750 253077 252181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49750 254201 253107 gene locus_tag LOCUS_49760 gene murG 254201 253107 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976731.1 protein_id gnl|my_center|LOCUS_49760 255593 254208 gene locus_tag LOCUS_49770 gene ftsW 255593 254208 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_49770 257130 255703 gene locus_tag LOCUS_49780 gene murD 257130 255703 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976729.1 protein_id gnl|my_center|LOCUS_49780 258191 257127 gene locus_tag LOCUS_49790 gene mraY 258191 257127 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976728.1 protein_id gnl|my_center|LOCUS_49790 259612 258191 gene locus_tag LOCUS_49800 259612 258191 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976727.1 protein_id gnl|my_center|LOCUS_49800 261372 259678 gene locus_tag LOCUS_49810 261372 259678 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028131.1 protein_id gnl|my_center|LOCUS_49810 263286 261388 gene locus_tag LOCUS_49820 gene ftsI 263286 261388 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_49820 263929 263294 gene locus_tag LOCUS_49830 263929 263294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 264885 263926 gene locus_tag LOCUS_49840 gene rsmH 264885 263926 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976723.1 protein_id gnl|my_center|LOCUS_49840 265296 265859 gene locus_tag LOCUS_49850 265296 265859 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976722.1 protein_id gnl|my_center|LOCUS_49850 266062 267108 gene locus_tag LOCUS_49860 266062 267108 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_49860 267108 268658 gene locus_tag LOCUS_49870 267108 268658 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486197.1 protein_id gnl|my_center|LOCUS_49870 268655 271042 gene locus_tag LOCUS_49880 268655 271042 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486200.1 protein_id gnl|my_center|LOCUS_49880 271559 271149 gene locus_tag LOCUS_49890 271559 271149 CDS product spore wall synthesis complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_49890 272681 271818 gene locus_tag LOCUS_49900 272681 271818 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_49900 272802 273563 gene locus_tag LOCUS_49910 272802 273563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 273535 275742 gene locus_tag LOCUS_49920 273535 275742 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095789.1 protein_id gnl|my_center|LOCUS_49920 275739 276392 gene locus_tag LOCUS_49930 275739 276392 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028140.1 protein_id gnl|my_center|LOCUS_49930 276676 277266 gene locus_tag LOCUS_49940 276676 277266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49940 277351 278859 gene locus_tag LOCUS_49950 277351 278859 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028141.1 protein_id gnl|my_center|LOCUS_49950 279970 278948 gene locus_tag LOCUS_49960 279970 278948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 280928 280011 gene locus_tag LOCUS_49970 gene metF 280928 280011 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028143.1 protein_id gnl|my_center|LOCUS_49970 281690 281037 gene locus_tag LOCUS_49980 gene thiE 281690 281037 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976712.1 protein_id gnl|my_center|LOCUS_49980 282145 281795 gene locus_tag LOCUS_49990 282145 281795 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805032.1 protein_id gnl|my_center|LOCUS_49990 283512 282286 gene locus_tag LOCUS_50000 283512 282286 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486236.1 protein_id gnl|my_center|LOCUS_50000 283897 285045 gene locus_tag LOCUS_50010 gene thiO 283897 285045 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421597.1 protein_id gnl|my_center|LOCUS_50010 285042 285251 gene locus_tag LOCUS_50020 gene thiS 285042 285251 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976708.1 protein_id gnl|my_center|LOCUS_50020 285261 286058 gene locus_tag LOCUS_50030 285261 286058 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976707.1 protein_id gnl|my_center|LOCUS_50030 286303 288288 gene locus_tag LOCUS_50040 gene pknB 286303 288288 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486214.1 protein_id gnl|my_center|LOCUS_50040 288294 289184 gene locus_tag LOCUS_50050 288294 289184 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976705.1 protein_id gnl|my_center|LOCUS_50050 289833 289201 gene locus_tag LOCUS_50060 289833 289201 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976704.1 protein_id gnl|my_center|LOCUS_50060 290008 290496 gene locus_tag LOCUS_50070 gene bfr 290008 290496 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976703.1 protein_id gnl|my_center|LOCUS_50070 290772 290512 gene locus_tag LOCUS_50080 290772 290512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50080 292275 290926 gene locus_tag LOCUS_50090 292275 290926 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976701.1 protein_id gnl|my_center|LOCUS_50090 292564 294453 gene locus_tag LOCUS_50100 292564 294453 CDS product phenazine-specific anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028148.1 protein_id gnl|my_center|LOCUS_50100 295612 294581 gene locus_tag LOCUS_50110 295612 294581 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_50110 296339 295668 gene locus_tag LOCUS_50120 296339 295668 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976695.1 protein_id gnl|my_center|LOCUS_50120 297565 296336 gene locus_tag LOCUS_50130 297565 296336 CDS product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976694.1 protein_id gnl|my_center|LOCUS_50130 298382 297594 gene locus_tag LOCUS_50140 298382 297594 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469516.1 protein_id gnl|my_center|LOCUS_50140 298507 299277 gene locus_tag LOCUS_50150 298507 299277 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_50150 299270 299836 gene locus_tag LOCUS_50160 299270 299836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_50160 300590 299841 gene locus_tag LOCUS_50170 300590 299841 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976690.1 protein_id gnl|my_center|LOCUS_50170 301564 300623 gene locus_tag LOCUS_50180 301564 300623 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976689.1 protein_id gnl|my_center|LOCUS_50180 302098 301622 gene locus_tag LOCUS_50190 302098 301622 CDS product carbon catabolit repression protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028152.1 protein_id gnl|my_center|LOCUS_50190 303402 302170 gene locus_tag LOCUS_50200 303402 302170 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976687.1 protein_id gnl|my_center|LOCUS_50200 303892 303443 gene locus_tag LOCUS_50210 303892 303443 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_50210 304738 303977 gene locus_tag LOCUS_50220 304738 303977 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_50220 305018 306814 gene locus_tag LOCUS_50230 305018 306814 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_50230 308027 306885 gene locus_tag LOCUS_50240 308027 306885 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486225.1 protein_id gnl|my_center|LOCUS_50240 308151 309392 gene locus_tag LOCUS_50250 308151 309392 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 protein_id gnl|my_center|LOCUS_50250 310656 309502 gene locus_tag LOCUS_50260 310656 309502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869422.1 protein_id gnl|my_center|LOCUS_50260 311770 310691 gene locus_tag LOCUS_50270 311770 310691 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976680.1 protein_id gnl|my_center|LOCUS_50270 313109 312036 gene locus_tag LOCUS_50280 313109 312036 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028159.1 protein_id gnl|my_center|LOCUS_50280 314716 313343 gene locus_tag LOCUS_50290 314716 313343 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028160.1 protein_id gnl|my_center|LOCUS_50290 314978 314736 gene locus_tag LOCUS_50300 314978 314736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976677.1 protein_id gnl|my_center|LOCUS_50300 315125 315844 gene locus_tag LOCUS_50310 315125 315844 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028161.1 protein_id gnl|my_center|LOCUS_50310 315841 316122 gene locus_tag LOCUS_50320 315841 316122 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_50320 317552 316182 gene locus_tag LOCUS_50330 317552 316182 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028165.1 protein_id gnl|my_center|LOCUS_50330 318956 317895 gene locus_tag LOCUS_50340 gene trpD 318956 317895 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028166.1 protein_id gnl|my_center|LOCUS_50340 320735 319107 gene locus_tag LOCUS_50350 320735 319107 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028167.1 protein_id gnl|my_center|LOCUS_50350 321784 320732 gene locus_tag LOCUS_50360 321784 320732 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976666.1 protein_id gnl|my_center|LOCUS_50360 322590 321781 gene locus_tag LOCUS_50370 322590 321781 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_50370 323278 322658 gene locus_tag LOCUS_50380 323278 322658 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976664.1 protein_id gnl|my_center|LOCUS_50380 323495 323896 gene locus_tag LOCUS_50390 323495 323896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976663.1 protein_id gnl|my_center|LOCUS_50390 325165 323915 gene locus_tag LOCUS_50400 325165 323915 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976662.1 protein_id gnl|my_center|LOCUS_50400 325700 325302 gene locus_tag LOCUS_50410 325700 325302 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976661.1 protein_id gnl|my_center|LOCUS_50410 327424 325697 gene locus_tag LOCUS_50420 gene ctaD 327424 325697 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_50420 328392 327421 gene locus_tag LOCUS_50430 gene coxB 328392 327421 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028168.1 protein_id gnl|my_center|LOCUS_50430 328719 330104 gene locus_tag LOCUS_50440 328719 330104 CDS product cysteine desulfurase/sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 protein_id gnl|my_center|LOCUS_50440 331206 330232 gene locus_tag LOCUS_50450 331206 330232 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326033.1 protein_id gnl|my_center|LOCUS_50450 331114 331335 gene locus_tag LOCUS_50460 331114 331335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 331391 331618 gene locus_tag LOCUS_50470 331391 331618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 331747 333288 gene locus_tag LOCUS_50480 331747 333288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028170.1 protein_id gnl|my_center|LOCUS_50480 333718 333353 gene locus_tag LOCUS_50490 333718 333353 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976654.1 protein_id gnl|my_center|LOCUS_50490 333942 335168 gene locus_tag LOCUS_50500 gene nadA 333942 335168 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030869444.1 protein_id gnl|my_center|LOCUS_50500 >Feature sequence09 1897 929 gene locus_tag LOCUS_50510 1897 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 2164 2075 gene locus_tag LOCUS_t00670 2164 2075 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2446 2267 gene locus_tag LOCUS_50520 2446 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 4188 2572 gene locus_tag LOCUS_50530 4188 2572 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029350.1 protein_id gnl|my_center|LOCUS_50530 4365 5210 gene locus_tag LOCUS_50540 4365 5210 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_50540 5443 6027 gene locus_tag LOCUS_50550 5443 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_50550 6089 7354 gene locus_tag LOCUS_50560 6089 7354 CDS product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_50560 8801 8034 gene locus_tag LOCUS_50570 8801 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 9994 9257 gene locus_tag LOCUS_50580 9994 9257 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974971.1 protein_id gnl|my_center|LOCUS_50580 10724 12376 gene locus_tag LOCUS_50590 10724 12376 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029348.1 protein_id gnl|my_center|LOCUS_50590 12532 13989 gene locus_tag LOCUS_50600 12532 13989 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974973.1 protein_id gnl|my_center|LOCUS_50600 14264 14082 gene locus_tag LOCUS_50610 14264 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50610 14456 14707 gene locus_tag LOCUS_50620 14456 14707 CDS product SCO4226 family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029517.1 protein_id gnl|my_center|LOCUS_50620 15211 14732 gene locus_tag LOCUS_50630 15211 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 15522 15214 gene locus_tag LOCUS_50640 15522 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50640 15427 16221 gene locus_tag LOCUS_50650 15427 16221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029346.1 protein_id gnl|my_center|LOCUS_50650 16334 17086 gene locus_tag LOCUS_50660 16334 17086 CDS product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974977.1 protein_id gnl|my_center|LOCUS_50660 17161 17817 gene locus_tag LOCUS_50670 17161 17817 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_50670 17817 18314 gene locus_tag LOCUS_50680 17817 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50680 18364 20400 gene locus_tag LOCUS_50690 18364 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 20400 21935 gene locus_tag LOCUS_50700 20400 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 22036 23034 gene locus_tag LOCUS_50710 gene pheA 22036 23034 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_50710 23633 24871 gene locus_tag LOCUS_50720 gene serS 23633 24871 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974982.1 protein_id gnl|my_center|LOCUS_50720 24868 25692 gene locus_tag LOCUS_50730 24868 25692 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029342.1 protein_id gnl|my_center|LOCUS_50730 26500 25622 gene locus_tag LOCUS_50740 26500 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50740 26604 27314 gene locus_tag LOCUS_50750 26604 27314 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097856.1 protein_id gnl|my_center|LOCUS_50750 27464 28783 gene locus_tag LOCUS_50760 27464 28783 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461355.1 protein_id gnl|my_center|LOCUS_50760 28893 29840 gene locus_tag LOCUS_50770 28893 29840 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_50770 30615 29881 gene locus_tag LOCUS_50780 30615 29881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974984.1 protein_id gnl|my_center|LOCUS_50780 31540 30629 gene locus_tag LOCUS_50790 31540 30629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_50790 32451 31537 gene locus_tag LOCUS_50800 32451 31537 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974986.1 protein_id gnl|my_center|LOCUS_50800 33529 32441 gene locus_tag LOCUS_50810 33529 32441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_50810 33803 34633 gene locus_tag LOCUS_50820 33803 34633 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485334.1 protein_id gnl|my_center|LOCUS_50820 34630 36417 gene locus_tag LOCUS_50830 34630 36417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029339.1 protein_id gnl|my_center|LOCUS_50830 36503 37405 gene locus_tag LOCUS_50840 36503 37405 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 protein_id gnl|my_center|LOCUS_50840 37445 38407 gene locus_tag LOCUS_50850 37445 38407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 39814 38468 gene locus_tag LOCUS_50860 39814 38468 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224852.1 protein_id gnl|my_center|LOCUS_50860 40407 39847 gene locus_tag LOCUS_50870 40407 39847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224853.1 protein_id gnl|my_center|LOCUS_50870 40550 41176 gene locus_tag LOCUS_50880 40550 41176 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224854.1 protein_id gnl|my_center|LOCUS_50880 41686 41087 gene locus_tag LOCUS_50890 41686 41087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_50890 42650 41748 gene locus_tag LOCUS_50900 gene htpX 42650 41748 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976613.1 protein_id gnl|my_center|LOCUS_50900 43653 42769 gene locus_tag LOCUS_50910 43653 42769 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326709.1 protein_id gnl|my_center|LOCUS_50910 43799 44662 gene locus_tag LOCUS_50920 43799 44662 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_50920 45808 44768 gene locus_tag LOCUS_50930 45808 44768 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029334.1 protein_id gnl|my_center|LOCUS_50930 47668 46001 gene locus_tag LOCUS_50940 47668 46001 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029333.1 protein_id gnl|my_center|LOCUS_50940 51191 47679 gene locus_tag LOCUS_50950 gene cydD 51191 47679 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029332.1 protein_id gnl|my_center|LOCUS_50950 52206 51205 gene locus_tag LOCUS_50960 gene cydB 52206 51205 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029331.1 protein_id gnl|my_center|LOCUS_50960 53941 52277 gene locus_tag LOCUS_50970 53941 52277 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974998.1 protein_id gnl|my_center|LOCUS_50970 55164 54085 gene locus_tag LOCUS_50980 gene hisC 55164 54085 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029330.1 protein_id gnl|my_center|LOCUS_50980 55586 56674 gene locus_tag LOCUS_50990 55586 56674 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975000.1 protein_id gnl|my_center|LOCUS_50990 57017 58066 gene locus_tag LOCUS_51000 gene sppA 57017 58066 CDS product Ser/Thr/Tyr protein phosphatase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029328.1 protein_id gnl|my_center|LOCUS_51000 58247 59155 gene locus_tag LOCUS_51010 58247 59155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029327.1 protein_id gnl|my_center|LOCUS_51010 59298 59504 gene locus_tag LOCUS_51020 59298 59504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51020 59835 60596 gene locus_tag LOCUS_51030 59835 60596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 62540 60765 gene locus_tag LOCUS_51040 gene thiC 62540 60765 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029315.1 protein_id gnl|my_center|LOCUS_51040 62734 64092 gene locus_tag LOCUS_51050 62734 64092 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029314.1 protein_id gnl|my_center|LOCUS_51050 64115 64315 gene locus_tag LOCUS_51060 64115 64315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224191.1 protein_id gnl|my_center|LOCUS_51060 64419 66158 gene locus_tag LOCUS_51070 64419 66158 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224190.1 protein_id gnl|my_center|LOCUS_51070 66571 66155 gene locus_tag LOCUS_51080 66571 66155 CDS product SsgA family sporulation/cell division regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975006.1 protein_id gnl|my_center|LOCUS_51080 67247 67029 gene locus_tag LOCUS_51090 67247 67029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 67783 67466 gene locus_tag LOCUS_51100 67783 67466 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029310.1 protein_id gnl|my_center|LOCUS_51100 67877 68257 gene locus_tag LOCUS_51110 67877 68257 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_51110 68511 69407 gene locus_tag LOCUS_51120 68511 69407 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029308.1 protein_id gnl|my_center|LOCUS_51120 69449 69946 gene locus_tag LOCUS_51130 69449 69946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51130 71065 69953 gene locus_tag LOCUS_51140 71065 69953 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978774.1 protein_id gnl|my_center|LOCUS_51140 72407 71775 gene locus_tag LOCUS_51150 72407 71775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 73711 72446 gene locus_tag LOCUS_51160 73711 72446 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029306.1 protein_id gnl|my_center|LOCUS_51160 73851 74387 gene locus_tag LOCUS_51170 73851 74387 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975018.1 protein_id gnl|my_center|LOCUS_51170 75242 74493 gene locus_tag LOCUS_51180 75242 74493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 76575 75448 gene locus_tag LOCUS_51190 76575 75448 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972854.1 protein_id gnl|my_center|LOCUS_51190 78122 76668 gene locus_tag LOCUS_51200 78122 76668 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975020.1 protein_id gnl|my_center|LOCUS_51200 79613 78135 gene locus_tag LOCUS_51210 gene dnaB 79613 78135 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975021.1 protein_id gnl|my_center|LOCUS_51210 80119 81459 gene locus_tag LOCUS_51220 80119 81459 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485269.1 protein_id gnl|my_center|LOCUS_51220 82082 81636 gene locus_tag LOCUS_51230 gene rplI 82082 81636 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975023.1 protein_id gnl|my_center|LOCUS_51230 82337 82101 gene locus_tag LOCUS_51240 gene rpsR 82337 82101 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_51240 83000 82413 gene locus_tag LOCUS_51250 83000 82413 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029303.1 protein_id gnl|my_center|LOCUS_51250 83371 83081 gene locus_tag LOCUS_51260 gene rpsF 83371 83081 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975025.1 protein_id gnl|my_center|LOCUS_51260 83648 83977 gene locus_tag LOCUS_51270 83648 83977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975026.1 protein_id gnl|my_center|LOCUS_51270 84079 85197 gene locus_tag LOCUS_51280 gene femX 84079 85197 CDS product peptidoglycan bridge formation glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029302.1 protein_id gnl|my_center|LOCUS_51280 85243 86274 gene locus_tag LOCUS_51290 85243 86274 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_51290 87803 86310 gene locus_tag LOCUS_51300 87803 86310 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029301.1 protein_id gnl|my_center|LOCUS_51300 90582 87934 gene locus_tag LOCUS_51310 90582 87934 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975030.1 protein_id gnl|my_center|LOCUS_51310 90977 91564 gene locus_tag LOCUS_51320 90977 91564 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_51320 91613 92695 gene locus_tag LOCUS_51330 91613 92695 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975032.1 protein_id gnl|my_center|LOCUS_51330 92803 94062 gene locus_tag LOCUS_51340 92803 94062 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029300.1 protein_id gnl|my_center|LOCUS_51340 94174 94695 gene locus_tag LOCUS_51350 94174 94695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 96255 94774 gene locus_tag LOCUS_51360 96255 94774 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_51360 96465 98807 gene locus_tag LOCUS_51370 96465 98807 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029298.1 protein_id gnl|my_center|LOCUS_51370 98853 101063 gene locus_tag LOCUS_51380 gene murJ 98853 101063 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029297.1 protein_id gnl|my_center|LOCUS_51380 101173 102852 gene locus_tag LOCUS_51390 101173 102852 CDS product protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029296.1 protein_id gnl|my_center|LOCUS_51390 102888 103577 gene locus_tag LOCUS_51400 gene sigM 102888 103577 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_51400 103574 104515 gene locus_tag LOCUS_51410 103574 104515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029294.1 protein_id gnl|my_center|LOCUS_51410 104630 105604 gene locus_tag LOCUS_51420 gene trxB 104630 105604 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975041.1 protein_id gnl|my_center|LOCUS_51420 105652 105978 gene locus_tag LOCUS_51430 gene trxA 105652 105978 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_51430 106660 106043 gene locus_tag LOCUS_51440 106660 106043 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975043.1 protein_id gnl|my_center|LOCUS_51440 108160 107003 gene locus_tag LOCUS_51450 108160 107003 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863476.1 protein_id gnl|my_center|LOCUS_51450 109161 108157 gene locus_tag LOCUS_51460 109161 108157 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_51460 110159 109446 gene locus_tag LOCUS_51470 gene rsmG 110159 109446 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029291.1 protein_id gnl|my_center|LOCUS_51470 110799 110290 gene locus_tag LOCUS_51480 110799 110290 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_51480 111908 110814 gene locus_tag LOCUS_51490 gene yidC 111908 110814 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029289.1 protein_id gnl|my_center|LOCUS_51490 112229 111912 gene locus_tag LOCUS_51500 gene yidD 112229 111912 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975049.1 protein_id gnl|my_center|LOCUS_51500 112531 112226 gene locus_tag LOCUS_51510 112531 112226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 112816 112679 gene locus_tag LOCUS_51520 gene rpmH 112816 112679 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975051.1 protein_id gnl|my_center|LOCUS_51520 113318 115084 gene locus_tag LOCUS_51530 gene dnaA 113318 115084 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029287.1 protein_id gnl|my_center|LOCUS_51530 115923 117053 gene locus_tag LOCUS_51540 gene dnaN 115923 117053 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975054.1 protein_id gnl|my_center|LOCUS_51540 117243 118121 gene locus_tag LOCUS_51550 gene gnd 117243 118121 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_51550 118168 119292 gene locus_tag LOCUS_51560 gene recF 118168 119292 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975056.1 protein_id gnl|my_center|LOCUS_51560 119289 119846 gene locus_tag LOCUS_51570 119289 119846 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975057.1 protein_id gnl|my_center|LOCUS_51570 120251 122302 gene locus_tag LOCUS_51580 gene gyrB 120251 122302 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029285.1 protein_id gnl|my_center|LOCUS_51580 122353 124974 gene locus_tag LOCUS_51590 gene gyrA 122353 124974 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326690.1 protein_id gnl|my_center|LOCUS_51590 124978 125910 gene locus_tag LOCUS_51600 124978 125910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 125988 126062 gene locus_tag LOCUS_t00680 125988 126062 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 126274 126408 gene locus_tag LOCUS_51610 126274 126408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_51610 127695 126565 gene locus_tag LOCUS_51620 127695 126565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51620 128292 127747 gene locus_tag LOCUS_51630 128292 127747 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029275.1 protein_id gnl|my_center|LOCUS_51630 128411 128484 gene locus_tag LOCUS_t00690 128411 128484 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 129313 128663 gene locus_tag LOCUS_51640 129313 128663 CDS product DUF5324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029273.1 protein_id gnl|my_center|LOCUS_51640 129542 130075 gene locus_tag LOCUS_51650 129542 130075 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975078.1 protein_id gnl|my_center|LOCUS_51650 130244 131104 gene locus_tag LOCUS_51660 130244 131104 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_51660 131653 131399 gene locus_tag LOCUS_51670 gene crgA 131653 131399 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975080.1 protein_id gnl|my_center|LOCUS_51670 131816 132580 gene locus_tag LOCUS_51680 131816 132580 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485254.1 protein_id gnl|my_center|LOCUS_51680 132602 133408 gene locus_tag LOCUS_51690 132602 133408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 133478 133675 gene locus_tag LOCUS_51700 133478 133675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174256084.1 protein_id gnl|my_center|LOCUS_51700 133693 134310 gene locus_tag LOCUS_51710 133693 134310 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029271.1 protein_id gnl|my_center|LOCUS_51710 134307 135194 gene locus_tag LOCUS_51720 134307 135194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 135225 135950 gene locus_tag LOCUS_51730 135225 135950 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975085.1 protein_id gnl|my_center|LOCUS_51730 138067 136025 gene locus_tag LOCUS_51740 gene pknB 138067 136025 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029269.1 protein_id gnl|my_center|LOCUS_51740 139681 138230 gene locus_tag LOCUS_51750 139681 138230 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_51750 141096 139678 gene locus_tag LOCUS_51760 141096 139678 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029267.1 protein_id gnl|my_center|LOCUS_51760 142706 141120 gene locus_tag LOCUS_51770 142706 141120 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029266.1 protein_id gnl|my_center|LOCUS_51770 143234 142728 gene locus_tag LOCUS_51780 gene fhaB 143234 142728 CDS product antibiotic biosynthesis regulator FhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_51780 144108 143269 gene locus_tag LOCUS_51790 gene fhaA 144108 143269 CDS product antibiotic biosynthesis regulator FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975091.1 protein_id gnl|my_center|LOCUS_51790 144440 144524 gene locus_tag LOCUS_t00700 144440 144524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 146358 144655 gene locus_tag LOCUS_51800 146358 144655 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973327.1 protein_id gnl|my_center|LOCUS_51800 146465 148120 gene locus_tag LOCUS_51810 146465 148120 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029264.1 protein_id gnl|my_center|LOCUS_51810 148230 149057 gene locus_tag LOCUS_51820 148230 149057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975094.1 protein_id gnl|my_center|LOCUS_51820 149080 149427 gene locus_tag LOCUS_51830 149080 149427 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975095.1 protein_id gnl|my_center|LOCUS_51830 150616 149471 gene locus_tag LOCUS_51840 150616 149471 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_51840 151785 150691 gene locus_tag LOCUS_51850 gene paaK 151785 150691 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971667.1 protein_id gnl|my_center|LOCUS_51850 152297 151785 gene locus_tag LOCUS_51860 gene paaJ 152297 151785 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223466.1 protein_id gnl|my_center|LOCUS_51860 153043 152291 gene locus_tag LOCUS_51870 gene paaC 153043 152291 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_51870 153327 153040 gene locus_tag LOCUS_51880 gene paaB 153327 153040 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167454960.1 protein_id gnl|my_center|LOCUS_51880 154286 153324 gene locus_tag LOCUS_51890 gene paaA 154286 153324 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031683.1 protein_id gnl|my_center|LOCUS_51890 154502 155179 gene locus_tag LOCUS_51900 154502 155179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 155176 156471 gene locus_tag LOCUS_51910 155176 156471 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029262.1 protein_id gnl|my_center|LOCUS_51910 156477 157250 gene locus_tag LOCUS_51920 156477 157250 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029261.1 protein_id gnl|my_center|LOCUS_51920 158955 157252 gene locus_tag LOCUS_51930 gene paaN 158955 157252 CDS product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029260.1 protein_id gnl|my_center|LOCUS_51930 159093 160613 gene locus_tag LOCUS_51940 159093 160613 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029259.1 protein_id gnl|my_center|LOCUS_51940 160616 161209 gene locus_tag LOCUS_51950 160616 161209 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975101.1 protein_id gnl|my_center|LOCUS_51950 161770 161264 gene locus_tag LOCUS_51960 161770 161264 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029198.1 protein_id gnl|my_center|LOCUS_51960 161941 163110 gene locus_tag LOCUS_51970 gene pdhA 161941 163110 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467649.1 protein_id gnl|my_center|LOCUS_51970 163107 164153 gene locus_tag LOCUS_51980 163107 164153 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029256.1 protein_id gnl|my_center|LOCUS_51980 164153 165595 gene locus_tag LOCUS_51990 164153 165595 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029255.1 protein_id gnl|my_center|LOCUS_51990 165646 166503 gene locus_tag LOCUS_52000 165646 166503 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943903.1 protein_id gnl|my_center|LOCUS_52000 166500 168533 gene locus_tag LOCUS_52010 166500 168533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 168530 169594 gene locus_tag LOCUS_52020 168530 169594 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_52020 169673 170650 gene locus_tag LOCUS_52030 169673 170650 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 protein_id gnl|my_center|LOCUS_52030 170757 171245 gene locus_tag LOCUS_52040 170757 171245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52040 171292 171903 gene locus_tag LOCUS_52050 171292 171903 CDS product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_52050 173783 172011 gene locus_tag LOCUS_52060 173783 172011 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029251.1 protein_id gnl|my_center|LOCUS_52060 174144 175787 gene locus_tag LOCUS_52070 174144 175787 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326665.1 protein_id gnl|my_center|LOCUS_52070 176984 175914 gene locus_tag LOCUS_52080 176984 175914 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109282207.1 protein_id gnl|my_center|LOCUS_52080 177449 177000 gene locus_tag LOCUS_52090 177449 177000 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029249.1 protein_id gnl|my_center|LOCUS_52090 178138 177551 gene locus_tag LOCUS_52100 178138 177551 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_52100 178575 179720 gene locus_tag LOCUS_52110 gene pdhA 178575 179720 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230923.1 protein_id gnl|my_center|LOCUS_52110 179723 180703 gene locus_tag LOCUS_52120 179723 180703 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326663.1 protein_id gnl|my_center|LOCUS_52120 180725 182185 gene locus_tag LOCUS_52130 180725 182185 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029246.1 protein_id gnl|my_center|LOCUS_52130 182477 183307 gene locus_tag LOCUS_52140 182477 183307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031308.1 protein_id gnl|my_center|LOCUS_52140 183400 184068 gene locus_tag LOCUS_52150 183400 184068 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975126.1 protein_id gnl|my_center|LOCUS_52150 184065 185405 gene locus_tag LOCUS_52160 184065 185405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975127.1 protein_id gnl|my_center|LOCUS_52160 186270 185440 gene locus_tag LOCUS_52170 186270 185440 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029242.1 protein_id gnl|my_center|LOCUS_52170 186462 187241 gene locus_tag LOCUS_52180 186462 187241 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975129.1 protein_id gnl|my_center|LOCUS_52180 187328 189142 gene locus_tag LOCUS_52190 187328 189142 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026880.1 protein_id gnl|my_center|LOCUS_52190 189816 189184 gene locus_tag LOCUS_52200 189816 189184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 191215 189923 gene locus_tag LOCUS_52210 191215 189923 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975140.1 protein_id gnl|my_center|LOCUS_52210 193150 191321 gene locus_tag LOCUS_52220 193150 191321 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_52220 193291 193743 gene locus_tag LOCUS_52230 193291 193743 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975142.1 protein_id gnl|my_center|LOCUS_52230 194722 193796 gene locus_tag LOCUS_52240 194722 193796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52240 194862 195593 gene locus_tag LOCUS_52250 194862 195593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 195703 196725 gene locus_tag LOCUS_52260 195703 196725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 198864 196732 gene locus_tag LOCUS_52270 198864 196732 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975145.1 protein_id gnl|my_center|LOCUS_52270 198995 200764 gene locus_tag LOCUS_52280 gene aspS 198995 200764 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_52280 201210 200842 gene locus_tag LOCUS_52290 201210 200842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52290 203176 201296 gene locus_tag LOCUS_52300 203176 201296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 205209 203488 gene locus_tag LOCUS_52310 gene metG 205209 203488 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338224.1 protein_id gnl|my_center|LOCUS_52310 205584 205348 gene locus_tag LOCUS_52320 205584 205348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 205817 205581 gene locus_tag LOCUS_52330 205817 205581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 206053 206508 gene locus_tag LOCUS_52340 206053 206508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52340 206614 207267 gene locus_tag LOCUS_52350 206614 207267 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 protein_id gnl|my_center|LOCUS_52350 207264 208361 gene locus_tag LOCUS_52360 207264 208361 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 protein_id gnl|my_center|LOCUS_52360 209466 208303 gene locus_tag LOCUS_52370 209466 208303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 210989 209637 gene locus_tag LOCUS_52380 210989 209637 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027026.1 protein_id gnl|my_center|LOCUS_52380 211313 212593 gene locus_tag LOCUS_52390 211313 212593 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_52390 213736 212672 gene locus_tag LOCUS_52400 213736 212672 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_52400 214815 213826 gene locus_tag LOCUS_52410 214815 213826 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_52410 215070 215852 gene locus_tag LOCUS_52420 215070 215852 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227005.1 protein_id gnl|my_center|LOCUS_52420 215870 216643 gene locus_tag LOCUS_52430 215870 216643 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727787.1 protein_id gnl|my_center|LOCUS_52430 216842 217546 gene locus_tag LOCUS_52440 216842 217546 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_52440 218360 217761 gene locus_tag LOCUS_52450 218360 217761 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975467.1 protein_id gnl|my_center|LOCUS_52450 218608 218952 gene locus_tag LOCUS_52460 218608 218952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 219111 219554 gene locus_tag LOCUS_52470 gene rdlA 219111 219554 CDS product rodlin RdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976082.1 protein_id gnl|my_center|LOCUS_52470 219786 220244 gene locus_tag LOCUS_52480 gene rdlB 219786 220244 CDS product rodlin RdlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976081.1 protein_id gnl|my_center|LOCUS_52480 220580 220314 gene locus_tag LOCUS_52490 220580 220314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 221145 220735 gene locus_tag LOCUS_52500 221145 220735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52500 221386 221601 gene locus_tag LOCUS_52510 221386 221601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 221669 221887 gene locus_tag LOCUS_52520 221669 221887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52520 222013 224109 gene locus_tag LOCUS_52530 222013 224109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 224140 224775 gene locus_tag LOCUS_52540 224140 224775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 224841 225590 gene locus_tag LOCUS_52550 224841 225590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52550 227490 225613 gene locus_tag LOCUS_52560 227490 225613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52560 227623 230607 gene locus_tag LOCUS_52570 227623 230607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 231065 230778 gene locus_tag LOCUS_52580 231065 230778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 231387 231049 gene locus_tag LOCUS_52590 231387 231049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 231555 232037 gene locus_tag LOCUS_52600 231555 232037 CDS product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975252.1 protein_id gnl|my_center|LOCUS_52600 232638 232219 gene locus_tag LOCUS_52610 232638 232219 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_52610 233734 232631 gene locus_tag LOCUS_52620 gene arsB 233734 232631 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222674.1 protein_id gnl|my_center|LOCUS_52620 234108 233731 gene locus_tag LOCUS_52630 234108 233731 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112737.1 protein_id gnl|my_center|LOCUS_52630 234532 234461 gene locus_tag LOCUS_t00710 234532 234461 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 234789 234953 gene locus_tag LOCUS_52640 234789 234953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52640 235052 235627 gene locus_tag LOCUS_52650 gene dcd 235052 235627 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975261.1 protein_id gnl|my_center|LOCUS_52650 235672 236169 gene locus_tag LOCUS_52660 235672 236169 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975262.1 protein_id gnl|my_center|LOCUS_52660 237238 236327 gene locus_tag LOCUS_52670 237238 236327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52670 237890 237378 gene locus_tag LOCUS_52680 237890 237378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 240280 238007 gene locus_tag LOCUS_52690 240280 238007 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029156.1 protein_id gnl|my_center|LOCUS_52690 240570 242426 gene locus_tag LOCUS_52700 gene dnaK 240570 242426 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975268.1 protein_id gnl|my_center|LOCUS_52700 242423 243076 gene locus_tag LOCUS_52710 gene grpE 242423 243076 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975269.1 protein_id gnl|my_center|LOCUS_52710 243110 244288 gene locus_tag LOCUS_52720 gene dnaJ 243110 244288 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975270.1 protein_id gnl|my_center|LOCUS_52720 244292 244750 gene locus_tag LOCUS_52730 244292 244750 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975271.1 protein_id gnl|my_center|LOCUS_52730 245238 244807 gene locus_tag LOCUS_52740 245238 244807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326908.1 protein_id gnl|my_center|LOCUS_52740 245477 246328 gene locus_tag LOCUS_52750 gene whiJ 245477 246328 CDS product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 protein_id gnl|my_center|LOCUS_52750 246339 246533 gene locus_tag LOCUS_52760 246339 246533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 247051 246530 gene locus_tag LOCUS_52770 247051 246530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 protein_id gnl|my_center|LOCUS_52770 247591 247112 gene locus_tag LOCUS_52780 247591 247112 CDS product TIGR03618 family F420-dependent PPOX class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284874.1 protein_id gnl|my_center|LOCUS_52780 247691 250351 gene locus_tag LOCUS_52790 gene clpB 247691 250351 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975278.1 protein_id gnl|my_center|LOCUS_52790 250388 250963 gene locus_tag LOCUS_52800 250388 250963 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975279.1 protein_id gnl|my_center|LOCUS_52800 252222 250996 gene locus_tag LOCUS_52810 252222 250996 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_52810 252469 253707 gene locus_tag LOCUS_52820 252469 253707 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_52820 254077 253856 gene locus_tag LOCUS_52830 254077 253856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52830 254076 254594 gene locus_tag LOCUS_52840 254076 254594 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975282.1 protein_id gnl|my_center|LOCUS_52840 254680 256242 gene locus_tag LOCUS_52850 254680 256242 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029148.1 protein_id gnl|my_center|LOCUS_52850 257141 256230 gene locus_tag LOCUS_52860 257141 256230 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227588.1 protein_id gnl|my_center|LOCUS_52860 257273 257923 gene locus_tag LOCUS_52870 257273 257923 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526504.1 protein_id gnl|my_center|LOCUS_52870 258013 258789 gene locus_tag LOCUS_52880 258013 258789 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109029331.1 protein_id gnl|my_center|LOCUS_52880 258953 259732 gene locus_tag LOCUS_52890 258953 259732 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 protein_id gnl|my_center|LOCUS_52890 259737 260291 gene locus_tag LOCUS_52900 gene pyrE 259737 260291 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029143.1 protein_id gnl|my_center|LOCUS_52900 260488 261510 gene locus_tag LOCUS_52910 gene fbaA 260488 261510 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029142.1 protein_id gnl|my_center|LOCUS_52910 261643 263196 gene locus_tag LOCUS_52920 261643 263196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029141.1 protein_id gnl|my_center|LOCUS_52920 263275 263688 gene locus_tag LOCUS_52930 263275 263688 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975291.1 protein_id gnl|my_center|LOCUS_52930 263855 264676 gene locus_tag LOCUS_52940 263855 264676 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029139.1 protein_id gnl|my_center|LOCUS_52940 264669 265907 gene locus_tag LOCUS_52950 gene kynU 264669 265907 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029138.1 protein_id gnl|my_center|LOCUS_52950 265981 267294 gene locus_tag LOCUS_52960 265981 267294 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029134.1 protein_id gnl|my_center|LOCUS_52960 267291 267959 gene locus_tag LOCUS_52970 267291 267959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975300.1 protein_id gnl|my_center|LOCUS_52970 268923 267973 gene locus_tag LOCUS_52980 268923 267973 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029127.1 protein_id gnl|my_center|LOCUS_52980 269101 270387 gene locus_tag LOCUS_52990 269101 270387 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_52990 270490 271350 gene locus_tag LOCUS_53000 gene whiJ 270490 271350 CDS product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 protein_id gnl|my_center|LOCUS_53000 271364 271567 gene locus_tag LOCUS_53010 271364 271567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53010 271754 272179 gene locus_tag LOCUS_53020 271754 272179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53020 272176 272490 gene locus_tag LOCUS_53030 272176 272490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 272575 272817 gene locus_tag LOCUS_53040 272575 272817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53040 272817 273032 gene locus_tag LOCUS_53050 272817 273032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 274902 273136 gene locus_tag LOCUS_53060 274902 273136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 275232 275029 gene locus_tag LOCUS_53070 275232 275029 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975194.1 protein_id gnl|my_center|LOCUS_53070 275555 276910 gene locus_tag LOCUS_53080 275555 276910 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_53080 277104 277772 gene locus_tag LOCUS_53090 277104 277772 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777122.1 protein_id gnl|my_center|LOCUS_53090 277908 280385 gene locus_tag LOCUS_53100 277908 280385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 280551 281201 gene locus_tag LOCUS_53110 280551 281201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975315.1 protein_id gnl|my_center|LOCUS_53110 282021 281281 gene locus_tag LOCUS_53120 282021 281281 CDS product SLATT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029121.1 protein_id gnl|my_center|LOCUS_53120 282325 283572 gene locus_tag LOCUS_53130 gene purD 282325 283572 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029417.1 protein_id gnl|my_center|LOCUS_53130 283945 285555 gene locus_tag LOCUS_53140 283945 285555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 285731 287209 gene locus_tag LOCUS_53150 285731 287209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_53150 287279 288181 gene locus_tag LOCUS_53160 287279 288181 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974901.1 protein_id gnl|my_center|LOCUS_53160 288403 289116 gene locus_tag LOCUS_53170 288403 289116 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 protein_id gnl|my_center|LOCUS_53170 289113 290492 gene locus_tag LOCUS_53180 289113 290492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 290609 290536 gene locus_tag LOCUS_t00720 290609 290536 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 291282 290644 gene locus_tag LOCUS_53190 291282 290644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326755.1 protein_id gnl|my_center|LOCUS_53190 292853 291279 gene locus_tag LOCUS_53200 292853 291279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 293715 292885 gene locus_tag LOCUS_53210 293715 292885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974898.1 protein_id gnl|my_center|LOCUS_53210 294680 293715 gene locus_tag LOCUS_53220 294680 293715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974897.1 protein_id gnl|my_center|LOCUS_53220 294884 294811 gene locus_tag LOCUS_t00730 294884 294811 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 295745 295428 gene locus_tag LOCUS_53230 295745 295428 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974896.1 protein_id gnl|my_center|LOCUS_53230 296087 296308 gene locus_tag LOCUS_53240 gene purS 296087 296308 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974895.1 protein_id gnl|my_center|LOCUS_53240 296305 296988 gene locus_tag LOCUS_53250 gene purQ 296305 296988 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974894.1 protein_id gnl|my_center|LOCUS_53250 296985 299258 gene locus_tag LOCUS_53260 gene purL 296985 299258 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974893.1 protein_id gnl|my_center|LOCUS_53260 299366 300211 gene locus_tag LOCUS_53270 299366 300211 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974888.1 protein_id gnl|my_center|LOCUS_53270 300358 301875 gene locus_tag LOCUS_53280 gene purF 300358 301875 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872463.1 protein_id gnl|my_center|LOCUS_53280 301915 302982 gene locus_tag LOCUS_53290 gene purM 301915 302982 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974885.1 protein_id gnl|my_center|LOCUS_53290 303435 303172 gene locus_tag LOCUS_53300 303435 303172 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974884.1 protein_id gnl|my_center|LOCUS_53300 305020 303866 gene locus_tag LOCUS_53310 305020 303866 CDS product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029424.1 protein_id gnl|my_center|LOCUS_53310 305214 306080 gene locus_tag LOCUS_53320 305214 306080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974882.1 protein_id gnl|my_center|LOCUS_53320 306572 306778 gene locus_tag LOCUS_53330 gene bldC 306572 306778 CDS product developmental transcriptional regulator BldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_53330 307464 307282 gene locus_tag LOCUS_53340 307464 307282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 307727 307652 gene locus_tag LOCUS_t00740 307727 307652 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 311809 307850 gene locus_tag LOCUS_53350 gene hrpA 311809 307850 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029425.1 protein_id gnl|my_center|LOCUS_53350 312123 312049 gene locus_tag LOCUS_t00750 312123 312049 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 312223 312148 gene locus_tag LOCUS_t00760 312223 312148 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 312335 312262 gene locus_tag LOCUS_t00770 312335 312262 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 312417 312824 gene locus_tag LOCUS_53360 312417 312824 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_53360 312932 313435 gene locus_tag LOCUS_53370 312932 313435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53370 315408 315666 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcttccgccgcgacgaccgcc 316050 316124 gene locus_tag LOCUS_t00780 316050 316124 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 316365 316120 gene locus_tag LOCUS_53380 316365 316120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 316519 316941 gene locus_tag LOCUS_53390 316519 316941 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_53390 317613 316963 gene locus_tag LOCUS_53400 317613 316963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 317747 318307 gene locus_tag LOCUS_53410 317747 318307 CDS product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975254.1 protein_id gnl|my_center|LOCUS_53410 318396 318680 gene locus_tag LOCUS_53420 318396 318680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 318779 319027 gene locus_tag LOCUS_53430 318779 319027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 <320096 319299 gene locus_tag LOCUS_53440 <320096 319299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029795.1:elongation factor Tu >Feature sequence10 1124 177 gene locus_tag LOCUS_53450 1124 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 1935 1276 gene locus_tag LOCUS_53460 1935 1276 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728216.1 protein_id gnl|my_center|LOCUS_53460 2142 2894 gene locus_tag LOCUS_53470 2142 2894 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972638.1 protein_id gnl|my_center|LOCUS_53470 2992 4599 gene locus_tag LOCUS_53480 2992 4599 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030791.1 protein_id gnl|my_center|LOCUS_53480 7065 4684 gene locus_tag LOCUS_53490 7065 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 7628 7293 gene locus_tag LOCUS_53500 7628 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53500 8171 7752 gene locus_tag LOCUS_53510 8171 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 9736 8267 gene locus_tag LOCUS_53520 9736 8267 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_53520 10266 9886 gene locus_tag LOCUS_53530 10266 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 10612 24378 gene locus_tag LOCUS_53540 10612 24378 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030787.1 protein_id gnl|my_center|LOCUS_53540 24511 30030 gene locus_tag LOCUS_53550 24511 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 30070 36537 gene locus_tag LOCUS_53560 30070 36537 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030785.1 protein_id gnl|my_center|LOCUS_53560 36622 37389 gene locus_tag LOCUS_53570 36622 37389 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_53570 38398 37379 gene locus_tag LOCUS_53580 38398 37379 CDS product ScbA/BarX family gamma-butyrolactone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190059139.1 protein_id gnl|my_center|LOCUS_53580 38469 39191 gene locus_tag LOCUS_53590 38469 39191 CDS product ScbR family autoregulator-binding transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972660.1 protein_id gnl|my_center|LOCUS_53590 39499 40692 gene locus_tag LOCUS_53600 39499 40692 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083703.1 protein_id gnl|my_center|LOCUS_53600 41232 40729 gene locus_tag LOCUS_53610 41232 40729 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_53610 41484 43142 gene locus_tag LOCUS_53620 41484 43142 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972641.1 protein_id gnl|my_center|LOCUS_53620 43414 44256 gene locus_tag LOCUS_53630 43414 44256 CDS product AfsR/SARP family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972637.1 protein_id gnl|my_center|LOCUS_53630 44893 44315 gene locus_tag LOCUS_53640 44893 44315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 45981 45091 gene locus_tag LOCUS_53650 45981 45091 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 protein_id gnl|my_center|LOCUS_53650 46236 47411 gene locus_tag LOCUS_53660 46236 47411 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228609.1 protein_id gnl|my_center|LOCUS_53660 47593 47814 gene locus_tag LOCUS_53670 47593 47814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 47947 47872 gene locus_tag LOCUS_t00790 47947 47872 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 49760 48045 gene locus_tag LOCUS_53680 49760 48045 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975395.1 protein_id gnl|my_center|LOCUS_53680 51274 50054 gene locus_tag LOCUS_53690 51274 50054 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975394.1 protein_id gnl|my_center|LOCUS_53690 54896 51444 gene locus_tag LOCUS_53700 54896 51444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 57976 55115 gene locus_tag LOCUS_53710 gene topA 57976 55115 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029075.1 protein_id gnl|my_center|LOCUS_53710 56261 56172 gene locus_tag LOCUS_t00800 56261 56172 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 59877 58351 gene locus_tag LOCUS_53720 59877 58351 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975390.1 protein_id gnl|my_center|LOCUS_53720 60550 59969 gene locus_tag LOCUS_53730 60550 59969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975389.1 protein_id gnl|my_center|LOCUS_53730 63125 60735 gene locus_tag LOCUS_53740 63125 60735 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029076.1 protein_id gnl|my_center|LOCUS_53740 64076 63591 gene locus_tag LOCUS_53750 64076 63591 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975387.1 protein_id gnl|my_center|LOCUS_53750 64620 64279 gene locus_tag LOCUS_53760 gene bldG 64620 64279 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_53760 64924 67230 gene locus_tag LOCUS_53770 64924 67230 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485160.1 protein_id gnl|my_center|LOCUS_53770 67661 67305 gene locus_tag LOCUS_53780 67661 67305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53780 68007 67639 gene locus_tag LOCUS_53790 68007 67639 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485162.1 protein_id gnl|my_center|LOCUS_53790 68224 67994 gene locus_tag LOCUS_53800 68224 67994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 69169 68342 gene locus_tag LOCUS_53810 69169 68342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 70119 69166 gene locus_tag LOCUS_53820 70119 69166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 70541 70116 gene locus_tag LOCUS_53830 70541 70116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53830 70881 73124 gene locus_tag LOCUS_53840 70881 73124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53840 73376 73080 gene locus_tag LOCUS_53850 73376 73080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 73850 73632 gene locus_tag LOCUS_53860 73850 73632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 74722 73847 gene locus_tag LOCUS_53870 74722 73847 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_53870 74923 75396 gene locus_tag LOCUS_53880 74923 75396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53880 75380 75718 gene locus_tag LOCUS_53890 75380 75718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53890 75864 76043 gene locus_tag LOCUS_53900 75864 76043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 76040 77860 gene locus_tag LOCUS_53910 76040 77860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53910 77882 78139 gene locus_tag LOCUS_53920 77882 78139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 78136 78573 gene locus_tag LOCUS_53930 78136 78573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 78570 79721 gene locus_tag LOCUS_53940 78570 79721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 80311 79913 gene locus_tag LOCUS_53950 80311 79913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 82683 80311 gene locus_tag LOCUS_53960 82683 80311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53960 84656 82680 gene locus_tag LOCUS_53970 84656 82680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 86146 84656 gene locus_tag LOCUS_53980 86146 84656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 86934 86209 gene locus_tag LOCUS_53990 86934 86209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 88040 86931 gene locus_tag LOCUS_54000 88040 86931 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029084.1 protein_id gnl|my_center|LOCUS_54000 88491 89333 gene locus_tag LOCUS_54010 88491 89333 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270110.1 protein_id gnl|my_center|LOCUS_54010 90514 89693 gene locus_tag LOCUS_54020 90514 89693 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975377.1 protein_id gnl|my_center|LOCUS_54020 90616 91608 gene locus_tag LOCUS_54030 90616 91608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326561.1 protein_id gnl|my_center|LOCUS_54030 92809 91589 gene locus_tag LOCUS_54040 92809 91589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029086.1 protein_id gnl|my_center|LOCUS_54040 93106 95088 gene locus_tag LOCUS_54050 93106 95088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 95351 97318 gene locus_tag LOCUS_54060 gene acs 95351 97318 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975373.1 protein_id gnl|my_center|LOCUS_54060 97539 98936 gene locus_tag LOCUS_54070 gene nhaA 97539 98936 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029088.1 protein_id gnl|my_center|LOCUS_54070 99038 99496 gene locus_tag LOCUS_54080 99038 99496 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975371.1 protein_id gnl|my_center|LOCUS_54080 99493 100488 gene locus_tag LOCUS_54090 99493 100488 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029089.1 protein_id gnl|my_center|LOCUS_54090 100586 100804 gene locus_tag LOCUS_54100 100586 100804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54100 102169 100970 gene locus_tag LOCUS_54110 102169 100970 CDS product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136209493.1 protein_id gnl|my_center|LOCUS_54110 103066 102263 gene locus_tag LOCUS_54120 103066 102263 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_54120 103887 103063 gene locus_tag LOCUS_54130 103887 103063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 103784 104026 gene locus_tag LOCUS_54140 103784 104026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 104195 104869 gene locus_tag LOCUS_54150 104195 104869 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_54150 105798 104968 gene locus_tag LOCUS_54160 105798 104968 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975364.1 protein_id gnl|my_center|LOCUS_54160 106700 105795 gene locus_tag LOCUS_54170 106700 105795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_54170 107263 106799 gene locus_tag LOCUS_54180 107263 106799 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975361.1 protein_id gnl|my_center|LOCUS_54180 107520 107260 gene locus_tag LOCUS_54190 107520 107260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 107519 108541 gene locus_tag LOCUS_54200 107519 108541 CDS product ArsA-related P-loop ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_54200 108538 110253 gene locus_tag LOCUS_54210 108538 110253 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029096.1 protein_id gnl|my_center|LOCUS_54210 110853 110467 gene locus_tag LOCUS_54220 gene wblA 110853 110467 CDS product transcriptional regulator WblA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029097.1 protein_id gnl|my_center|LOCUS_54220 111188 113527 gene locus_tag LOCUS_54230 111188 113527 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930028.1 protein_id gnl|my_center|LOCUS_54230 114096 113632 gene locus_tag LOCUS_54240 114096 113632 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975355.1 protein_id gnl|my_center|LOCUS_54240 114407 115333 gene locus_tag LOCUS_54250 114407 115333 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 protein_id gnl|my_center|LOCUS_54250 115371 116156 gene locus_tag LOCUS_54260 115371 116156 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029099.1 protein_id gnl|my_center|LOCUS_54260 116203 116277 gene locus_tag LOCUS_t00810 116203 116277 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 118052 116541 gene locus_tag LOCUS_54270 118052 116541 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208613552.1 protein_id gnl|my_center|LOCUS_54270 118457 118065 gene locus_tag LOCUS_54280 118457 118065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 118909 118544 gene locus_tag LOCUS_54290 118909 118544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54290 119209 118964 gene locus_tag LOCUS_54300 119209 118964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54300 119478 119284 gene locus_tag LOCUS_54310 119478 119284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54310 119752 119501 gene locus_tag LOCUS_54320 119752 119501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 121939 119894 gene locus_tag LOCUS_54330 121939 119894 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230500.1 protein_id gnl|my_center|LOCUS_54330 122411 122037 gene locus_tag LOCUS_54340 122411 122037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 122770 123558 gene locus_tag LOCUS_54350 122770 123558 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029278.1 protein_id gnl|my_center|LOCUS_54350 123555 124328 gene locus_tag LOCUS_54360 123555 124328 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897093.1 protein_id gnl|my_center|LOCUS_54360 125076 124318 gene locus_tag LOCUS_54370 125076 124318 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028876.1 protein_id gnl|my_center|LOCUS_54370 125157 125441 gene locus_tag LOCUS_54380 125157 125441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029354.1 protein_id gnl|my_center|LOCUS_54380 125447 125761 gene locus_tag LOCUS_54390 125447 125761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 125761 126834 gene locus_tag LOCUS_54400 125761 126834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 126831 127022 gene locus_tag LOCUS_54410 126831 127022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 128019 127096 gene locus_tag LOCUS_54420 128019 127096 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029280.1 protein_id gnl|my_center|LOCUS_54420 129606 130445 gene locus_tag LOCUS_54430 129606 130445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 131171 133123 gene locus_tag LOCUS_54440 131171 133123 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975329.1 protein_id gnl|my_center|LOCUS_54440 133243 133590 gene locus_tag LOCUS_54450 133243 133590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54450 135158 133947 gene locus_tag LOCUS_54460 135158 133947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029120.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54460 135655 135155 gene locus_tag LOCUS_54470 135655 135155 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975326.1 protein_id gnl|my_center|LOCUS_54470 137425 136277 gene locus_tag LOCUS_54480 137425 136277 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975325.1 protein_id gnl|my_center|LOCUS_54480 138693 137422 gene locus_tag LOCUS_54490 138693 137422 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975324.1 protein_id gnl|my_center|LOCUS_54490 139197 138820 gene locus_tag LOCUS_54500 139197 138820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978453.1 protein_id gnl|my_center|LOCUS_54500 139418 139194 gene locus_tag LOCUS_54510 139418 139194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54510 140263 139442 gene locus_tag LOCUS_54520 140263 139442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 140771 140502 gene locus_tag LOCUS_54530 140771 140502 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030672.1 protein_id gnl|my_center|LOCUS_54530 141589 140768 gene locus_tag LOCUS_54540 141589 140768 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031055.1 protein_id gnl|my_center|LOCUS_54540 141679 142122 gene locus_tag LOCUS_54550 141679 142122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 142317 143189 gene locus_tag LOCUS_54560 142317 143189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 143195 144196 gene locus_tag LOCUS_54570 143195 144196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 144935 144261 gene locus_tag LOCUS_54580 144935 144261 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975322.1 protein_id gnl|my_center|LOCUS_54580 145527 144928 gene locus_tag LOCUS_54590 gene recR 145527 144928 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_54590 145942 145604 gene locus_tag LOCUS_54600 145942 145604 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975320.1 protein_id gnl|my_center|LOCUS_54600 148701 146194 gene locus_tag LOCUS_54610 148701 146194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 149003 149090 gene locus_tag LOCUS_t00820 149003 149090 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 149588 151042 gene locus_tag LOCUS_54620 149588 151042 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_54620 151119 151724 gene locus_tag LOCUS_54630 151119 151724 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_54630 152194 152682 gene locus_tag LOCUS_54640 152194 152682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 152832 154277 gene locus_tag LOCUS_54650 152832 154277 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_54650 154659 154829 gene locus_tag LOCUS_54660 gene rpmF 154659 154829 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978430.1 protein_id gnl|my_center|LOCUS_54660 154835 155977 gene locus_tag LOCUS_54670 gene zigA 154835 155977 CDS product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165446171.1 protein_id gnl|my_center|LOCUS_54670 156568 156131 gene locus_tag LOCUS_54680 156568 156131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 156847 157086 gene locus_tag LOCUS_54690 156847 157086 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113056.1 protein_id gnl|my_center|LOCUS_54690 157188 159458 gene locus_tag LOCUS_54700 157188 159458 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028547.1 protein_id gnl|my_center|LOCUS_54700 159620 160300 gene locus_tag LOCUS_54710 159620 160300 CDS product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400959.1 protein_id gnl|my_center|LOCUS_54710 160781 160227 gene locus_tag LOCUS_54720 160781 160227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 161813 160881 gene locus_tag LOCUS_54730 161813 160881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 162259 161810 gene locus_tag LOCUS_54740 162259 161810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 162486 163574 gene locus_tag LOCUS_54750 162486 163574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54750 163666 164271 gene locus_tag LOCUS_54760 163666 164271 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974916.1 protein_id gnl|my_center|LOCUS_54760 164340 164543 gene locus_tag LOCUS_54770 164340 164543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 164744 165040 gene locus_tag LOCUS_54780 164744 165040 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003999914.1 protein_id gnl|my_center|LOCUS_54780 165164 165886 gene locus_tag LOCUS_54790 165164 165886 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974920.1 protein_id gnl|my_center|LOCUS_54790 166658 166023 gene locus_tag LOCUS_54800 gene upp 166658 166023 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974921.1 protein_id gnl|my_center|LOCUS_54800 166806 167072 gene locus_tag LOCUS_54810 166806 167072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 167307 167840 gene locus_tag LOCUS_54820 167307 167840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974923.1 protein_id gnl|my_center|LOCUS_54820 167875 168372 gene locus_tag LOCUS_54830 gene tadA 167875 168372 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974924.1 protein_id gnl|my_center|LOCUS_54830 168454 168541 gene locus_tag LOCUS_t00830 168454 168541 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 171118 168599 gene locus_tag LOCUS_54840 171118 168599 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975721.1 protein_id gnl|my_center|LOCUS_54840 171943 171155 gene locus_tag LOCUS_54850 171943 171155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_54850 172723 172106 gene locus_tag LOCUS_54860 172723 172106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 173528 172815 gene locus_tag LOCUS_54870 173528 172815 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 protein_id gnl|my_center|LOCUS_54870 173720 173953 gene locus_tag LOCUS_54880 173720 173953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54880 175761 173866 gene locus_tag LOCUS_54890 175761 173866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 176376 176915 gene locus_tag LOCUS_54900 176376 176915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 176988 177521 gene locus_tag LOCUS_54910 176988 177521 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229589.1 protein_id gnl|my_center|LOCUS_54910 177518 179131 gene locus_tag LOCUS_54920 177518 179131 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229590.1 protein_id gnl|my_center|LOCUS_54920 179200 180207 gene locus_tag LOCUS_54930 179200 180207 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030870088.1 protein_id gnl|my_center|LOCUS_54930 180255 180836 gene locus_tag LOCUS_54940 180255 180836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54940 180902 181885 gene locus_tag LOCUS_54950 180902 181885 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775774.1 protein_id gnl|my_center|LOCUS_54950 181947 183224 gene locus_tag LOCUS_54960 181947 183224 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227234.1 protein_id gnl|my_center|LOCUS_54960 183270 184571 gene locus_tag LOCUS_54970 183270 184571 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227218.1 protein_id gnl|my_center|LOCUS_54970 184589 185890 gene locus_tag LOCUS_54980 184589 185890 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_54980 185896 187182 gene locus_tag LOCUS_54990 185896 187182 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_54990 187203 188483 gene locus_tag LOCUS_55000 187203 188483 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227218.1 protein_id gnl|my_center|LOCUS_55000 188497 189774 gene locus_tag LOCUS_55010 188497 189774 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_55010 189794 191065 gene locus_tag LOCUS_55020 189794 191065 CDS product DUF1205 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227238.1 protein_id gnl|my_center|LOCUS_55020 191829 191128 gene locus_tag LOCUS_55030 191829 191128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886572.1 protein_id gnl|my_center|LOCUS_55030 192999 191902 gene locus_tag LOCUS_55040 192999 191902 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030770.1 protein_id gnl|my_center|LOCUS_55040 193396 194931 gene locus_tag LOCUS_55050 193396 194931 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257231.1 protein_id gnl|my_center|LOCUS_55050 194943 195986 gene locus_tag LOCUS_55060 gene sbnA 194943 195986 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921742.1 protein_id gnl|my_center|LOCUS_55060 195980 196978 gene locus_tag LOCUS_55070 gene sbnB 195980 196978 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225889.1 protein_id gnl|my_center|LOCUS_55070 198043 197051 gene locus_tag LOCUS_55080 198043 197051 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222572.1 protein_id gnl|my_center|LOCUS_55080 198738 198112 gene locus_tag LOCUS_55090 198738 198112 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222570.1 protein_id gnl|my_center|LOCUS_55090 200193 198817 gene locus_tag LOCUS_55100 200193 198817 CDS product NDP-hexose 2,3-dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043781848.1 protein_id gnl|my_center|LOCUS_55100 201308 200199 gene locus_tag LOCUS_55110 201308 200199 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_55110 201881 201351 gene locus_tag LOCUS_55120 201881 201351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 202146 202469 gene locus_tag LOCUS_55130 202146 202469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55130 202476 202697 gene locus_tag LOCUS_55140 202476 202697 CDS product MbtH family NRPS accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226625.1 protein_id gnl|my_center|LOCUS_55140 202756 207825 gene locus_tag LOCUS_55150 202756 207825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55150 207822 214334 gene locus_tag LOCUS_55160 207822 214334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55160 214339 215265 gene locus_tag LOCUS_55170 gene argF 214339 215265 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_55170 216405 215425 gene locus_tag LOCUS_55180 216405 215425 CDS product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 protein_id gnl|my_center|LOCUS_55180 216689 217918 gene locus_tag LOCUS_55190 216689 217918 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_55190 217967 218842 gene locus_tag LOCUS_55200 gene rfbA 217967 218842 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227213.1 protein_id gnl|my_center|LOCUS_55200 218903 220048 gene locus_tag LOCUS_55210 218903 220048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 220053 221573 gene locus_tag LOCUS_55220 220053 221573 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403486.1 protein_id gnl|my_center|LOCUS_55220 221650 222384 gene locus_tag LOCUS_55230 221650 222384 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_55230 222381 223367 gene locus_tag LOCUS_55240 gene rfbB 222381 223367 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071386332.1 protein_id gnl|my_center|LOCUS_55240 223364 224305 gene locus_tag LOCUS_55250 gene rfbD 223364 224305 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222918.1 protein_id gnl|my_center|LOCUS_55250 224287 224913 gene locus_tag LOCUS_55260 224287 224913 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229701.1 protein_id gnl|my_center|LOCUS_55260 224910 226154 gene locus_tag LOCUS_55270 gene mgt 224910 226154 CDS product macrolide-inactivating glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972830.1 protein_id gnl|my_center|LOCUS_55270 226476 227858 gene locus_tag LOCUS_55280 226476 227858 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_55280 227845 229221 gene locus_tag LOCUS_55290 227845 229221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 229772 229287 gene locus_tag LOCUS_55300 229772 229287 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028555.1 protein_id gnl|my_center|LOCUS_55300 229905 230804 gene locus_tag LOCUS_55310 229905 230804 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028554.1 protein_id gnl|my_center|LOCUS_55310 230877 233915 gene locus_tag LOCUS_55320 gene afsR 230877 233915 CDS product transcriptional regulator AfsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029645.1 protein_id gnl|my_center|LOCUS_55320 234578 234204 gene locus_tag LOCUS_55330 234578 234204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 235152 235313 gene locus_tag LOCUS_55340 235152 235313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052836888.1 protein_id gnl|my_center|LOCUS_55340 235326 235619 gene locus_tag LOCUS_55350 235326 235619 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974926.1 protein_id gnl|my_center|LOCUS_55350 235776 236789 gene locus_tag LOCUS_55360 235776 236789 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029398.1 protein_id gnl|my_center|LOCUS_55360 236979 237812 gene locus_tag LOCUS_55370 236979 237812 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974928.1 protein_id gnl|my_center|LOCUS_55370 237858 238343 gene locus_tag LOCUS_55380 237858 238343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55380 238685 238428 gene locus_tag LOCUS_55390 238685 238428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55390 238875 239369 gene locus_tag LOCUS_55400 238875 239369 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029397.1 protein_id gnl|my_center|LOCUS_55400 239392 241029 gene locus_tag LOCUS_55410 239392 241029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55410 242311 241523 gene locus_tag LOCUS_55420 242311 241523 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029392.1 protein_id gnl|my_center|LOCUS_55420 243908 242376 gene locus_tag LOCUS_55430 243908 242376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029391.1 protein_id gnl|my_center|LOCUS_55430 244889 244020 gene locus_tag LOCUS_55440 244889 244020 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863629.1 protein_id gnl|my_center|LOCUS_55440 244907 245797 gene locus_tag LOCUS_55450 244907 245797 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 protein_id gnl|my_center|LOCUS_55450 245919 245845 gene locus_tag LOCUS_t00840 245919 245845 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 246019 245946 gene locus_tag LOCUS_t00850 246019 245946 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 246313 246222 gene locus_tag LOCUS_t00860 246313 246222 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 246644 246387 gene locus_tag LOCUS_55460 246644 246387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 246534 246995 gene locus_tag LOCUS_55470 246534 246995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55470 247210 252261 gene locus_tag LOCUS_55480 247210 252261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55480 252945 252322 gene locus_tag LOCUS_55490 252945 252322 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029378.1 protein_id gnl|my_center|LOCUS_55490 253042 254310 gene locus_tag LOCUS_55500 253042 254310 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029377.1 protein_id gnl|my_center|LOCUS_55500 254443 256110 gene locus_tag LOCUS_55510 254443 256110 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029376.1 protein_id gnl|my_center|LOCUS_55510 256596 256144 gene locus_tag LOCUS_55520 256596 256144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 257759 256935 gene locus_tag LOCUS_55530 257759 256935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 258953 257814 gene locus_tag LOCUS_55540 258953 257814 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 protein_id gnl|my_center|LOCUS_55540 259354 258950 gene locus_tag LOCUS_55550 259354 258950 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064825.1 protein_id gnl|my_center|LOCUS_55550 260268 259351 gene locus_tag LOCUS_55560 260268 259351 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224382.1 protein_id gnl|my_center|LOCUS_55560 260743 260417 gene locus_tag LOCUS_55570 260743 260417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 261294 261956 gene locus_tag LOCUS_55580 261294 261956 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030194.1 protein_id gnl|my_center|LOCUS_55580 262216 263133 gene locus_tag LOCUS_55590 262216 263133 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_55590 >Feature sequence11 1576 125 gene locus_tag LOCUS_55600 gene aspA 1576 125 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224033.1 protein_id gnl|my_center|LOCUS_55600 2661 1651 gene locus_tag LOCUS_55610 2661 1651 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973324.1 protein_id gnl|my_center|LOCUS_55610 2836 3267 gene locus_tag LOCUS_55620 2836 3267 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975474.1 protein_id gnl|my_center|LOCUS_55620 3320 3976 gene locus_tag LOCUS_55630 3320 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55630 4529 4035 gene locus_tag LOCUS_55640 4529 4035 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028699.1 protein_id gnl|my_center|LOCUS_55640 4646 5059 gene locus_tag LOCUS_55650 4646 5059 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975825.1 protein_id gnl|my_center|LOCUS_55650 5453 6880 gene locus_tag LOCUS_55660 5453 6880 CDS product family 2B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225101.1 protein_id gnl|my_center|LOCUS_55660 6921 8168 gene locus_tag LOCUS_55670 6921 8168 CDS product family 2 encapsulin nanocompartment cargo protein terpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225102.1 protein_id gnl|my_center|LOCUS_55670 8194 9057 gene locus_tag LOCUS_55680 8194 9057 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225103.1 protein_id gnl|my_center|LOCUS_55680 9240 9070 gene locus_tag LOCUS_55690 9240 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 9422 10129 gene locus_tag LOCUS_55700 9422 10129 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776513.1 protein_id gnl|my_center|LOCUS_55700 10300 10533 gene locus_tag LOCUS_55710 10300 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 10770 12377 gene locus_tag LOCUS_55720 10770 12377 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_55720 12447 13244 gene locus_tag LOCUS_55730 12447 13244 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705555.1 protein_id gnl|my_center|LOCUS_55730 13299 14021 gene locus_tag LOCUS_55740 13299 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55740 14521 14081 gene locus_tag LOCUS_55750 14521 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 15560 14628 gene locus_tag LOCUS_55760 15560 14628 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223519.1 protein_id gnl|my_center|LOCUS_55760 15702 16931 gene locus_tag LOCUS_55770 15702 16931 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728773.1 protein_id gnl|my_center|LOCUS_55770 17839 16937 gene locus_tag LOCUS_55780 17839 16937 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_55780 18045 18791 gene locus_tag LOCUS_55790 18045 18791 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868693.1 protein_id gnl|my_center|LOCUS_55790 19830 18775 gene locus_tag LOCUS_55800 19830 18775 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_55800 20695 19934 gene locus_tag LOCUS_55810 20695 19934 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028079.1 protein_id gnl|my_center|LOCUS_55810 22384 20744 gene locus_tag LOCUS_55820 22384 20744 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031132.1 protein_id gnl|my_center|LOCUS_55820 23037 24701 gene locus_tag LOCUS_55830 23037 24701 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550958.1 protein_id gnl|my_center|LOCUS_55830 24921 24709 gene locus_tag LOCUS_55840 24921 24709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55840 24998 25414 gene locus_tag LOCUS_55850 24998 25414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55850 26821 25448 gene locus_tag LOCUS_55860 26821 25448 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389555.1 protein_id gnl|my_center|LOCUS_55860 28518 26857 gene locus_tag LOCUS_55870 28518 26857 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143234.1 protein_id gnl|my_center|LOCUS_55870 29521 28643 gene locus_tag LOCUS_55880 29521 28643 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113074.1 protein_id gnl|my_center|LOCUS_55880 30759 29578 gene locus_tag LOCUS_55890 30759 29578 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027238.1 protein_id gnl|my_center|LOCUS_55890 31038 31310 gene locus_tag LOCUS_55900 31038 31310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55900 31437 32267 gene locus_tag LOCUS_55910 31437 32267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 32200 33174 gene locus_tag LOCUS_55920 gene pip 32200 33174 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226797.1 protein_id gnl|my_center|LOCUS_55920 34709 33183 gene locus_tag LOCUS_55930 34709 33183 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899485.1 protein_id gnl|my_center|LOCUS_55930 34968 35834 gene locus_tag LOCUS_55940 34968 35834 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892867.1 protein_id gnl|my_center|LOCUS_55940 36928 35810 gene locus_tag LOCUS_55950 36928 35810 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326766.1 protein_id gnl|my_center|LOCUS_55950 38050 37088 gene locus_tag LOCUS_55960 38050 37088 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 protein_id gnl|my_center|LOCUS_55960 38327 38587 gene locus_tag LOCUS_55970 38327 38587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55970 39861 38818 gene locus_tag LOCUS_55980 39861 38818 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229442.1 protein_id gnl|my_center|LOCUS_55980 40000 40953 gene locus_tag LOCUS_55990 40000 40953 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467673.1 protein_id gnl|my_center|LOCUS_55990 41077 41562 gene locus_tag LOCUS_56000 41077 41562 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_56000 43008 41701 gene locus_tag LOCUS_56010 43008 41701 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899846.1 protein_id gnl|my_center|LOCUS_56010 43142 43807 gene locus_tag LOCUS_56020 43142 43807 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973445.1 protein_id gnl|my_center|LOCUS_56020 43895 45025 gene locus_tag LOCUS_56030 43895 45025 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227324.1 protein_id gnl|my_center|LOCUS_56030 45046 46296 gene locus_tag LOCUS_56040 45046 46296 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974677.1 protein_id gnl|my_center|LOCUS_56040 46349 46963 gene locus_tag LOCUS_56050 46349 46963 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225405.1 protein_id gnl|my_center|LOCUS_56050 47026 47101 gene locus_tag LOCUS_t00870 47026 47101 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 47218 48399 gene locus_tag LOCUS_56060 47218 48399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56060 49952 48465 gene locus_tag LOCUS_56070 49952 48465 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225412.1 protein_id gnl|my_center|LOCUS_56070 50995 49949 gene locus_tag LOCUS_56080 50995 49949 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228152.1 protein_id gnl|my_center|LOCUS_56080 51759 51022 gene locus_tag LOCUS_56090 51759 51022 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228151.1 protein_id gnl|my_center|LOCUS_56090 51841 52761 gene locus_tag LOCUS_56100 51841 52761 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568594.1 protein_id gnl|my_center|LOCUS_56100 54583 53084 gene locus_tag LOCUS_56110 54583 53084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 54983 54654 gene locus_tag LOCUS_56120 54983 54654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56120 54934 56250 gene locus_tag LOCUS_56130 54934 56250 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972427.1 protein_id gnl|my_center|LOCUS_56130 56384 56986 gene locus_tag LOCUS_56140 56384 56986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 57772 57107 gene locus_tag LOCUS_56150 57772 57107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 58529 57948 gene locus_tag LOCUS_56160 58529 57948 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222489.1 protein_id gnl|my_center|LOCUS_56160 58617 59540 gene locus_tag LOCUS_56170 58617 59540 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230083.1 protein_id gnl|my_center|LOCUS_56170 59799 60257 gene locus_tag LOCUS_56180 59799 60257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 60250 61563 gene locus_tag LOCUS_56190 60250 61563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 62263 61568 gene locus_tag LOCUS_56200 62263 61568 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208677.1 protein_id gnl|my_center|LOCUS_56200 62375 63217 gene locus_tag LOCUS_56210 62375 63217 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027480.1 protein_id gnl|my_center|LOCUS_56210 63310 64548 gene locus_tag LOCUS_56220 63310 64548 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973365.1 protein_id gnl|my_center|LOCUS_56220 64653 65231 gene locus_tag LOCUS_56230 64653 65231 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_56230 65311 67032 gene locus_tag LOCUS_56240 65311 67032 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223446.1 protein_id gnl|my_center|LOCUS_56240 68646 67102 gene locus_tag LOCUS_56250 68646 67102 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028977.1 protein_id gnl|my_center|LOCUS_56250 69589 68834 gene locus_tag LOCUS_56260 69589 68834 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226761.1 protein_id gnl|my_center|LOCUS_56260 69732 71288 gene locus_tag LOCUS_56270 69732 71288 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030843.1 protein_id gnl|my_center|LOCUS_56270 71915 71310 gene locus_tag LOCUS_56280 71915 71310 CDS product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027096.1 protein_id gnl|my_center|LOCUS_56280 72594 72013 gene locus_tag LOCUS_56290 72594 72013 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027171.1 protein_id gnl|my_center|LOCUS_56290 72755 73723 gene locus_tag LOCUS_56300 72755 73723 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 protein_id gnl|my_center|LOCUS_56300 73866 73648 gene locus_tag LOCUS_56310 73866 73648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 73891 74064 gene locus_tag LOCUS_56320 73891 74064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 74769 74287 gene locus_tag LOCUS_56330 74769 74287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56330 75772 76071 gene locus_tag LOCUS_56340 75772 76071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 76311 76108 gene locus_tag LOCUS_56350 76311 76108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 76409 77254 gene locus_tag LOCUS_56360 76409 77254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 78319 77264 gene locus_tag LOCUS_56370 78319 77264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 78416 79057 gene locus_tag LOCUS_56380 78416 79057 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930138.1 protein_id gnl|my_center|LOCUS_56380 79725 79132 gene locus_tag LOCUS_56390 79725 79132 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974324.1 protein_id gnl|my_center|LOCUS_56390 79854 80645 gene locus_tag LOCUS_56400 79854 80645 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029786.1 protein_id gnl|my_center|LOCUS_56400 81334 80642 gene locus_tag LOCUS_56410 81334 80642 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 protein_id gnl|my_center|LOCUS_56410 81400 82395 gene locus_tag LOCUS_56420 81400 82395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 82515 85664 gene locus_tag LOCUS_56430 82515 85664 CDS product patatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230321.1 protein_id gnl|my_center|LOCUS_56430 85754 86182 gene locus_tag LOCUS_56440 85754 86182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56440 86225 90457 gene locus_tag LOCUS_56450 86225 90457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 90472 90990 gene locus_tag LOCUS_56460 90472 90990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 91193 91011 gene locus_tag LOCUS_56470 91193 91011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 91102 91323 gene locus_tag LOCUS_56480 91102 91323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 91508 93400 gene locus_tag LOCUS_56490 91508 93400 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027064.1 protein_id gnl|my_center|LOCUS_56490 94038 93460 gene locus_tag LOCUS_56500 94038 93460 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975690.1 protein_id gnl|my_center|LOCUS_56500 95477 94362 gene locus_tag LOCUS_56510 95477 94362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 95653 96153 gene locus_tag LOCUS_56520 95653 96153 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193779.1 protein_id gnl|my_center|LOCUS_56520 96305 96880 gene locus_tag LOCUS_56530 96305 96880 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975463.1 protein_id gnl|my_center|LOCUS_56530 97068 98600 gene locus_tag LOCUS_56540 97068 98600 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226673.1 protein_id gnl|my_center|LOCUS_56540 98621 99061 gene locus_tag LOCUS_56550 98621 99061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 99080 100423 gene locus_tag LOCUS_56560 99080 100423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 100432 100866 gene locus_tag LOCUS_56570 100432 100866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 101906 100881 gene locus_tag LOCUS_56580 101906 100881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 102872 102015 gene locus_tag LOCUS_56590 102872 102015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 104366 102909 gene locus_tag LOCUS_56600 104366 102909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 106552 104363 gene locus_tag LOCUS_56610 106552 104363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029537.1 protein_id gnl|my_center|LOCUS_56610 107178 106549 gene locus_tag LOCUS_56620 107178 106549 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226677.1 protein_id gnl|my_center|LOCUS_56620 110138 107175 gene locus_tag LOCUS_56630 110138 107175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56630 113404 110135 gene locus_tag LOCUS_56640 113404 110135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 113955 113422 gene locus_tag LOCUS_56650 113955 113422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 116167 113993 gene locus_tag LOCUS_56660 116167 113993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 116577 116176 gene locus_tag LOCUS_56670 116577 116176 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_56670 118408 116609 gene locus_tag LOCUS_56680 118408 116609 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_56680 119127 118405 gene locus_tag LOCUS_56690 119127 118405 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974728.1 protein_id gnl|my_center|LOCUS_56690 119594 119163 gene locus_tag LOCUS_56700 119594 119163 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974727.1 protein_id gnl|my_center|LOCUS_56700 121118 119634 gene locus_tag LOCUS_56710 121118 119634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 121273 121115 gene locus_tag LOCUS_56720 121273 121115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098516.1 protein_id gnl|my_center|LOCUS_56720 121665 121270 gene locus_tag LOCUS_56730 121665 121270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_56730 123328 121769 gene locus_tag LOCUS_56740 123328 121769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 124699 123380 gene locus_tag LOCUS_56750 124699 123380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 125316 126350 gene locus_tag LOCUS_56760 125316 126350 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467337.1 protein_id gnl|my_center|LOCUS_56760 127703 126369 gene locus_tag LOCUS_56770 127703 126369 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_56770 127843 129030 gene locus_tag LOCUS_56780 127843 129030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 129299 129814 gene locus_tag LOCUS_56790 129299 129814 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027260.1 protein_id gnl|my_center|LOCUS_56790 130098 131201 gene locus_tag LOCUS_56800 130098 131201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56800 131300 131500 gene locus_tag LOCUS_56810 131300 131500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 132004 131597 gene locus_tag LOCUS_56820 132004 131597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56820 132914 132138 gene locus_tag LOCUS_56830 132914 132138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971044.1 protein_id gnl|my_center|LOCUS_56830 133888 132980 gene locus_tag LOCUS_56840 133888 132980 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976847.1 protein_id gnl|my_center|LOCUS_56840 134811 133885 gene locus_tag LOCUS_56850 134811 133885 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976848.1 protein_id gnl|my_center|LOCUS_56850 135371 134928 gene locus_tag LOCUS_56860 135371 134928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 135935 135462 gene locus_tag LOCUS_56870 135935 135462 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976464.1 protein_id gnl|my_center|LOCUS_56870 136004 136732 gene locus_tag LOCUS_56880 136004 136732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 136844 137062 gene locus_tag LOCUS_56890 136844 137062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 138423 137122 gene locus_tag LOCUS_56900 138423 137122 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029191.1 protein_id gnl|my_center|LOCUS_56900 138684 141377 gene locus_tag LOCUS_56910 138684 141377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 141383 141514 gene locus_tag LOCUS_56920 141383 141514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56920 141603 142688 gene locus_tag LOCUS_56930 141603 142688 CDS product lanthionine synthetase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026975.1 protein_id gnl|my_center|LOCUS_56930 142838 144157 gene locus_tag LOCUS_56940 142838 144157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56940 144308 147034 gene locus_tag LOCUS_56950 144308 147034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 147096 147758 gene locus_tag LOCUS_56960 147096 147758 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027849.1 protein_id gnl|my_center|LOCUS_56960 148607 147771 gene locus_tag LOCUS_56970 148607 147771 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223937.1 protein_id gnl|my_center|LOCUS_56970 149236 148673 gene locus_tag LOCUS_56980 149236 148673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223938.1 protein_id gnl|my_center|LOCUS_56980 149726 149289 gene locus_tag LOCUS_56990 149726 149289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 151147 149723 gene locus_tag LOCUS_57000 151147 149723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 protein_id gnl|my_center|LOCUS_57000 152104 151337 gene locus_tag LOCUS_57010 152104 151337 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731593.1 protein_id gnl|my_center|LOCUS_57010 152507 153211 gene locus_tag LOCUS_57020 152507 153211 CDS product chitosanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228755.1 protein_id gnl|my_center|LOCUS_57020 153336 154226 gene locus_tag LOCUS_57030 153336 154226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57030 154267 154911 gene locus_tag LOCUS_57040 154267 154911 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029175.1 protein_id gnl|my_center|LOCUS_57040 157139 154956 gene locus_tag LOCUS_57050 157139 154956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57050 157051 157239 gene locus_tag LOCUS_57060 157051 157239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 158082 157297 gene locus_tag LOCUS_57070 158082 157297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57070 158208 158429 gene locus_tag LOCUS_57080 158208 158429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 >Feature sequence12 73 480 gene locus_tag LOCUS_57090 73 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57090 524 1114 gene locus_tag LOCUS_57100 524 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 1229 1519 gene locus_tag LOCUS_57110 1229 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 1743 1480 gene locus_tag LOCUS_57120 1743 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 1636 1932 gene locus_tag LOCUS_57130 1636 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57130 2404 1949 gene locus_tag LOCUS_57140 2404 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 2665 3351 gene locus_tag LOCUS_57150 2665 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57150 3395 4471 gene locus_tag LOCUS_57160 3395 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57160 4502 5680 gene locus_tag LOCUS_57170 4502 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57170 5783 6718 gene locus_tag LOCUS_57180 5783 6718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 6798 7904 gene locus_tag LOCUS_57190 6798 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57190 7901 9010 gene locus_tag LOCUS_57200 7901 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 9010 9723 gene locus_tag LOCUS_57210 9010 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 9776 11389 gene locus_tag LOCUS_57220 9776 11389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 11428 11766 gene locus_tag LOCUS_57230 11428 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57230 11846 12889 gene locus_tag LOCUS_57240 11846 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57240 12934 13182 gene locus_tag LOCUS_57250 12934 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 13179 13442 gene locus_tag LOCUS_57260 13179 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57260 17420 13521 gene locus_tag LOCUS_57270 17420 13521 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_57270 21022 17540 gene locus_tag LOCUS_57280 gene rpoB 21022 17540 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029792.1 protein_id gnl|my_center|LOCUS_57280 22035 21649 gene locus_tag LOCUS_57290 gene rplL 22035 21649 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974310.1 protein_id gnl|my_center|LOCUS_57290 22673 22143 gene locus_tag LOCUS_57300 gene rplJ 22673 22143 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974311.1 protein_id gnl|my_center|LOCUS_57300 23748 23035 gene locus_tag LOCUS_57310 gene rplA 23748 23035 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_57310 24265 23831 gene locus_tag LOCUS_57320 gene rplK 24265 23831 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974315.1 protein_id gnl|my_center|LOCUS_57320 25335 24451 gene locus_tag LOCUS_57330 gene nusG 25335 24451 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029791.1 protein_id gnl|my_center|LOCUS_57330 25758 25420 gene locus_tag LOCUS_57340 gene secE 25758 25420 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974317.1 protein_id gnl|my_center|LOCUS_57340 25882 25809 gene locus_tag LOCUS_t00880 25882 25809 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 26146 27378 gene locus_tag LOCUS_57350 26146 27378 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_57350 27580 27380 gene locus_tag LOCUS_57360 27580 27380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 27527 28546 gene locus_tag LOCUS_57370 27527 28546 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974319.1 protein_id gnl|my_center|LOCUS_57370 29703 28642 gene locus_tag LOCUS_57380 29703 28642 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270166.1 protein_id gnl|my_center|LOCUS_57380 30431 29997 gene locus_tag LOCUS_57390 30431 29997 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_57390 30883 30431 gene locus_tag LOCUS_57400 30883 30431 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029784.1 protein_id gnl|my_center|LOCUS_57400 31161 30997 gene locus_tag LOCUS_57410 gene rpmG 31161 30997 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948671.1 protein_id gnl|my_center|LOCUS_57410 31319 31246 gene locus_tag LOCUS_t00890 31319 31246 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31442 31369 gene locus_tag LOCUS_t00900 31442 31369 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 31672 32940 gene locus_tag LOCUS_57420 31672 32940 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029783.1 protein_id gnl|my_center|LOCUS_57420 32965 33630 gene locus_tag LOCUS_57430 32965 33630 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029782.1 protein_id gnl|my_center|LOCUS_57430 33772 33690 gene locus_tag LOCUS_t00910 33772 33690 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 33957 34445 gene locus_tag LOCUS_57440 33957 34445 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974333.1 protein_id gnl|my_center|LOCUS_57440 34942 34550 gene locus_tag LOCUS_57450 34942 34550 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_57450 35073 35300 gene locus_tag LOCUS_57460 35073 35300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57460 35584 36009 gene locus_tag LOCUS_57470 35584 36009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 37051 36188 gene locus_tag LOCUS_57480 gene htpX 37051 36188 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974338.1 protein_id gnl|my_center|LOCUS_57480 38749 37214 gene locus_tag LOCUS_57490 38749 37214 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029760.1 protein_id gnl|my_center|LOCUS_57490 40341 38749 gene locus_tag LOCUS_57500 40341 38749 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029759.1 protein_id gnl|my_center|LOCUS_57500 42348 40345 gene locus_tag LOCUS_57510 42348 40345 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029758.1 protein_id gnl|my_center|LOCUS_57510 42710 42345 gene locus_tag LOCUS_57520 gene nuoK 42710 42345 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029757.1 protein_id gnl|my_center|LOCUS_57520 43282 42710 gene locus_tag LOCUS_57530 43282 42710 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_57530 43830 43279 gene locus_tag LOCUS_57540 43830 43279 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974344.1 protein_id gnl|my_center|LOCUS_57540 44801 43833 gene locus_tag LOCUS_57550 44801 43833 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029756.1 protein_id gnl|my_center|LOCUS_57550 46273 44798 gene locus_tag LOCUS_57560 46273 44798 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029755.1 protein_id gnl|my_center|LOCUS_57560 46869 46270 gene locus_tag LOCUS_57570 46869 46270 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486629.1 protein_id gnl|my_center|LOCUS_57570 47276 46860 gene locus_tag LOCUS_57580 47276 46860 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974348.1 protein_id gnl|my_center|LOCUS_57580 47449 48702 gene locus_tag LOCUS_57590 47449 48702 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029753.1 protein_id gnl|my_center|LOCUS_57590 48827 50161 gene locus_tag LOCUS_57600 48827 50161 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029752.1 protein_id gnl|my_center|LOCUS_57600 50300 50977 gene locus_tag LOCUS_57610 50300 50977 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 protein_id gnl|my_center|LOCUS_57610 51164 53137 gene locus_tag LOCUS_57620 51164 53137 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_57620 53130 54179 gene locus_tag LOCUS_57630 53130 54179 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_57630 54264 56234 gene locus_tag LOCUS_57640 54264 56234 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742800.1 protein_id gnl|my_center|LOCUS_57640 56337 57341 gene locus_tag LOCUS_57650 gene rarD 56337 57341 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029749.1 protein_id gnl|my_center|LOCUS_57650 57453 58832 gene locus_tag LOCUS_57660 57453 58832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 59741 58869 gene locus_tag LOCUS_57670 59741 58869 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_57670 60705 59728 gene locus_tag LOCUS_57680 60705 59728 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_57680 62111 60801 gene locus_tag LOCUS_57690 62111 60801 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974363.1 protein_id gnl|my_center|LOCUS_57690 63289 62276 gene locus_tag LOCUS_57700 63289 62276 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_57700 64731 63508 gene locus_tag LOCUS_57710 64731 63508 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029639.1 protein_id gnl|my_center|LOCUS_57710 66141 64870 gene locus_tag LOCUS_57720 66141 64870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028535.1 protein_id gnl|my_center|LOCUS_57720 66493 67680 gene locus_tag LOCUS_57730 gene fahA 66493 67680 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029743.1 protein_id gnl|my_center|LOCUS_57730 66931 66837 gene locus_tag LOCUS_t00920 66931 66837 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 67677 68447 gene locus_tag LOCUS_57740 67677 68447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 68521 69051 gene locus_tag LOCUS_57750 68521 69051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867772.1 protein_id gnl|my_center|LOCUS_57750 70788 69133 gene locus_tag LOCUS_57760 gene nuoN 70788 69133 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974371.1 protein_id gnl|my_center|LOCUS_57760 72407 70785 gene locus_tag LOCUS_57770 72407 70785 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_57770 74350 72410 gene locus_tag LOCUS_57780 gene nuoL 74350 72410 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974373.1 protein_id gnl|my_center|LOCUS_57780 74663 74364 gene locus_tag LOCUS_57790 gene nuoK 74663 74364 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974374.1 protein_id gnl|my_center|LOCUS_57790 75499 74660 gene locus_tag LOCUS_57800 75499 74660 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_57800 76107 75496 gene locus_tag LOCUS_57810 gene nuoI 76107 75496 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327003.1 protein_id gnl|my_center|LOCUS_57810 77479 76100 gene locus_tag LOCUS_57820 gene nuoH 77479 76100 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029736.1 protein_id gnl|my_center|LOCUS_57820 79923 77476 gene locus_tag LOCUS_57830 79923 77476 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029735.1 protein_id gnl|my_center|LOCUS_57830 81353 79983 gene locus_tag LOCUS_57840 gene nuoF 81353 79983 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974379.1 protein_id gnl|my_center|LOCUS_57840 82177 81350 gene locus_tag LOCUS_57850 gene nuoE 82177 81350 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974380.1 protein_id gnl|my_center|LOCUS_57850 83370 82174 gene locus_tag LOCUS_57860 83370 82174 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029734.1 protein_id gnl|my_center|LOCUS_57860 84347 83550 gene locus_tag LOCUS_57870 84347 83550 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029733.1 protein_id gnl|my_center|LOCUS_57870 84898 84344 gene locus_tag LOCUS_57880 84898 84344 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006133126.1 protein_id gnl|my_center|LOCUS_57880 85270 84911 gene locus_tag LOCUS_57890 85270 84911 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974383.1 protein_id gnl|my_center|LOCUS_57890 86052 86873 gene locus_tag LOCUS_57900 86052 86873 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029732.1 protein_id gnl|my_center|LOCUS_57900 88409 87129 gene locus_tag LOCUS_57910 88409 87129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57910 88507 88680 gene locus_tag LOCUS_57920 88507 88680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57920 89127 88681 gene locus_tag LOCUS_57930 89127 88681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57930 89397 90245 gene locus_tag LOCUS_57940 gene whiJ 89397 90245 CDS product transcriptional regulator WhiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029721.1 protein_id gnl|my_center|LOCUS_57940 90256 90444 gene locus_tag LOCUS_57950 90256 90444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 90441 90629 gene locus_tag LOCUS_57960 90441 90629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 90626 90814 gene locus_tag LOCUS_57970 90626 90814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 90900 91250 gene locus_tag LOCUS_57980 90900 91250 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226049.1 protein_id gnl|my_center|LOCUS_57980 91294 91743 gene locus_tag LOCUS_57990 91294 91743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 91786 92379 gene locus_tag LOCUS_58000 91786 92379 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974022.1 protein_id gnl|my_center|LOCUS_58000 93038 92358 gene locus_tag LOCUS_58010 93038 92358 CDS product DUF4232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109034961.1 protein_id gnl|my_center|LOCUS_58010 93268 94674 gene locus_tag LOCUS_58020 93268 94674 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850204.1 protein_id gnl|my_center|LOCUS_58020 95379 94690 gene locus_tag LOCUS_58030 95379 94690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58030 95299 95478 gene locus_tag LOCUS_58040 95299 95478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58040 96767 95481 gene locus_tag LOCUS_58050 96767 95481 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_58050 99119 96843 gene locus_tag LOCUS_58060 99119 96843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 100034 99336 gene locus_tag LOCUS_58070 100034 99336 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974389.1 protein_id gnl|my_center|LOCUS_58070 101082 100399 gene locus_tag LOCUS_58080 101082 100399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029727.1 protein_id gnl|my_center|LOCUS_58080 102306 101095 gene locus_tag LOCUS_58090 gene mqnC 102306 101095 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029726.1 protein_id gnl|my_center|LOCUS_58090 103997 102420 gene locus_tag LOCUS_58100 103997 102420 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029699.1 protein_id gnl|my_center|LOCUS_58100 104162 105550 gene locus_tag LOCUS_58110 104162 105550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 106533 105643 gene locus_tag LOCUS_58120 106533 105643 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974442.1 protein_id gnl|my_center|LOCUS_58120 106817 107020 gene locus_tag LOCUS_58130 106817 107020 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_58130 108990 107170 gene locus_tag LOCUS_58140 108990 107170 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805025.1 protein_id gnl|my_center|LOCUS_58140 109171 110178 gene locus_tag LOCUS_58150 109171 110178 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106595.1 protein_id gnl|my_center|LOCUS_58150 110272 111426 gene locus_tag LOCUS_58160 110272 111426 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230171.1 protein_id gnl|my_center|LOCUS_58160 113374 111458 gene locus_tag LOCUS_58170 113374 111458 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029698.1 protein_id gnl|my_center|LOCUS_58170 114328 113531 gene locus_tag LOCUS_58180 114328 113531 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029695.1 protein_id gnl|my_center|LOCUS_58180 115719 114445 gene locus_tag LOCUS_58190 115719 114445 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974451.1 protein_id gnl|my_center|LOCUS_58190 116237 115947 gene locus_tag LOCUS_58200 116237 115947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58200 117472 116309 gene locus_tag LOCUS_58210 gene mqnE 117472 116309 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974455.1 protein_id gnl|my_center|LOCUS_58210 117987 117532 gene locus_tag LOCUS_58220 117987 117532 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974456.1 protein_id gnl|my_center|LOCUS_58220 118126 118260 gene locus_tag LOCUS_58230 118126 118260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 118949 118257 gene locus_tag LOCUS_58240 118949 118257 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974457.1 protein_id gnl|my_center|LOCUS_58240 119433 120314 gene locus_tag LOCUS_58250 119433 120314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 121272 120376 gene locus_tag LOCUS_58260 121272 120376 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029692.1 protein_id gnl|my_center|LOCUS_58260 122720 121269 gene locus_tag LOCUS_58270 122720 121269 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974459.1 protein_id gnl|my_center|LOCUS_58270 122808 123089 gene locus_tag LOCUS_58280 122808 123089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 123633 123115 gene locus_tag LOCUS_58290 123633 123115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 124800 123718 gene locus_tag LOCUS_58300 gene ccsB 124800 123718 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_58300 126599 124797 gene locus_tag LOCUS_58310 126599 124797 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_58310 127400 126603 gene locus_tag LOCUS_58320 127400 126603 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974477.1 protein_id gnl|my_center|LOCUS_58320 127980 127405 gene locus_tag LOCUS_58330 127980 127405 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029677.1 protein_id gnl|my_center|LOCUS_58330 129488 128055 gene locus_tag LOCUS_58340 129488 128055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029676.1 protein_id gnl|my_center|LOCUS_58340 130367 129684 gene locus_tag LOCUS_58350 130367 129684 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_58350 131689 130364 gene locus_tag LOCUS_58360 gene hemL 131689 130364 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029675.1 protein_id gnl|my_center|LOCUS_58360 131761 131997 gene locus_tag LOCUS_58370 131761 131997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58370 131988 132425 gene locus_tag LOCUS_58380 131988 132425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974483.1 protein_id gnl|my_center|LOCUS_58380 132463 132813 gene locus_tag LOCUS_58390 132463 132813 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224704.1 protein_id gnl|my_center|LOCUS_58390 132882 133634 gene locus_tag LOCUS_58400 132882 133634 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_58400 133718 134128 gene locus_tag LOCUS_58410 133718 134128 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_58410 134246 135049 gene locus_tag LOCUS_58420 134246 135049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58420 136290 135097 gene locus_tag LOCUS_58430 136290 135097 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028892.1 protein_id gnl|my_center|LOCUS_58430 136535 137320 gene locus_tag LOCUS_58440 136535 137320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975534.1 protein_id gnl|my_center|LOCUS_58440 137459 138178 gene locus_tag LOCUS_58450 137459 138178 CDS product DUF3558 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668737.1 protein_id gnl|my_center|LOCUS_58450 139968 138250 gene locus_tag LOCUS_58460 gene lysS 139968 138250 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_58460 140128 141882 gene locus_tag LOCUS_58470 gene argS 140128 141882 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028896.1 protein_id gnl|my_center|LOCUS_58470 142318 141887 gene locus_tag LOCUS_58480 142318 141887 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029722.1 protein_id gnl|my_center|LOCUS_58480 143596 142604 gene locus_tag LOCUS_58490 gene hemB 143596 142604 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028903.1 protein_id gnl|my_center|LOCUS_58490 145149 143593 gene locus_tag LOCUS_58500 145149 143593 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_58500 146210 145239 gene locus_tag LOCUS_58510 gene hemC 146210 145239 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975518.1 protein_id gnl|my_center|LOCUS_58510 147598 146207 gene locus_tag LOCUS_58520 147598 146207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 148377 147595 gene locus_tag LOCUS_58530 148377 147595 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975516.1 protein_id gnl|my_center|LOCUS_58530 148735 149013 gene locus_tag LOCUS_58540 148735 149013 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030145241.1 protein_id gnl|my_center|LOCUS_58540 149141 150085 gene locus_tag LOCUS_58550 149141 150085 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666589.1 protein_id gnl|my_center|LOCUS_58550 150550 151350 gene locus_tag LOCUS_58560 150550 151350 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975513.1 protein_id gnl|my_center|LOCUS_58560 151637 152827 gene locus_tag LOCUS_58570 151637 152827 CDS product DUF5667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495181.1 protein_id gnl|my_center|LOCUS_58570 153956 152898 gene locus_tag LOCUS_58580 153956 152898 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_58580 155017 153971 gene locus_tag LOCUS_58590 155017 153971 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_58590 155683 155441 gene locus_tag LOCUS_58600 155683 155441 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004984898.1 protein_id gnl|my_center|LOCUS_58600 156594 155779 gene locus_tag LOCUS_58610 156594 155779 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028912.1 protein_id gnl|my_center|LOCUS_58610 157892 156699 gene locus_tag LOCUS_58620 157892 156699 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326515.1 protein_id gnl|my_center|LOCUS_58620 >Feature sequence13 853 215 gene locus_tag LOCUS_58630 853 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 1077 2216 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggggtcatccccgcgtgcgcggggagcag 3646 2501 gene locus_tag LOCUS_58640 3646 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 4003 5256 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggttcatccccgcgtgcgcggggaacag 5779 6294 gene locus_tag LOCUS_58650 5779 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 7700 7176 gene locus_tag LOCUS_58660 7700 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 8197 8370 gene locus_tag LOCUS_58670 8197 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 10517 8538 gene locus_tag LOCUS_58680 10517 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 11741 10575 gene locus_tag LOCUS_58690 11741 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58690 11928 11743 gene locus_tag LOCUS_58700 11928 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58700 12222 13577 gene locus_tag LOCUS_58710 12222 13577 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199314899.1 protein_id gnl|my_center|LOCUS_58710 13579 14112 gene locus_tag LOCUS_58720 13579 14112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 14783 14995 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcgggatcatcccgcgtgcgcggggaacag 15241 15504 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catccccgcgtgcgcgggga 16041 16901 gene locus_tag LOCUS_58730 16041 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 17269 17406 gene locus_tag LOCUS_58740 17269 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 17497 17706 gene locus_tag LOCUS_58750 17497 17706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 18348 18623 gene locus_tag LOCUS_58760 18348 18623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 19868 19146 gene locus_tag LOCUS_58770 gene cas6e 19868 19146 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227610.1 protein_id gnl|my_center|LOCUS_58770 20710 19865 gene locus_tag LOCUS_58780 gene cas5e 20710 19865 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_58780 22047 20707 gene locus_tag LOCUS_58790 gene cas7e 22047 20707 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388097.1 protein_id gnl|my_center|LOCUS_58790 22685 22044 gene locus_tag LOCUS_58800 22685 22044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 24289 22682 gene locus_tag LOCUS_58810 24289 22682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58810 24881 24702 gene locus_tag LOCUS_58820 24881 24702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 25021 28902 gene locus_tag LOCUS_58830 25021 28902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58830 30288 29221 gene locus_tag LOCUS_58840 30288 29221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_58840 30712 31278 gene locus_tag LOCUS_58850 30712 31278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58850 31614 31309 gene locus_tag LOCUS_58860 31614 31309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 32560 32937 gene locus_tag LOCUS_58870 32560 32937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58870 33315 33055 gene locus_tag LOCUS_58880 33315 33055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 34924 33413 gene locus_tag LOCUS_58890 34924 33413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58890 35840 35256 gene locus_tag LOCUS_58900 35840 35256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 36904 36011 gene locus_tag LOCUS_58910 36904 36011 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031499.1 protein_id gnl|my_center|LOCUS_58910 36932 37693 gene locus_tag LOCUS_58920 36932 37693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58920 37910 38305 gene locus_tag LOCUS_58930 37910 38305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 38933 38400 gene locus_tag LOCUS_58940 38933 38400 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028460.1 protein_id gnl|my_center|LOCUS_58940 39396 39920 gene locus_tag LOCUS_58950 39396 39920 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228108.1 protein_id gnl|my_center|LOCUS_58950 40293 40454 gene locus_tag LOCUS_58960 40293 40454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 40849 41364 gene locus_tag LOCUS_58970 40849 41364 CDS product immunity 21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977534.1 protein_id gnl|my_center|LOCUS_58970 41683 42003 gene locus_tag LOCUS_58980 41683 42003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 42270 42094 gene locus_tag LOCUS_58990 42270 42094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58990 42455 42667 gene locus_tag LOCUS_59000 42455 42667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59000 42651 43175 gene locus_tag LOCUS_59010 42651 43175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 43165 43998 gene locus_tag LOCUS_59020 43165 43998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 44147 44332 gene locus_tag LOCUS_59030 44147 44332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 44837 45016 gene locus_tag LOCUS_59040 44837 45016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 45141 45617 gene locus_tag LOCUS_59050 45141 45617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59050 46564 47037 gene locus_tag LOCUS_59060 46564 47037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 47989 47360 gene locus_tag LOCUS_59070 47989 47360 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285566.1 protein_id gnl|my_center|LOCUS_59070 48697 49539 gene locus_tag LOCUS_59080 48697 49539 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062658316.1 protein_id gnl|my_center|LOCUS_59080 50060 50572 gene locus_tag LOCUS_59090 50060 50572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 50553 51944 gene locus_tag LOCUS_59100 50553 51944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59100 52656 52027 gene locus_tag LOCUS_59110 52656 52027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 52721 53203 gene locus_tag LOCUS_59120 52721 53203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 53377 53886 gene locus_tag LOCUS_59130 53377 53886 CDS product HAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028507.1 protein_id gnl|my_center|LOCUS_59130 53950 54636 gene locus_tag LOCUS_59140 53950 54636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59140 54935 55549 gene locus_tag LOCUS_59150 54935 55549 CDS product CbrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911837.1 protein_id gnl|my_center|LOCUS_59150 56201 56010 gene locus_tag LOCUS_59160 56201 56010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59160 56824 56264 gene locus_tag LOCUS_59170 56824 56264 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084162.1 protein_id gnl|my_center|LOCUS_59170 56933 57535 gene locus_tag LOCUS_59180 56933 57535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59180 58630 58001 gene locus_tag LOCUS_59190 58630 58001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084748217.1 protein_id gnl|my_center|LOCUS_59190 60004 58982 gene locus_tag LOCUS_59200 60004 58982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 60033 60347 gene locus_tag LOCUS_59210 60033 60347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 60770 60357 gene locus_tag LOCUS_59220 60770 60357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59220 61084 60818 gene locus_tag LOCUS_59230 61084 60818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 62020 61097 gene locus_tag LOCUS_59240 gene sigJ 62020 61097 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978451.1 protein_id gnl|my_center|LOCUS_59240 62127 62519 gene locus_tag LOCUS_59250 62127 62519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027097.1 protein_id gnl|my_center|LOCUS_59250 63223 62549 gene locus_tag LOCUS_59260 63223 62549 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201020.1 protein_id gnl|my_center|LOCUS_59260 63463 64668 gene locus_tag LOCUS_59270 63463 64668 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 protein_id gnl|my_center|LOCUS_59270 64741 65220 gene locus_tag LOCUS_59280 64741 65220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59280 65442 65352 gene locus_tag LOCUS_t00930 65442 65352 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 66380 65553 gene locus_tag LOCUS_59290 66380 65553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 67085 67174 gene locus_tag LOCUS_t00940 67085 67174 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 69065 67416 gene locus_tag LOCUS_59300 69065 67416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59300 70199 69222 gene locus_tag LOCUS_59310 70199 69222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59310 70840 70244 gene locus_tag LOCUS_59320 70840 70244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 71328 70837 gene locus_tag LOCUS_59330 71328 70837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075257.1 protein_id gnl|my_center|LOCUS_59330 72508 71372 gene locus_tag LOCUS_59340 72508 71372 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027695.1 protein_id gnl|my_center|LOCUS_59340 72815 73828 gene locus_tag LOCUS_59350 72815 73828 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977544.1 protein_id gnl|my_center|LOCUS_59350 73881 74057 gene locus_tag LOCUS_59360 73881 74057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 75418 74129 gene locus_tag LOCUS_59370 gene serS 75418 74129 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937547.1 protein_id gnl|my_center|LOCUS_59370 76986 75460 gene locus_tag LOCUS_59380 76986 75460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 77960 76983 gene locus_tag LOCUS_59390 77960 76983 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_59390 78623 78234 gene locus_tag LOCUS_59400 78623 78234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59400 79011 78688 gene locus_tag LOCUS_59410 79011 78688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59410 79027 79734 gene locus_tag LOCUS_59420 79027 79734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59420 83668 79802 gene locus_tag LOCUS_59430 83668 79802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 84591 84097 gene locus_tag LOCUS_59440 84591 84097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59440 84566 85174 gene locus_tag LOCUS_59450 84566 85174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59450 85247 85459 gene locus_tag LOCUS_59460 85247 85459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 85470 85604 gene locus_tag LOCUS_59470 85470 85604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 86995 86816 gene locus_tag LOCUS_59480 86995 86816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 88010 90628 gene locus_tag LOCUS_59490 88010 90628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59490 90636 92837 gene locus_tag LOCUS_59500 90636 92837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59500 92834 96277 gene locus_tag LOCUS_59510 92834 96277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098509933.1 protein_id gnl|my_center|LOCUS_59510 96324 97292 gene locus_tag LOCUS_59520 96324 97292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59520 97289 98410 gene locus_tag LOCUS_59530 97289 98410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 98443 100206 gene locus_tag LOCUS_59540 98443 100206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 100337 103222 gene locus_tag LOCUS_59550 100337 103222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 103616 104038 gene locus_tag LOCUS_59560 103616 104038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 104041 104286 gene locus_tag LOCUS_59570 104041 104286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59570 104291 104731 gene locus_tag LOCUS_59580 104291 104731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 105129 106310 gene locus_tag LOCUS_59590 105129 106310 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_59590 106853 106473 gene locus_tag LOCUS_59600 106853 106473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 107838 107227 gene locus_tag LOCUS_59610 107838 107227 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731396.1 protein_id gnl|my_center|LOCUS_59610 107968 108396 gene locus_tag LOCUS_59620 107968 108396 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731395.1 protein_id gnl|my_center|LOCUS_59620 108393 108560 gene locus_tag LOCUS_59630 108393 108560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 108600 109640 gene locus_tag LOCUS_59640 108600 109640 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028737.1 protein_id gnl|my_center|LOCUS_59640 110357 109713 gene locus_tag LOCUS_59650 110357 109713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 113051 110415 gene locus_tag LOCUS_59660 113051 110415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 113628 113218 gene locus_tag LOCUS_59670 113628 113218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59670 114025 114864 gene locus_tag LOCUS_59680 114025 114864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59680 115559 114945 gene locus_tag LOCUS_59690 115559 114945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 115727 116866 gene locus_tag LOCUS_59700 115727 116866 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 protein_id gnl|my_center|LOCUS_59700 117659 116916 gene locus_tag LOCUS_59710 117659 116916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 118587 117721 gene locus_tag LOCUS_59720 118587 117721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 119645 118584 gene locus_tag LOCUS_59730 119645 118584 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_59730 120094 119645 gene locus_tag LOCUS_59740 120094 119645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 120345 120091 gene locus_tag LOCUS_59750 120345 120091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 120750 120908 gene locus_tag LOCUS_59760 120750 120908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 120940 122739 gene locus_tag LOCUS_59770 120940 122739 CDS product lasso peptide isopeptide bond-forming cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228688.1 protein_id gnl|my_center|LOCUS_59770 122910 123263 gene locus_tag LOCUS_59780 122910 123263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 123760 124620 gene locus_tag LOCUS_59790 123760 124620 CDS product leishmanolysin-related zinc metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088772.1 protein_id gnl|my_center|LOCUS_59790 124633 124992 gene locus_tag LOCUS_59800 124633 124992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 125332 125072 gene locus_tag LOCUS_59810 125332 125072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59810 125626 125402 gene locus_tag LOCUS_59820 gene infA 125626 125402 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228772.1 protein_id gnl|my_center|LOCUS_59820 126534 125692 gene locus_tag LOCUS_59830 126534 125692 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228773.1 protein_id gnl|my_center|LOCUS_59830 126803 128131 gene locus_tag LOCUS_59840 126803 128131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 128247 129326 gene locus_tag LOCUS_59850 128247 129326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228674.1 protein_id gnl|my_center|LOCUS_59850 129801 129349 gene locus_tag LOCUS_59860 129801 129349 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_59860 131579 129990 gene locus_tag LOCUS_59870 131579 129990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972427.1 protein_id gnl|my_center|LOCUS_59870 131767 132732 gene locus_tag LOCUS_59880 131767 132732 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224785.1 protein_id gnl|my_center|LOCUS_59880 >Feature sequence14 761 267 gene locus_tag LOCUS_59890 761 267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028921.1 protein_id gnl|my_center|LOCUS_59890 1123 872 gene locus_tag LOCUS_59900 1123 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 1264 3402 gene locus_tag LOCUS_59910 1264 3402 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028924.1 protein_id gnl|my_center|LOCUS_59910 5309 3459 gene locus_tag LOCUS_59920 gene ilvD 5309 3459 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028925.1 protein_id gnl|my_center|LOCUS_59920 6074 5412 gene locus_tag LOCUS_59930 6074 5412 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_59930 6895 6071 gene locus_tag LOCUS_59940 6895 6071 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975487.1 protein_id gnl|my_center|LOCUS_59940 7976 7044 gene locus_tag LOCUS_59950 7976 7044 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028926.1 protein_id gnl|my_center|LOCUS_59950 8022 8969 gene locus_tag LOCUS_59960 8022 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975485.1 protein_id gnl|my_center|LOCUS_59960 10763 9051 gene locus_tag LOCUS_59970 10763 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59970 10971 12470 gene locus_tag LOCUS_59980 gene radA 10971 12470 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028928.1 protein_id gnl|my_center|LOCUS_59980 12619 13749 gene locus_tag LOCUS_59990 gene disA 12619 13749 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_59990 14686 13844 gene locus_tag LOCUS_60000 14686 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191851224.1 protein_id gnl|my_center|LOCUS_60000 15347 14832 gene locus_tag LOCUS_60010 15347 14832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 15642 15352 gene locus_tag LOCUS_60020 15642 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 15542 16405 gene locus_tag LOCUS_60030 15542 16405 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_60030 16718 17269 gene locus_tag LOCUS_60040 16718 17269 CDS product SigE family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975479.1 protein_id gnl|my_center|LOCUS_60040 17257 17910 gene locus_tag LOCUS_60050 17257 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173943984.1 protein_id gnl|my_center|LOCUS_60050 17918 18628 gene locus_tag LOCUS_60060 gene cseB 17918 18628 CDS product two-component system response regulator CseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975477.1 protein_id gnl|my_center|LOCUS_60060 18763 20058 gene locus_tag LOCUS_60070 18763 20058 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028932.1 protein_id gnl|my_center|LOCUS_60070 20820 20077 gene locus_tag LOCUS_60080 20820 20077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60080 21131 21478 gene locus_tag LOCUS_60090 21131 21478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60090 21475 24765 gene locus_tag LOCUS_60100 21475 24765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 25417 24773 gene locus_tag LOCUS_60110 25417 24773 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811973.1 protein_id gnl|my_center|LOCUS_60110 28000 25538 gene locus_tag LOCUS_60120 28000 25538 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975461.1 protein_id gnl|my_center|LOCUS_60120 28626 29312 gene locus_tag LOCUS_60130 28626 29312 CDS product SCO3374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028943.1 protein_id gnl|my_center|LOCUS_60130 29581 29243 gene locus_tag LOCUS_60140 29581 29243 CDS product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975458.1 protein_id gnl|my_center|LOCUS_60140 30262 29744 gene locus_tag LOCUS_60150 30262 29744 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975457.1 protein_id gnl|my_center|LOCUS_60150 30631 30272 gene locus_tag LOCUS_60160 30631 30272 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975456.1 protein_id gnl|my_center|LOCUS_60160 31002 30823 gene locus_tag LOCUS_60170 31002 30823 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028944.1 protein_id gnl|my_center|LOCUS_60170 31940 31104 gene locus_tag LOCUS_60180 31940 31104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 32711 32058 gene locus_tag LOCUS_60190 32711 32058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 33619 32822 gene locus_tag LOCUS_60200 33619 32822 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_60200 36369 33619 gene locus_tag LOCUS_60210 36369 33619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 37232 36366 gene locus_tag LOCUS_60220 gene panC 37232 36366 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975450.1 protein_id gnl|my_center|LOCUS_60220 38149 37229 gene locus_tag LOCUS_60230 38149 37229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_60230 38428 38207 gene locus_tag LOCUS_60240 38428 38207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 38357 39529 gene locus_tag LOCUS_60250 38357 39529 CDS product beta-eliminating lyase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028948.1 protein_id gnl|my_center|LOCUS_60250 39772 39419 gene locus_tag LOCUS_60260 39772 39419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60260 39873 40991 gene locus_tag LOCUS_60270 39873 40991 CDS product DUF5937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028949.1 protein_id gnl|my_center|LOCUS_60270 41765 41088 gene locus_tag LOCUS_60280 41765 41088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975444.1 protein_id gnl|my_center|LOCUS_60280 43033 41819 gene locus_tag LOCUS_60290 43033 41819 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975443.1 protein_id gnl|my_center|LOCUS_60290 43155 44156 gene locus_tag LOCUS_60300 43155 44156 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028950.1 protein_id gnl|my_center|LOCUS_60300 44153 45295 gene locus_tag LOCUS_60310 44153 45295 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975441.1 protein_id gnl|my_center|LOCUS_60310 46319 45369 gene locus_tag LOCUS_60320 46319 45369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 47383 46403 gene locus_tag LOCUS_60330 47383 46403 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222373.1 protein_id gnl|my_center|LOCUS_60330 48128 47439 gene locus_tag LOCUS_60340 48128 47439 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229696.1 protein_id gnl|my_center|LOCUS_60340 48841 48128 gene locus_tag LOCUS_60350 48841 48128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222372.1 protein_id gnl|my_center|LOCUS_60350 48973 50145 gene locus_tag LOCUS_60360 48973 50145 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969992.1 protein_id gnl|my_center|LOCUS_60360 50756 50265 gene locus_tag LOCUS_60370 50756 50265 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975431.1 protein_id gnl|my_center|LOCUS_60370 51400 50807 gene locus_tag LOCUS_60380 gene folK 51400 50807 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_60380 51756 51397 gene locus_tag LOCUS_60390 gene folB 51756 51397 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028954.1 protein_id gnl|my_center|LOCUS_60390 52445 51975 gene locus_tag LOCUS_60400 52445 51975 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975434.1 protein_id gnl|my_center|LOCUS_60400 53392 52442 gene locus_tag LOCUS_60410 gene folP 53392 52442 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975435.1 protein_id gnl|my_center|LOCUS_60410 55335 53488 gene locus_tag LOCUS_60420 55335 53488 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028953.1 protein_id gnl|my_center|LOCUS_60420 55507 56619 gene locus_tag LOCUS_60430 55507 56619 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975437.1 protein_id gnl|my_center|LOCUS_60430 57298 56693 gene locus_tag LOCUS_60440 gene folE 57298 56693 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975430.1 protein_id gnl|my_center|LOCUS_60440 59454 57451 gene locus_tag LOCUS_60450 gene ftsH 59454 57451 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867756.1 protein_id gnl|my_center|LOCUS_60450 60312 59749 gene locus_tag LOCUS_60460 gene hpt 60312 59749 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_60460 61387 60368 gene locus_tag LOCUS_60470 gene tilS 61387 60368 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975427.1 protein_id gnl|my_center|LOCUS_60470 62708 61599 gene locus_tag LOCUS_60480 62708 61599 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975426.1 protein_id gnl|my_center|LOCUS_60480 64351 62909 gene locus_tag LOCUS_60490 gene dacB 64351 62909 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485148.1 protein_id gnl|my_center|LOCUS_60490 64434 64931 gene locus_tag LOCUS_60500 64434 64931 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975424.1 protein_id gnl|my_center|LOCUS_60500 66792 65125 gene locus_tag LOCUS_60510 66792 65125 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975423.1 protein_id gnl|my_center|LOCUS_60510 68317 66944 gene locus_tag LOCUS_60520 68317 66944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60520 68587 68952 gene locus_tag LOCUS_60530 68587 68952 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975421.1 protein_id gnl|my_center|LOCUS_60530 69727 68972 gene locus_tag LOCUS_60540 69727 68972 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 protein_id gnl|my_center|LOCUS_60540 69921 70481 gene locus_tag LOCUS_60550 69921 70481 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029739.1 protein_id gnl|my_center|LOCUS_60550 71488 70493 gene locus_tag LOCUS_60560 71488 70493 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189457038.1 protein_id gnl|my_center|LOCUS_60560 71685 72491 gene locus_tag LOCUS_60570 71685 72491 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226025318.1 protein_id gnl|my_center|LOCUS_60570 72488 72688 gene locus_tag LOCUS_60580 72488 72688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60580 72876 73703 gene locus_tag LOCUS_60590 72876 73703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 77517 73681 gene locus_tag LOCUS_60600 77517 73681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60600 78119 77550 gene locus_tag LOCUS_60610 78119 77550 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 protein_id gnl|my_center|LOCUS_60610 78710 78165 gene locus_tag LOCUS_60620 78710 78165 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223116.1 protein_id gnl|my_center|LOCUS_60620 80315 78795 gene locus_tag LOCUS_60630 80315 78795 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028965.1 protein_id gnl|my_center|LOCUS_60630 81358 80495 gene locus_tag LOCUS_60640 81358 80495 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975412.1 protein_id gnl|my_center|LOCUS_60640 81903 81511 gene locus_tag LOCUS_60650 81903 81511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 81854 82180 gene locus_tag LOCUS_60660 81854 82180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 82447 82190 gene locus_tag LOCUS_60670 82447 82190 CDS product DUF397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028968.1 protein_id gnl|my_center|LOCUS_60670 83850 82699 gene locus_tag LOCUS_60680 83850 82699 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093456408.1 protein_id gnl|my_center|LOCUS_60680 84107 83850 gene locus_tag LOCUS_60690 84107 83850 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_60690 84278 84114 gene locus_tag LOCUS_60700 gene rpmG 84278 84114 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 protein_id gnl|my_center|LOCUS_60700 84341 84580 gene locus_tag LOCUS_60710 gene rpmB 84341 84580 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028971.1 protein_id gnl|my_center|LOCUS_60710 84580 84882 gene locus_tag LOCUS_60720 gene rpsN 84580 84882 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975403.1 protein_id gnl|my_center|LOCUS_60720 85275 84946 gene locus_tag LOCUS_60730 85275 84946 CDS product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727177.1 protein_id gnl|my_center|LOCUS_60730 85589 86617 gene locus_tag LOCUS_60740 85589 86617 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976353.1 protein_id gnl|my_center|LOCUS_60740 86718 87173 gene locus_tag LOCUS_60750 86718 87173 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975175.1 protein_id gnl|my_center|LOCUS_60750 88361 87276 gene locus_tag LOCUS_60760 88361 87276 CDS product 1,3,6,8-tetrahydroxynaphthalene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027653.1 protein_id gnl|my_center|LOCUS_60760 <89446 88640 gene locus_tag LOCUS_60770 <89446 88640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029950.1:biotin carboxylase N-terminal domain-containing protein >Feature sequence15 3107 771 gene locus_tag LOCUS_60780 3107 771 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975859.1 protein_id gnl|my_center|LOCUS_60780 4011 3220 gene locus_tag LOCUS_60790 gene rsuA 4011 3220 CDS product anti-sigma U factor RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975858.1 protein_id gnl|my_center|LOCUS_60790 4547 4008 gene locus_tag LOCUS_60800 4547 4008 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975857.1 protein_id gnl|my_center|LOCUS_60800 5292 4687 gene locus_tag LOCUS_60810 5292 4687 CDS product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028679.1 protein_id gnl|my_center|LOCUS_60810 5981 6877 gene locus_tag LOCUS_60820 5981 6877 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977589.1 protein_id gnl|my_center|LOCUS_60820 7027 7398 gene locus_tag LOCUS_60830 7027 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 7783 7983 gene locus_tag LOCUS_60840 7783 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60840 8558 7980 gene locus_tag LOCUS_60850 8558 7980 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222864.1 protein_id gnl|my_center|LOCUS_60850 9542 8565 gene locus_tag LOCUS_60860 gene stgR 9542 8565 CDS product LysR family transcriptional regulator StgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028688.1 protein_id gnl|my_center|LOCUS_60860 11073 9826 gene locus_tag LOCUS_60870 11073 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60870 11174 11617 gene locus_tag LOCUS_60880 11174 11617 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035584.1 protein_id gnl|my_center|LOCUS_60880 11832 12653 gene locus_tag LOCUS_60890 11832 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 12732 12932 gene locus_tag LOCUS_60900 12732 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 13369 13002 gene locus_tag LOCUS_tm00010 13369 13002 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13989 13480 gene locus_tag LOCUS_60910 gene smpB 13989 13480 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975846.1 protein_id gnl|my_center|LOCUS_60910 15315 14008 gene locus_tag LOCUS_60920 15315 14008 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668732.1 protein_id gnl|my_center|LOCUS_60920 16361 15447 gene locus_tag LOCUS_60930 gene ftsX 16361 15447 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975844.1 protein_id gnl|my_center|LOCUS_60930 17079 16390 gene locus_tag LOCUS_60940 gene ftsE 17079 16390 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_60940 17322 17516 gene locus_tag LOCUS_60950 17322 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975842.1 protein_id gnl|my_center|LOCUS_60950 18670 17621 gene locus_tag LOCUS_60960 18670 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 20047 18941 gene locus_tag LOCUS_60970 gene prfB 20047 18941 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975840.1 protein_id gnl|my_center|LOCUS_60970 21655 20312 gene locus_tag LOCUS_60980 21655 20312 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028691.1 protein_id gnl|my_center|LOCUS_60980 23712 21868 gene locus_tag LOCUS_60990 23712 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 23978 23700 gene locus_tag LOCUS_61000 23978 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 24246 27896 gene locus_tag LOCUS_61010 24246 27896 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028692.1 protein_id gnl|my_center|LOCUS_61010 28107 29543 gene locus_tag LOCUS_61020 28107 29543 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975833.1 protein_id gnl|my_center|LOCUS_61020 29558 30925 gene locus_tag LOCUS_61030 29558 30925 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865510.1 protein_id gnl|my_center|LOCUS_61030 31035 31916 gene locus_tag LOCUS_61040 31035 31916 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975831.1 protein_id gnl|my_center|LOCUS_61040 33525 31960 gene locus_tag LOCUS_61050 33525 31960 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408080.1 protein_id gnl|my_center|LOCUS_61050 33615 35462 gene locus_tag LOCUS_61060 33615 35462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 36727 35528 gene locus_tag LOCUS_61070 36727 35528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61070 39537 36724 gene locus_tag LOCUS_61080 39537 36724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 40883 39585 gene locus_tag LOCUS_61090 40883 39585 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486603.1 protein_id gnl|my_center|LOCUS_61090 42457 40880 gene locus_tag LOCUS_61100 42457 40880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028698.1 protein_id gnl|my_center|LOCUS_61100 43276 42461 gene locus_tag LOCUS_61110 43276 42461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 44483 43404 gene locus_tag LOCUS_61120 44483 43404 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_61120 44623 45180 gene locus_tag LOCUS_61130 44623 45180 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028743.1 protein_id gnl|my_center|LOCUS_61130 46268 45108 gene locus_tag LOCUS_61140 46268 45108 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666416.1 protein_id gnl|my_center|LOCUS_61140 51359 46353 gene locus_tag LOCUS_61150 51359 46353 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_61150 52413 51691 gene locus_tag LOCUS_61160 52413 51691 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_61160 52952 52449 gene locus_tag LOCUS_61170 52952 52449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028709.1 protein_id gnl|my_center|LOCUS_61170 52951 53142 gene locus_tag LOCUS_61180 52951 53142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61180 53245 53775 gene locus_tag LOCUS_61190 53245 53775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61190 56659 53840 gene locus_tag LOCUS_61200 gene secA 56659 53840 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975807.1 protein_id gnl|my_center|LOCUS_61200 54001 54095 gene locus_tag LOCUS_t00950 54001 54095 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 56887 57480 gene locus_tag LOCUS_61210 56887 57480 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028711.1 protein_id gnl|my_center|LOCUS_61210 57524 58756 gene locus_tag LOCUS_61220 57524 58756 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028712.1 protein_id gnl|my_center|LOCUS_61220 59503 58760 gene locus_tag LOCUS_61230 59503 58760 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_61230 60390 59704 gene locus_tag LOCUS_61240 gene raiA 60390 59704 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_61240 61455 60730 gene locus_tag LOCUS_61250 61455 60730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61250 63447 61606 gene locus_tag LOCUS_61260 63447 61606 CDS product LpqB family beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028714.1 protein_id gnl|my_center|LOCUS_61260 65524 63431 gene locus_tag LOCUS_61270 gene mtrB 65524 63431 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_61270 66203 65526 gene locus_tag LOCUS_61280 gene mtrA 66203 65526 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_61280 67327 66200 gene locus_tag LOCUS_61290 gene mtnA 67327 66200 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028716.1 protein_id gnl|my_center|LOCUS_61290 67523 68680 gene locus_tag LOCUS_61300 67523 68680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61300 >Feature sequence16 947 90 gene locus_tag LOCUS_61310 947 90 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972868.1 protein_id gnl|my_center|LOCUS_61310 2051 1122 gene locus_tag LOCUS_61320 2051 1122 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977080.1 protein_id gnl|my_center|LOCUS_61320 2695 2312 gene locus_tag LOCUS_61330 2695 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61330 3095 2661 gene locus_tag LOCUS_61340 3095 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61340 4414 3101 gene locus_tag LOCUS_61350 4414 3101 CDS product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086420.1 protein_id gnl|my_center|LOCUS_61350 5475 4411 gene locus_tag LOCUS_61360 5475 4411 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222505.1 protein_id gnl|my_center|LOCUS_61360 7422 5560 gene locus_tag LOCUS_61370 7422 5560 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 protein_id gnl|my_center|LOCUS_61370 8958 7849 gene locus_tag LOCUS_61380 8958 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61380 9387 9830 gene locus_tag LOCUS_61390 9387 9830 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977077.1 protein_id gnl|my_center|LOCUS_61390 11018 9852 gene locus_tag LOCUS_61400 11018 9852 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_61400 12609 11134 gene locus_tag LOCUS_61410 12609 11134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027955.1 protein_id gnl|my_center|LOCUS_61410 12885 14102 gene locus_tag LOCUS_61420 12885 14102 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 protein_id gnl|my_center|LOCUS_61420 14366 15388 gene locus_tag LOCUS_61430 14366 15388 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027956.1 protein_id gnl|my_center|LOCUS_61430 15687 15472 gene locus_tag LOCUS_61440 15687 15472 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977071.1 protein_id gnl|my_center|LOCUS_61440 16119 17807 gene locus_tag LOCUS_61450 gene ctaD 16119 17807 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976660.1 protein_id gnl|my_center|LOCUS_61450 18782 17817 gene locus_tag LOCUS_61460 18782 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027957.1 protein_id gnl|my_center|LOCUS_61460 20029 18779 gene locus_tag LOCUS_61470 20029 18779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61470 20294 21076 gene locus_tag LOCUS_61480 20294 21076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977068.1 protein_id gnl|my_center|LOCUS_61480 21073 21597 gene locus_tag LOCUS_61490 21073 21597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61490 23097 21637 gene locus_tag LOCUS_61500 gene der 23097 21637 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977066.1 protein_id gnl|my_center|LOCUS_61500 23798 23163 gene locus_tag LOCUS_61510 23798 23163 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977065.1 protein_id gnl|my_center|LOCUS_61510 24508 23795 gene locus_tag LOCUS_61520 gene cmk 24508 23795 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027958.1 protein_id gnl|my_center|LOCUS_61520 25704 24619 gene locus_tag LOCUS_61530 25704 24619 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027959.1 protein_id gnl|my_center|LOCUS_61530 25772 26134 gene locus_tag LOCUS_61540 25772 26134 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975206.1 protein_id gnl|my_center|LOCUS_61540 26131 26826 gene locus_tag LOCUS_61550 26131 26826 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027961.1 protein_id gnl|my_center|LOCUS_61550 28205 26907 gene locus_tag LOCUS_61560 28205 26907 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027963.1 protein_id gnl|my_center|LOCUS_61560 28843 28205 gene locus_tag LOCUS_61570 gene scpB 28843 28205 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_61570 29916 28840 gene locus_tag LOCUS_61580 29916 28840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61580 30513 29986 gene locus_tag LOCUS_61590 30513 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162495132.1 protein_id gnl|my_center|LOCUS_61590 31640 30510 gene locus_tag LOCUS_61600 31640 30510 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_61600 33078 31963 gene locus_tag LOCUS_61610 gene ald 33078 31963 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868159.1 protein_id gnl|my_center|LOCUS_61610 35431 33272 gene locus_tag LOCUS_61620 35431 33272 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868162.1 protein_id gnl|my_center|LOCUS_61620 36306 35659 gene locus_tag LOCUS_61630 36306 35659 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_61630 38050 36395 gene locus_tag LOCUS_61640 38050 36395 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027968.1 protein_id gnl|my_center|LOCUS_61640 38453 38094 gene locus_tag LOCUS_61650 38453 38094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 38741 38511 gene locus_tag LOCUS_61660 38741 38511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 38634 40397 gene locus_tag LOCUS_61670 38634 40397 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027969.1 protein_id gnl|my_center|LOCUS_61670 41856 40516 gene locus_tag LOCUS_61680 41856 40516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015414.1 protein_id gnl|my_center|LOCUS_61680 41868 43517 gene locus_tag LOCUS_61690 41868 43517 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027970.1 protein_id gnl|my_center|LOCUS_61690 44876 43761 gene locus_tag LOCUS_61700 44876 43761 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666770.1 protein_id gnl|my_center|LOCUS_61700 45758 45012 gene locus_tag LOCUS_61710 45758 45012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 46573 45755 gene locus_tag LOCUS_61720 46573 45755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325235.1 protein_id gnl|my_center|LOCUS_61720 48363 46624 gene locus_tag LOCUS_61730 gene recN 48363 46624 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_61730 48498 49859 gene locus_tag LOCUS_61740 48498 49859 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919894.1 protein_id gnl|my_center|LOCUS_61740 50838 49918 gene locus_tag LOCUS_61750 50838 49918 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027973.1 protein_id gnl|my_center|LOCUS_61750 51647 50835 gene locus_tag LOCUS_61760 51647 50835 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_61760 52062 51655 gene locus_tag LOCUS_61770 52062 51655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61770 52126 52479 gene locus_tag LOCUS_61780 52126 52479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977038.1 protein_id gnl|my_center|LOCUS_61780 53290 52427 gene locus_tag LOCUS_61790 53290 52427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027975.1 protein_id gnl|my_center|LOCUS_61790 54372 53317 gene locus_tag LOCUS_61800 54372 53317 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868181.1 protein_id gnl|my_center|LOCUS_61800 55433 54369 gene locus_tag LOCUS_61810 55433 54369 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027977.1 protein_id gnl|my_center|LOCUS_61810 55490 56524 gene locus_tag LOCUS_61820 gene desE 55490 56524 CDS product siderophore-binding protein DesE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976020.1 protein_id gnl|my_center|LOCUS_61820 56555 57400 gene locus_tag LOCUS_61830 56555 57400 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028582.1 protein_id gnl|my_center|LOCUS_61830 58497 57466 gene locus_tag LOCUS_61840 58497 57466 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027978.1 protein_id gnl|my_center|LOCUS_61840 58574 59887 gene locus_tag LOCUS_61850 58574 59887 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027979.1 protein_id gnl|my_center|LOCUS_61850 62017 59954 gene locus_tag LOCUS_61860 62017 59954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61860 62261 62151 gene locus_tag LOCUS_r00010 62261 62151 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence17 559 3099 gene locus_tag LOCUS_61870 559 3099 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843320.1 protein_id gnl|my_center|LOCUS_61870 3209 4330 gene locus_tag LOCUS_61880 3209 4330 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223896.1 protein_id gnl|my_center|LOCUS_61880 4549 4475 gene locus_tag LOCUS_t00960 4549 4475 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4998 4573 gene locus_tag LOCUS_61890 4998 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 6081 5551 gene locus_tag LOCUS_61900 6081 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61900 6804 6367 gene locus_tag LOCUS_61910 6804 6367 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229490.1 protein_id gnl|my_center|LOCUS_61910 7493 6801 gene locus_tag LOCUS_61920 7493 6801 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229489.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_61920 7729 8193 gene locus_tag LOCUS_61930 7729 8193 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229488.1 protein_id gnl|my_center|LOCUS_61930 8735 8352 gene locus_tag LOCUS_61940 8735 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 9646 8933 gene locus_tag LOCUS_61950 9646 8933 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974661.1 protein_id gnl|my_center|LOCUS_61950 9807 10736 gene locus_tag LOCUS_61960 9807 10736 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031548.1 protein_id gnl|my_center|LOCUS_61960 11640 11386 gene locus_tag LOCUS_61970 11640 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61970 12254 11892 gene locus_tag LOCUS_61980 12254 11892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61980 12419 12982 gene locus_tag LOCUS_61990 12419 12982 CDS product papain-like cysteine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226265.1 protein_id gnl|my_center|LOCUS_61990 12993 13874 gene locus_tag LOCUS_62000 12993 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191309348.1 protein_id gnl|my_center|LOCUS_62000 14743 14201 gene locus_tag LOCUS_62010 14743 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 15034 15363 gene locus_tag LOCUS_62020 15034 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 15899 15399 gene locus_tag LOCUS_62030 15899 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_62030 16766 16572 gene locus_tag LOCUS_62040 16766 16572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_62040 17347 16769 gene locus_tag LOCUS_62050 17347 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62050 17250 17711 gene locus_tag LOCUS_62060 17250 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62060 18723 19709 gene locus_tag LOCUS_62070 18723 19709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945959.1 protein_id gnl|my_center|LOCUS_62070 20663 20223 gene locus_tag LOCUS_62080 20663 20223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 20753 21220 gene locus_tag LOCUS_62090 20753 21220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62090 22536 21619 gene locus_tag LOCUS_62100 22536 21619 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730772.1 protein_id gnl|my_center|LOCUS_62100 23379 22807 gene locus_tag LOCUS_62110 23379 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62110 25238 23379 gene locus_tag LOCUS_62120 25238 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 25525 25235 gene locus_tag LOCUS_62130 25525 25235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62130 26323 25925 gene locus_tag LOCUS_62140 26323 25925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62140 26772 26287 gene locus_tag LOCUS_62150 26772 26287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 28924 27992 gene locus_tag LOCUS_62160 28924 27992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62160 29164 29615 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catccccgcgtgcgcggggagcag 30028 30318 gene locus_tag LOCUS_62170 30028 30318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 30592 30356 gene locus_tag LOCUS_62180 30592 30356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 30742 31238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccatccccgcgcgtgcggggagcag 32325 31951 gene locus_tag LOCUS_62190 32325 31951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 32821 32507 gene locus_tag LOCUS_62200 32821 32507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 33436 34522 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcatccccgcgtgcgcgggga 35120 36718 gene locus_tag LOCUS_62210 35120 36718 CDS product ISL3-like element IS469 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029007.1 protein_id gnl|my_center|LOCUS_62210 37224 36727 gene locus_tag LOCUS_62220 37224 36727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62220 38067 37438 gene locus_tag LOCUS_62230 38067 37438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 38506 38896 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccatccccgcgtgcgcggggagcag 39123 39838 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq catccccgcctgcgcggggagcag 40684 40971 gene locus_tag LOCUS_62240 40684 40971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62240 41122 41685 gene locus_tag LOCUS_62250 41122 41685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62250 41688 42107 gene locus_tag LOCUS_62260 41688 42107 CDS product RacP protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069931728.1 protein_id gnl|my_center|LOCUS_62260 42330 42941 gene locus_tag LOCUS_62270 42330 42941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62270 >Feature sequence18 886 338 gene locus_tag LOCUS_62280 886 338 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974850.1 protein_id gnl|my_center|LOCUS_62280 1000 2331 gene locus_tag LOCUS_62290 1000 2331 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029449.1 protein_id gnl|my_center|LOCUS_62290 4187 2406 gene locus_tag LOCUS_62300 4187 2406 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029448.1 protein_id gnl|my_center|LOCUS_62300 4247 4534 gene locus_tag LOCUS_62310 4247 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 5998 4466 gene locus_tag LOCUS_62320 5998 4466 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974853.1 protein_id gnl|my_center|LOCUS_62320 7040 7136 gene locus_tag LOCUS_t00970 7040 7136 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7410 9860 gene locus_tag LOCUS_62330 7410 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 12164 9909 gene locus_tag LOCUS_62340 12164 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62340 12332 12592 gene locus_tag LOCUS_62350 12332 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 12866 14326 gene locus_tag LOCUS_62360 12866 14326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974859.1 protein_id gnl|my_center|LOCUS_62360 14449 15699 gene locus_tag LOCUS_62370 gene lhgO 14449 15699 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974860.1 protein_id gnl|my_center|LOCUS_62370 17024 16002 gene locus_tag LOCUS_62380 17024 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62380 17228 18091 gene locus_tag LOCUS_62390 gene trmB 17228 18091 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974862.1 protein_id gnl|my_center|LOCUS_62390 18174 19583 gene locus_tag LOCUS_62400 18174 19583 CDS product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029441.1 protein_id gnl|my_center|LOCUS_62400 19784 20248 gene locus_tag LOCUS_62410 19784 20248 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831429.1 protein_id gnl|my_center|LOCUS_62410 21410 20331 gene locus_tag LOCUS_62420 21410 20331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 21570 24710 gene locus_tag LOCUS_62430 21570 24710 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189742338.1 protein_id gnl|my_center|LOCUS_62430 24819 25505 gene locus_tag LOCUS_62440 24819 25505 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_62440 25920 25507 gene locus_tag LOCUS_62450 25920 25507 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_62450 26376 26002 gene locus_tag LOCUS_62460 26376 26002 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369567.1 protein_id gnl|my_center|LOCUS_62460 26537 27130 gene locus_tag LOCUS_62470 26537 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62470 28153 27143 gene locus_tag LOCUS_62480 28153 27143 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815985.1 protein_id gnl|my_center|LOCUS_62480 28241 28543 gene locus_tag LOCUS_62490 28241 28543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028647.1 protein_id gnl|my_center|LOCUS_62490 29269 28604 gene locus_tag LOCUS_62500 29269 28604 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228584.1 protein_id gnl|my_center|LOCUS_62500 30248 29298 gene locus_tag LOCUS_62510 30248 29298 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_62510 31753 30278 gene locus_tag LOCUS_62520 31753 30278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028648.1 protein_id gnl|my_center|LOCUS_62520 33110 31893 gene locus_tag LOCUS_62530 33110 31893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62530 34644 33430 gene locus_tag LOCUS_62540 34644 33430 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326766.1 protein_id gnl|my_center|LOCUS_62540 36414 34777 gene locus_tag LOCUS_62550 36414 34777 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029195.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_62550 36824 36621 gene locus_tag LOCUS_62560 36824 36621 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974279.1 protein_id gnl|my_center|LOCUS_62560 37861 37025 gene locus_tag LOCUS_62570 37861 37025 CDS product DUF6227 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975622.1 protein_id gnl|my_center|LOCUS_62570 39319 38087 gene locus_tag LOCUS_62580 39319 38087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 >Feature sequence19 209 589 gene locus_tag LOCUS_62590 209 589 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_62590 1546 650 gene locus_tag LOCUS_62600 1546 650 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_62600 2910 1729 gene locus_tag LOCUS_62610 2910 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027947.1 protein_id gnl|my_center|LOCUS_62610 6380 2907 gene locus_tag LOCUS_62620 gene dnaE 6380 2907 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027948.1 protein_id gnl|my_center|LOCUS_62620 6556 7590 gene locus_tag LOCUS_62630 6556 7590 CDS product DUF3533 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977086.1 protein_id gnl|my_center|LOCUS_62630 8075 8524 gene locus_tag LOCUS_62640 8075 8524 CDS product protease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978099.1 protein_id gnl|my_center|LOCUS_62640 9675 8632 gene locus_tag LOCUS_62650 9675 8632 CDS product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027949.1 protein_id gnl|my_center|LOCUS_62650 >Feature sequence20 2583 460 gene locus_tag LOCUS_62660 gene fusA 2583 460 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974302.1 protein_id gnl|my_center|LOCUS_62660 3093 2623 gene locus_tag LOCUS_62670 gene rpsG 3093 2623 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974303.1 protein_id gnl|my_center|LOCUS_62670 3467 3096 gene locus_tag LOCUS_62680 gene rpsL 3467 3096 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948652.1 protein_id gnl|my_center|LOCUS_62680 4284 3802 gene locus_tag LOCUS_62690 4284 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62690 4703 5080 gene locus_tag LOCUS_62700 4703 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 5077 5745 gene locus_tag LOCUS_62710 5077 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 5742 5954 gene locus_tag LOCUS_62720 5742 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 6317 6042 gene locus_tag LOCUS_62730 6317 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 6589 7287 gene locus_tag LOCUS_62740 6589 7287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 7295 7669 gene locus_tag LOCUS_62750 7295 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62750 >Feature sequence21 336 1358 gene locus_tag LOCUS_62760 gene trpS 336 1358 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975499.1 protein_id gnl|my_center|LOCUS_62760 2426 1401 gene locus_tag LOCUS_62770 2426 1401 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975498.1 protein_id gnl|my_center|LOCUS_62770 2522 3103 gene locus_tag LOCUS_62780 2522 3103 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028916.1 protein_id gnl|my_center|LOCUS_62780 3970 3161 gene locus_tag LOCUS_62790 gene proC 3970 3161 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975496.1 protein_id gnl|my_center|LOCUS_62790 4297 5874 gene locus_tag LOCUS_62800 4297 5874 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_62800 >Feature sequence22 96 1844 gene locus_tag LOCUS_62810 96 1844 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227280.1 protein_id gnl|my_center|LOCUS_62810 1841 2296 gene locus_tag LOCUS_62820 1841 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 2293 2709 gene locus_tag LOCUS_62830 2293 2709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326622.1 protein_id gnl|my_center|LOCUS_62830 2772 3134 gene locus_tag LOCUS_62840 2772 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 3703 3167 gene locus_tag LOCUS_62850 3703 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 >Feature sequence23 >Feature sequence24 <1 1208 gene locus_tag LOCUS_62860 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057346.1:form I ribulose bisphosphate carboxylase large subunit >Feature sequence25 1103 42 gene locus_tag LOCUS_62870 gene psbA 1103 42 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_62870 >Feature sequence26 >Feature sequence27 >Feature sequence28 >Feature sequence29 >Feature sequence30 114 317 gene locus_tag LOCUS_62880 114 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62880